KASP molecular marker combination for detecting ammonia-nitrogen tolerance of takifugu rubripes and its application
By developing a KASP molecular marker combination to assess the ammonia nitrogen tolerance of red-finned pufferfish, and utilizing PCR amplification and fluorescence signal scanning techniques, the inefficiency and high cost of existing methods for detecting ammonia nitrogen tolerance in red-finned pufferfish have been resolved, achieving efficient and accurate early screening and breeding results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TANGSHAN HAIDU SEAFOOD CO LTD
- Filing Date
- 2026-06-17
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies struggle to develop low-cost, readily applicable, and mass-producible molecular detection tools for ammonia nitrogen tolerance in redfin pufferfish. Traditional phenotypic selection is complex and inefficient, while whole-genome selection is costly.
A KASP molecular marker combinatorial system containing five SNP sites significantly associated with ammonia nitrogen tolerance in redfin pufferfish was developed. Specific and universal primers were designed, and efficient and non-destructive detection of ammonia nitrogen-tolerant individuals was achieved through PCR amplification and fluorescence signal scanning.
This method enables efficient, accurate, and low-cost detection of ammonia nitrogen tolerance in redfin pufferfish, allowing for early screening of superior ammonia nitrogen-tolerant germplasm and improving breeding efficiency and survival rate.
Smart Images

Figure CN122428046A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, specifically involving the KASP molecular marker combination for detecting the ammonia nitrogen tolerance of redfin pufferfish and its application. Technical Background
[0002] Red-finned pufferfish (Takifugu rubripes) is an important economically important marine aquaculture fish, prized for its delicious flesh and high nutritional and economic value. It is a key species for intensive recirculating aquaculture systems (RAS) and deep-sea cage culture. In high-density intensive aquaculture and RAS models, ammonia nitrogen (especially non-ionic ammonia) is one of the most significant water quality stressors. Excessive ammonia nitrogen concentration in the culture water can damage gill tissue, interfere with osmotic regulation and nitrogen metabolism, inhibit growth, and even lead to mass mortality, becoming a critical bottleneck restricting the healthy aquaculture of red-finned pufferfish and the sustainable development of the industry.
[0003] Significant genetic differences exist in the tolerance of different individuals and families to ammonia nitrogen stress. Breeding new ammonia nitrogen-tolerant varieties (lines) is an effective way to fundamentally improve aquaculture survival rates and reduce water treatment costs. However, phenotypic determination of ammonia nitrogen tolerance relies on ammonia nitrogen stress challenge experiments, which are complex, destructive to individuals, and difficult to perform non-destructive screening of breeding populations in the early stages. Traditional phenotypic and family selection breeding methods are time-consuming and inefficient. While modern molecular breeding technologies, such as genome-wide selection, can improve selection accuracy and efficiency, they require large-scale sequencing for genotyping, resulting in high costs. KASP (Kompetitive Allele Specific PCR) technology offers advantages such as low cost, high throughput, ease of operation, and high accuracy, making it particularly suitable for rapidly converting a few core loci into molecular detection tools that can be directly used by enterprises. Therefore, developing KASP molecular marker combinations that are stably associated with the ammonia nitrogen tolerance of red-finned pufferfish and facilitate large-scale detection at low cost, and establishing clear judgment rules, is of great significance for improving the efficiency of ammonia nitrogen tolerance breeding in red-finned pufferfish. Summary of the Invention
[0004] The purpose of this invention is to provide a combination of KASP molecular markers, a screening method, detection primers, and a kit for detecting the ammonia nitrogen tolerance of red-finned pufferfish, in order to solve the problem of the lack of low-cost, practical, and mass-producible molecular detection tools for the ammonia nitrogen tolerance trait of red-finned pufferfish.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] In a first aspect, this invention provides a KASP molecular marker combination for detecting the ammonia nitrogen tolerance of *Putrachea rubra*, comprising five SNP sites significantly associated with the ammonia nitrogen tolerance of *Putrachea rubra*, namely AN_KASP1, AN_KASP2, AN_KASP3, AN_KASP4, and AN_KASP5, located on chromosome 11 of *Putrachea rubra* at Chr11:9542716, Chr11:9544701, Chr11:9546090, Chr11:9547752, and Chr11:9551066, respectively (latest version of the *Putrachea rubra* reference genome: https: / / doi.org / 10.6084 / m9.figshare.29877131), with base polymorphism types of C / A, T / C, T / C, G / A, and G / C, respectively. The dominant genotypes for ammonia nitrogen tolerance at the five SNP loci are AA, CC, CC, AA, and CC (i.e., the homozygous genotypes of each point mutation allele). When all five SNP loci of an individual are dominant genotypes for ammonia nitrogen tolerance, it indicates that the individual is ammonia nitrogen tolerant (strongly tolerant).
[0007] Secondly, this invention provides the application of the KASP molecular marker combination in the preparation of ammonia nitrogen tolerance testing products for redfin pufferfish.
[0008] Thirdly, the present invention provides a method for screening ammonia-tolerant candidate individuals of red-finned pufferfish using the KASP molecular marker combination, comprising the following steps: extracting DNA from the individual to be tested, performing KASP genotyping on the 5 SNP loci, and determining the genotype of each locus; when the genotypes of the 5 SNP loci are AA, CC, CC, AA and CC in sequence, the individual to be tested is determined to be an ammonia-tolerant candidate individual.
[0009] Fourthly, the present invention provides detection primers and kits for the KASP molecular marker combination and their applications. The kit includes detection primers for the KASP molecular marker combination, KASP reaction solution, and genotyping result interpretation reagents. Each KASP molecular marker includes two allele-specific primers (labeled with FAM and HEX fluorescent linkers, respectively) and one universal primer. The specific primer Fam is used to detect the reference type (ammonia nitrogen sensitive) allele, and the specific primer Hex is used to detect the mutant type (ammonia nitrogen resistant) allele. The detection primers or the kit can be used to prepare products for detecting the ammonia nitrogen tolerance of redfin pufferfish and for molecular marker-assisted breeding.
[0010] The nucleotide sequences of the primers labeled AN_KASP1 are as follows: specific primer Fam is shown in SEQ ID NO: 1, specific primer Hex is shown in SEQ ID NO: 2, and universal primer Common is shown in SEQ ID NO: 3;
[0011] AN_KASP2-tagged primer nucleotide sequence:
[0012] The specific primer Fam is shown in SEQ ID NO: 4, the specific primer Hex is shown in SEQ ID NO: 5, and the universal primer Common is shown in SEQ ID NO: 6;
[0013] AN_KASP3-tagged primer nucleotide sequence:
[0014] The specific primer Fam is shown in SEQ ID NO: 7, the specific primer Hex is shown in SEQ ID NO: 8, and the universal primer Common is shown in SEQ ID NO: 9;
[0015] AN_KASP4-tagged primer nucleotide sequence:
[0016] The specific primer Fam is shown in SEQ ID NO: 10, the specific primer Hex is shown in SEQ ID NO: 11, and the universal primer Common is shown in SEQ ID NO: 12;
[0017] The nucleotide sequences of the primers labeled AN_KASP5 are as follows: specific primer Fam is shown in SEQ ID NO: 13, specific primer Hex is shown in SEQ ID NO: 14, and universal primer Common is shown in SEQ ID NO: 15.
[0018] The present invention develops a KASP molecular marker combination and kit for detecting the ammonia nitrogen tolerance of red-finned pufferfish, comprising the following steps:
[0019] (1) Acute ammonia nitrogen stress challenge experiment was conducted on juvenile redfin pufferfish from the same breeding group. Under the condition of a predetermined high concentration of ammonia nitrogen (calculated as total ammonia nitrogen TAN, the concentration was determined based on the half-lethal concentration of the pre-test 72 hours), the fish were continuously stressed. The survival / death status and survival time of each individual were recorded. Individuals that died during the challenge were recorded as ammonia nitrogen sensitive individuals, and surviving individuals were recorded as ammonia nitrogen tolerant individuals. Tail fin samples were collected, and the number of samples was greater than 800.
[0020] (2) Extract DNA from fin samples and perform library construction, resequencing and genotyping to obtain high-quality SNP genotypes; fit the ammonia nitrogen tolerance phenotype (survival / death or survival time) with the genotype in a linear mixed model for genome-wide association analysis, screen for significant SNP markers associated with ammonia nitrogen tolerance performance, and determine the tolerance dominant genotype;
[0021] (3) Extract 200bp sequences from each of the flanking segments of the significant SNP markers associated with ammonia nitrogen tolerance, and design two specific primers (Fam and Hex) and one universal primer (Common). Attach fluorescent adapter sequences to the 5' ends of the two specific primers. GAAGGTGACCAAGTTCATGCT is the FAM fluorescent adapter sequence, as shown in SEQ ID NO: 16, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent adapter sequence, as shown in SEQ ID NO: 17. Extract DNA from the sample to be tested for PCR amplification. The PCR reaction system includes 0.0012μL of specific primer Fam (0.15μM), 0.0012μL of specific primer Hex (0.15μM), 0.0030μL of universal primer Common (0.375μM), 0.40μL of 2×KASP Master Mix, 10~20ng of sample DNA (dry powder), and add ultrapure water to 0.80μL. The PCR reaction program was as follows: 94℃ for 15 min, 1 cycle; 95℃ for 20 s, 65-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s, 57℃ for 60 s, 30 cycles. After the PCR reaction, fluorescence signals were scanned using a microplate reader, and data analysis and genotyping were performed. When the genotype of AN_KASP1 was AA, and the genotype of AN_KASP2 was CC, and the genotype of AN_KASP3 was CC, and the genotype of AN_KASP4 was AA, and the genotype of AN_KASP5 was CC, the tested redfin pufferfish individuals were considered ammonia-tolerant (strongly tolerant); otherwise, they were considered non-tolerant.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] (1) For the first time, the significant sites identified by genome-wide association analysis of ammonia nitrogen tolerance in redfin pufferfish were systematically converted into five KASP marker combinations that can be directly applied; (2) The judgment rules are clear and suitable for detecting the ammonia nitrogen tolerance of candidate redfin pufferfish; (3) The KASP molecular marker combination has the advantages of high efficiency, high accuracy and low cost, and can be used to conduct batch and non-destructive detection of ammonia nitrogen tolerance in redfin pufferfish in the early stage, providing a molecular tool for the breeding of new ammonia nitrogen tolerant varieties (lines) of redfin pufferfish; (4) After independent population verification, the survival rate / survival time of ammonia nitrogen tolerant individuals screened by this invention under ammonia nitrogen stress are better than those of non-tolerant individuals, indicating that this invention has good application effect. Attached Figure Description
[0024] Figure 1The image shows the KASP genotyping results for AN_KASP1, which includes three genotypes: CC (sensitive homozygous), AC (heterozygous), and AA (tolerant homozygous).
[0025] Figure 2 The image shows the KASP genotyping results for AN_KASP2, which includes three genotypes: TT (sensitive homozygous), TC (heterozygous), and CC (tolerant homozygous).
[0026] Figure 3 The image shows the KASP genotyping results for AN_KASP3, which includes three genotypes: TT (sensitive homozygous), TC (heterozygous), and CC (tolerant homozygous).
[0027] Figure 4 The image shows the KASP genotyping results for AN_KASP4, which includes three genotypes: GG (sensitive homozygous), GA (heterozygous), and AA (tolerant homozygous).
[0028] Figure 5 The image shows the KASP genotyping results for AN_KASP5, which includes three genotypes: GG (sensitive homozygous), GC (heterozygous), and CC (tolerant homozygous). Detailed Implementation
[0029] To enable those skilled in the art to better understand the technical content of this invention, the invention will be further described below with reference to specific embodiments. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in the art or according to the product instructions. Unless otherwise specified, the equipment and reagents used in each embodiment are all commercially available.
[0030] Example 1: Development of KASP molecular marker assemblages for detecting ammonia nitrogen tolerance in redfin pufferfish
[0031] (1) Determination of ammonia nitrogen tolerance phenotype and sample collection
[0032] Healthy juvenile redfin pufferfish were used in an acute ammonia nitrogen stress challenge experiment from a breeding population. The median lethal concentration (LC50) was determined before the challenge. In the formal experiment, the fish were subjected to continuous stress at a constant high concentration of ammonia nitrogen. Survival and mortality, as well as survival time, were recorded for each fish. Individuals that died during the challenge were classified as ammonia nitrogen sensitive, while surviving individuals were classified as ammonia nitrogen tolerant. A total of 880 individuals with ammonia nitrogen tolerance phenotypes were obtained, and a small number of fin samples were taken from each individual and stored at -80℃.
[0033] (2) Genotyping and genome-wide association analysis
[0034] Genomic DNA was extracted from fin samples of the individuals described above. Library construction, resequencing, and genotyping were performed. After filtering, high-quality SNP genotypes were obtained. The ammonia nitrogen tolerance phenotype and genotype were fitted into a linear mixed model (MLMA-LOCO model) for genome-wide association analysis (GWAS), using a Bonferroni-corrected threshold (i.e., 1 / N, where N is the total number of SNP markers). A QTL region closely associated with ammonia nitrogen tolerance was identified in approximately 9.54 Mb of chromosome 11, containing 10 significant SNP markers. Table 1 lists the 5 SNP sites successfully converted to KASP markers in this invention. Statistical results showed that almost all significant loci in ammonia nitrogen-sensitive (deceased) individuals in this region were homozygous for the reference genotype, while the survival rate of individuals carrying mutant alleles was significantly increased. Based on this, the homozygous genotype of the mutant allele was determined to be the dominant genotype for ammonia nitrogen tolerance, the heterozygous genotype to be the intermediate genotype, and the homozygous genotype to be the sensitive genotype. Further KASP transformation was performed on the above 10 loci, among which 5 SNP loci (Chr11:9542716, Chr11:9544701, Chr11:9546090, Chr11:9547752 and Chr11:9551066) were successfully developed, and the corresponding ammonia nitrogen tolerance dominant genotypes were AA, CC, CC, AA and CC in that order (Table 2).
[0035] Table 1. Representative SNPs identified by genome-wide association analysis that are closely associated with ammonia nitrogen tolerance in redfin pufferfish.
[0036]
[0037] Note: A1 is the reference type (ammonia nitrogen sensitive) allele, and A2 is the mutant type (ammonia nitrogen resistant) allele; the homozygous A2 genotype is the ammonia nitrogen resistant dominant genotype.
[0038] Table 2. KASP marker locus information, ammonia nitrogen tolerance dominant genotypes, and statistical results.
[0039]
[0040] Note: The polymorphism column is listed in the order of reference type / mutant type. The first base is the reference type (ammonia nitrogen sensitive) allele, and the second base is the mutant type (ammonia nitrogen resistant) allele. The ammonia nitrogen resistant genotype is the homozygous mutant allele. The number of dominant individuals is the number of individuals in the 94 validation samples who have the dominant ammonia nitrogen resistant genotype (homozygous).
[0041] Example 2: Construction and Genotyping Validation of the KASP Molecular Marker Genotyping Kit
[0042] The KASP markers corresponding to the five SNP sites successfully developed in Example 1 were named AN_KASP1 to AN_KASP5, and a kit for KASP marker genotyping was constructed. This kit contains detection primers for the five KASP molecular marker combinations, KASP reaction solution, and genotyping result interpretation reagents; each KASP molecular marker contains two allele-specific primers (Fam and Hex) and one universal primer (Common), as shown in Table 3.
[0043] The reaction system for PCR amplification using the kit described above is as follows: 0.0012 μL of specific primer Fam (0.15 μM), 0.0012 μL of specific primer Hex (0.15 μM), 0.0030 μL of universal primer Common (0.375 μM), 0.40 μL of 2×KASPMaster Mix, 10-20 ng of DNA (dry powder) to be tested, and ultrapure water to a final volume of 0.80 μL.
[0044] The reaction procedure for PCR amplification using the kit described is as follows: 94℃ for 15 min, 1 cycle; 95℃ for 20 s, 65~56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s, 57℃ for 60 s, 30 cycles.
[0045] After the PCR reaction, fluorescence signals were scanned using an ELISA reader, and genotyping was performed by reading the fluorescence signal data. Homozygous FAM fluorescence signals represented homozygous sensitive alleles, homozygous HEX fluorescence signals represented homozygous tolerant alleles, and the presence of both fluorescence signals represented heterozygous genotypes.
[0046] To assess the effectiveness of KASP marker genotyping, genotyping was performed on 94 DNA samples of *Pueraria lobata* (covering individuals with different phenotypes of ammonia nitrogen sensitivity and tolerance) using the aforementioned kit. Individuals were identified as ammonia nitrogen tolerant (strongly tolerant) if the genotype of AN_KASP1 marker was AA, the genotype of AN_KASP2 marker was CC, the genotype of AN_KASP3 marker was CC, the genotype of AN_KASP4 marker was AA, and the genotype of AN_KASP5 marker was CC; otherwise, they were considered non-tolerant. Each KASP marker successfully separated into three genotype clusters: homozygous sensitive, heterozygous, and homozygous tolerant. Figures 1-5In the figure, FAM represents the ratio of fluorescence of the Fam primer amplification product to the fluorescence of the underlying Rox primer, and VIC represents the ratio of fluorescence of the Hex primer amplification product to the fluorescence of the underlying Rox primer. The number of individuals with the dominant ammonia nitrogen tolerance genotype at each locus ranges from 2 to 6 (Table 2). Among them, two samples all matched the dominant ammonia nitrogen tolerance genotype combination at all 5 loci, indicating that these individuals have outstanding ammonia nitrogen tolerance potential. Therefore, the KASP molecular marker combination of the present invention can be used for ammonia nitrogen tolerance trait-assisted breeding, enabling early artificial screening of ammonia nitrogen tolerant individuals.
[0047] Table 3. Detection primers for the KASP molecular marker genotyping kit
[0048]
[0049] Example 3: Application of KASP molecular marker combinations in assisted breeding
[0050] To further verify the robustness of this invention in the detection of ammonia nitrogen tolerance and assisted breeding of redfin pufferfish, validation was conducted using an independent population, specifically including the following steps:
[0051] (1) Collection of test samples and ammonia nitrogen tolerance phenotypes
[0052] Ninety-four healthy juvenile redfin pufferfish were randomly selected from a certain aquaculture population. After individual electronic tagging, an acute ammonia nitrogen stress challenge experiment was conducted. The survival and mortality of each fish and the survival time were recorded. Fin samples were collected and temporarily stored in an ultra-low temperature freezer at -80℃.
[0053] (2) Genotyping and ammonia nitrogen tolerance test based on KASP molecular marker combination kit
[0054] The above samples were genotyped using the kit and related experimental methods described in Example 2, from AN_KASP1 to AN_KASP5, and the genotypes at each locus were compared with the dominant genotype combinations. Individuals with genotypes of AA, CC, CC, AA, and CC at the five SNP loci were identified as ammonia nitrogen-tolerant candidate individuals. The results showed that six samples met the above-mentioned dominant genotype combinations for ammonia nitrogen tolerance; among them, the 72-hour survival rate of ammonia nitrogen-tolerant individuals under ammonia nitrogen stress was 100%, with an average survival time of 144 hours, while the 72-hour survival rate of non-tolerant individuals was 44.3%, with an average survival time of 90 hours. The survival rate and survival time of ammonia nitrogen-tolerant individuals were significantly higher than those of non-tolerant individuals (P<0.05). These results indicate that the KASP molecular marker combination provided by this invention can be used for detecting ammonia nitrogen tolerance in red-finned pufferfish and for marker-assisted breeding, facilitating efficient screening of superior ammonia nitrogen-tolerant germplasm at an early stage.
Claims
1. A KASP molecular marker combinatorial method for detecting the ammonia nitrogen tolerance of red-finned pufferfish, characterized in that, It contains 5 SNP sites, namely AN_KASP1, AN_KASP2, AN_KASP3, AN_KASP4, and AN_KASP5, located on chromosome 11 of the redfin pufferfish at Chr11:9542716, Chr11:9544701, Chr11:9546090, Chr11:9547752, and Chr11:9551066, respectively, with base polymorphism types of C / A, T / C, T / C, G / A, and G / C, respectively.
2. The KASP molecular marker combination for detecting the ammonia nitrogen tolerance of red-finned pufferfish as described in claim 1, characterized in that, The dominant genotypes for ammonia nitrogen tolerance at the five SNP loci are AA, CC, CC, AA, and CC, respectively. When all five SNP loci of an individual are dominant genotypes for ammonia nitrogen tolerance, the individual is considered to be ammonia nitrogen tolerant.
3. The application of the KASP molecular marker combination for detecting the ammonia nitrogen tolerance of redfin pufferfish as described in claim 1 or 2 in the preparation of ammonia nitrogen tolerance testing products for redfin pufferfish.
4. A method for screening candidate individuals of red-finned pufferfish with ammonia nitrogen tolerance using the KASP molecular marker combination for detecting ammonia nitrogen tolerance as described in claim 1 or 2, characterized in that, Includes the following steps: DNA was extracted from the individuals to be tested, and KASP typing was performed on the 5 SNP loci to determine the genotype at each locus. When the genotypes of the five SNP loci are AA, CC, CC, AA and CC in sequence, the individual to be tested is determined to be a candidate individual for ammonia nitrogen tolerance.
5. A detection primer for the KASP molecular marker combination for detecting the ammonia nitrogen tolerance of the red-finned pufferfish as described in claim 1, characterized in that, Each KASP molecular marker contains two allele-specific primers and one universal primer; The nucleotide sequences of the primers labeled AN_KASP1 are as follows: specific primer Fam is shown in SEQ ID NO: 1, specific primer Hex is shown in SEQ ID NO: 2, and universal primer Common is shown in SEQ ID NO: 3; AN_KASP2-tagged primer nucleotide sequence: The specific primer Fam is shown in SEQ ID NO: 4, the specific primer Hex is shown in SEQ ID NO: 5, and the universal primer Common is shown in SEQ ID NO: 6; AN_KASP3-tagged primer nucleotide sequence: The specific primer Fam is shown in SEQ ID NO: 7, the specific primer Hex is shown in SEQ ID NO: 8, and the universal primer Common is shown in SEQ ID NO: 9; AN_KASP4-tagged primer nucleotide sequence: The specific primer Fam is shown in SEQ ID NO: 10, the specific primer Hex is shown in SEQ ID NO: 11, and the universal primer Common is shown in SEQ ID NO: 12; The nucleotide sequences of the primers labeled AN_KASP5 are as follows: specific primer Fam is shown in SEQ ID NO: 13, specific primer Hex is shown in SEQ ID NO: 14, and universal primer Common is shown in SEQ ID NO:
15.
6. A kit for detecting the ammonia nitrogen tolerance of red-finned pufferfish according to claim 1, characterized in that, It includes the primers described in claim 5, KASP reaction solution, and genotyping result interpretation reagent.
7. The application of the detection primers of claim 5 or the kit of claim 6 in the preparation of products for detecting the ammonia nitrogen tolerance of redfin pufferfish and for molecular marker-assisted breeding.