Method for knocking down ubiquitin-specific peptidase 7 protein and application thereof

By preparing recombinant vectors by loading human USP7 shRNA onto an adeno-associated virus vector, the targeting and efficiency issues of USP7 knockdown in existing technologies have been resolved, significantly improving endothelial cell function and providing new drug targets for the treatment of myocardial microvascular endothelial cell inflammation and cardiovascular diseases.

CN122503448APending Publication Date: 2026-08-04ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610468428.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-10
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Existing technologies for knocking down ubiquitin-specific peptidase 7 (USP7) suffer from poor targeting, low biosafety, and low treatment efficiency. Furthermore, traditional gene knockout techniques are complex and irreversible, making them difficult to apply in live animal models.

Method used

A recombinant USP7 knockdown vector was prepared by using an adeno-associated virus vector to carry human USP7 shRNA. The expression of USP7 in endothelial cells was specifically inhibited by gene intervention. The recombinant viral vector was constructed using a specific shRNA sequence and then packaged and purified to ensure efficient and reversible USP7 protein knockdown.

Benefits of technology

This study achieved efficient and specific inhibition of USP7 expression in endothelial cells, significantly suppressed NLRP3 inflammasome activation, reduced the release of downstream inflammatory factors, and improved endothelial cell function, providing a new drug target for the treatment of myocardial microvascular endothelial cell inflammation and cardiovascular diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122503448A_ABST
    Figure CN122503448A_ABST
Patent Text Reader

Abstract

The application discloses a method and application of knocking down ubiquitin-specific peptidase 7 protein, and belongs to the field of biological medicine. The method for knocking down the USP7 protein comprises: specifically inhibiting the expression of USP7 in endothelial cells through gene intervention, and the gene intervention means comprises shRNA, siRNA or recombinant virus carrier-mediated USP7 expression down-regulation. Further provided is a USP7 knockdown reagent for preparing a drug for treating endothelial cell inflammation or a cardiovascular disease, in particular, the USP7 knockdown reagent is a USP7 knockdown virus carrier containing a Cdh5 promoter; the cardiovascular disease comprises heart failure, myocardial infarction or ischemic cardiomyopathy. The application specifically knocks down the expression of USP7 in endothelial cells through gene intervention, significantly improves the migration, tube formation capacity and reduces the apoptosis of the endothelial cells, repairs endothelial dysfunction, the USP7 knockdown virus carrier is used for preparing a drug for treating a cardiovascular disease, and has important clinical value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a method and application for knocking down ubiquitin-specific peptidase 7 protein. Background Technology

[0002] Inflammation of myocardial microvascular endothelial cells is the underlying cause of various ischemic cardiomyopathies and heart failure. Previous observational studies have confirmed that endothelial inflammation is the best predictor of myocardial injury and prognosis. Endothelial cell inflammation induced by various factors leads to endothelial dysfunction, induces myocardial fibrosis and hypertrophy, and results in irreversible ventricular remodeling. Identifying relevant targets and improving endothelial cell inflammation has important clinical significance.

[0003] Ubiquitin-specific peptidase 7 (USP7) is a deubiquitinating enzyme that can bind to and regulate the deubiquitination of various target proteins, maintain protein stability, and participate in a variety of life activities, such as mitosis, apoptosis, cell cycle, DNA replication, neural development, and epigenetic regulation. Therefore, identifying effective knockout methods for USP7 has potential value for the treatment and research of a range of diseases. The primary structure of the USP7 protein contains 1102 amino acids, forming multiple domains that exert diverse biological activities. The tertiary structure of USP7 includes the TNF receptor-associated factor domain (TRAF, 53aa-208aa) after the N-terminus (50 amino acids), the catalytic domain (208aa-560aa), and the C-terminal ubiquitin-like domain (UBL, 560aa-1102aa).

[0004] The existing technology has the following drawbacks in knocking down the USP7:

[0005] 1. Limitations of traditional gene knockout technology: Traditional gene knockout technology requires altering the DNA sequence of the target gene through transgenic methods. This method may lead to irreversible gene mutations, and it is complex to operate and has limited applicability. In particular, when it comes to research involving live animal models, a more precise and reversible knockdown method is needed.

[0006] 2. Targeting and Specificity: For USP7 knockdown, it is necessary to ensure that the method used has high targeting and specificity, affecting only the expression of the target protein without affecting the function of other related proteins.

[0007] 3. Knockdown efficiency and stability: The knockdown method should be highly efficient and stable, capable of continuously inhibiting the expression of USP7 protein in long-term experiments, so as to ensure reliable and durable research results on the functional effects on endothelial cells.

[0008] 4. Ease of experimental operation: In order to improve the efficiency and operability of the experiment, the knockdown method should be simple, fast and widely applicable to research on different diseases. Summary of the Invention

[0009] To address the problems of poor targeting, low biosafety, and low treatment efficiency of traditional drugs used to treat inflammation of myocardial microvascular endothelial cells, the main objective of this invention is to provide a method for knocking down ubiquitin-specific peptidase 7 protein, and to design an adeno-associated virus vector to carry human USP7 shRNA to prepare a recombinant vector for knocking down USP7.

[0010] Another object of the present invention is to provide a USP7 recombinant vector obtained by the method of knocking down the USP7 protein.

[0011] Another object of the present invention is to provide the use of the said knockdown USP7 recombinant vector in the preparation of medicaments for treating endothelial cell inflammation or cardiovascular diseases.

[0012] To achieve the above objectives, the present invention provides the following technical solution:

[0013] In a first aspect, the present invention provides a method for knocking down ubiquitin-specific peptidase 7 protein, specifically inhibiting the expression of USP7 in endothelial cells through gene intervention, wherein the gene intervention includes downregulation of USP7 expression mediated by shRNA, siRNA, or recombinant viral vector.

[0014] Preferably, the recombinant viral vector is the adenovirus vector Adv-shUSP7.

[0015] More preferably, the method for constructing the adenovirus vector Adv-shUSP7 includes the following steps:

[0016] S1. Design and synthesize shRNA sequences targeting the USP7 gene, as shown in SEQ ID NO:1 and 2; the sequence of the USP7 gene is shown in SEQ ID NO:3;

[0017] S2. The shRNA sequence is cloned into an adenovirus expression vector containing KpnI / XhoI restriction sites to obtain a recombinant vector, which may also include a reporter gene or tag.

[0018] S3. The recombinant vector is introduced into host cells for viral packaging and amplification to obtain a high-titer recombinant adenovirus Adv-shUSP7;

[0019] S4. The recombinant adenovirus Adv-shUSP7 is purified by at least one of centrifugation, ultrafiltration, and column chromatography, and the knockdown effect of USP7 protein is verified by Western blot or quantitative PCR. Qualified adenovirus vector Adv-shUSP7 is collected to obtain the final product.

[0020] Specifically, the shRNA sequence is as follows:

[0021] Positive (F):

[0022] TGTGACCGGCGCCTACTCTGGTACCGCCACCATGAACCACCAACAG (SEQ ID NO: 1);

[0023] Reverse (R):

[0024] CCATCGTCATCCTTGTAGTCCTCGAGGTTGTGGATTTTAATTGCCT (SEQ ID NO: 2);

[0025] The USP7 gene sequence is as follows:

[0026]

[0027] Preferably, the endothelial cells are cardiac-derived endothelial cells.

[0028] Preferably, the recombinant viral vector contains the endothelial cell-specific promoter Cdh5.

[0029] In a second aspect, the present invention provides a USP7 knockdown reagent, which is constructed by the method of knocking down ubiquitin-specific peptidase 7 protein.

[0030] Preferably, the USP7 knockdown reagent includes at least one of shRNA, siRNA, or recombinant viral vector.

[0031] A third aspect of the invention provides the use of the USP7 knockdown reagent in the preparation of medicaments for treating endothelial cell inflammation or cardiovascular diseases.

[0032] Preferably, the USP7 knockdown reagent is a USP7 knockdown viral vector containing a Cdh5 promoter.

[0033] Preferably, the drug exerts its anti-inflammatory effect by inhibiting the NLRP3 inflammasome and its downstream inflammatory factors.

[0034] Preferably, the cardiovascular disease includes heart failure, myocardial infarction, or ischemic cardiomyopathy.

[0035] A fourth aspect of the present invention provides a pharmaceutical composition for improving endothelial cell inflammation, characterized in that it comprises an effective amount of a USP7 knockdown reagent and a pharmaceutically acceptable carrier, said USP7 knockdown reagent specifically inhibiting the expression of USP7 in endothelial cells.

[0036] Preferably, the USP7 knockdown reagent is a USP7 knockdown viral vector containing a Cdh5 promoter.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] 1. This invention provides a highly efficient, specific, and operable method for knocking down USP7 protein. By specifically inhibiting the expression of USP7 in endothelial cells through gene intervention, it improves endothelial cell inflammation and restores normal endothelial cell function. It is the first time that knocking down USP7 in endothelial cells can significantly inhibit the activation of NLRP3 inflammasome, reduce the release of downstream inflammatory factors such as IL-1β and IL-18, improve endothelial cell migration, tube formation, and survival, and alleviate endothelial dysfunction. This provides a new drug target for improving endothelial inflammation and endothelial cell dysfunction.

[0039] 2. This invention utilizes specific shRNA sequences to construct vectors and for viral replication and purification steps. The shRNA sequences are highly specific and effective, achieving optimal knockdown of the target protein.

[0040] 3. This invention reveals for the first time that knocking down USP7 can improve endothelial cell inflammation. The results show that knocking down USP7 expression in endothelial cells stimulated by AngII significantly improves endothelial cell function, specifically by improving migration function, tube formation and endothelial cell death, which has important clinical application value.

[0041] 4. The gene expression vector provided by this invention is convenient and easy to implement, providing a new strategy for improving the pathophysiological state of endothelial cells. Attached Figure Description

[0042] Figure 1 The image shows the PcDNA-shUsp7 vector map in this example.

[0043] Figure 2 The results show the verification of the transfection efficiency of Adv-shUSP7 in CMECs in the examples.

[0044] Figure 3 The Western blot test in this example demonstrates the knockdown effect of Adv-shUSP7.

[0045] Figure 4 This is a verification result of the effect of the Adv-shUSP7 formulation in improving endothelial cell migration ability under stress in the examples.

[0046] Figure 5 This is the result of verifying the effect of the Adv-shUSP7 formulation on improving the tubular formation ability of endothelial cells under stress in the examples.

[0047] Figure 6 This is the result of verifying the effect of the Adv-shUSP7 formulation on improving endothelial cell death under stress in the examples.

[0048] Figure 7 This is a verification result of the effect of the Adv-shUSP7 formulation in improving the release of inflammatory factors in endothelial cells under stress, as described in the examples. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0050] In the following examples, an adeno-associated virus agent with USP7 protein knockdown driven by the endothelial cell-specific promoter Cdh5 was used as a drug to promote endothelial cell function repair in the treatment and evaluation of an ischemic heart disease model, specifically including:

[0051] ① Cell Culture and Transfection: Primary myocardial microvascular endothelial cells (CMECs) were isolated and cultured from the heart of a lactating rat. The USP7 knockdown adenovirus preparation driven by the constructed endothelial-specific promoter was transfected into the endothelial cells. The endothelial cell-specific promoter Cdh5 was used to drive the knockdown, ensuring that the knockdown effect was cell-specific.

[0052] ② Functional assessment: Evaluation of the application of endothelial-specific promoter-driven USP7 knockdown adeno-associated virus (AAV) agents in endothelial cell function and endothelial inflammation under stress, including assessment of transfection efficiency, endothelial cell migration ability, tube formation ability, and endothelial cell death; including:

[0053] Migration ability: The Transwell chamber assay was used to observe the changes in the migration ability of endothelial cells under stress after USP7 knockdown.

[0054] Tube-forming ability: The ability of cells to form tubular structures is observed when cells are seeded on a matrix gel.

[0055] Cell death: Cell death was detected using PI staining to assess the effect of USP7 knockdown on cell survival.

[0056] ③ Assessment of inflammatory response: The expression levels of NLRP3 inflammasome and its downstream inflammatory factors were detected by Western blot to verify the inhibitory effect of USP7 knockdown on NLRP3 inflammasome and its downstream inflammatory factors in endothelial cells under stress.

[0057] Example 1: Preparation of an adeno-associated virus formulation driven by the endothelial cell-specific Cdh5 promoter to knock down the USP7 protein

[0058] I. Construction of adeno-associated viral vector driven by the myocardial-specific promoter Cdh5 to knock down USP7 protein

[0059] 1. Target gene: Human USP7

[0060] 2. Tool carrier information:

[0061] Vector name: PcDNA3.1-shUSP7; (e.g., ...) Figure 1 As shown.

[0062] 3. Vector digestion

[0063] Add each reagent in the order shown in Table 1, gently aspirate and mix, and place in a 37℃ water bath for 1-2 hours. After enzyme digestion, perform agarose gel electrophoresis to recover the target fragment.

[0064] The vector digestion system is shown in Table 1:

[0065] Table 1

[0066]

[0067] 4. Acquisition of the target fragment

[0068] (1) Design and synthesize primers to knock down the USP7 gene

[0069] Usp7-Kpn / Xho-F:

[0070] TGTGACCGGCGCCTACTCTGGTACCGCCACCATGAACCACCAACAG (SEQ ID NO: 1);

[0071] Usp7-Kpn / Xho-R:

[0072] CCATCGTCATCCTTGTAGTCCTCGAGGTTGTGGATTTTAATTGCCT (SEQ ID NO: 2).

[0073] (2) PCR amplification of the target fragment

[0074] Prepare the mixture, mix it gently, and place it in a PCR instrument for reaction. The fragment PCR amplification system is shown in Table 2:

[0075] Table 2

[0076]

[0077] Note: 1) The annealing temperature is the primer Tm value, and the annealing temperature directly determines the amplification specificity; 2) If poor amplification specificity is found, the annealing temperature can be increased appropriately by +2℃ each time; 3) Appropriately extending the extension time helps to improve the amplification yield.

[0078] The PCR procedure is shown in Table 3:

[0079] Table 3

[0080]

[0081] 5. Ligation of the target fragment to the vector

[0082] HB infusion TM One-step cloning linker system:

[0083] Prepare the reaction system as shown in Table 4 in an ice-water bath. If the liquid accidentally sticks to the tube wall, centrifuge briefly to make it sink to the bottom of the tube. After reacting the reaction solution at 50°C for 30 minutes, place it on ice for 5 minutes to immediately convert the reaction.

[0084] Table 4

[0085]

[0086] 6. Bacterial culture PCR identification

[0087] 6.1 The bacterial culture PCR identification system is shown in Table 5:

[0088] Table 5

[0089]

[0090] Note: When preparing the mix, scale up the proportions proportionally. Select validation primers based on the vector used.

[0091] 6.2 The bacterial culture PCR identification procedure is shown in Table 6:

[0092] Table 6

[0093]

[0094] 7. Sequencing

[0095] Two of the selected positive clones were sequenced, and the sequencing results showed that the electrophoresis results of the PCR products were consistent with the expected results.

[0096] II. Virus Packaging of the Above-mentioned Vectors

[0097] 1. Cell seeding

[0098] One day before transfection, 293 cells were seeded in 60 mm culture dishes with DMEM + 10% Hyclon fetal bovine serum and cultured overnight at 37°C in an incubator containing 5% CO2.

[0099] 2. Transfection

[0100] When the cells have grown to 70%–80% confluence with the base area, the linearized plasmid of the successfully recombined adenovirus vector is taken and processed using Lipofiter. TM Transfection was performed using transfection reagents, and the specific steps were as follows:

[0101] ① Replace the complete culture medium 2 hours before transfection, take 4 μg of the linearized plasmid of the successfully recombined adenovirus vector, dilute it with 300 μL of DMEM culture medium, and let it stand at room temperature for 5 min.

[0102] ② Take 15 μL of LipofiterTM Dilute with 300 μL of DMEM culture medium and incubate at room temperature for 5 min.

[0103] ③ Mix the two ingredients and let stand at room temperature in the dark for 20 minutes. Then add the mixture to a 60 mm petri dish, shake in a figure-eight motion, and incubate at 37°C in an incubator containing 5% CO2.

[0104] 3. Change the fluid

[0105] Replace with fresh cell culture medium 6 hours after transfection.

[0106] 4. Receiving the poison (P1)

[0107] Observe the cells for signs of toxicity daily. Once most of the cells have become diseased and detached from the bottom, collect the toxic cells and culture medium from the 60 mm culture dish into a 15 mL centrifuge tube.

[0108] 5. Freeze-thaw cycle

[0109] Set the constant temperature water bath to 37°C, freeze and thaw the 15mL centrifuge tube three times in liquid nitrogen and a 37°C water bath, centrifuge at 3000rpm for 5 minutes, collect the supernatant containing the virus, discard the precipitate, and this supernatant is the first generation control virus (P1), which will be used as the virus for subsequent large-scale viral amplification.

[0110] 6. Amplification

[0111] Take 2 mL of the P1 generation virus supernatant (about 3 mL) to infect cells in a 10 cm cell culture dish (ensuring a cell density of over 90%). Place the remaining virus supernatant in a cryovial and store it at -80°C as a seed virus.

[0112] 7. Receiving the poison (P2)

[0113] Two days after the virus is amplified, once all cells have detached from the bottom, the virus can be collected. The cells, along with the culture medium, are collected into a 15mL centrifuge tube. Following the freeze-thaw method described above, the cells are frozen and thawed three times. The supernatant is then used for the next generation of amplification or stored at -80℃. The amplification and collection of the virus for each subsequent generation are repeated in this manner.

[0114] 8. P3 generation virus amplification and collection

[0115] Based on 75cm each 2 Inoculate 4×10 in a square bottle 6 293 cells, seeded into 6 75cm cells 2The cells were cultured overnight in culture flasks. When the cells reached 90% confluence, all of the P2 generation virus (except for a small amount of retained virus seed) was inoculated into the culture flasks. After 24 hours, microscopic observation revealed 60% cytopathic effect, and after 46 hours, the cells were completely infected. The cytopathic cell suspension was harvested, centrifuged at 2000 rpm for 5 min, the supernatant was discarded, and 6 mL of ST buffer (culture medium + 10% serum + 2.5% glycerol) was added. The mixture was votexted and thawed three times between liquid nitrogen and 37°C, centrifuged at 3000 rpm for 5 min, and the supernatant was collected as the third generation virus (P3).

[0116] 9. Adenovirus purification (Non-purification items proceed directly to the titer detection section)

[0117] (1) First ultracentrifugation

[0118] ①Pre-cool the centrifuge to 4℃.

[0119] ② Slowly add 8 mL of CsCl 1.4 to the centrifuge tube, then slowly add 10 mL of CsCl 1.2, and slowly add about 20 mL of virus solution on top (if less than 20 mL, make up the difference with 10 mM Tris) (total volume about 37 mL).

[0120] ③ Balance the solution, 100000 × g (24000 rpm in SW31) for 90 min, 4℃, with a deceleration of 0.

[0121] ④ After centrifugation, remove the waste liquid from the top of the centrifuge tube and wipe the tube wall with 75% alcohol. Cover the area to be punctured with adhesive tape (to prevent the tube from cracking during puncture).

[0122] ⑤ Use a 5mL syringe with a 1.22 (18G) needle to puncture and aspirate the virus solution below the blue and white band.

[0123] ⑥ Dilute the collected virus solution with at least one volume of TE.

[0124] (2) Second ultracentrifugation

[0125] ① Slowly add 12 mL of CsCl 1.4 to the centrifuge tube, then slowly add 14 mL of CsCl 1.2, and very slowly add 8-10 mL of diluted virus solution to the top.

[0126] ② Balance the mixture, 100000 × g (24000 rpm in SW31) for 16-20 hours, 4℃, with a deceleration of 0.

[0127] ③ After centrifugation, remove the waste liquid from the top of the centrifuge tube and wipe the tube wall with 75% alcohol. Cover the area to be punctured with adhesive tape (to prevent the tube from cracking during puncture).

[0128] ④ Use a 5mL syringe with a 0.8 (20G) needle to draw out the blue and white band (method as above) or make a hole at the bottom of the centrifuge tube to let the liquid flow down naturally and collect the blue and white band (this can reduce the mixing of CsCl).

[0129] (3) Dialysis

[0130] Use 200× dialysis buffer each time, perform dialysis three times, and change the solution every hour.

[0131] (4) After dialysis, the titer was measured and the virus was aliquoted and stored at -80℃.

[0132] Example 2: Validation experiment on the effect of knockdown of USP7 viral vector on stress-induced endothelial dysfunction and endothelial inflammation.

[0133] Primary myocardial microvascular endothelial cells (CMECs) were cultured using the tissue block adherence method. One-week-old lactating rats were euthanized by cervical dislocation and immersed in 75% ethanol for 2 minutes. The thoracic cavity was opened with delicate surgical instruments, and the heart was harvested. The heart chambers were rinsed with sterile PBS to remove any remaining blood. Ophthalmic scissors were used to trim the tissues at the base of the heart. The epicardium and endocardium were gently removed with fine forceps. The heart was then minced using ophthalmic scissors to approximately 1 mm pieces. 3 Tissue blocks were infiltrated with 1 mL of fetal bovine serum and evenly distributed in 10 cm culture dishes. After incubation at 37°C for 4 hours, culture medium was added, and the culture was continued at 37°C for another 48 hours. The medium was then changed. After changing the medium, the culture continued until polygonal and astrological cells were distributed around the tissue blocks. The culture medium was then changed again. Cells were passaged when the confluence reached 80%. Transfection efficiency was determined under a microscope 48 hours after P2 generation cell transfection. Figure 2 ), collect samples for subsequent experiments.

[0134] I. Immunoblotting was used to detect the efficiency of USP7 virus knockdown after sample collection. Figure 3 )

[0135] CMECs were cultured using the tissue block adherence method. P2 generation cells were transfected with an adenovirus vector for 48 hours until the cell density reached approximately 80%. Cell samples were then collected for protein extraction. Immunoblot analysis was used to detect the knockdown efficiency of the control virus (ADV-ShCtrl) and the USP7 knockdown virus (ADV-shUSP7). The results showed that the ADV-shUSP7 vector significantly inhibited USP7 expression in CMECs.

[0136] II. Evaluation of the effect of USP7 knockdown of viral vectors on improving endothelial function under stress.

[0137] Endothelial cells treated with angiotensin II (AngII) or the control group were transfected with USP7 knockdown virus and digested with trypsin to form a single-cell suspension. Using a 24-well plate, an appropriate amount of culture medium (approximately 600 μL, containing 10% fetal bovine serum) was added to each well. Transwell chambers were placed in the plate, and single-cell suspension was added to each chamber at an appropriate density. The endothelial cells were then cultured at 37°C for 24 h. After culture, the chambers were removed, excess cells were washed with PBS, air-dried at room temperature, and fixed with 4% paraformaldehyde for 30 min, followed by washing with deionized water. The treated chambers were then stained with crystal violet at room temperature for 15 min, and rinsed with deionized water to remove excess stain. After staining, the chambers were placed in a 24-well plate, and images were taken using an inverted microscope. The migration ability of endothelial cells was assessed, showing that USP7 knockdown significantly improved migration dysfunction under AngII stimulation. Figure 4 ).

[0138] Pre-cool the special glass slides and sterilize the pipette tips at -20℃, and dissolve the matrix gel at 4℃. Add matrix gel to each well of the special glass slide, shake to distribute evenly, and incubate at 37℃ for 30 min. Dilute the single-cell suspension of endothelial cells to 4×10⁻⁶. 4 The concentration was 1 / mL, and the cells were placed on a substrate gel. After inoculation, the cells were incubated at 37°C for 12 hours. After incubation, the cells were placed on a glass slide under an inverted microscope to acquire images and assess the tube-forming ability of endothelial cells. It was observed that USP7 knockdown significantly improved the tube-forming ability of endothelial cells stimulated by AngII. Figure 5 ).

[0139] The cell samples to be observed are fixed on a glass slide. Hyaluronic acid and collagenase are added to the cell samples on the slide to increase cell membrane permeability, facilitating the entry of PI fluorescent staining agent. A buffer solution containing PI fluorescent staining agent is dropped onto the slide to allow the fluorescent dye to fully penetrate the cell nucleus. Specifically, PI is dissolved in PBS containing 0.1% Triton X-100 to a final concentration of 50 μg / mL, containing 100 μg / mL RNase, and should be stored in the dark. Then, 1 mL of the cell suspension is taken, and an appropriate amount of PI staining solution is added and mixed. The mixture is allowed to react for a period of time to allow for thorough staining. Excess PI staining agent is washed away with PBS or other buffer solutions to reduce background fluorescence. Observation is then performed under a fluorescence microscope using an excitation light greater than 647 nm. Normal living cell nuclei are stained green by PI, while apoptotic cell nuclei exhibit different morphological changes. In early apoptotic cells, the nuclei are condensed and stained more deeply, or the nuclear chromatin aggregates on one side of the nuclear membrane, forming a crescent shape. In late apoptotic cells, the nuclei fragment into round bodies of varying sizes, which are then surrounded by the cell membrane, forming apoptotic bodies. It is evident that USP7 knockdown can significantly alleviate endothelial cell death induced by AngII stimulation. Figure 6 ).

[0140] Cell suspensions from different treatment groups were collected, and the protein levels of NLRP3 inflammasome and its downstream inflammatory factors in endothelial cells after USP7 knockdown were detected by immunoblotting. Figure 7 ).

[0141] In summary, this invention demonstrates through the above embodiments that the adenovirus vector Adv-shUSP7 can improve endothelial dysfunction under stress. The adenovirus vector Adv-shUSP7 is applied to endothelial cell function research in the following three aspects, demonstrating its promising applications: ① Drug development: as a tool for screening anti-inflammatory or endothelial function-protecting drugs; ② Disease treatment: for preparing drugs or reagents to improve endothelial dysfunction in ischemic heart diseases such as myocardial infarction and heart failure; ③ Basic research: for exploring the molecular mechanisms of USP7 in endothelial cell inflammation, migration, and tubule formation.

[0142] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A method for knocking down ubiquitin-specific peptidase 7 (USP7) protein, characterized in that, include: The expression of USP7 in endothelial cells was specifically inhibited through gene intervention. The gene intervention methods include downregulation of USP7 expression mediated by shRNA, siRNA, or recombinant viral vectors.

2. The method for knocking down ubiquitin-specific peptidase 7 protein according to claim 1, characterized in that, The recombinant viral vector is the adenovirus vector Adv-shUSP7.

3. The method for knocking down ubiquitin-specific peptidase 7 protein according to claim 2, characterized in that, The method for constructing the adenovirus vector Adv-shUSP7 includes the following steps: S1. Design and synthesize shRNA sequences targeting the USP7 gene, as shown in SEQ ID NO:1 and 2, and the sequence of the USP7 gene is shown in SEQ ID NO:3; S2. The shRNA sequence is cloned into an adenovirus expression vector containing KpnI / XhoI restriction sites to obtain a recombinant vector, which may also include a reporter gene or tag. S3. The recombinant vector is introduced into host cells for viral packaging and amplification to obtain a high-titer recombinant adenovirus Adv-shUSP7; S4. The recombinant adenovirus Adv-shUSP7 is purified by at least one of centrifugation, ultrafiltration, and column chromatography, and the knockdown effect of USP7 protein is verified by Western blot or quantitative PCR. Qualified adenovirus vector Adv-shUSP7 is collected to obtain the final product.

4. The method for knocking down ubiquitin-specific peptidase 7 protein according to claim 1, characterized in that, The endothelial cells are cardiac-derived endothelial cells.

5. The method for knocking down ubiquitin-specific peptidase 7 protein according to claim 1, characterized in that, The recombinant viral vector contains the endothelial cell-specific promoter Cdh5.

6. A ubiquitin-specific peptidase 7 knockdown reagent, characterized in that, It was constructed by the method of knocking down ubiquitin-specific peptidase 7 protein as described in any one of claims 1 to 5.

7. The ubiquitin-specific peptidase 7 knockdown reagent according to claim 6, characterized in that, The ubiquitin-specific peptidase 7 knockdown reagent includes at least one of shRNA, siRNA, or recombinant viral vector.

8. The use of the ubiquitin-specific peptidase 7 knockdown reagent of claim 6 or 7 in the preparation of a medicament for treating endothelial cell inflammation or cardiovascular disease.

9. The application according to claim 8, characterized in that, The USP7 knockdown reagent is a USP7 knockdown viral vector containing a Cdh5 promoter; and / or the cardiovascular disease includes heart failure, myocardial infarction, or ischemic cardiomyopathy.

10. A pharmaceutical composition for improving endothelial cell inflammation, characterized in that, It contains an effective amount of a USP7 knockdown reagent and a pharmaceutically acceptable vector, wherein the USP7 knockdown reagent is a USP7 knockdown viral vector containing a Cdh5 promoter that specifically inhibits the expression of USP7 in endothelial cells.