TaSIRH2-14 gene and application thereof in plant drought resistance

Abstract

The application belongs to the technical field of genetic engineering, and discloses TaSIRH2-14 A gene and application thereof in plant drought resistance. TaSIRH2-14 The nucleotide sequence of the gene is shown as SEQ ID NO:1, the gene positively regulates drought resistance of plants, overexpression TaSIRH2-14 The gene improves drought resistance of plants. After overexpression TaSIRH2-14 of the gene, the survival rate of plants under water deficiency conditions is improved, the gene significantly improves the tolerance of plants to drought stress through the pathways of improving water retention capacity of plants, reducing membrane lipid peroxidation damage, promoting proline accumulation, enhancing antioxidant enzyme activity and the like. The application provides a germplasm resource for wheat drought resistance breeding, and provides a new idea for cultivating drought-resistant wheat varieties through molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to... TaSIRH2-14 Genes and their application in plant drought resistance. Background Technology

[0002] Wheat is one of the major food crops, and its stable and high yields play a vital role in ensuring a stable food supply. Throughout the wheat growth process, drought is a significant abiotic stress factor restricting wheat growth, development, yield formation, and quality improvement. Prolonged or intermittent drought can lead to poor emergence, fewer tillers, insufficient grain filling, and decreased thousand-grain weight, ultimately resulting in reduced yields and lower processing quality. Currently, production mainly mitigates the damage of drought to wheat by optimizing irrigation patterns, adjusting cultivation measures, and spraying stress-resistance regulators. However, these conventional methods are limited by water resource conditions, planting environment, and production costs, resulting in poor adaptability and stability. They can only provide short-term relief and cannot fundamentally improve wheat's inherent drought resistance. Compared to traditional cultivation and regulation methods, variety improvement is a crucial measure to address drought stress and achieve long-term stable wheat yields. Molecular breeding, with its advantages of high precision, short breeding cycle, and significant targeted improvement effects, has become the core technology for breeding drought-resistant wheat varieties. This technology overcomes the limitations of traditional hybridization breeding, which suffers from low efficiency and strong randomness in trait improvement.

[0003] Molecular breeding relies on drought-resistant genes with well-defined functions and superior traits. However, the number of drought-resistant genes discovered and identified in wheat is currently limited. Because wheat is an allohexaploid crop with a large and complex genome, and its stress resistance traits are mostly complex quantitative traits regulated by multiple genes, gene discovery and functional analysis are challenging, resulting in a scarce existing drought-resistant gene resource bank. Therefore, systematically discovering and identifying novel drought-resistant functional genes in wheat, elucidating their molecular regulatory mechanisms, and enriching wheat drought-resistant gene resources have significant theoretical research value and practical application significance for breeding highly drought-resistant and stable-yielding drought-resistant wheat varieties and improving wheat's drought adaptability and water use efficiency. Summary of the Invention

[0004] To solve the above-mentioned technical problems, the present invention provides TaSIRH2-14 Genes and their application in plant drought resistance. TaSIRH2-14 The nucleotide sequence of the gene is shown in SEQ ID NO:1. This gene positively regulates drought resistance in plants and is overexpressed. TaSIRH2-14 Genes enhance plant drought resistance. Overexpression TaSIRH2-14Following gene induction, the survival rate of plants under water-deficient conditions improved. This gene significantly enhanced the plant's tolerance to drought stress by improving water retention capacity, reducing membrane lipid peroxidation damage, promoting proline accumulation, and enhancing antioxidant enzyme activity. This invention provides a germplasm resource for drought-resistant wheat breeding and offers new insights for molecular breeding of drought-resistant wheat varieties.

[0005] On the one hand, this invention seeks protection TaSIRH2-14 Genes, the ones mentioned TaSIRH2-14 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0006] On the other hand, this invention seeks protection for the TaSIRH2-14 protein, as described above. TaSIRH2-14 The amino acid sequence of the TaSIRH2-14 protein encoded by the gene is shown in SEQ ID NO:2.

[0007] On the other hand, the present invention requests protection for the above. TaSIRH2-14 The application of genes in plant drought resistance, the aforementioned TaSIRH2-14 Genes positively regulate drought resistance in plants, and overexpression of the aforementioned genes... TaSIRH2-14 Genes enhance plant drought resistance;

[0008] The plants mentioned include Arabidopsis thaliana and wheat.

[0009] Specifically, this invention detects [certain substances] in wheat plants. TaSIRH2-14 Gene expression levels were discovered. TaSIRH2-14 The gene is significantly expressed in wheat roots and its expression is significantly upregulated after wheat plants are subjected to drought stress.

[0010] Furthermore, overexpression TaSIRH2-14 Genes enhance the water retention capacity of plants; Overexpression TaSIRH2-14 Genes enhance the stability of plant cell membranes; Improving plant cell membrane stability includes reducing malondialdehyde (MDA) content.

[0011] Specifically, the present invention has discovered through experiments that, TaSIRH2-14 The leaf water loss rate of the overexpressing plants was significantly lower than that of the WT plants, indicating stronger water retention capacity and improved drought resistance. Under normal growth conditions, WT and TaSIRH2-14 There was no significant difference in malondialdehyde (MDA) content among overexpressing plants, but under drought stress, MDA content increased significantly in all plants. TaSIRH2-14 The increase in expression levels in overexpressing plants was significantly lower than that in WT plants. This indicates that overexpression... TaSIRH2-14 Genes can reduce the damage to plant cell membranes caused by drought stress and improve cell membrane stability.

[0012] Furthermore, overexpression TaSIRH2-14Genes enhance the plant's osmotic regulation ability; The improvement of plant osmotic regulation capacity includes increasing proline content.

[0013] Specifically, this invention has discovered through experiments that, under normal conditions, WT and TaSIRH2-14 There was no significant difference in proline content among the overexpressing plants, but the content increased significantly after drought treatment. TaSIRH2-14 The increase in expression levels in overexpressing plants was significantly higher than in WT plants. This indicates that overexpression... TaSIRH2-14 Genes can enhance a plant's osmotic regulation ability, thereby improving its drought resistance.

[0014] Furthermore, overexpression TaSIRH2-14 Genes enhance plants' antioxidant defense capabilities; Overexpression TaSIRH2-14 Genes reduce the rate of water loss through leaf transpiration.

[0015] Furthermore, the enhancement of plant antioxidant defense capabilities includes increasing the activity of antioxidant enzymes; The antioxidant enzymes include at least one of SOD, CAT, and POD.

[0016] Specifically, this invention has discovered through experiments that, under normal conditions, WT and TaSIRH2-14 The overexpressing plants showed low and no significant differences in SOD, CAT, and POD activities. However, after drought treatment, the activities of SOD, CAT, and POD all increased significantly. TaSIRH2- 14 The enzyme activity of overexpressing plants was significantly greater than that of WT plants. This indicates that overexpression... TaSIRH2-14 It can improve the plant's antioxidant defense capabilities, thereby enhancing the plant's drought resistance.

[0017] Furthermore, overexpression TaSIRH2-14 Genes improve plant survival rates under drought stress; Overexpression TaSIRH2-14 Genes enhance the recovery and survival rate of drought-stressed plants after rehydration.

[0018] Specifically, this invention has found through experiments that after drought treatment, WT plants and TaSIRH2-14 Overexpressing plants showed varying degrees of wilting, with WT plants exhibiting more severe wilting and chlorosis. Three days after rehydration, TaSIRH2-14 Overexpressing plants showed greater regreening and survival rates, while some WT plants died. TaSIRH2- 14Overexpression-treated wheat lines exhibited significantly higher drought resistance, survival rates, and soil water loss rates compared to the wild type. Furthermore, the leaf surface temperature of the overexpression-treated lines after drought was significantly higher than the wild type, indicating smaller stomatal opening and lower leaf transpiration rates, thus reducing water loss through transpiration under drought stress. The knockout lines showed the opposite effect. This suggests that overexpression... TaSIRH2-14 Genes can significantly improve the drought resistance of wheat.

[0019] Furthermore, this invention claims protection for a method for breeding a drought-resistant wheat variety, involving overexpression of [a specific herb] in wheat. TaSIRH2- 14 Gene; The TaSIRH2-14 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0020] Furthermore, the method for cultivating this drought-resistant wheat variety includes constructing an overexpression vector, transferring the overexpression vector into Agrobacterium, and infecting wheat with the Agrobacterium carrying the overexpression vector to obtain the drought-resistant wheat variety.

[0021] Furthermore, the overexpression vector includes TaSIRH2-14 Genes and empty vectors; The empty carrier is pCAMBIA3301.

[0022] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) This invention TaSIRH2-14 The nucleotide sequence of the gene's open reading frame is shown in SEQ. ID. NO:1. TaSIRH2-14 Genes can positively regulate drought resistance in plants, and overexpression of these genes can help regulate drought resistance. TaSIRH2-14 Genes enhance plant drought resistance. Overexpression TaSIRH2-14 Following gene expression, the plant's leaf water loss rate decreased, malondialdehyde content decreased, proline content increased, and antioxidant enzyme activity increased, indicating that overexpression of this gene can enhance the plant's drought resistance by improving water retention capacity, cell membrane stability, osmotic regulation, and antioxidant defense. TaSIRH2-14 Genes can improve the survival rate of plants under drought stress, and also improve the recovery and survival rate of drought-stressed plants after rehydration.

[0023] (2) TaSIRH2-14The gene-encoded TaSIRH2-14 protein is located on the cell membrane and possesses E3 ubiquitin ligase activity. In a complete reaction system containing Ub, E1, E2, and His-TaSIRH2-14, both anti-His and anti-Ub antibodies detected high-molecular-weight polyubiquitinated bands above the target protein. However, when Ub, E1, and E2 were omitted, or when His-TaSIRH2-14 was replaced with a His-TF tag control, no ubiquitinated bands appeared. Based on its spatial location on the cell membrane, the TaSIRH2-14 protein ubiquitinates drought-related target proteins on the membrane, thereby reducing transpiration and water loss by regulating stomatal opening and closing, and improving wheat drought tolerance. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 for TaSIRH2-14 Analysis of gene expression patterns in different parts of wheat. Figure 1 A in the text is TaSIRH2-14 A graph showing the relative expression levels of genes in different parts of wheat; Figure 1 In the figure, B represents the wheat root after different durations of drought stress. TaSIRH2-14 The graph shows the relative expression levels of genes.

[0026] Figure 2 This is a diagram showing the subcellular localization of the TaSIRH2-14 protein.

[0027] Figure 3 SDS-PAGE image of prokaryotic expression and purification of TaSIRH2-14-TF-His fusion protein; Figure 3 In the image, A represents the SDS-PAGE image of the protein induction expression stage. Lanes 1-3 contain pCold-TF-His control strain samples, and lanes 4-6 contain samples carrying the protein. TaSIRH2-14 The recombinant expression strain samples are shown in lanes 1 and 4, which are the total cell protein of the corresponding strains without low-temperature induction, lanes 2 and 5, which are the total cell protein of the corresponding strains after low-temperature induction, and lanes 3 and 6, which are the supernatant protein of the corresponding strains after induction. Figure 3 In the image, B is the SDS-PAGE image of the purified protein. Lane 1 is the purified control protein, and lane 2 is the purified TaSIRH2-14-TF-His fusion protein.

[0028] Figure 4 The figure shows the results of E3 ubiquitin ligase activity assay for TaSIRH2-14-TF-His protein.

[0029] Figure 5 For negative control Arabidopsis thaliana and TaSIRH2-14 A diagram showing the growth of Arabidopsis thaliana overexpressed.

[0030] Figure 6 For negative control Arabidopsis thaliana and TaSIRH2-14 Figure showing the water loss rate of Arabidopsis thaliana overexpressing the gene. WT represents the negative control Arabidopsis thaliana; OE1, OE2, and OE3 represent... TaSIRH2-14 Overexpression of Arabidopsis thaliana lines 1, 2, and 3.

[0031] Figure 7 For negative control Arabidopsis thaliana and TaSIRH2-14 The results of malondialdehyde content in Arabidopsis thaliana overexpression are shown in the figure.

[0032] Figure 8 For negative control Arabidopsis thaliana and TaSIRH2-14 The results of proline content in Arabidopsis thaliana overexpression.

[0033] Figure 9 For negative control Arabidopsis thaliana and TaSIRH2-14 The results of antioxidant enzyme activity after overexpression of Arabidopsis thaliana are shown in the figure. Figure 9 A in the figure represents the POD activity results; Figure 9 B in the graph represents the SOD activity results; Figure 9 C in the figure represents the CAT activity results.

[0034] Figure 10 In genetically modified wheat TaSIRH2-14 The quantitative analysis results are shown in the figure. Figure 10 A in the text is TaSIRH2-14 Overexpression of wheat TaSIRH2-14 The results of the quantitative analysis are shown in the figure. Figure 10 B in the text is TaSIRH2-14 Knockout wheat TaSIRH2- 14 The quantitative analysis results are shown in the figure. WT represents wild-type wheat; OE1, OE2, and OE3 are... TaSIRH2-14 Overexpression of wheat lines 1, 2, and 3; ko1, ko2, and ko3 were respectively TaSIRH2-14 Knock out wheat lines 1, 2, and 3.

[0035] Figure 11 This figure shows the statistical results of the survival rates of wild-type wheat and genetically modified wheat after drought stress.

[0036] Figure 12 Phenotypic images and infrared thermographs of wild-type wheat and transgenic wheat before and after drought stress. Figure 12In the diagram, A represents the phenotype before drought stress; Figure 12 B in the diagram represents the phenotypic pattern after drought stress. Figure 12 C in the image represents the infrared thermal image before drought stress. Figure 12 D in the image represents the infrared thermal image after drought stress.

[0037] Figure 13 This figure shows the statistical results of leaf surface temperature before and after drought stress in wild-type wheat and genetically modified wheat.

[0038] Figure 14 This figure shows the statistical results of soil moisture content before and after drought stress in wild-type wheat and genetically modified wheat. Detailed Implementation

[0039] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially. Unless otherwise specified, the percentages in the following embodiments refer to mass percentages.

[0040] Example 1 This embodiment provides TaSIRH2-14 Obtaining the gene and TaSIRH2-14 protein.

[0041] Seeds of the wheat cultivar Chinese Spring were germinated at 25℃ for three days. The germinated seeds were then transferred to a nutrient solution and cultured for two weeks. The entire plant was then quick-frozen in liquid nitrogen, ground, and total RNA was extracted. Reverse transcription was performed to obtain cDNA (SEQ ID NO:3). Using this cDNA as a template, cloning primers were used (… TaSIRH2-14 -F、 TaSIRH2-14 PCR amplification was performed using the gene-R, and the amplification product was subjected to agarose gel electrophoresis. The 762bp DNA fragment was isolated and purified and sequenced. The results showed that the nucleotide sequence of the DNA fragment was as shown in SEQ ID NO:1, and the amino acid sequence of the TaSIRH2-14 protein encoded by the gene was as shown in SEQ ID NO:2.

[0042] TaSIRH2-14 -F: 5′-ATGAGCATGGAGGTGCTAC-3′; TaSIRH2-14 -R: 5′-TCACGACCCAAAAACCTCCT-3′.

[0043] Example 2 This embodiment provides TaSIRH2-14 Analysis of gene expression patterns.

[0044] The test materials were roots, stems, leaves, and ears of Chinese spring wheat, as well as drought stress materials after the roots were treated with 20% PEG6000 to simulate drought for 0h, 3h, 6h, 9h, 12h, and 24h. Total RNA was extracted from the test materials and reverse transcribed to obtain cDNA. Real-time quantitative PCR was performed using cDNA as a template for detection. TaSIRH2-14 The primers for the genes (including homologous genes from the B and D genomes) are: qTaSIRH2-14 -F、 qTaSIRH2-14 -R is used to detect the internal reference gene ( β-Actin The primer pair for the gene is β-Actin -F、 β-Actin The reaction system (15 μL) for real-time quantitative PCR was as follows: 7.5 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.6 μL of primer F (10 μM), 0.6 μL of primer R (10 μM), 1.2 μL of cDNA template, and 5.6 μL of ddH2O. The real-time quantitative PCR reaction program was: 95℃ pre-denaturation for 30 s; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; extension at 72℃ for 5 min; fluorescence signal was collected and melting curves were plotted every 0.2℃ as the temperature increased from 60℃ to 95℃, and different parts of wheat were analyzed. TaSIRH2-14 Statistical results of relative gene expression levels are as follows Figure 1 As shown.

[0045] qTaSIRH2-14 -F: 5′-CATCCGCGAAAATCGAGTGG-3′; qTaSIRH2-14 -R: 5′-TTGTTGCCTTGGCGATTTGG-3′; β-Actin -F: 5′-CTCCCTCACAACAACAACCGC-3′; β-Actin -R: 5′-TACCAGGAACTTCCATACCAAC-3′.

[0046] Depend on Figure 1 It can be seen that, TaSIRH2-14 The gene was significantly expressed in wheat roots, and its expression was significantly upregulated after wheat plants were subjected to drought stress, indicating that... TaSIRH2-14 Genes are involved in drought stress response.

[0047] Example 3 This example investigated the subcellular localization of the TaSIRH2-14 protein.

[0048] The subcellular expression vector pCAMBIA1302-EGFP was digested with BstBI and inserted into the cell. TaSIRH2 A sequence containing no stop codon (-14) was used to obtain a fusion expression vector. SNAP-RFP, acting as a cell membrane marker, specifically localized to the cell membrane in plant cells, expressing a red fluorescent signal under a laser confocal microscope. The fusion protein expressed a green fluorescent signal. The fusion expression vector was transformed into Agrobacterium GV3101 and injected into tobacco to obtain transient expression. The results were observed under a laser confocal microscope. Figure 2 As shown.

[0049] Depend on Figure 2 It is known that the TaSIRH2-14 protein is located in the cell membrane.

[0050] Example 4 This embodiment provides the detection of E3 ubiquitin ligase activity of TaSIRH2-14 protein.

[0051] 1. Obtaining the TaSIRH2-14-TF-His fusion protein The prokaryotic expression vector pCold-TF-His was linearized using a double enzyme digestion method, with the restriction sites being BamHI and HindIII. TaSIRH2-14 The coding region sequence of the gene was constructed into a linearized pCold-TF-His vector to obtain the TaSIRH2-14-TF-His recombinant plasmid. This plasmid and the pCold-TF-His empty vector were then transformed into *E. coli* strain BL21. After low-temperature induction of expression, bacterial cells were collected, lysed, and total protein, precipitated inclusion body protein, and soluble supernatant protein were separated. The induced supernatant protein was affinity purified and analyzed by SDS-PAGE. The results are shown below. Figure 3 As shown, the TaSIRH2-14-TF-His fusion protein was successfully obtained.

[0052] 2. Detection of E3 ubiquitin ligase activity Protein purification was performed using beaver bio-histidine tagging protein purification magnetic beads: (1) Sample preparation: The expression cells stored at -80℃ were suspended in 1×PBS, placed on ice, and repeatedly frozen and thawed or sonicated to lyse the protein. Centrifuged at 4℃ and 7000rpm for 5min, and the supernatant (protein) was transferred to a new centrifuge tube. (2) Magnetic bead pretreatment: Magnetic beads were aspirated into centrifuge tubes, separated using a magnetic separator, and 1×PBS was added to wash the magnetic beads repeatedly. (3) Target protein binding to magnetic beads: The supernatant protein and the pretreated magnetic beads were incubated overnight on a shaker at 4℃. (4) Protein washing: The protein was washed 5-7 times with 70mM imidazole washing buffer (prepared with 1×PBS). (5) Protein elution: Elute the target protein in each tube with 400 μL of 500 mM imidazole elution buffer (prepared with 1×PBS), collect the eluted protein, aliquot it, add glycerol to a concentration of 10%, and store at -80℃ to obtain the purified TaSIRH2-14-TF-His protein. (6) Magnetic bead post-treatment: Wash the magnetic beads 5-7 times with 500 mM imidazole elution buffer, then wash the magnetic beads 5-7 times with sterile ddH2O, and finally store the magnetic beads in 20% ethanol.

[0053] E3 ubiquitin ligase activity assay: 1 μg of purified TaSIRH2-14-TF-His protein, 100 ng UBE1, 150 ng UbcH5b / UBE2D2, and 5 μg Ub protein were mixed in 20× ubiquitinase activity reaction buffer (1 M Tris pH=7.6, 85 mM MgCl2, 150 mM ATP-Na2, 50 mM DTT), incubated at 30℃ for 3-4 h with a constant temperature shaker, followed by denaturation at 98℃ for 5 min. Separation was performed by 8% SDS-PAGE gel electrophoresis, and Western blotting was used for detection. The results are shown below. Figure 4 As shown.

[0054] Depend on Figure 4 It can be seen that in the complete reaction system containing Ub, E1, E2 and His-TaSIRH2-14, both anti-His and anti-Ub antibodies detected high molecular weight polyubiquitination bands above the target protein. However, when Ub, E1, and E2 were missing or His-TaSIRH2-14 was replaced with the His-TF tag control, no ubiquitination bands appeared, indicating that the TaSIRH2-14 protein has E3 ubiquitin ligase activity.

[0055] Example 5 This embodiment provides TaSIRH2-14 Research on the mechanism by which genes enhance plant drought resistance.

[0056] Will TaSIRH2-14After removing the TGA from the coding region of the gene, it was constructed into the pCAMBIA1302-GFP vector and transformed with Agrobacterium to obtain recombinant Agrobacterium. Arabidopsis was transformed using the flower-dipping method. The recombinant Agrobacterium was inoculated into LB broth containing 50 mg / L kanamycin and 50 mg / L rifampin and cultured at 28°C with shaking until OD (Organic Growth Rate). 600 Centrifuge at 0.8, 25℃, 5000 r / min for 2 min, remove supernatant, and resuspend bacterial cells in resuspending solution (containing 50 g / L sucrose and 0.02 vol% silwet77, solvent is water) to obtain infection solution. Place Arabidopsis flower buds in the infection solution for 1 min, remove, cover with a film, keep moist for 2 days, and then grow under normal conditions (16 h light, 8 h dark, 22℃) to harvest T1 generation seeds. Screen positive seedlings with MS medium containing hygromycin (Hyg). Seedlings that can grow roots and cotyledons normally on hygromycin medium are considered positive seedlings, and T2 generation seeds are obtained. Repeat the above hygromycin screening steps for T2 generation seeds to obtain single-copy lines with a positive segregation ratio of 3:1, which are harvested as single-copy positive seedlings. After transplanting the above single-copy positive seedlings, culture them, extract Arabidopsis leaf DNA and use specific primers ( TaSIRH2-14 -F、 TaSIRH2-14 -R) molecular identification was performed, and qualified strains were continuously planted and repeatedly screened until a result was obtained. TaSIRH2- 14 Homozygous Arabidopsis thaliana overexpression lines were obtained. The pCAMBIA1302-GFP vector was transformed using the above method to obtain homozygous positive transgenic Arabidopsis thaliana as a transgenic negative control.

[0057] 1. Drought resistance and rehydration performance Negative control Arabidopsis seeds and TaSIRH2-14 Overexpressing Arabidopsis thaliana seeds were disinfected with 3% sodium hypochlorite for 10 min and then rinsed 6 times with water to completely remove the sodium hypochlorite. The seeds were then sown on 1 / 2 MS medium. After two weeks of growth, seedlings with uniform growth were selected and transplanted into nutrient soil. They were then grown in a light incubator (16 h light, 8 h dark, 22℃) for approximately three weeks, followed by two weeks of drought (watering stopped). The control Arabidopsis thaliana (WT) and... TaSIRH2-14 The growth of Arabidopsis thaliana was observed after overexpression and rehydration for three days. The growth status was as follows: Figure 5 As shown.

[0058] Depend on Figure 5 It can be seen that after drought treatment, WT plants and TaSIRH2-14 Overexpressing plants showed varying degrees of wilting, with WT plants exhibiting more severe wilting and chlorosis. Three days after rehydration, TaSIRH2-14 Overexpression resulted in greater regreening and survival rates in plants, while some WT plants died. This indicates that overexpression... TaSIRH2-14Genes can enhance a plant's drought resistance.

[0059] 2. Water loss rate test The control Arabidopsis thaliana and the control Arabidopsis thaliana, which had grown for about three weeks, were compared. TaSIRH2-14 Overexpressing Arabidopsis thaliana was divided into two groups: one group received normal watering and growth, while the other group received no watering for approximately one week. Fresh leaves were collected for water loss testing. The weight of fresh Arabidopsis leaves was recorded as FW; they were then allowed to dehydrate naturally indoors, and their weight (dWs) was measured and recorded every hour. The plant leaf tissue was then blanched at 105℃ for 10 minutes, followed by drying in a 65℃ oven for 24 hours, and the dry weight (DW) was obtained. The water loss rate was calculated using the following formula, and the results are as follows: Figure 6 As shown.

[0060] Water loss rate (%) = (FW - dW) / (FW - DW) × 100% Depend on Figure 6 It can be seen that, TaSIRH2-14 The leaf water loss rate of the overexpressing plants was significantly lower than that of the WT plants, indicating that they had stronger water retention capacity and improved drought resistance.

[0061] 3. Malondialdehyde (MDA) content detection The control Arabidopsis thaliana and the control Arabidopsis thaliana, which had grown for about three weeks, were compared. TaSIRH2-14 Overexpressing Arabidopsis thaliana was divided into two groups: one group received normal watering and growth, while the other group received no watering for about one week. Fresh leaves were collected to determine malondialdehyde (MDA) content. 0.2g of Arabidopsis leaves were weighed, ground with 10% trichloroacetic acid and a small amount of quartz sand, and centrifuged at 4000 rpm for 10 minutes. The supernatant was used as the sample extract, and 0.6% thiobarbituric acid (TBA) was added and mixed thoroughly. The mixture was then heated in a boiling water bath for 15-30 minutes. After cooling, the absorbance was measured at wavelengths of 532 nm, 600 nm, and 450 nm. The control group received 0.6% TBA. The MDA content was calculated using the following formula. The results are as follows: Figure 7 As shown.

[0062] MDA content (mmol / g FW) = [6.452 × (A 532 -A 600 )-0.559×A 450 ]×V t / (V s ×FW) In the formula, V t V represents the total volume of the extract (mL). s The volume of the extract used for determination is (mL); FW is the fresh weight of the sample (g).

[0063] Depend on Figure 7 It can be seen that under normal growth conditions, WT and TaSIRH2-14There was no significant difference in malondialdehyde (MDA) content among overexpressing plants, but under drought stress, MDA content increased significantly in all plants. TaSIRH2-14 The increase in expression levels in overexpressing plants was significantly lower than that in WT plants. This indicates that overexpression... TaSIRH2-14 Genes can reduce the damage to plant cell membranes caused by drought stress and improve cell membrane stability.

[0064] 4. Proline content detection The standard curve for proline content was prepared as follows: the preparation methods for samples of each concentration are shown in Table 1. After mixing, the samples were incubated in a boiling water bath for 30 min. After cooling, the absorbance was measured at 520 nm using 0 μg / ml proline as a blank, and the standard curve was plotted.

[0065] The control Arabidopsis thaliana and the control Arabidopsis thaliana, which had grown for about three weeks, were compared. TaSIRH2-14 Overexpressing Arabidopsis thaliana was divided into two groups: one group was watered normally for growth, while the other group was watered for about a week without watering. Fresh leaves were collected to determine proline content. 0.1g of sample was weighed and placed in a mortar, 5mL of 3% sulfosalicylic acid was added, and the mixture was ground into a homogenate. The homogenate was heated in a boiling water bath at 100℃ for 15min, cooled on ice, and centrifuged at 4000rpm for 10min. The supernatant was used as the proline extract. Glacial acetic acid (2mL) and 2.5% ninhydrin (3mL) were added to the extract and mixed thoroughly. The mixture was then boiled in water at 100℃ for 30min. After cooling, the absorbance was measured at 520nm. The proline content X (μg) was calculated based on the standard curve. The results are as follows: Figure 8 As shown.

[0066] Table 1. Sample formulations for each concentration in the proline content standard curve.

[0067] Proline content (μg / g FW) = X × V t / (V s ×FW) Depend on Figure 8 It can be seen that under normal conditions, WT and TaSIRH2-14 There was no significant difference in proline content among the overexpressing plants, but the content increased significantly after drought treatment. TaSIRH2-14 The increase in expression levels in overexpressing plants was significantly higher than in WT plants. This indicates that overexpression... TaSIRH2-14 Genes can enhance a plant's osmotic regulation ability, thereby improving its drought resistance.

[0068] 5. Antioxidant enzyme activity detection The control Arabidopsis thaliana and the control Arabidopsis thaliana, which had grown for about three weeks, were compared. TaSIRH2-14Overexpressing Arabidopsis thaliana was divided into two groups: one group was watered normally for growth, while the other group was dewatered for about one week. Fresh leaves were collected to detect antioxidant enzyme activity. 0.2 g of fresh Arabidopsis thaliana leaves were weighed, and the sample solution was extracted by low-temperature grinding with phosphate buffer. Then, the activities of three antioxidant enzymes, SOD, POD, and CAT, were measured according to (Rao et al. 1996). The results are as follows: Figure 9 As shown.

[0069] Depend on Figure 9 It can be seen that under normal conditions, WT and TaSIRH2-14 The overexpressing plants showed low and no significant differences in SOD, CAT, and POD activities. However, after drought treatment, the activities of SOD, CAT, and POD all increased significantly. TaSIRH2-14 The enzyme activity of overexpressing plants was significantly greater than that of WT plants. This indicates that overexpression... TaSIRH2-14 It can improve the plant's antioxidant defense capabilities, thereby enhancing the plant's drought resistance.

[0070] Example 6 This embodiment provides TaSIRH2-14 Application of genes in plant drought resistance.

[0071] 1. TaSIRH2-14 Obtaining wheat by overexpression Will TaSIRH2-14 The coding region sequence of the gene was constructed into the pCAMBIA3301-2MYC-EGFP vector to obtain the 35S:TaSIRH2-14 overexpression vector, which was then transformed into wheat Fielder using Agrobacterium-mediated transformation. T0 generation plants were obtained and planted in a greenhouse (16h light, 22℃ / 8h darkness, 15℃). T0 generation plants that tested positive by PCR were self-pollinated to obtain T1 generation seeds. T1 generation plants that tested positive by PCR were self-pollinated to obtain T2 generation seeds. Simultaneously, positive and negative seedlings were randomly selected and subjected to qRT-PCR detection according to the method described in Example 2 to determine the generation. TaSIRH2-14 The expression level of [the substance / molecule]. T2 generation plants that were positive by PCR were self-pollinated to obtain T3 generation seeds.

[0072] 2. Gene Editing TaSIRH2-14 wheat acquisition The intermediate vector pENTR:gRNA4 was linearized, and the digestion system (30.0 μL) consisted of: 3.0 μL 10x CutSmart Buffer, 20.0 μL pENTR:gRNA4, 2.0 μL BsaI, and ddH2O to a final volume of 30.0 μL. Primers were denatured and annealed, and 10 μL of 1×TE buffer, forward and reverse primers (…) were added to the PCR tube. TaSIRH2-14 -Target1-F、 TaSIRH2-14 -Target1-R、 TaSIRH2-14-Target2-F、 TaSIRH2-14 Mix 5 μL each of Target2-R and other reagents, boil in a water bath for 5 min, then allow to return to room temperature, and store at -20℃ for later use. Ligate the intermediate vector using a 10.0 μL ligation system consisting of: 7.0 μL annealed primers, 1.0 μL linearized pENTR:gRNA4, 1.0 μL 10×T4 Buffer, and 1.0 μL T4 DNA ligase. Ligate at 16℃ for 2 h. Transform E. coli DH5α into the ligation product, plate on LB agar containing ampicillin, and incubate overnight at 37℃. Select single clones for sequencing identification and extract positive recombinant plasmids. Ligate the second sgRNA, digest with BtgZ I, and repeat the above process to obtain the recombinant intermediate vector. The recombinant intermediate vector was constructed into the final vector Cas9-PCL4 using the LR reaction. The reaction system (5.0 μL) consisted of: 0.5 μL of the recombinant intermediate vector, 1.5 ng of the Cas9-PCL4 vector, 0.5 μL of LR Clonase™ II enzyme, and ddH2O to make up to 5.0 μL. The reaction system was incubated overnight at 25°C. The recombinant product was transformed into *E. coli* DH5α and plated on LB agar containing kanamycin. Clones were picked and sent for sequencing. Plasmids were extracted from correctly sequenced clones and transformed into *Agrobacterium* EHA 105. Subsequently, *Agrobacterium*-mediated transformation of wheat Fielder yielded T0 generation plants, which were planted in a greenhouse (16 h light / 8 h dark). After PCR identification, T0 generation plants were obtained as edited plants. After self-pollination, T1 generation seeds were obtained. After PCR identification, T1 generation plants were obtained as homozygous edited plants. After self-pollination, T2 generation seeds were obtained. Simultaneously, positive and negative seedlings were randomly selected and subjected to qRT-PCR detection according to the method in Example 2 to determine the results. TaSIRH2-14 The expression level was determined. Positive edited plants were obtained from the T2 generation plants after PCR identification, and T3 generation seeds were obtained after self-pollination.

[0073] TaSIRH2-14 -Target1-F:ACTCGCAATTGAAGAGAATTTCGG; TaSIRH2-14 -Target1-R:AAACCCGAAATTCTCTTCAATTGC; TaSIRH2-14 -Target2-F:ACTTGCTCATGAGAACCTGACAAA; TaSIRH2-14 -Target2-R:AAACTTTGTCAGGTTCTCATGAGC.

[0074] 3. In genetically modified wheat TaSIRH2-14 Quantitative analysis of genes Wild-type wheat and T3 generation were extracted respectively. TaSIRH2-14 Overexpression wheat lines (OE1~OE3) and T3 generation TaSIRH2- 14 RNA from wheat lines (ko1~ko3) was knocked out and reverse transcribed into cDNA. qRT-PCR was performed according to the method described in Example 2, and the quantitative analysis results are as follows: Figure 10 As shown.

[0075] Depend on Figure 10 It can be seen that, TaSIRH2-14 Overexpression of genes in wheat lines OE1-OE3 TaSIRH2-14 The expression level was significantly higher in the wild-type WT. TaSIRH2-14 Knockout genes in wheat lines ko1~ko3 TaSIRH2-14 The expression level of was significantly reduced.

[0076] 4. Phenotypic analysis of drought resistance in transgenic wheat Wild-type wheat, T3 generation TaSIRH2-14 Overexpression wheat lines (OE1~OE3) and T3 generation TaSIRH2-14 The knockout wheat lines (ko1~ko3) were transferred to pots containing 250g of nutrient soil. After 21 days of normal watering and growth, a drought treatment (stopping watering) was applied for 20-30 days. When the leaves showed severe wilting, the plants were re-watered. Three days after re-watering, the survival rate of each line was counted (plants showing normal growth were defined as surviving plants, and plants showing severe drought damage and unable to grow normally were defined as dead plants; the survival rate was the percentage of surviving plants in each line out of the total number of plants). The experiment was repeated three times, with at least 50 plants from each line in each replicate. The average value was used for statistical analysis. The results are as follows: Figure 11 As shown. In infrared thermal imaging measurements, seedlings approximately 3 weeks old, cultured in a greenhouse, were dehydrated for 10 days and then imaged using a FLIR A655sc infrared camera (TeledyneFLIR). The results are as follows. Figure 12 As shown. The blade temperature was measured using FLIR RESEARCHIR MAX professional software, and the results are as follows. Figure 13 As shown. Soil moisture content was measured on 3-week-old transgenic wheat and wild-type seedlings, and the results are as follows. Figure 14 As shown.

[0077] Depend on Figures 11-14 It can be seen that, TaSIRH2-14 Overexpression-treated wheat lines exhibited significantly higher drought resistance, survival rates, and soil water loss rates compared to the wild type. Furthermore, the leaf surface temperature of the overexpression-treated lines after drought was significantly higher than the wild type, indicating smaller stomatal opening and lower leaf transpiration rates, thus reducing water loss through transpiration under drought stress. The knockout lines showed the opposite effect. This suggests that overexpression... TaSIRH2-14Genes can significantly improve the drought resistance of wheat.

[0078] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. TaSIRH2-14 The application of genes in plant drought resistance is characterized by, The TaSIRH2-14 Genes positively regulate drought resistance in plants, and overexpression of the aforementioned genes... TaSIRH2-14 Genes enhance plant drought resistance; The TaSIRH2-14 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The plant in question is either Arabidopsis thaliana or wheat.

2. The application according to claim 1, characterized in that, Overexpression TaSIRH2-14 Genes enhance the water retention capacity of plants; Overexpression TaSIRH2-14 Genes reduce malondialdehyde (MDA) levels.

3. The application according to claim 1, characterized in that, Overexpression TaSIRH2-14 Genes increase proline content.

4. The application according to claim 1, characterized in that, Overexpression TaSIRH2-14 Genes enhance plants' antioxidant defense capabilities; The improvement of plant antioxidant defense capabilities refers to increasing the activity of antioxidant enzymes; The antioxidant enzyme is at least one of SOD, CAT, and POD.

5. The application according to claim 1, characterized in that, Overexpression TaSIRH2-14 Genes improve plant survival rates under drought stress; Overexpression TaSIRH2-14 Genes enhance the recovery and survival rate of drought-stressed plants after rehydration.

6. A method for breeding a drought-resistant wheat variety, characterized in that, Overexpression in wheat TaSIRH2-14 Gene; The TaSIRH2-14 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

7. The method for breeding drought-resistant wheat varieties according to claim 6, characterized in that, The method includes constructing an overexpression vector, transferring the overexpression vector into Agrobacterium, infecting wheat with Agrobacterium carrying the overexpression vector, and obtaining the drought-resistant wheat variety.

8. The method for breeding drought-resistant wheat varieties according to claim 7, characterized in that, The overexpression vector has a vector backbone of pCAMBIA3301.

Images