Use of idh2 inhibitors to enhance nk cell expansion and tumor cell killing

Abstract

The present application relates to the technical field of cell culture, and particularly relates to the use of IDH2 inhibitors in improving the expansion capacity of NK cells and the killing capacity of tumor cells. The present application uses small molecule compounds (IDH2 inhibitors) to inhibit the expression of IDH2, so that the expansion capacity of NK cells and the clearance capacity of tumor cells are both improved. The use of IDH2 inhibitors (such as Enasidenib) for pretreatment of iPSC-NK improves the cell function of iPSC-NK, thereby improving the curative effect of iPSC-NK cells in tumor immunotherapy and reducing the manufacturing cost.

Description

Technical Field

[0001] This invention relates to the field of cell culture technology, specifically to the use of IDH2 inhibitors in enhancing the proliferation capacity of NK cells and the killing capacity of tumor cells. Background Technology

[0002] In recent years, immunotherapy, especially CAR-T cells, has achieved great success in tumor immunotherapy. However, its high manufacturing cost is a huge burden for ordinary patients. NK cells, also known as natural killer cells, are an important type of innate immune cell in the human body. Allogeneic use is an important characteristic of NK cells. However, the use of NK cells in tumor immunotherapy still faces challenges. Limitations such as in vitro expansion capacity, toxicity to tumor cells, in vivo sustainability, and tumor clearance capacity all affect their ability to clear target cells.

[0003] During tumorigenesis, IDH2 mutations promote tumor development and progression through multiple mechanisms, including metabolic pathway disruption, competitive inhibition of α-KG-dependent enzymes, influence on DNA methylation, promotion of tumor stem cell characteristics, impaired myeloid differentiation, and paracrine induction of NF-κB activation in stromal cells. These mechanisms work together to lead to abnormal proliferation, survival, and metabolism of tumor cells, thereby promoting tumor development. Enasidenib (trade name Idhifa) is an oral, reversible, selective IDH2 mutant enzyme inhibitor that inhibits the activities of IDH2 R140Q and IDH2 R172K. Enasidenib indirectly inhibits tumor growth by reducing the level of 2-hydroxyglutaric acid (2-HG) and can be used to treat AML patients carrying IDH2 gene mutations.

[0004] Enasidenib is an inhibitor of wild-type and mutant IDH2 enzymes (Yen, K., Travins, J., Wang, F., David, MD, Artin, E., Straley, K., Padyana, A., Gross, S., DeLaBarre, B., Tobin, E., et al. (2017). AG-221, a first-in-class therapy targeting acute myeloid leukemia harboring oncogenic IDH2 mutations. Cancer Discov. 7,478–493.). IDH2Gene mutations can lead to various cancers in the human body, such as hematologic malignancies, gliomas, and glioblastomas (DiNardo, CD, Jabbour, E., Ravandi, F., Takahashi, K., Daver, N., Routbort, M., Patel, KP, Brandt, M., Pierce, S., Kantarjian, H., and Garcia-Manero, G. (2016). IDH1 and IDH2 mutations in myelodysplastic syndromes and role in disease progression. Leukemia 30, 980–984.). However, the impact of IDH2 inhibition on iPSC-NK and CAR-NK cell immunotherapy remains unknown. Summary of the Invention

[0005] This invention aims to at least partially address one of the technical problems in related technologies. To this end, one object of this invention is to provide the use of IDH2 inhibitors in the preparation of reagents / cell culture compositions that enhance NK cell proliferation capacity. This invention also provides a method for enhancing NK cell proliferation capacity and / or tumor-killing ability. Inhibiting IDH2 expression using small molecule compounds (IDH2 inhibitors) can enhance both the proliferation capacity of NK cells and their ability to clear tumor cells. Pretreatment of iPSC-NK cells with an IDH2 inhibitor (such as Enasidenib) improves iPSC-NK cell function, thereby enhancing the efficacy of iPSC-NK cells in tumor immunotherapy and reducing manufacturing costs.

[0006] Therefore, the first aspect of the present invention provides the use of IDH2 inhibitors in the preparation of reagent / cell culture compositions that enhance the amplification capacity of NK cells.

[0007] The inventors discovered that inhibiting IDH2 expression using small molecule compounds (IDH2 inhibitors) can enhance both the proliferation capacity and tumor cell clearance ability of NK cells. Pretreatment of iPSC-NK cells with IDH2 inhibitors (such as Enasidenib) improves iPSC-NK cell function, thereby enhancing the efficacy of iPSC-NK cells in tumor immunotherapy and reducing manufacturing costs.

[0008] A second aspect of the present invention provides a cell culture composition. According to embodiments of the present invention, the cell culture composition comprises: (1) NK cells; (2) An effective amount of IDH2 inhibitor, and (3) Cell culture medium, The NK cells include at least one of the following: peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells.

[0009] A third aspect of the present invention provides the use of an IDH2 inhibitor in the preparation of a medicament that enhances the ability of NK cells to clear tumor cells.

[0010] A fourth aspect of the present invention provides a method for obtaining NK cells with enhanced amplification capacity and / or enhanced tumor cell killing ability. According to embodiments of the present invention, the method includes: a. During the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, add an effective amount of IDH2 inhibitor to the culture system, and / or b. [The text appears to be incomplete and contains errors. A more accurate translation would require the full context.] IDH2 Gene knockout or knockdown, followed by further differentiation and culture of the cells to obtain NK cells.

[0011] The inventors discovered that adding an effective amount of IDH2 inhibitor to the culture system, or knocking out or reducing the concentration of IDH2 in iPSC-NK cells during the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, can help. IDH2 The gene reduces the level of isocitrate dehydrogenase 2 (IDH2), enabling NK cells to exhibit stronger in vitro expansion capacity and cytotoxicity compared to control cells. Based on this, the inventors can obtain NK cells with enhanced expansion capacity and / or enhanced killing ability against tumor cells.

[0012] A fifth aspect of the present invention provides a method for enhancing the proliferative capacity and / or tumor-killing capacity of NK cells. According to an embodiment of the present invention, the method includes: a. During the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, add an effective amount of IDH2 inhibitor to the culture system, and / or b. Knock out or knock down the IDH2 gene in iPSCs and then further differentiate and culture the cells.

[0013] The inventors discovered that adding an effective amount of IDH2 inhibitor to the culture system, or knocking out or reducing the concentration of IDH2 in iPSC-NK cells during the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, can help. IDH2The gene reduces the level of isocitrate dehydrogenase 2 (IDH2), which enables NK cells to have stronger in vitro expansion capacity and cytotoxicity compared to control cells. Based on this, the expansion capacity of iPSC-NK cells and / or their ability to kill tumor cells can be enhanced.

[0014] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0015] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which: Figure 1 The growth curves of NK cells treated with 5 μM Enasidenib are shown. Figure 2 The amplification fold of iPSC-NK after treatment with 5 μM Enasidenib is shown; Figure 3 The toxic activity of iPSC-NK on K562 Luci was demonstrated after treatment with 5 μM Enasidenib; Figure 4 The cytotoxicity of iPSC-NK cells to K562 Luci cells after treatment with different concentrations of Enasidenib was shown, **** P<0.0001 vs. Vehicle; Figure 5 The cytotoxicity of CBNK against K562 Luci after Enasidenib treatment was shown, * P = 0.0401 vs. Vehicle; Figure 6 The results show the expression of CD56 in cells added at the end of the differentiation phase (Day 22), Day 18, Day 19, and Day 20 after treatment with different concentrations of Enasidenib. Figure 7 The results showed the expression of CD56 in cells added on Day 18, Day 19, and Day 20 after different concentrations of Enasidenib continued expansion for 6 days at the end of the differentiation phase (Day 22) (Day 22+6); Figure 8 The results show the Ki67 expression levels in cells added at the end of the differentiation phase (Day 22), Day 18, Day 19, and Day 20 after treatment with different concentrations of Enasidenib. Figure 9The results show the expression of Caspase 3 / 7 in cells added at the end of the differentiation phase (Day 22), Day 18, Day 19, and Day 20 after treatment with different concentrations of Enasidenib. Figure 10 The study showed the toxicity of different concentrations of Enasidenib to K562 cells that continued to expand for 6 days after the end of the differentiation phase (Day 22) (Day 22+6), and the cells added on Day 18, Day 19, and Day 20. Figure 11 The plasmid map of the IDH2 KO obtained during construction is shown; Figure 12 Genotyping results of iPSCs obtained from the constructed IDH2 KO are shown. Figure 13 The expansion curves of the iNK cells obtained from the construction of IDH2 KO are shown; Figure 14 Apoptosis of WT iNK and IDH2 KO iNK was shown by Annexin-V and PI. Figure 15 The cell phenotypes of expanded WT iNK and IDH2 KO iNK are shown; Figure 16 The toxicity of WT iNK and IDH2 KO iNK to K562 tumor cells was demonstrated; Figure 17 The ATP production of WT iNK and IDH2 KO iNK is shown. Detailed Implementation

[0016] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0017] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0018] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0019] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0020] In this document, the terms “comprising” or “including” are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0021] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0022] According to a specific embodiment of the present invention, the present invention provides the use of IDH2 inhibitors in the preparation of reagent / cell culture compositions that enhance the amplification capacity of NK cells.

[0023] In this document, "cell culture composition" refers to a culture system prepared in specific proportions from multiple components during cell culture, used to maintain cell growth, proliferation, and differentiation in vitro. The IDH2 inhibitor can be used as a component of the cell culture composition to enhance NK cell expansion or differentiation culture.

[0024] According to a specific embodiment of the present invention, the IDH2 inhibitor includes, but is not limited to, Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032, etc., and may also be other IDH2 inhibitors known in the art, all of which are covered within the scope of protection of the present invention.

[0025] According to a preferred embodiment of the present invention, the IDH2 inhibitor is Enasidenib.

[0026] According to a specific embodiment of the present invention, the working concentration of Enasidenib is 0.01 μM-50 μM. For example, the working concentration of Enasidenib can be 0.01 μM, 0.05 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, 10 μM, 15 μM, 20 μM, 25 μM, 30 μM, 35 μM, 40 μM, 45 μM, 50 μM, etc. According to a preferred embodiment of the present invention, the working concentration of Enasidenib is 0.5-5 μM.

[0027] In this article, "working concentration" refers to the actual concentration of a component in a cell culture or experimental system at which it ultimately exerts its effect.

[0028] According to a specific embodiment of the present invention, the NK cells include at least one selected from peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells.

[0029] According to a preferred embodiment of the present invention, the NK cells are iPSC-NK cells or iPSC-CAR-NK cells.

[0030] According to a specific embodiment of the present invention, the present invention provides a cell culture composition comprising: (1) NK cells; (2) An effective amount of IDH2 inhibitor, and (3) Cell culture medium, The NK cells include at least one of the following: peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells.

[0031] It should be noted that the cell culture medium can be any commercially available culture medium suitable for NK cell expansion or a basal culture medium requiring the addition of other components, such as commercially available culture media X-VIVO 15, X-VIVO 10, KBM 501 / KBM 502, PRIME-XV NK Cell CDM, etc., or a basal culture medium RPMI-1640, IMDM, or DMEM / F12. These basal culture media can be supplemented with cytokines such as IL-2, IL-15, IL-21, or IL-12 to further enhance expansion efficiency and cytotoxic activity. These commercially available culture media or basal culture media with added components are all covered within the scope of protection of the cell culture media of this invention.

[0032] According to a specific embodiment of the present invention, the IDH2 inhibitor includes, but is not limited to, Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032, etc., and may also be other IDH2 inhibitors known in the art, all of which are covered within the scope of protection of the present invention.

[0033] According to a preferred embodiment of the present invention, the IDH2 inhibitor is Enasidenib.

[0034] According to a specific embodiment of the present invention, the working concentration of Enasidenib is 0.01 μM-50 μM, preferably 0.5-5 μM.

[0035] According to a specific embodiment of the present invention, the present invention provides the use of IDH2 inhibitors in the preparation of medicaments that enhance the ability of NK cells to clear tumor cells.

[0036] In this article, "enhancing the ability of NK cells to clear tumor cells" refers to improving the efficiency of natural killer (NK) cells in recognizing, activating, and killing tumor cells through biological, pharmacological, or engineering methods.

[0037] According to a specific embodiment of the present invention, the IDH2 inhibitor includes, but is not limited to, Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032, etc., and may also be other IDH2 inhibitors known in the art, all of which are covered within the scope of protection of the present invention.

[0038] According to a specific embodiment of the present invention, the IDH2 inhibitor is Enasidenib.

[0039] According to one specific embodiment of the present invention, the working concentration of Enasidenib is 0.01 μM-50 μM. According to a preferred embodiment of the present invention, the working concentration of Enasidenib is 0.5-5 μM.

[0040] According to a specific embodiment of the present invention, the NK cells include at least one selected from peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells.

[0041] According to a specific embodiment of the present invention, the tumor cells are derived from hematologic malignancies or solid tumors. The hematologic malignancies include, but are not limited to, chronic myeloid leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, non-Hodgkin's lymphoma, and multiple myeloma. The solid tumors include, but are not limited to, lung cancer, liver cancer, gastric cancer, colorectal cancer, breast cancer, neuroblastoma, glioblastoma, pancreatic cancer, ovarian cancer, and prostate cancer. The tumor cells can also be any other type of tumor cells that can be killed by NK cells, all of which are covered within the scope of protection of this invention.

[0042] According to a specific embodiment of the present invention, the present invention provides a method for obtaining NK cells with enhanced amplification capacity and / or enhanced tumor cell killing ability, comprising: a. During the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, add an effective amount of IDH2 inhibitor to the culture system, and / or b. [The text appears to be incomplete and contains errors. A more accurate translation would require the full context.] IDH2 Gene knockout or knockdown, followed by further differentiation and culture of the cells to obtain NK cells.

[0043] The inventors discovered that by using small molecule compounds to inhibit IDH2 and adding IDH2 inhibitors (such as Enasidenib) during NK cell expansion culture, the cytotoxicity of NK cells against tumor cells and the expansion capacity of NK cells can be enhanced; gene editing technology can be used to knock out or knock down IDH2. IDH2 Genes, either by direct knockout or knockdown, or by knockout or knockdown at the iPSC stage. IDH2 Genes enable the differentiated NK cells to acquire enhanced killing ability against tumor cells and increased NK cell proliferation capacity.

[0044] In this article, "the terminal stage of iPSC differentiation into NK cells" refers to the final stage of the differentiation process in the in vitro culture of induced pluripotent stem cells (iPSCs) directed to differentiate into natural killer (NK) cells, at which point the cells have essentially acquired the phenotypic characteristics and functional activity of mature NK cells. For example, this could be 2-5 days before complete differentiation and maturation.

[0045] In this article, "effective amount" refers to the amount of substance that can produce the expected biological effect or therapeutic effect in a specific application scenario.

[0046] According to a specific embodiment of the present invention, the IDH2 inhibitor includes, but is not limited to, Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032, etc., and may also be other IDH2 inhibitors known in the art, all of which are covered within the scope of protection of the present invention.

[0047] According to a specific embodiment of the present invention, the IDH2 inhibitor is Enasidenib.

[0048] According to one specific embodiment of the present invention, the working concentration of Enasidenib is 0.01 μM-50 μM. According to a preferred embodiment of the present invention, the working concentration of Enasidenib is 0.5-5 μM.

[0049] According to a specific embodiment of the present invention, the source of the tumor cells is as described above.

[0050] According to a specific embodiment of the present invention, the NK cells are CAR-NK cells obtained after CAR modification. According to a specific embodiment of the present invention, gene editing technology is used to knock out the iPSCs. IDH2 Gene.

[0051] According to a specific embodiment of the present invention, RNA interference technology is used to knock down the iPSCs. IDH2 Gene.

[0052] According to a specific embodiment of the present invention, the present invention provides a method for enhancing the NK cell proliferation capacity and / or tumor killing capacity, the method comprising: a. During the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, add an effective amount of IDH2 inhibitor to the culture system, and / or b. Knock out or knock down the IDH2 gene in iPSCs and then further differentiate and culture the cells.

[0053] According to a specific embodiment of the present invention, the IDH2 inhibitor includes, but is not limited to, Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032, etc., and may also be other IDH2 inhibitors known in the art, all of which are covered within the scope of protection of the present invention.

[0054] According to a specific embodiment of the present invention, the IDH2 inhibitor is Enasidenib.

[0055] According to one specific embodiment of the present invention, the working concentration of Enasidenib is 0.01 μM-50 μM. According to a preferred embodiment of the present invention, the working concentration of Enasidenib is 0.5-5 μM.

[0056] According to a specific embodiment of the present invention, the hematologic malignancies include, but are not limited to, chronic myeloid leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, non-Hodgkin's lymphoma, multiple myeloma, etc.; the solid tumors include, but are not limited to, lung cancer, liver cancer, gastric cancer, colorectal cancer, breast cancer, neuroblastoma, glioblastoma, pancreatic cancer, ovarian cancer, prostate cancer, etc.

[0057] According to a specific embodiment of the present invention, the NK cells are CAR-NK cells obtained by CAR modification.

[0058] The inventors discovered that by using the iPSC in IDH2 Gene knockout or knockdown can enhance the cell proliferation and tumor-killing capabilities of iPSC-NK cells, as well as iPSC-CAR-NK cells.

[0059] It should be noted that any known method of knocking out the iPSC IDH2 All gene-related methods are covered within the scope of protection of this invention, including but not limited to gene editing technologies (CRISPR / Cas9 system), TALEN, ZFN, and base editors (BE).

[0060] According to a specific embodiment of the present invention, gene editing technology is used to knock out the iPSC. IDH2 Genes. Specifically, for example, frameshift mutations can be generated in the IDH2 coding region via the CRISPR / Cas9 system.

[0061] It should be noted that any known method of knocking down the iPSC in this art... IDH2Genetic methods are all covered within the scope of protection of this invention, including but not limited to siRNA (small interfering RNA), shRNA (short hairpin RNA), miRNA mimics / inhibitors, or ASO (antisense oligonucleotides).

[0062] According to a specific embodiment of the present invention, RNA interference technology is used to knock down the iPSCs. IDH2 Gene.

[0063] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0064] Example 1. Differentiation and amplification of iPSC-NK or iPSC-CAR-NK The method for obtaining iPSC-NK cells refers to Example 1 of patent CN118667760A. In brief, iPSCs are first differentiated into hematopoietic stem / progenitor cells (HSPCs). Then, the NK cell differentiation medium is changed to further differentiate the HSPCs into NK cells. This process generally lasts 3-5 weeks. During differentiation and expansion, the expression of iNK markers CD45 and CD56 gradually increases, reaching a purity of over 99% after more than 40 days. The iNK cell differentiation medium includes basal medium and cytokines. The basal medium is DMEM / F12 + 2% serum substitute-3 (Sigma-Aldrich) + 0.2%-1% human serum albumin. Cytokines used include IL-3 (used in the first week), 20 ng / mL IL-7, 10 ng / mL IL-15, 10 ng / mL LFLT3L, and 50 ng / mL LSCF.

[0065] iNK cell expansion was performed using an expansion medium formulated as follows: GTT-551 H3 medium supplemented with 5% FBS, 1000 U of IL-2, and 10 U of IL-15.

[0066] Example 2. IDH2 inhibitor treatment of NK cells The iPSC-NK cells obtained in Example 1 were centrifuged, the supernatant was removed, and the prepared iNK cell expansion medium was added at a cell density of 1E6 / mL. Then, 5 μM of the IDH2 inhibitor Enasidenib was added to the experimental group (ENA), and an equal volume of DMSO was added to the control group (Vehicle). After thorough mixing, the cells were incubated at 37°C with 5% CO2. On day 3, an equal volume of medium was added to replenish the medium. On day 6, the cells were remixed and counted. Medium was then added according to the cell density to adjust the cell density to 1E6 / mL, and the cells were then incubated for further culture. Cell counting and medium replenishment were performed every 2-3 days until day 21. Cytotoxic activity was assessed on day 17 of culture.

[0067] The method for determining the cytotoxic performance of NK cells against tumor cells can be found in Example 8 of CN118667760A. Briefly, taking K562-Luci tumor cells (target cells) as an example, first, a target cell suspension (target cell viability not less than 90%) is prepared. After counting, the cells are seeded into the wells of a 96-well plate according to the specified effector-to-target ratio (e.g., 10:1, 5:1, 2:1, 1:1). Each effector-to-target ratio corresponds to at least three replicates per effector cell. The culture medium in each well is adjusted to 100 μL. Then, the required number of iNK cells or control NK cells are added according to the specified effector-to-target ratio. The 96-well plate is placed in a 37°C, 5% CO2 incubator and incubated for the specified time (e.g., 4h or 24h). A fluorescein substrate is taken and diluted 100-fold with cell culture medium. 50 μL of fluorescein substrate dilution is added to each well, and the reaction is carried out at room temperature in the dark for 10 minutes. The microplate reader is set to LμM light source and 1000ms time, and the readings are taken. Kill efficiency % = (control group - kill group) / cell control group * 100.

[0068] according to Figure 1 amplification curves of iPSC-NK and Figure 2 The expansion rate results of iPSC-NK cells showed that iPSC-NK cells treated with 5 μM Enasidenib were superior to untreated cells in in vitro expansion, and the cytotoxicity of Enasidenib-treated iPSC-NK cells against K562 Luci was also stronger than that of untreated NK cells. Figure 3 ).

[0069] To determine the optimal concentration of Enasidenib pretreatment, the inventors set different concentrations of Enasidenib treatment (0.5 μM, 5 μM, and 10 μM) and tested the cell function of iPSC-NK after Enasidenib treatment according to the iPSC-NK culture procedure described above.

[0070] The results are as follows Figure 4 As shown, iPSC-NK cells treated with 0.5 μM–5 μM Enasidenib exhibited stronger cytotoxicity against K562 Luci than untreated iPSC-NK cells (see [link to study]). Figure 4 The 0.5 μM treatment resulted in slightly higher iNK levels than the 5 μM treatment, but there was no significant difference between the two groups.

[0071] Example 3: Effects of IDH2 inhibitors on NK cells from different sources To confirm whether Enasidenib treatment is effective for NK cells from multiple sources, the inventors treated CBNK (umbilical cord-derived NK cells) with a 5 μM concentration of Enasidenib, using the same method as in Example 2.

[0072] Figure 5 The study demonstrated the cytotoxicity of CBNK cells to K562 Luci cells after treatment with 5 μM Enasidenib, indicating that 5 μM Enasidenib also has a certain cytotoxic effect on CBNK cells.

[0073] To investigate the effects of Enasidenib on immature iNK cells, the inventors conducted the following experiments: To simultaneously determine the timing and dosage of enasidenib, 0.05 μM, 0.5 μM, and 5 μM were added on days 18, 19, and 20 of iNK differentiation, respectively, and the iNK amplification medium was replaced on day 22 of iNK differentiation. Subsequent amplification and detection methods were the same as in Examples 1 and 2, but cytotoxicity and functional phenotypes were detected on day 6 of amplification. The following... Figure 6-10 The results obtained using flow cytometry are shown.

[0074] according to Figure 6 The results showed that CD56 expression was measured at the end of the differentiation period (Day 22) after treatment with different concentrations of Enasidenib. It was found that the three concentrations (0.05 μM, 0.5 μM and 5 μM) of treatment on Day 19 all increased CD56 expression to some extent.

[0075] Will Figure 6 The iNK cells shown continued to amplify for 6 days, according to... Figure 7The results showed that CD56 expression was measured at Day 22+6, and the CD56 expression in iNK cells treated with enasidenib on Day 18, Day 19, and Day 20 was significantly higher than that in the Vehicle cell group. The three concentrations added on Day 18 and the 5 μM added on Day 20 had a weak effect on CD56 expression; the three concentrations added on Day 19 had a greater impact on CD56 expression, with the 5 μM enasidenib showing the largest increase.

[0076] Figure 8 The results showed that after Enasidenib treatment, Ki67 expression was generally increased in cell groups treated with different concentrations of Enasidenib at the end of the differentiation phase (Day 22), Day 18, Day 19, and Day 20. This indicates that iNK cells have a stronger amplification capacity as they are about to enter the amplification phase. The group treated with 0.05 μM Enasidenib on Day 20 showed the highest increase in iNK Ki67 expression.

[0077] Figure 9 The results showed that after Enasidenib treatment, Caspase 3 / 7 expression was reduced in all cell groups with added concentrations on Days 18, 19, and 20 at the end of the differentiation phase (Day 22), indicating that iNK cells were more active as they were about to enter the expansion phase. The iNK Caspase 3 / 7 expression was relatively lowest in the 0.05 μM group added on Day 20.

[0078] Figure 10 The results showed that after Enasidenib treatment, on day 6 of the expansion phase after the differentiation phase, the three concentrations on Day 19 and the 5 μM cell group added on Day 20 all significantly enhanced K562 cytotoxicity, with the 5 μM group added on Day 19 showing the highest enhancement of iNK cytotoxicity.

[0079] Example 4: Effects of knocking out the IDH2 gene in iPSC-NK cells on iPSC-NK cells The following candidate sgRNA sequences were designed for human IDH2: Guide1: ACGCCTAGTCCCTGGCTGGAC (SEQ ID NO: 1) Guide2: GAACTATCCGGAACATCCTGG (SEQ ID NO: 2) Construct a CRISPR / Cas9 plasmid that carries an sgRNA targeting IDH2 and the Cas9 protein (see plasmid map). Figure 11The plasmid was transfected into an iPSC derived from a healthy individual using electroporation. After transfection, the cells were cultured in human iPSC medium, with 10 μM Y27632 added for the first 24 hours to promote cell survival. Once the cells recovered, they were digested and seeded as single cells to obtain a single-cell clone. PCR and first-generation sequencing confirmed the presence of a frameshift mutation in the IDH2 coding region. Figure 12 ).

[0080] Furthermore, iPSCs carrying the IDH2 frameshift mutation were differentiated into NK cells (iNK acquisition method refers to Example 1 of patent CN118667760A). Figure 13 The results of the amplification experiments showed that the iNK amplification capacity of IDH2 KO was superior to that of iNK without gene knockout, and the proportion of apoptosis was lower than that of WT iNK. Figure 14 ).

[0081] Figure 14 The process for detecting apoptosis in cells is as follows: IDH2 KO iPSC-NK and non-genetically modified iPSC-NK cells were collected, and after removing the supernatant, they were washed once with D-PBS. The cells were then divided into two groups: one group was supplemented with Annexin-V and PI antibody, while the other group served as a control without flow cytometry antibody. The cells were incubated in the dark for 15-30 minutes, after which excess staining solution was washed away with D-PBS, and the cells were resuspended in 100 μL of D-PBS before flow cytometry analysis.

[0082] Based on the number of biomarkers detected by flow cytometry, IDH2 KO iPSC-NK and non-genetically modified iPSC-NK cells were extracted at a rate of 0.5–1E6 cells / biomarker. After removing the supernatant, the cells were washed once with D-PBS. The cells were then divided into two groups, with the flow cytometry antibody and the corresponding isotype added to one group, respectively. The cells were incubated in the dark for 15–30 minutes, followed by washing away excess staining solution with D-PBS. The cells were then resuspended in 100 μL of D-PBS before flow cytometry analysis. Results are as follows: Figure 15 As shown, the iNK phenotype of IDH2 KO is not significantly different from that of normal iNK, and its expression on HLA-DR and CD62L is slightly higher than that of WT iNK.

[0083] For the detection of IDH2 KO iNK's killing effect on tumor cells, please refer to Example 2. Briefly, based on the effector-to-target ratio, the corresponding IDH2 KO iNK and non-genetically modified iNK were seeded with the corresponding K562 cells in 96-well plates for co-incubation. After 4 hours, the cells were removed, substrate enzymes were added, and the reaction was allowed to proceed for 10 minutes before analysis. Killing efficiency % = (control group - killing group) / cell control group * 100. Results are shown below. Figure 16This indicates that iNK cells after IDH2 KO have a significantly enhanced killing activity against K562 tumor cells.

[0084] IDH2 KO iPSC-NK and non-genetically modified iPSC-NK cells were obtained, and after removing the supernatant, they were washed once with D-PBS. The cell density was resuspended to 5E5 / mL, and 100 μL was added to each well of a 96-well plate. The cells were then analyzed using the CellCounting-Lite® 2.0 LμMinescent Cell Viability Assay. In short, cell lysis buffer was added to lyse the cells, releasing ATP, which reacted with luciferin and luciferase in the reagents, emitting a "glow" cell signal. The results were then detected using the chemiluminescence detection system in a microplate reader. The results are as follows: Figure 17 This indicates that the ATP content of iNK after IDH2 KO is also higher than that of WT iNK.

[0085] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," "some implementations," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0086] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. Use of IDH2 inhibitors in the preparation of reagent / cell culture compositions that enhance NK cell proliferation capacity.

2. The use according to claim 1, characterized in that, The IDH2 inhibitors include at least one of Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032; Optionally, the IDH2 inhibitor is Enasidenib; Optionally, the working concentration of Enasidenib is 0.01 μM-50 μM, preferably 0.5-5 μM.

3. The use according to claim 1, characterized in that, The NK cells include at least one of the following: peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells.

4. A cell culture composition, characterized in that, include: (1) NK cells; (2) An effective amount of IDH2 inhibitor, and (3) Cell culture medium, The NK cells include at least one of the following: peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells.

5. The cell culture composition according to claim 4, characterized in that, The IDH2 inhibitors include at least one of Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032; Optionally, the IDH2 inhibitor is Enasidenib; Optionally, the working concentration of Enasidenib is 0.01 μM-50 μM, preferably 0.5-5 μM.

6. Use of IDH2 inhibitors in the preparation of drugs that enhance the ability of NK cells to clear tumor cells.

7. The use according to claim 6, characterized in that, The IDH2 inhibitors include at least one of Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032; Optionally, the IDH2 inhibitor is Enasidenib; Optionally, the working concentration of the enasidenib is 0.01 μM-50 μM, preferably 0.5-5 μM; Optionally, the NK cells include at least one of the following: peripheral blood NK cells, umbilical cord blood NK cells, CAR-NK cells, iPSC-NK cells, or iPSC-CAR-NK cells. Optionally, the tumor cells are derived from hematologic malignancies or solid tumors, wherein the hematologic malignancies include chronic myeloid leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, non-Hodgkin's lymphoma, and multiple myeloma; and the solid tumors include lung cancer, liver cancer, gastric cancer, colorectal cancer, breast cancer, neuroblastoma, glioblastoma, pancreatic cancer, ovarian cancer, and prostate cancer.

8. A method for obtaining NK cells with enhanced amplification capacity and / or enhanced tumor cell killing ability, characterized in that, include: a. During the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, add an effective amount of IDH2 inhibitor to the culture system, and / or b. [The text appears to be incomplete and contains errors. A more accurate translation would require the full context.] IDH2 Gene knockout or knockdown is performed, and the cells are further differentiated and cultured to obtain NK cells.

9. The method according to claim 8, characterized in that, The IDH2 inhibitors include at least one of Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032; Optionally, the IDH2 inhibitor is Enasidenib; Optionally, the working concentration of the enasidenib is 0.01 μM-50 μM, preferably 0.5-5 μM; Optionally, the tumor cells are derived from hematologic malignancies or solid tumors, wherein the hematologic malignancies include chronic myeloid leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, non-Hodgkin's lymphoma, and multiple myeloma; and the solid tumors include lung cancer, liver cancer, gastric cancer, colorectal cancer, breast cancer, neuroblastoma, glioblastoma, pancreatic cancer, ovarian cancer, and prostate cancer. Optionally, the NK cells are CAR-NK cells obtained by CAR modification; Optionally, gene editing technology can be used to knock out the iPSCs. IDH2 Gene; Optionally, RNA interference technology is used to knock down the iPSCs. IDH2 Gene.

10. A method for enhancing the proliferative capacity and / or tumor-killing capacity of NK cells, characterized in that, The method includes: a. During the terminal phase of iPSC differentiation into NK cells and / or during the in vitro expansion of iPSC-NK cells, add an effective amount of IDH2 inhibitor to the culture system, and / or b. Knock out or knock down the IDH2 gene in iPSCs and then further differentiate and culture the cells.

11. The method according to claim 10, characterized in that, The IDH2 inhibitors include at least one of Enasidenib, Vorasidenib, HMPL-306, TQB-3455, SH1573, AGI-6780, GSK864, Ranosidenib, IDH1 / 2-IN-1, TQ05310, AGI-5198, and BAY-1436032; Optionally, the IDH2 inhibitor is Enasidenib; Optionally, the working concentration of the enasidenib is 0.01 μM-50 μM, preferably 0.5-5 μM; Optionally, the tumor is a hematologic malignancy or a solid tumor. The hematologic malignancy includes chronic myeloid leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, non-Hodgkin's lymphoma, and multiple myeloma. The solid tumor includes lung cancer, liver cancer, gastric cancer, colorectal cancer, breast cancer, neuroblastoma, glioblastoma, pancreatic cancer, ovarian cancer, and prostate cancer. Optionally, the NK cells are CAR-NK cells obtained by CAR modification; Optionally, gene editing technology can be used to knock out the iPSCs. IDH2 Gene; Optionally, RNA interference technology is used to knock down the iPSCs. IDH2 Gene.

Images