Engineering pseudomonas and methods of use thereof in 2,5-furan dicarboxylic acid biosynthesis

Abstract

The application belongs to the technical field of 2,5-furan dicarboxylic acid (FDCA) biosynthesis, and particularly relates to an engineered Pseudomonas and application and a method thereof in 2,5-furan dicarboxylic acid biosynthesis. The engineered Pseudomonas takes MB04S-HMF1 as a starting strain, and 7 copies of a glycerolaldehyde-3-phosphate dehydrogenase gene expression cassette and an aldehyde dehydrogenase gene expression cassette are inserted into a 16s rDNA site of a genome of the starting strain, the glycerolaldehyde-3-phosphate dehydrogenase gene expression cassette comprises P MP00 a promoter, a gapA gene and a gapB gene, and the aldehyde dehydrogenase gene expression cassette comprises P MP00 a promoter and an aldehyde dehydrogenase gene. The engineered strain has good growth performance, extremely high substrate conversion rate and space-time yield, completely eliminates byproduct accumulation, has excellent operation stability and multi-batch recycling ability in continuous multiple recycling, and has extremely high genetic and phenotypic stability.

Description

Technical Field

[0001] This invention relates to the field of 2,5-furandicarboxylic acid biosynthesis technology, and particularly to an engineered Pseudomonas bacterium and its application and method in the biosynthesis of 2,5-furandicarboxylic acid. Background Technology

[0002] 2,5-Furandicarboxylic acid (FDCA), as a typical biomass platform compound, is widely used in the production of various bio-based polymers. Due to the similarity in structure and chemical properties between FDCA and petrochemical-based terephthalic acid (PTA), FDCA is considered a promising candidate to replace PTA in the synthesis of high-performance bio-based polyester products, such as polyethylene 2,5-furandicarboxylic acid (PEF). This is of great significance for overcoming the limitations of petroleum-based materials and achieving the upgrading of the green chemical industry. PEF possesses excellent O2, CO2, and H2O barrier properties, showing great potential in packaging materials for bottles and films, and bio-based fibers. However, the industrialization technology of FDCA monomer is limited, resulting in slow progress in industrialization research and development both domestically and internationally. Therefore, the engineering and industrialization technology of the core monomer FDCA is currently one of the focal points of research and industrialization in the field of bio-based new materials both domestically and internationally.

[0003] Currently, the synthetic route for FDCA is based on the oxidation of the biomass derivative 5-hydroxymethylfurfural (HMF). Existing HMF conversion routes mainly include chemical catalysis and biocatalysis. Although chemical catalysis has been studied for a longer period, it heavily relies on precious metal catalysts (such as Pt, Au, Pd, etc.) and often requires harsh conditions such as high temperature, high pressure, and strong alkali, resulting in bottlenecks for industrial scale-up, including high catalyst costs, severe equipment corrosion, and high risks of heavy metal pollution. Compared to the stringent conditions of chemical catalysis, biocatalysis offers milder reaction conditions (room temperature and pressure) and is more environmentally friendly. However, traditional purified enzyme catalysis systems suffer from poor stability of free enzymes and are highly dependent on expensive external cofactors (such as FAD, NADPH, etc.), limiting their large-scale application. In contrast, whole-cell biocatalysis systems utilize living microbial cells as biocatalysts, enabling the conversion of the matrix into the target product within the cell. It integrates microenvironmental barrier protection, cofactor self-regeneration, and multi-enzyme cascade catalysis mechanisms, with an estimated cost of only one-tenth that of purified enzyme systems, making it a green synthetic route with great industrial potential.

[0004] Some progress has been made in the synthesis of high-value-added FDCA using whole-cell biocatalysis. Some recombinant strains have enhanced HMF oxidation capacity by heterologously expressing genes involved in the HMF oxidase pathway, achieving good yields and productivity. However, most of these methods have drawbacks. For example, in the complex endogenous metabolic network of conventional chassis cells, incomplete catalysis occurs, leading to carbon loss and byproduct accumulation, resulting in reduced substrate conversion and low FDCA space-time yield. This also results in poor product specificity and increased purification costs. Furthermore, existing conventional whole-cell catalytic systems exhibit poor tolerance to high concentrations of HMF substrates and unstable genetic phenotypes, leading to rapid catalytic decay over long periods of operation and a lack of industrial potential for multiple recycling cycles. This, to some extent, increases the overall catalyst preparation cost for industrial scale-up applications. Summary of the Invention

[0005] To address the problems of low catalytic efficiency, incomplete product conversion, and poor long-term operational stability of existing whole-cell catalysts, this invention, through genetic modification, yields a novel engineered Pseudomonas strain suitable for FDCA biosynthesis. The novel engineered strain provided by this invention exhibits excellent growth performance, extremely high substrate conversion and space-time yield, completely eliminates byproduct accumulation, and demonstrates excellent operational stability and batch-to-batch recycling capability for continuous reuse, exhibiting extremely high genetic and phenotypic stability. This invention further provides its application method in the biosynthesis of 2,5-furandicarboxylic acid and related synthetic methods. This invention is specifically achieved through the following technical solutions:

[0006] The first aspect of this invention provides an engineered Pseudomonas bacterium for the biosynthesis of 2,5-furandicarboxylic acid. The engineered Pseudomonas bacterium is a primary engineered strain MB04S-HMF1, which integrates a single copy of an HMF oxidase gene expression cassette at its 16S rDNA site. Seven copies of a glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and an aldehyde dehydrogenase gene expression cassette are inserted into the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette from upstream to downstream. MP00 The promoter, gapA gene, and gapB gene, the aldehyde dehydrogenase gene expression cassette including P from upstream to downstream MP00 Promoter and aldehyde dehydrogenase gene.

[0007] Furthermore, the P MP00 The nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the gapA gene is shown in SEQ ID NO.6, the nucleotide sequence of the gapB gene is shown in SEQ ID NO.7, and the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID NO.8.

[0008] Furthermore, the gapA gene is located upstream of the gapB gene, and the two are linked by the ACCGCGAGACCAAGAAGGAG sequence.

[0009] Furthermore, the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette is located upstream of the aldehyde dehydrogenase gene expression cassette, and the nucleotide sequence of the fusion gene formed by the connection of the two is shown in SEQ ID NO.9.

[0010] A second aspect of the present invention provides a method for preparing engineered Pseudomonas bacteria for the biosynthesis of 2,5-furandicarboxylic acid as described above, comprising the following steps:

[0011] S1. By using homologous recombination technology, the MYG11_19675 and MYG11_24170 genes on the genome of the primary engineered bacterium MB04S-HMF1 were knocked out to obtain the double knockout engineered bacterium MB04S-HMF1.

[0012] S2. The effector vector carrying the Cascade protein complex and transposase, along with the donor vector carrying the target gene and crRNA targeting the 16S rDNA site, are co-transformed into the double-knockout engineered bacterium MB04S-HMF1. Seven copies of the target gene are inserted into its genome using a CRISPR-associated transposase system to obtain an engineered Pseudomonas bacterium suitable for the biosynthesis of 2,5-furandicarboxylic acid. The target gene includes a glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and an aldehyde dehydrogenase gene expression cassette. The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette includes P from upstream to downstream. MP00 The promoter, gapA gene, and gapB gene, the aldehyde dehydrogenase gene expression cassette including P from upstream to downstream MP00 Promoter and aldehyde dehydrogenase gene.

[0013] Further, in step S1, the knockout method for the MYG11_19675 and MYG11_24170 genes includes the following steps:

[0014] The sequences of the upstream homologous arm 19675US and the downstream homologous arm 19675DS of the MYG11_19675 gene were obtained. The sequences of 19675US and 19675DS were ligated into the gene knockout vector to construct the MYG11_19675 gene knockout vector. The nucleotide sequences of 19675US and 19675DS are shown in SEQ ID NO.13-14, respectively.

[0015] The sequences of the upstream homologous arm 24170US and the downstream homologous arm 24170DS of the MYG11_24170 gene were obtained. The sequences of 24170US and 24170DS were ligated into the gene knockout vector to construct the MYG11_24170 gene knockout vector. The nucleotide sequences of 24170US and 24170DS are shown in SEQ ID NO.15-16, respectively.

[0016] The MYG11_19675 gene knockout vector and the MYG11_24170 gene knockout vector were transformed into the primary engineered strain MB04S-HMF1, and gene knockout was performed by homologous recombination. The resulting strain was MB04S-HMF1, which was a double knockout engineered strain of MYG11_19675 and MYG11_24170 genes.

[0017] Furthermore, the gene knockout vector is a pDS3.0 plasmid.

[0018] Furthermore, in step S2, the method for constructing the donor vector carrying the target gene and crRNA targeting the 16S rDNA site includes the following steps:

[0019] The gapA gene is tandemly linked with the gapB gene, and a P gene is attached upstream of it. MP00 The promoter was used to obtain the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette, and P was linked upstream of the aldehyde dehydrogenase gene. MP00 The promoter was used to obtain the aldehyde dehydrogenase gene expression cassette.

[0020] The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and the aldehyde dehydrogenase gene expression cassette were cloned into the space between the left and right arms of the transposon of the pDonorG vector. The crRNA expression element targeting the 16S rDNA site was cloned into the downstream of the promoter of the pDonorG vector to obtain the donor vector.

[0021] Furthermore, the nucleotide sequence of the crRNA is shown in SEQ ID NO.12.

[0022] Furthermore, in step S2, the effector is a pSPIN carrier or a pEFF carrier.

[0023] A third aspect of the present invention provides the use of the engineered Pseudomonas bacteria described above in the biosynthesis of 2,5-furandicarboxylic acid.

[0024] A fourth aspect of this invention provides a method for the biosynthesis of 2,5-furandicarboxylic acid, comprising the following steps:

[0025] The engineered Pseudomonas aeruginosa, 5-hydroxymethylfurfural, and pH adjuster were added to the buffer solution to adjust the absorbance of the bacterial solution at 600 nm to 50-200, and the catalytic reaction was carried out at 20-35℃.

[0026] Furthermore, the pH adjuster is calcium carbonate.

[0027] Furthermore, the engineered Pseudomonas bacteria are obtained by culturing in a fermentation medium or by centrifuging the reaction solution after the previous batch of catalytic reaction has ended.

[0028] Furthermore, the fermentation medium for the engineered Pseudomonas bacteria comprises: 25 g / L glucose, 4.5 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.5 g / L calcium carbonate, with the pH value of the fermentation medium controlled within the range of 8-9.

[0029] Furthermore, the absorbance of the bacterial solution at 600 nm is 100, and the concentration of 5-hydroxymethylfurfural is 100 mmol / L.

[0030] Furthermore, the catalytic reaction was carried out at 30°C for 12 hours, either under stirring or in a shaker.

[0031] Furthermore, the buffer solution is a phosphate buffer with a concentration of 200 mmol / L.

[0032] The advantages and positive effects of this invention are as follows:

[0033] The novel engineered bacterial strain provided by this invention exhibits excellent growth performance, as well as extremely high substrate conversion and space-time yield. The substrate conversion and product specificity reach 100%, and the space-time yield (STY) reaches 1.30 g / L / h. It completely eliminates byproduct accumulation, allowing the reaction product to be used directly after only a simple purification step, resulting in extremely low purification costs. Simultaneously, it possesses excellent operational stability and multi-batch recycling capability, demonstrating extremely high genetic and phenotypic stability. This completely solves the problem of high preparation costs caused by the difficulty in reusing traditional biocatalysts, and shows great potential for industrial application. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1The diagram shows the verification results of double knockout of the ubiD / MYG11_19675 and ubiX / MYG11_24170 genes in the primary engineered strain MB04S-HMF1 of this invention. In the diagram, A is a schematic diagram of gene editing, and BC are the test results of the whole-cell catalytic ability of FDCA in the single knockout and double knockout engineered strains, respectively.

[0036] Figure 2 A map of the donor vector pDonorG-SpacerL2-gapA / B-MYG11_24155 used to construct the engineered strain MB04S-N3 in this embodiment of the invention;

[0037] Figure 3 This is an electrophoresis image of the genomic colony PCR amplification results of an engineered strain with multiple copies of the gapA / B-MYG11_24155 gene in an embodiment of the present invention.

[0038] Figure 4 This is a genome sequencing peak diagram and sequence alignment results of an engineered strain with multiple copies of the gapA / B-MYG11_24155 gene in an embodiment of the present invention;

[0039] Figure 5 This is a graph showing the performance test results of the engineered strain MB04S-N3 synthesizing FDCA by shake-flask fermentation in an embodiment of the present invention.

[0040] Figure 6 The growth curves of the engineered strain MB04S-N3 and the control strain MB04S-HMF8 in this embodiment of the invention are shown.

[0041] Figure 7 This is a graph showing the results of cyclic fermentation performance testing of different batches of the control strain MB04S-HMF8 in this invention.

[0042] Figure 8 The graph shows the results of cyclic fermentation performance testing of different batches of the engineered strain MB04S-N3 in an embodiment of the present invention. Detailed Implementation

[0043] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0044] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0045] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods. Furthermore, the terms "comprising," "including," "containing," "having," and similar words are non-limiting in meaning, allowing for the addition of other steps and components that do not affect the result.

[0046] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0047] Whole-cell catalytic systems, using living cells as an "enzyme library," integrate substrate transport, multi-step cascade reactions, and cofactor regeneration, and are becoming the mainstream green preparation process for biomass-based furan compounds. Recombinant *Pseudomonas putida* S12 or *Escherichia coli* expressing relevant oxidases (such as hmfH) have been shown to convert 5-hydroxymethylfurfural (HMF) to FDCA in these systems. However, in existing conventional whole-cell catalytic systems, the substrate HMF is a typical furan aldehyde inhibitor, and conventional chassis bacteria struggle to tolerate its toxic inhibitory effects and the high intracellular reactive oxygen species (ROS) oxidation stress during FDCA synthesis, thus limiting the synthesis efficiency of FDCA.

[0048] In the earlier research of this invention (see reference [1] "LIU Yongxuan, ZHOU Zhicheng, XU Jingjing, et al. Engineering an Mn(II)-oxidizing Pseudomonas whole-cellcatalyst chassis to efficiently biosynthesize 2,5-furandicarboxylic acid from hydroxymethylfurfural[J]. Bioresource Technology, 2025, 419: 132036. DOI:10.1016 / j.biortech.2025.132036."), Pseudomonas sp., which has manganese(II) oxidation activity, was used as the chassis microorganism for FDCA biosynthesis. This bacterium has the ability to tolerate intracellular oxidative stress. To realize its application in FDCA synthesis, 4.6% of redundant genes in the MB04B genome were first knocked out to obtain a streamlined strain, MB04C-6, which has a faster growth rate, higher gene editing efficiency, and stronger adaptability to foreign genes. Then, multiple copies of the furfural oxidoreductase gene hmfH and the HMF transporter gene hmfH' were integrated into the MB04C-6 genome to obtain an eight-copy engineered strain, MB04S-HMF8. Using MB04S-HMF8 as a whole-cell catalyst, 100 mM HMF can be converted to 97 mMMFDCA within 12 hours, achieving a production intensity of 1.26 g·L⁻¹. -1 ·h -1 This provides a new option for FDCA's green manufacturing.

[0049] The genome sequence of Pseudomonas MB04B can be found in the GenBank database accession number JALLPP000000000.1.

[0050] However, further research in this study revealed that the whole-cell catalyst exhibits poor stability under prolonged and high-intensity catalytic operation, exhibiting insufficient tolerance to substrate (HMF)-induced reactive oxygen species damage. This results in a rapid decline in catalytic efficiency over long periods of operation, lacking the industrial potential for repeated recycling. Furthermore, the introduction of the exogenous HMF oxidase pathway disrupts the cell's original metabolic balance, leading to a severe shortage of endogenous cofactors such as NADPH. This results in insufficient redox driving force, incomplete substrate conversion and byproduct accumulation, poor product specificity, and a low space-time yield of 2,5-furandicarboxylic acid (FDCA). Consequently, the catalytic efficiency consistently fails to meet the requirements for large-scale production. The combined effect of these factors leads to persistently high catalyst preparation costs in industrial-scale applications, and significantly increases substrate waste and the difficulty and cost of product purification.

[0051] To address this issue, this invention, based on the aforementioned research, uses the Pseudomonas genome-deleted chassis cell MB04C-6, which possesses natural antioxidant (anti-ROS) capabilities, as the starting strain. Through the CRISPR-associated transposase system (CAST), single copies of the hmfH and hmfH' genes are integrated into the 16S ribosomal RNA gene (16S rDNA) site of the hmfH genome, via the constitutive strong promoter P. MP00 The expression of the hmfH gene is driven by the constitutive promoter P. J23119 Drive hmfH' gene expression to realize the exogenous HMF oxidase gene expression cassette (P MP00 -hmfH-P J23119 The introduction of -hmfH') led to the construction of the primary engineered bacterium MB04S-HMF1 (the construction process can be found in reference [1]). Based on this, the decarboxylase system encoded by the ubiD / MYG11_19675 and ubiX / MYG11_24170 genes was knocked out, blocking the endogenous competitive degradation pathway of FDCA and the carbon flow consumption of the target product to byproducts. Furthermore, a systems metabolic engineering strategy was employed to introduce multiple copies of the decarboxylase system encoded by the constitutive strong promoter P... MP00 Expression cassettes (P) of the glyceraldehyde-3-phosphate dehydrogenase gene (gapA / MYG11_26255 and gapB / MYG11_01885) and the aldehyde dehydrogenase gene (MYG11_24155) were activated. MP00 -gapA / BP MP00 The invention, for the first time, reveals that by systematically strengthening the cofactor regeneration and endogenous dehydrogenation backbone pathway, the bottleneck of reducing power (NADPH / NADH) supply and catalytic rate caused by the single-copy exogenous pathway can be overcome by integrating -MYG11_24155) into the 16S rDNA site of the primary engineered bacterium MB04S-HMF1 genome.

[0052] Through multiple screenings and optimizations, this invention ultimately yielded the optimal engineered strain MB04S-N3, which knocks out the degradation bypass (ΔMYG11_19675 / MYG11_24170) and stably integrates 7 copies of the cofactor regeneration enhancement expression cassette on the chromosome. Compared to MB04S-HMF8, this engineered strain MB04S-N3 exhibits higher fermentation biomass and lower culture costs. Under whole-cell catalytic conditions, the engineered strain MB04S-N3 not only tolerates high concentrations of substrate toxicity but also achieves complete transformation of 100 mmol / L HMF and FDCA synthesis with double the space-time yield (up to 1.30 g / L / h) within 12 hours, with 100% substrate conversion and product specificity and no byproduct accumulation throughout the process. Furthermore, it breaks through the bottleneck of easy inactivation of conventional whole-cell catalysts. The engineered strain MB04S-N3 still maintains extremely high catalytic activity after undergoing multiple high-intensity centrifugation and high-concentration substrate stress. After being continuously recycled 5 times, the yield of FDCA can still be maintained at 93.63% of the maximum yield. Compared with MB04S-HMF8, the genetic and phenotypic stability is greatly improved, showing extremely high potential for industrial-scale production.

[0053] Based on this, one embodiment of the present invention provides an engineered Pseudomonas bacterium for the biosynthesis of 2,5-furandicarboxylic acid (FDCA), wherein the engineered Pseudomonas bacterium integrates a single copy of the HMF oxidase gene expression cassette (P) at the 16S rDNA site of its genome. MP00 -hmfH-P J23119 The starting strain is Pseudomonas sp. MB04S-HMF1 (-hmfH'), which has 7 copies of a glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and an aldehyde dehydrogenase gene expression cassette inserted into its 16S rDNA site. The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette includes P from upstream to downstream. MP00 The promoter, gapA gene (MYG11_26255), and gapB gene (MYG11_01885) of the aldehyde dehydrogenase gene expression cassette, from upstream to downstream, include P. MP00 Promoter and aldehyde dehydrogenase gene (MYG11_24155).

[0054] The novel engineered bacterial strain provided by this invention exhibits excellent growth performance, as well as extremely high substrate conversion and space-time yield. The substrate conversion and product specificity reach 100%, and the space-time yield (STY) reaches 1.30 g / L / h. It completely eliminates byproduct accumulation, allowing the reaction product to be used directly after only a simple purification step, resulting in extremely low purification costs. Simultaneously, it possesses excellent operational stability and multi-batch recycling capability, demonstrating extremely high genetic and phenotypic stability. This completely solves the problem of high preparation costs caused by the difficulty in reusing traditional biocatalysts, and shows great potential for industrial application.

[0055] Optionally, the P MP00 The nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the gapA gene is shown in SEQ ID NO.6, the nucleotide sequence of the gapB gene is shown in SEQ ID NO.7, and the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID NO.8.

[0056] Optionally, the gapA gene is located upstream of the gapB gene, and the two are linked by an RBS sequence or a variant of the RBS sequence. In a preferred embodiment of the present invention, the linking sequence is ACCGCGAGACCAAGAAGGAG.

[0057] Optionally, the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette is located upstream of the aldehyde dehydrogenase gene expression cassette, and the two are linked by the GAGCTCATGGTCTCGCGGT sequence.

[0058] Optionally, the fusion gene (P) formed by linking the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and the aldehyde dehydrogenase gene expression cassette... MP00 -gapA / BP MP00 The nucleotide sequence of (-MYG11_24155) is shown in SEQ ID NO.9.

[0059] Another embodiment of the present invention provides a method for constructing engineered Pseudomonas bacteria for the biosynthesis of 2,5-furandicarboxylic acid (FDCA) as described above, comprising the following steps:

[0060] S1. By using homologous recombination technology, the MYG11_19675 and MYG11_24170 genes on the genome of the primary engineered bacterium MB04S-HMF1 were knocked out to obtain the double knockout engineered bacterium MB04S-HMF1.

[0061] S2. The effector vector (pEffector) carrying the Cascade protein complex and transposase, along with the donor vector (pDonor) carrying the target gene and crRNA targeting the 16S rDNA site, are co-transformed into the double-knockout engineered bacterium MB04S-HMF1. Seven copies of the target gene are inserted into its genome using a CRISPR-associated transposase system to obtain an engineered Pseudomonas bacterium suitable for FDCA biosynthesis. The target gene includes a glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and an aldehyde dehydrogenase gene expression cassette. The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette includes P from upstream to downstream. MP00 The promoter, gapA gene (MYG11_26255), and gapB gene (MYG11_01885) of the aldehyde dehydrogenase gene expression cassette, from upstream to downstream, include P. MP00 Promoter and aldehyde dehydrogenase gene (MYG11_24155).

[0062] Optionally, in step S1, the MYG11_19675 gene and MYG11_24170 gene knockout method includes the following steps:

[0063] The sequences of the upstream homologous arm 19675US and the downstream homologous arm 19675DS of the MYG11_19675 gene were obtained. The sequences of 19675US and 19675DS were ligated into the gene knockout vector to construct the MYG11_19675 gene knockout vector. The nucleotide sequences of 19675US and 19675DS are shown in SEQ ID NO.13-14, respectively.

[0064] The sequences of the upstream homologous arm 24170US and the downstream homologous arm 24170DS of the MYG11_24170 gene were obtained. The sequences of 24170US and 24170DS were ligated into the gene knockout vector to construct the MYG11_24170 gene knockout vector. The nucleotide sequences of 24170US and 24170DS are shown in SEQ ID NO.15-16, respectively.

[0065] The MYG11_19675 gene knockout vector and the MYG11_24170 gene knockout vector were transformed into the primary engineered strain MB04S-HMF1, and gene knockout was performed by homologous recombination. The resulting strain was MB04S-HMF1, which was a double knockout engineered strain of MYG11_19675 and MYG11_24170 genes.

[0066] Optionally, the sequences of the upstream homologous arm 19675US and the downstream homologous arm 19675DS of the MYG11_19675 gene are obtained by PCR amplification, wherein the nucleotide sequence of the 19675US amplification primer pair is shown in SEQ ID NO.17-18, and the nucleotide sequence of the 19675DS amplification primer pair is shown in SEQ ID NO.19-20.

[0067] Optionally, the sequences of the upstream homologous arm 24170US and the downstream homologous arm 24170DS of the MYG11_24170 gene are obtained by PCR amplification, wherein the nucleotide sequence of the 24170US amplification primer pair is shown in SEQ ID NO.21-22, and the nucleotide sequence of the 24170DS amplification primer pair is shown in SEQ ID NO.23-24.

[0068] Optionally, the gene knockout vector is the pDS3.0 suicide plasmid.

[0069] The method for ligating the upstream and downstream homologous arms of the MYG11_19675 and MYG11_24170 genes into the pDS3.0 suicide plasmid includes: ligating the upstream and downstream homologous arms by overlapping extension PCR to obtain donor fragments (19675US-19675DS and 24170US-24170DS), and then ligating the donor fragments into the Sac I digested pDS3.0 suicide plasmid using DNA ligase.

[0070] Optionally, in step S2, the method for constructing the donor vector carrying the target gene and crRNA targeting the 16S rDNA site includes the following steps:

[0071] The gapA gene is tandemly linked with the gapB gene, and a P gene is attached upstream of it. MP00 The promoter was used to obtain the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette, and P was linked upstream of the aldehyde dehydrogenase gene (MYG11_24155). MP00 The promoter was used to obtain the aldehyde dehydrogenase gene expression cassette.

[0072] The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and the aldehyde dehydrogenase gene expression cassette were cloned between the left and right arms of the transposon of the pDonorG vector, and the crRNA expression element targeting the 16S rDNA site was cloned downstream of the promoter of the pDonorG vector.

[0073] Optionally, the P MP00The nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the gapA gene is shown in SEQ ID NO.6, the nucleotide sequence of the gapB gene is shown in SEQ ID NO.7, and the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID NO.8.

[0074] Optionally, the gapA gene is located upstream of the gapB gene, and the two are linked by an RBS sequence or its variant sequence ACGCGAGACCAAGAAGGAG.

[0075] Optionally, the target gene (P) MP00 -gapA / BP MP00 The nucleotide sequence of (-MYG11_24155) is shown in SEQ ID NO.9.

[0076] Optionally, the nucleotide sequence of the crRNA is shown in SEQ ID NO.12.

[0077] Optionally, in step S2, the effect vector is a pSPIN vector or a pEFF vector, and its details and construction method can be found in reference [1].

[0078] Another embodiment of the present invention provides the application of the engineered Pseudomonas bacteria described above in the biosynthesis of 2,5-furandicarboxylic acid (FDCA).

[0079] The advantages of engineered Pseudomonas in the biosynthesis of FDCA are basically the same as those of engineered Pseudomonas over existing technologies, as described above, and will not be repeated here.

[0080] Another embodiment of the present invention provides a method for the biosynthesis of 2,5-furandicarboxylic acid (FDCA), comprising the following steps:

[0081] The engineered Pseudomonas aeruginosa, 5-hydroxymethylfurfural (HMF), and pH adjuster were added to the buffer solution to adjust the absorbance of the bacterial solution at 600 nm to 50-200, and the catalytic reaction was carried out at 20-35℃.

[0082] During the above catalytic reaction, the generated FDCA is acidic. Therefore, it is necessary to add an appropriate alkaline pH adjuster, such as calcium carbonate, to neutralize the acidity of FDCA so that the reaction can continue.

[0083] Optionally, the engineered Pseudomonas bacteria are obtained by culturing in a fermentation medium or by centrifuging the reaction solution after the previous batch of catalytic reaction has ended.

[0084] Optionally, the fermentation medium for the engineered Pseudomonas bacteria comprises: 25 g / L glucose, 4.5 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.5 g / L calcium carbonate. The pH of the fermentation medium is controlled within the range of 8-9, specifically pH 8.6. The inoculum size of the fermentation medium is 1-5%, such as 2%.

[0085] Conventional yeast culture conditions are used, such as 25℃-35℃ and 150-250 rpm. The culture time is adjusted adaptively according to cell activity, inoculum size, etc. Usually, the cells are collected as whole-cell catalysts after the culture reaches the logarithmic growth phase.

[0086] Preferably, the absorbance value of the bacterial solution at 600 nm is 100.

[0087] Optionally, the concentration of 5-hydroxymethylfurfural is 100 mmol / L.

[0088] Optionally, the catalytic reaction time is 12 hours, and the reaction is carried out under stirring conditions or in a shaker.

[0089] Optionally, the buffer solution is a phosphate buffer with a concentration of 200 mmol / L.

[0090] The method for purifying FDCA from the reaction solution is a conventional method in the art, such as slowly adding dilute hydrochloric acid or dilute sulfuric acid to a phosphate buffer containing FDCA under stirring to adjust the pH to acidic, so that FDCA will gradually precipitate out as a white solid, and the product can be collected by filtration; or, washing with a low-boiling-point solvent or its aqueous solution and recrystallizing to obtain high-purity FDCA. The present invention does not have any particular limitations on these methods and steps.

[0091] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0092] The main culture media and biological materials involved in the following examples are as follows:

[0093] (1) VBMM medium: 0.5 g / L yeast extract, 0.5 g / L Casamino Acids, 1 g / L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES), 0.48 mM CaCl2, 0.83 mM MgSO4 and 3.7 μM FeCl3, pH 7.5; solid medium supplemented with 20 g / L agar;

[0094] (2) Fermentation medium: glucose 25g / L, yeast powder 4.5g / L, dipotassium hydrogen phosphate 0.5g / L, magnesium sulfate 0.5g / L and calcium carbonate 0.5g / L, pH 8.6.

[0095] (3) Plasmids: pSPIN plasmid was derived from Addgene (catalog number #160730), and the construction of pDS3.0 plasmid can be found in reference [2] "Yu, X., Meng, C., Tan, X., Su, Y., Cao, Z., Hwang, T.-S., & Li, L.(2022). RsmA3 modulates RpoS through the RetS‐Gac‐Rsm signalling pathway in response to H2O2 stress in the phytopathogen Pseudomonas syringae.Environmental Microbiology, 24(10), 4755-4770."

[0096] 1. Construction of primary engineered bacteria MB04S-HMF1

[0097] 1.1 Codon optimization and artificial synthesis of HMF oxidase gene

[0098] To optimize the gene sequences of hmfH and hmfH' based on the optimal codon preference of Pseudomonas, a constitutive strong promoter P was employed. MP00 The constitutive promoter P drives hmfH gene expression. J23119 The expression of the hmfH' gene was driven. The sequences were assembled using a polymerase cycle assembly method to create a full-length HMF oxidase gene expression cassette (P...). MP00 -hmfH-P J23119 -hmfH'), where P MP00 promoter, hmfH gene, P J23119 The nucleotide sequences of the promoter and hmfH' gene are shown in SEQ ID NO. 1-4, respectively. MP00 -hmfH-P J23119 The full-length sequence of -hmfH' is shown in SEQ ID NO.5.

[0099] 1.2 Transformation of HMF oxidase gene expression cassette

[0100] This embodiment constructs a CRISPR-associated transposase system (CAST) adapted to Pseudomonas MB04C-6 based on the INTEGRATE system, integrating an exogenous HMF oxidase gene expression cassette into the 16S rDNA site of the Pseudomonas MB04C-6 genome. The system includes a low-copy pSPIN vector expressing the Cascade protein complex (Cas6, Cas7, Cas8 / 5, and TniQ) and transposases (TnsA / B / C), and a high-copy shuttle vector pGDonor carrying a crRNA sequence outside its payload region (Cargo). The crRNA sequence is located at p... J23119 Downstream of the promoter, the Cargo region carries the externally sourced target fragment P. MP00 -hmfH-P J23119 The payload region (Cargo) of the crRNA, located between the left and right arms (Tn-R and Tn-L) of the transposon, also includes two co-directional FRT sites for deleting selection markers. One end of the crRNA binds to the Cascade protein complex, while the other end binds to the target site via base pairing, guiding it to target a specific DNA sequence in the genome. Once the Cas-crRNA complex binds to the designated target site on the genome, it recruits transposase proteins such as TnsA, TnsB, and TnsC via the TniQ protein. These transposases aggregate near the target site, forming a functional DNA insertion complex that inserts the payload into the target site in the genome, achieving RNA-guided, non-destructive, site-specific DNA insertion.

[0101] In this embodiment, crRNA was designed based on the 16S rDNA gene site to be edited, and its sequence is shown below:

[0102] gttctgctcgaaagagcgacgtgcgaattttc (SEQ ID NO. 12).

[0103] Construction of donor plasmid pGDonor: P MP00 -hmfH-P J23119 The -hmfH' fragment is linked to the payload region (Cargo) of pGDonor, and the crRNA is linked to pGDonor P. J23119 Downstream of the promoter, the recombinant expression donor plasmid pGDonor is formed.

[0104] Plasmid transformation and genome-targeted integration: First, the helper plasmid pSPIN was introduced into the recipient strain MB04C-6 via electroporation. Then, the donor plasmid pGDonor, carrying crRNA and an HMF oxidase expression cassette, was introduced into the recipient strain containing the pSPIN plasmid via conjugation transfer. The treated bacterial culture was plated on VBMM solid medium containing the appropriate selection antibiotics (gentamicin and tetracycline) and cultured for 48 hours under suitable conditions. Positive transformants were picked, genomic DNA was extracted, and PCR amplification was performed using primers designed for the designed insertion site. Sanger sequencing analysis confirmed that the large exogenous gene fragment had been specifically integrated into the chromosomal target site, resulting in the genetically stable, marker-free primary engineered strain MB04S-HMF1, achieving single-chromosome-dependent expression of the exogenous HMF oxidation pathway.

[0105] The growth medium for the primary engineered bacteria was systematically optimized. The optimal fermentation medium formulation was determined through experiments to be: 25 g / L glucose, 4.5 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate, and 0.5 g / L magnesium sulfate, with an inoculum size of 2% and an initial pH adjusted to 8.6. 0.5 g / L calcium carbonate was added to the medium as an acid-base buffer to neutralize the metabolic acidity.

[0106] Furthermore, the optimal conditions for whole-cell catalysis of FDCA were determined to be: using 200 mmol / L phosphate buffer (pH 7.0) and controlling the cell density to OD0.0. 600 =100, temperature controlled at 30℃, shaker speed 150r / min, HMF concentration 100mmol / L.

[0107] 2. Knockout of the competitive degradation pathway of FDCA in the primary engineered bacterium MB04S-HMF1

[0108] To further increase FDCA accumulation, this invention discovered a competitive degradation pathway that consumes the target product during whole-cell catalysis. Based on MB04S-HMF1, a two-step homologous recombination technique mediated by the pDS3.0 suicide plasmid was used to double-knock out the ubiD / MYG11_19675 (SEQ ID NO.10) and ubiX / MYG11_24170 (SEQ ID NO.11) genes mediating this degradation reaction, resulting in a degradation pathway-deficient strain. The specific steps are as follows:

[0109] (1) Homologous fragments of about 300-800 bp upstream and downstream of the target gene were amplified from the Pseudomonas genome by PCR. Specifically, the upstream homologous arm (US) sequence of the ubiD / MYG11_19675 gene (abbreviated as 19675US, SEQ ID NO.13) was amplified using primer pair 19675US-F / R (SEQ ID NO.17-18); the downstream homologous arm (DS) sequence of the ubiD / MYG11_19675 gene (abbreviated as 19675DS, SEQ ID NO.14) was amplified using primer pair 19675DS-F / R (SEQ ID NO.19-20); the upstream homologous arm (US) sequence of the ubiX / MYG11_24170 gene (abbreviated as 24170US, SEQ ID NO.15) was amplified using primer pair 24170US-F / R (SEQ ID NO.21-22); and the downstream homologous arm (DS) sequence of the ubiX / MYG11_24170 gene (abbreviated as 24170US, SEQ ID NO.15) was amplified using primer pair 24170DS-F / R (SEQ ID NO.17-18). Primer pair NO.23-24 was used to amplify the downstream homologous arm (DS) sequence of the ubiX / MYG11_24170 gene (abbreviated as 24170DS, SEQ ID NO.16).

[0110] (2) The US and DS sequences of the corresponding genes were ligated by overlap extension PCR to obtain donor fragments 19675US-19675DS and 24170US-24170DS for knocking out the ubiD / MYG11_19675 and ubiX / MYG11_24170 genes, respectively. The aforementioned fragments were mixed with pDS3.0 plasmid linearized by Sac I restriction at a 1:1 molar ratio, and 5× TEDA mixture was added. The mixture was incubated at 30°C for 40 minutes to complete the in vitro assembly of the knockout vectors pDS3.0-MYG11_19675 and pDS3.0-MYG11_24170. Subsequently, one of the assembly products was transformed into E. coli S17-1 / λpir competent cells, and positive clones that were correctly sequenced and verified on LB plates containing gentamicin were selected as donor bacteria. Donor bacteria cultured to mid-log phase were mixed with recipient bacteria MB04S-HMF1 at a 1:3 volume ratio and dropped onto sterile filter paper on LB agar plates for 8 hours of conjugation incubation. After washing, the collected bacteria were spread onto VBMM plates containing gentamicin to screen for single-recombination integrons that had undergone the first homologous recombination. Clones that grew well on VBMM plates containing gentamicin but not on VBMM plates containing 10% sucrose were selected and inoculated into antibiotic-free LB liquid medium for overnight culture to induce the second homologous recombination excision of the plasmid backbone. The bacterial culture was then washed and serially diluted and spread onto VBMM plates containing sucrose for reverse selection. Finally, single colonies that grew on sucrose plates and were sensitive to gentamicin were selected. PCR and sequencing cross-validation were performed using external primers that crossed the target site. After confirming successful deletion of the first target gene without residual resistance markers, the entire homologous recombination process was repeated using this single knockout strain as the recipient to knock out the second gene. This resulted in the degradation pathway-deficient double knockout mutants ubiD / MYG11_19675 and ubiX / MYG11_24170. The gene editing results are shown in […]. Figure 1 Sequencing results showed that approximately 480bp and 375bp segments were deleted from the middle segments of the ubiD / MYG11_19675 and ubiX / MYG11_24170 genes, respectively.

[0111] To verify the effectiveness of knocking out the degradation pathway, a free expression plasmid pHMF was constructed and transformed into the defective strain for catalytic verification. Results ( Figure 1 The graph (B-C, x-axis represents grouping, y-axis represents FDCA concentration) shows that knocking out MYG11_19675 and MYG11_24170 can effectively cut off the pathway of conversion of the target product to the byproduct, and the substrate conversion rate and FDCA production significantly increased.

[0112] 3. Construction of MB04S-N3, a highly efficient engineered bacterium that enhances cofactor regeneration and endogenous dehydrogenation pathways.

[0113] Using the genome of Pseudomonas MB04B as a template, the NEB Q5 high-fidelity DNA polymerase kit (NEB, catalog number #M0493L) was used to amplify the endogenous glyceraldehyde-3-phosphate dehydrogenase gene (MYG11_26255, MYG11_01885) and aldehyde dehydrogenase gene (MYG11_24155) using primer pairs gapA-F / R (SEQ ID NO.25-26), gapB-F / R (SEQ ID NO.27-28), and 24155-F / R (SEQ ID NO.29-30).

[0114] The PCR amplification system (50 μL) included: 1× Q5 Reaction Buffer, 200 μM dNTPs, 0.5 μM each of forward and reverse primers, an appropriate amount of genomic template, and 0.5 μL of Q5 high-fidelity enzyme. It also included 1× Q5 High GC Enhancer to improve amplification efficiency and specificity. The PCR thermal cycling program was set as follows: 98°C pre-denaturation for 30 seconds; followed by 30 cycles, including 98°C denaturation for 10 seconds, 60-65°C annealing for 15 seconds, and 72°C extension (set at 20-30 seconds / kb); finally, a complete extension at 72°C for 2 minutes. After amplification, the product was subjected to 1% agarose gel electrophoresis to check the band size and uniformity. After verification, the product was excised and purified for subsequent experiments.

[0115] The pDonorG vector was used as the exogenous target gene insertion vector. Its difference from the pGDonor vector used in "1.2, Transformation of HMF Oxidase Gene Expression Cassette" lies in the insertion of the gentamicin resistance gene (Gm) at two unidirectional FRT sites. R The amplified gapA and gapB genes were tandemly ligated to obtain the gapA / B fusion gene. PA molecules were then ligated upstream of both the gapA / B fusion gene and the MYG11_24155 gene. MP00 The promoter, the aforementioned work was outsourced to a gene synthesis company, which yielded the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette (P... MP00 -gapA / B) and aldehyde dehydrogenase gene expression cassette (P MP00 -MYG11_24155), then P MP00 -gapA / B and P MP00 -MYG11_24155 was assembled into the payload region of the pDonorG vector to obtain the targeted donor vector pDonorG-SpacerL2-gapA / B-MYG11_24155. The vector pattern is shown in [reference needed]. Figure 2SpacerL2 represents crRNA, which is integrated in tandem with the constitutive promoter P within the recognition ends of the two mini-transposons (Tn-L and Tn-R arms of the transposon). MP00 The gapA and gapB genes are co-driven, and another independent promoter, P, drives them. MP00 The MYG11_24155 gene driven by P has the following gene sequence: MP00 -gapA / BP MP00 -MYG11_24155, where P MP00 The sequences of the promoter, gapA gene, gapB gene, and MYG11_24155 gene are shown in SEQ ID NO.1 and SEQ ID NO.6-8, respectively. MP00 -gapA / BP MP00 The -MYG11_24155 sequence is shown in SEQ ID NO.9.

[0116] The pEFF plasmid (a derivative of the pSPIN vector) carrying Cascade-TnsA / B / C was co-transformed with the donor plasmid pDonorG-SpacerL2-gapA / B-MYG11_24155 into the MYG11_19675 and MYG11_24170 defective strains MB04S-HMF1. The target fragment was then guided into integration into multiple partially homologous 16S rDNA sites on the chromosome using the CAST system.

[0117] After introducing the donor plasmid into the recipient bacteria and inducing transposition integration, single clones of positive transformants were selected. PCR verification was performed on Aim-F / R (SEQ ID NO. 33-34) using primers specific to the plasmid backbone. Agarose gel electrophoresis was then performed on the amplification results, and the gel images are shown below. Figure 3 As shown, lanes 1-7 represent positive transformants, CK is the control group with empty vector plasmid, and 5K is the molecular marker. Results showed that all positive transformants successfully amplified the expected 3100 bp target band, while the control group CK did not show this amplification product. Genomic DNA was extracted from the PCR-positive strains for boundary sequence amplification and sequencing alignment. The sequencing results clearly confirmed that the transposon carrying the target pathway expression cassette had been precisely inserted into the 16S rDNA sequence of the host genome. The transposon boundary was clearly connected and contained a characteristic target site normal repeat (TSD) CCATC, indicating that the target multi-gene expression cassette had been successfully integrated into the recipient bacterial genome. Sequencing results are shown below. Figure 4 As shown.

[0118] The FCDA synthesis capacity of different positive transformants was verified, and the engineered strain with the highest synthesis capacity was selected for qPCR copy number verification. The experimental method followed the instructions of *Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR* (Thermo Fisher), using the qCopy-F / R primer pair. By setting a cycle number threshold, the number of cycles required for engineered strains containing different copy numbers of the gene to reach the threshold was compared, and the copy number of the target gene was quantified. After screening and absolute quantification analysis, the final optimal engineered strain MB04S-N3, which stably integrated 7 copies of the target fragment onto the chromosome, was obtained.

[0119] Table 1. Knockout sequences and primers used in constructing the engineered bacterium MB04S-N3 according to embodiments of the present invention.

[0120] 4. Whole-cell catalytic performance analysis of engineered strain MB04S-N3

[0121] The engineered strain MB04S-N3 was inoculated at a 2% inoculation rate into fermentation medium (25 g / L glucose, 4.5 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.5 g / L calcium carbonate, pH 8.6), and cultured at 30°C and 250 rpm / min until the logarithmic growth phase. The cell culture was collected, centrifuged, and the supernatant was discarded; the bacterial cells were collected as whole-cell catalysts. Engineered strains N1, N2, and N4, with a copy number of gapA / B-MYG11_24155 lower than 7, were used as controls.

[0122] Resuspend the bacterial cells in phosphate buffer (pH 7.0) and adjust the cell density to OD. 600 =100, add an appropriate amount of CaCO3 to neutralize the acidity of the product, add 100 mmol / L of the substrate 5-hydroxymethylfurfural (HMF) to the reaction system, and carry out whole-cell catalytic transformation in a shaker at 30℃ and 150 r / min. After 12 h of fermentation, take a sample to determine the concentration of 2,5-furandicarboxylic acid (FDCA) in the fermentation broth.

[0123] Method for 2,5-furandicarboxylic acid (FDCA) concentration: The fermentation supernatant was collected, and the concentrations of FDCA and the substrate HMF were determined using a high-performance liquid chromatography (HPLC) system (Shimadzu LC30A, Kyoto, Japan). The chromatographic column was an Ultimate Sugar-H column (7.8 mm × 50 mm × 8 μm, Welch Materials, Inc.). The separation conditions for HMF and FDCA were: 10 mmol / L sulfuric acid solution as the mobile phase, column temperature 70℃, flow rate 0.2 mL / min, and detection wavelength 285 nm.

[0124] The results of shake-flask fermentation are as follows Figure 5 As shown in the figure. The results showed that the FDCA accumulation of the multi-copy engineered strains MB04S-N1 to N4 was significantly higher than that of the control strain, among which MB04S-N3 showed the best synthesis ability, with the highest yield reaching approximately 104.2 mmol / L.

[0125] To further investigate the ability of the engineered strain MB04S-N3 to synthesize the target product, samples were taken at different time points to determine the FDCA concentration in the fermentation broth and to perform kinetic analysis. Thanks to the complete blockade of the degradation bypass and the strong synergistic driving force of the 7-copy cofactor enhancement gene on the single-copy exogenous oxidation pathway (hmfH / hmfH'), the engineered strain MB04S-N3 could completely transform 100 mmol / L of substrate HMF in just 12 hours, achieving a 100% FDCA yield with no byproduct formation and a space-time yield of 1.30 g / L / h.

[0126] 5. Growth performance analysis of engineered strain MB04S-N3

[0127] The OD curves of engineered strain MB04S-N3 and control strain MB04S-HMF8 were measured after 15 hours. 600 Determination. Engineered strain MB04S-N3 and control strain MB04S-HMF8 were inoculated into fermentation medium at a 2% inoculum and cultured under the same conditions.

[0128] Comparative analysis revealed that both strains rapidly entered the logarithmic growth phase after a brief adaptation period, and throughout the entire growth cycle, the engineered strain MB04S-N3 exhibited superior growth rate and overall biomass compared to the control strain. Figure 5 The above data indicate that the multi-copy integration strategy of highly expressing exogenous genes did not cause significant metabolic burden or growth inhibition in host cells, and the selected MB04S-N3 exhibits both excellent FDCA synthesis capacity and good growth stability.

[0129] 6. Recycling potential of engineered strain MB04S-N3

[0130] To evaluate the operational stability and catalyst cost advantage of the engineered strain MB04S-N3 in actual industrial scale-up, multiple batch recycling validations were conducted. The fermentation system after the first 12-hour catalytic reaction was centrifuged at 8000 rpm for 10 minutes to collect the cell cells. After washing the cells once with 200 mmol / L phosphate buffer (pH 7.0), they were resuspended in a new reaction buffer containing 100 mmol / L fresh HMF substrate and an appropriate amount of calcium carbonate. The next batch of 12-hour whole-cell catalytic transformation was then performed at 30°C and 150 rpm. Five consecutive batch reactions were conducted. MB04S-HMF8 was used as a control strain.

[0131] The results of the cyclic fermentation performance tests of different batches of control strain MB04S-HMF8 and engineered strain MB04S-N3 are as follows: Figure 7-8 As shown, the two strains exhibited drastically different catalytic stability during repeated use. While the control strain MB04S-HMF8 showed high FDCA synthesis efficiency in the first round of reaction, its catalytic activity significantly declined in subsequent batches, with the yield plummeting to around 21 mmol / L by the fourth cycle, and almost completely losing its ability to synthesize the target product in the fifth cycle. In contrast, the engineered strain MB04S-N3 demonstrated exceptional catalytic robustness and genetic and phenotypic stability. Throughout five consecutive transformation cycles, the FDCA yield of MB04S-N3 remained consistently high, decreasing only slightly from approximately 100 mmol / L in the first batch to over 90 mmol / L in the fifth batch, with a catalytic efficiency retention rate exceeding 90% throughout the cycle. These data indicate that the MB04S-N3 strain not only possesses highly efficient initial synthesis capabilities but also tolerates multiple rounds of whole-cell catalytic operations without significant activity loss. Its excellent reusability significantly improves overall conversion efficiency and demonstrates great promise for industrial applications.

[0132] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An engineered Pseudomonas bacterium for the biosynthesis of 2,5-furandicarboxylic acid, characterized in that, The engineered Pseudomonas species used MB04S-HMF1, a primary engineered strain with a single copy of the HMF oxidase gene expression cassette integrated into its 16S rDNA site, as the starting strain. Seven copies of the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and the aldehyde dehydrogenase gene expression cassette were inserted into the 16S rDNA site of this strain. The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette includes P from upstream to downstream. MP00 The promoter, gapA gene, and gapB gene, the aldehyde dehydrogenase gene expression cassette including P from upstream to downstream MP00 Promoter and aldehyde dehydrogenase gene.

2. The engineered Pseudomonas bacillus for the biosynthesis of 2,5-furandicarboxylic acid according to claim 1, characterized in that, The P MP00 The nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the gapA gene is shown in SEQ ID NO.6, the nucleotide sequence of the gapB gene is shown in SEQ ID NO.7, and the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID NO.

8.

3. The method for preparing engineered Pseudomonas bacteria for the biosynthesis of 2,5-furandicarboxylic acid as described in any one of claims 1-2, characterized in that, Includes the following steps: S1. By using homologous recombination technology, the MYG11_19675 and MYG11_24170 genes on the genome of the primary engineered bacterium MB04S-HMF1 were knocked out to obtain the double knockout engineered bacterium MB04S-HMF1. S2. The effector vector carrying the Cascade protein complex and transposase and the donor vector carrying the target gene and crRNA targeting the 16S rDNA site were co-transformed into the double knockout engineered bacterium MB04S-HMF1. Seven copies of the target gene were inserted into its genome using the CRISPR-associated transposase system to obtain an engineered Pseudomonas bacterium suitable for the biosynthesis of 2,5-furandicarboxylic acid. The target gene includes a glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and an aldehyde dehydrogenase gene expression cassette. The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette includes P from upstream to downstream. MP00 The promoter, gapA gene, and gapB gene, the aldehyde dehydrogenase gene expression cassette including P from upstream to downstream MP00 Promoter and aldehyde dehydrogenase gene.

4. The method for preparing engineered Pseudomonas bacteria for the biosynthesis of 2,5-furandicarboxylic acid according to claim 3, characterized in that, In step S1, the MYG11_19675 and MYG11_24170 gene knockout methods include the following steps: The sequences of the upstream homologous arm 19675US and the downstream homologous arm 19675DS of the MYG11_19675 gene were obtained. The sequences of 19675US and 19675DS were ligated into the gene knockout vector to construct the MYG11_19675 gene knockout vector. The nucleotide sequences of 19675US and 19675DS are shown in SEQ ID NO.13-14, respectively. The sequences of the upstream homologous arm 24170US and the downstream homologous arm 24170DS of the MYG11_24170 gene were obtained. The sequences of 24170US and 24170DS were ligated into the gene knockout vector to construct the MYG11_24170 gene knockout vector. The nucleotide sequences of 24170US and 24170DS are shown in SEQ ID NO.15-16, respectively. The MYG11_19675 gene knockout vector and the MYG11_24170 gene knockout vector were transformed into the primary engineered strain MB04S-HMF1, and gene knockout was performed by homologous recombination. The double knockout engineered strain MB04S-HMF1 of MYG11_19675 gene and MYG11_24170 gene was obtained by screening. The gene knockout vector is the pDS3.0 plasmid.

5. The method for preparing engineered Pseudomonas bacteria for the biosynthesis of 2,5-furandicarboxylic acid according to claim 3, characterized in that, In step S2, the method for constructing a donor vector carrying the target gene and crRNA targeting the 16S rDNA site includes the following steps: The gapA gene is tandemly linked with the gapB gene, and a P gene is attached upstream of it. MP00 The promoter was used to obtain the glyceraldehyde-3-phosphate dehydrogenase gene expression cassette, and P was linked upstream of the aldehyde dehydrogenase gene. MP00 The promoter was used to obtain the aldehyde dehydrogenase gene expression cassette. The glyceraldehyde-3-phosphate dehydrogenase gene expression cassette and the aldehyde dehydrogenase gene expression cassette were cloned between the left and right arms of the transposon of the pDonorG vector, and the crRNA expression element targeting the 16S rDNA site was cloned downstream of the promoter of the pDonorG vector to obtain the donor vector. Wherein, P MP00 The nucleotide sequence of the promoter is shown in SEQ ID NO.1, the nucleotide sequence of the gapA gene is shown in SEQ ID NO.6, the nucleotide sequence of the gapB gene is shown in SEQ ID NO.7, and the nucleotide sequence of the aldehyde dehydrogenase gene is shown in SEQ ID NO.

8.

6. The method for preparing engineered Pseudomonas bacteria for the biosynthesis of 2,5-furandicarboxylic acid according to claim 5, characterized in that, The nucleotide sequence of the target gene is shown in SEQ ID NO.9, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.12; The effector is a pSPIN or pEFF vector.

7. The use of the engineered Pseudomonas bacillus for the biosynthesis of 2,5-furandicarboxylic acid as described in any one of claims 1-2 in the biosynthesis of 2,5-furandicarboxylic acid.

8. A method for the biosynthesis of 2,5-furandicarboxylic acid, characterized in that, Includes the following steps: The engineered Pseudomonas bacillus for the biosynthesis of 2,5-furandicarboxylic acid as described in any one of claims 1-2, 5-hydroxymethylfurfural, and a pH adjuster are added to a buffer solution to adjust the absorbance of the bacterial solution at 600 nm to 50-200, and the catalytic reaction is carried out at 20-35°C.

9. The method for biosynthesizing 2,5-furandicarboxylic acid according to claim 8, characterized in that, The engineered Pseudomonas bacteria were obtained by culturing in a fermentation medium or by centrifuging the reaction solution after the previous batch of catalytic reaction was completed. The fermentation medium comprises: 25 g / L glucose, 4.5 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.5 g / L calcium carbonate. The pH of the fermentation medium is controlled within the range of 8-9.

10. The method for biosynthesizing 2,5-furandicarboxylic acid according to claim 8, characterized in that, The bacterial solution had an absorbance of 100 at 600 nm, and the concentration of 5-hydroxymethylfurfural was 100 mmol / L. The reaction was carried out at 30 °C for 12 h.

Images