A duck rimerella 16s rna detection reagent kit based on MIRA-CRISPR / Cas12a, a detection method and application

Abstract

The application discloses a duck Riemerella anatipestifer 16S rRNA detection kit based on MIRA-CRISPR / Cas12a, a detection method and application, and belongs to the technical field of biology detection. The kit comprises forward primers and reverse primers shown as SEQ ID NO. 1 and SEQ ID NO. 2, a MIRA amplification reaction system and a CRISPR / Cas12a reaction system. The detection method can realize rapid and accurate detection of the duck Riemerella anatipestifer by establishing a detection method combining MIRA amplification reaction and CRISPR / Cas12a, has the advantages of simple operation, low cost, high sensitivity and strong specificity, solves the problems of high detection cost, long time, high requirement for detection personnel, the need for professional training, only suitable for auxiliary diagnosis in a laboratory and unable to be popularized and applied in the prior art, and has important significance for early detection of RA.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a MIRA-CRISPR / Cas12a-based detection kit, detection method, and application of Riemerella anatipestifer 16S rRNA. Background Technology

[0002] Riemerella anatipestifer, also known as duck infectious serositis, is an acute or chronic infectious disease caused by Riemerella anatipestifer (RA). This disease causes fibrinous pericarditis, perihepatitis, air sacculitis, and meningitis in infected ducks, leading to mass mortality. Surviving infected ducks experience stunted growth and reduced productivity, making it one of the most significant bacterial diseases hindering the healthy development of waterfowl farming.

[0003] The clinical symptoms and pathological changes caused by RA infection are highly similar to those of common avian diseases such as Muscovy duck reovirus disease and novel Muscovy duck reovirus disease. Accurate diagnosis cannot be achieved solely based on clinical symptoms and necropsy lesions; laboratory testing techniques are essential for pathogen identification. Currently, the mainstream detection methods for RA fall into three main categories: traditional microbiological detection, immunological detection, and molecular biological detection. However, these techniques, to varying degrees, rely on sophisticated and expensive thermal cycling instruments, involve cumbersome and time-consuming procedures, and require highly skilled operators, making them unsuitable for the rapid on-site screening needs of poultry farms. At present, a rapid RA detection technology that combines high sensitivity, high specificity, ease of operation, and visualized results is still lacking. Summary of the Invention

[0004] To address the aforementioned technical problems, the present invention aims to provide a MIRA-CRISPR / Cas12a-based 16S rRNA detection kit, detection method, and application for Rimerella anatipestifer, thereby resolving issues such as the need for bulky or expensive instruments and equipment, long detection times, high requirements for testing personnel, the need for professional training, applicability only to laboratory auxiliary diagnosis, and the inability to promote widespread application of existing Rimerella anatipestifer detection methods.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides a MIRA-CRISPR / Cas12a-based detection kit for Riemerella anatipestifer 16S rRNA, the kit comprising forward and reverse primers as shown in SEQ ID NO.1 and SEQ ID NO.2, a MIRA amplification reaction system and a CRISPR / Cas12a reaction system; The CRISPR / Cas12a reaction system includes crRNA and fluorescent probes; The nucleotide sequence of the crRNA is shown in SEQ ID NO.4; The nucleotide sequence of the fluorescent probe is: 5'-FAM-TTATT-BHQ Ⅰ-3'.

[0006] SEQ ID NO.1: GTAAGTCAGTGGTGAAAGCCTACAGCTTAA; SEQ ID NO.2: CGTGGACTACCAGGGTATCTAATCCTGTTC; SEQ ID NO. 4: AAUUUCUACUAAGUGUAGAUACCGCUACACUACUCAUUCC.

[0007] The beneficial effects of this invention are as follows: This invention provides a method for detecting the 16S rRNA gene of Riemerella anatipestifer. This detection method can specifically amplify Riemerella anatipestifer and has no cross-reactivity with the nucleic acids of avian pathogenic Escherichia coli, Salmonella enteritidis, Pasteurella multocida, Muscovy duck reovirus, novel Muscovy duck reovirus, and duck Tembusu virus. It has high specificity and can achieve rapid, accurate, and visual detection of Riemerella anatipestifer.

[0008] Furthermore, the MIRA amplification reaction system includes MIRA amplification reaction dry powder, buffer, positive control, and negative control.

[0009] Furthermore, the positive control includes the Riemerella anatipestifer 16S rRNA gene, the nucleotide sequence of which is shown in SEQ ID NO. 3; SEQ ID NO.3: GCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTGCAGGGATAAACCTACTCTCGTGAGGGTAGCTGAAGGTACTGTACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGCAGGCGGGCTAGTAAGTCAGTGGTGAAAGCCTACAGCTT AACTGTAGAACTGCCGTTGATACTGCTAGTCTTGAGTATAGTTGAGGTAGCTGGAATGAGTAGTGTAGCGGTGAAATGCATAGATATTACTCAGAACACCGATTGCGAAGGCAGGTTACCAAGTTATAACTGACGCTGAGGGACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGCTAACTCGTTTTTGGGCT.

[0010] Furthermore, negative controls include ddH2O.

[0011] Furthermore, the CRISPR / Cas12a reaction system also includes LbCas12a, 10×CasSmart Buffer, and ddH2O.

[0012] The beneficial effects of adopting the above-mentioned further technical solutions are as follows: the reagent kit of the present invention does not have special requirements for the source of general reagents, and commercially available products familiar to those skilled in the art can be used. The reagent requirements are low and the sources are wide.

[0013] A second aspect of the present invention provides the application of the above-described kit in the detection of Riemerella anatipestifer for non-disease diagnostic purposes.

[0014] A third aspect of the present invention provides a non-disease diagnostic detection method for Riemerella anatipestifer based on MIRA-CRISPR / Cas12a, using the aforementioned kit, specifically comprising the following steps: S1. Extract DNA from the sample to be tested; S2. Using the DNA obtained in S1 as a template, perform MIRA amplification using the reagents in the kit to obtain the amplification product; S3. Using the amplification product obtained in S2 as a template, perform the MIRA-CRISPR / Cas12a reaction using the reagents in the kit and collect the fluorescence signal. S4. Based on the fluorescence signal obtained in S3, if an amplification curve appears or the final product fluoresces under ultraviolet light, the sample to be tested is determined to be positive for Riemerella anatipestifer; if no amplification curve appears or the final product does not fluoresce under ultraviolet light, the sample to be tested is determined to be negative for Riemerella anatipestifer.

[0015] Furthermore, in the reaction system for MIRA amplification in S2, the mass-to-volume ratio of reaction powder, buffer, magnesium acetate, forward primer, reverse primer, DNA template, and ddH2O was 15 mg: 29.4 μL: 2.5 μL: 2 μL: 2 μL: 9.1 μL.

[0016] Furthermore, the concentrations of both the forward and reverse primers are 5-20 μmol / L.

[0017] Furthermore, in the reaction system of the MIRA-CRISPR / Cas12a reaction in S3, the volume ratio of LbCas12a, crRNA, 10×CasSmart Buffer, fluorescent probe, amplification product obtained in S2 and ddH2O was 2 μL:0.5 μL:5 μL:0.5 μL:1 μL:41 μL.

[0018] Furthermore, the concentration of LbCas12a was 0.05-0.2 μmol / L.

[0019] Furthermore, the concentration of crRNA was 0.5-2 ng / μL.

[0020] Furthermore, the concentration of the fluorescent probe is 0.5-2 μmol / L.

[0021] Furthermore, the reaction program for the MIRA-CRISPR / Cas12a reaction in S3 is: 39℃ for 30 s, 40 cycles.

[0022] The present invention has the following beneficial effects: 1. This invention provides a primer pair capable of specifically amplifying the 16S rRNA gene of Riemerella anatipestifer. This primer pair shows no cross-reactivity with the nucleic acids of avian pathogenic Escherichia coli, Salmonella enteritidis, Pasteurella multocida, Muscovy duck reovirus, novel Muscovy duck reovirus, and duck Tembusu virus, and has high specificity.

[0023] 2. This invention provides a MIRA amplification reaction system for the 16S rRNA gene of Riemerella anatipestifer. This method can rapidly complete the amplification of low-concentration Riemerella anatipestifer nucleic acid and has advantages such as strong anti-interference ability and strong stability.

[0024] 3. This invention provides a method for detecting Riemerella anatipestifer using MIRA-CRISPR / Cas12a fluorescence based on this primer pair. This method can complete the detection within 50 minutes and can detect low-copy Riemerella anatipestifer nucleic acid. It has the advantages of simple operation, low cost, high sensitivity and result visualization. Attached Figure Description

[0025] Figure 1 The image shows the screening and detection results of crRNA in Example 1, where N is the negative control; Figure 2 The image shows the agarose gel electrophoresis results of the MIRA amplification products of the 16S rRNA gene of Riemerella anatipestifer in Example 2. In the image, M is the marker, lane 1 is F1+R1 (261 bp), lane 2 is F2+R2 (200 bp), lane 3 is F2+R3 (217 bp), lane 4 is F3+R2 (169 bp), lane 5 is F3+R3 (186 bp), and lane 6 is ddH2O. Figure 3 The amplification results of the positive and negative controls in Example 3 are shown in the figure, where RA is the positive control and N is the negative control. Figure 4 The graph shows the sensitivity detection results of the method for Riemerella anatipestifer in Experiment Example 2, where N is the negative control; Figure 5 The image shows the specific detection results of the method for *Rimerella anatipestifer* in Experiment Example 3, where RA is the positive control and N is the negative control. Detailed Implementation

[0026] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0027] Example 1: Design and screening of crRNA I. Design of crRNA The RA gene sequences in the NCBI database (GenBank accession numbers: NZ_JAVKVS010000046.1, NZ_JAVKVT010000101.1, NZ_JAVKWM010000041.1, NZ_JAVKXU010000021.1, NZ_JAOTLD010000026.1, NZ_JAOBXF010000016.1, NZ_JAOZYW010000) were used as the reference sequences. 032.1, NZ_JAOTLO010000036.1, NZ_JAOZYV010000140.1, NZ_JAOBXC010000017.1, NZ_JAOZYU010000 021.1, NZ_JAMXWJ010000033.1, NZ_JAMXVR010000116.1, NZ_JAOBWT010000018.1, NZ_JAFELX010000 024.1, NZ_JAFELU010000021.1, NZ_JAFELP010000019.1, NZ_JAOZYN010000019.1, NZ_JAOZYI010000 118.1, NZ_VLII01000021.1, NZ_PKKR01000013.1, NZ_LEKU01000012.1, LUDR01000025.1, NZ_LAVB01 Using the genes 000016, NZ_QXQN01000018.1, LUDP01000018.1, LUDI01000015.1, NZ_PPEC01000017.1, LUDM01000018.1, NZ_LUDS01000013.1, NZ_QXHP01000181.1, NZ_VLIP01000011.1 and MW290519.1 as references, based on gene alignment analysis of conserved regions of the 16S rRNA gene, and after homology analysis, the following crRNA and probe (P) sequences were designed based on the PAM site: crRNA sequence: crRNA1: AAUUUCUACUAAGUGUAGAUAAGGGUCCGCAGGCGGGCUA (SEQ ID NO.5); crRNA2: AAUUUCUACUAAGUGUAGAUACCGCUACACUACUCAUUCC (SEQ ID NO.4); Fluorescent probe sequence: P: 5'-FAM-TTATT-BHQⅠ-3'.

[0028] II. Screening of crRNA Using the 16S rRNA gene of Rimerella anatipestifer as shown in SEQ ID NO.3 as a template and ddH2O as a negative control, the above two groups of crRNA were used to perform MIRA-CRISPR / Cas12a reaction.

[0029] The MIRA-CRISPR / Cas12a reaction system contained: 5 μL template, 2 μL LbCas12a, 0.5 μL crRNA, 5 μL 10×CasSmart Buffer, 0.5 μL fluorescent probe, and 41 μL ddH2O; the concentration of LbCas12a was 0.1 μmol / L; the concentration of crRNA was 1 ng / μL; and the concentration of the fluorescent probe was 1 μmol / L.

[0030] The reaction program for MIRA-CRISPR / Cas12a is: 39℃ for 30s, 40 cycles.

[0031] The results of the MIRA-CRISPR / Cas12a reaction are as follows: Figure 1 As shown.

[0032] Depend on Figure 1 It is known that, under the same primer and probe concentration, the crRNA with the larger amplification curve amplitude and higher fluorescence intensity is crRNA2. Therefore, crRNA2 was selected as the crRNA for detecting the 16S rRNA gene of Riemerella anatipestifer in this invention.

[0033] Example 2: Primer design and screening I. Primer Design Based on the results obtained in Example 1, the upstream and downstream primer sequences were designed as follows: F1: GAGGGTAGCTGAAGGTACTGTACGAATAAG (SEQ ID NO.6); F2: GTAAGTCAGTGGTGAAAGCCTACAGCTTAA (SEQ ID NO. 1); F3: TGTAGAACTGCCGTTGATACTGCTAGTCTT (SEQ ID NO.7); R1: CCTTCGCAATCGGTGTTCTGAGTAATATCTA (SEQ ID NO.8); R2:TCTAATCCTGTCGCTCCCCACGCTTTCGT (SEQ ID NO.9); R3: CGTGGACTACCAGGGTATCTAATCCTGTTC (SEQ ID NO. 2).

[0034] II. Primer Screening First, primers F1-F3 and R1-R3 were divided into 5 groups with suitable amplification fragments (150-300 bp): F1+R1 (261 bp), F2+R2 (200 bp), F2+R3 (217 bp), F3+R2 (169 bp) and F3+R3 (186 bp).

[0035] Then, using the 16S rRNA gene of Rimerella anatipestifer as shown in SEQ ID NO.3 as a template and ddH2O as a negative control, the above 5 sets of primer pairs were used to perform MIRA amplification reaction.

[0036] The MIRA amplification reaction system was 50 μL, including 15 mg of MIRA amplification reaction powder, 29.4 μL of PEG buffer, 2.5 μL of magnesium acetate, 2 μL each of forward and reverse primers (both at a concentration of 10 μmol / L), 9.1 μL of ddH2O, and 2 μL of DNA template.

[0037] The MIRA amplification reaction program was 39℃ for 30 min.

[0038] After the MIRA amplification reaction was completed, the protein was denatured using extraction buffer as follows: 50 μL of Tris-saturated phenol / chloroform / isoamyl alcohol DNA extraction buffer was added to the reaction product, mixed well, and centrifuged at 12000 rpm for 5 min. 5 μL of the supernatant was taken and mixed with 1 μL of 6× Loading Buffer for 1% agarose gel electrophoresis analysis.

[0039] Experimental results are as follows Figure 2 As shown.

[0040] Depend on Figure 2 It is known that, under the same primer concentration, the primer pair with the highest amplification product is F2R3. Therefore, F2R3 was selected as the primer pair for detecting the 16S rRNA gene of Riemerella anatipestifer in this invention.

[0041] Example 3: Kit for detecting Riemerella anatipestifer 16S rRNA gene A MIRA-CRISPR / Cas12a-based 16S rRNA detection kit for Riemerella anatipestifer includes forward and reverse primers as shown in SEQ ID NO.1 and SEQ ID NO.2, a MIRA amplification reaction system, and a CRISPR / Cas12a reaction system; SEQ ID NO.1: GTAAGTCAGTGGTGAAAGCCTACAGCTTAA; SEQ ID NO.2: CGTGGACTACCAGGGTATCTAATCCTGTTC; The MIRA amplification reaction system includes MIRA amplification reaction powder, PEG and other system buffers, magnesium acetate, positive control (such as the Riemerella anatipestifer 16S rRNA gene shown in SEQ ID NO.3) and negative control (ddH2O). SEQ ID NO.3: GCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTGCAGGGATAAACCTACTCTCGTGAGGGTAGCTGAAGGTACTGTACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGCAGGCGGGCTAGTAAGTCAGTGGTGAAAGCCTACAGCTT AACTGTAGAACTGCCGTTGATACTGCTAGTCTTGAGTATAGTTGAGGTAGCTGGAATGAGTAGTGTAGCGGTGAAATGCATAGATATTACTCAGAACACCGATTGCGAAGGCAGGTTACCAAGTTATAACTGACGCTGAGGGACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGCTAACTCGTTTTTGGGCT; The CRISPR / Cas12a reaction system includes LbCas12a, crRNA (as shown in SEQ ID NO.4), 10×CasSmart Buffer, fluorescent probe, and ddH2O; Fluorescent probe: 5'-FAM-TTATT-BHQ Ⅰ-3'; SEQ ID NO. 4: AAUUUCUACUAAGUGUAGAUACCGCUACACUACUCAUUCC.

[0042] In this kit, the MIRA amplification reaction powder, PEG buffer, and magnesium acetate are all components of the isothermal rapid amplification reagent purchased from Anpu Future Biotechnology Co., Ltd.; LbCas12a, crRNA, 10×CasSmart Buffer, and fluorescent probes are all from Beijing Xunshi Biotechnology Co., Ltd.

[0043] Example 4: Method for detecting Riemerella anatipestifer A non-diagnostic method for detecting Riemerella anatipestifer, this embodiment uses the kit from Example 3, and specifically includes the following steps: S1. Extraction of DNA template from the sample to be tested: Following the instructions of the DNA / RNA rapid extraction kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.), genomic DNA was extracted from the sample to be tested and used as a DNA template.

[0044] S2, MIRA amplification: First, prepare the MIRA amplification reaction solution. Each sample to be tested corresponds to one MIRA amplification reaction powder tube. The reaction system in each MIRA amplification reaction tube is 50 μL, including 15 mg of MIRA amplification reaction powder, 29.4 μL of PEG buffer, 2.5 μL of magnesium acetate, 2 μL each of forward and reverse primers (concentration of 10 μmol / L), 9.1 μL of ddH2O, and 2 μL of DNA template. After mixing, the MIRA amplification reaction solution is obtained. Then, the MIRA amplification reaction solution is briefly centrifuged to the bottom of the tube. Finally, the reaction tube is immediately placed in a constant temperature device and incubated at 39℃ for 30 min to obtain the amplification product.

[0045] S3, MIRA-CRISPR / Cas12a reaction: Using the amplification product obtained in S2 as a template, 5 μL of the amplification product was placed into a CRISPR / Cas12a reaction system, including 2 μL of LbCas12a, 0.5 μL of crRNA, 5 μL of 10×CasSmart Buffer, 0.5 μL of fluorescent probe, and 41 μL of ddH2O. The concentration of LbCas12a was 0.1 μmol / L; the concentration of crRNA was 1 ng / μL; and the concentration of the fluorescent probe was 1 μmol / L. Then, using Riemerella anatipestifer nucleic acid shown in SEQ ID NO.3 as a positive control and ddH2O as a negative control, the reaction tube of the prepared MIRA-CRISPR / Cas12a reaction system was inverted several times to mix thoroughly, and then centrifuged briefly to ensure that all the reaction solution was collected to the bottom of the tube. Finally, the reaction tube was placed in a fluorescence quantitative PCR instrument and incubated at 39℃ for 30 s for 40 cycles, and the fluorescence signal was collected.

[0046] S4. Result Determination After the reaction is complete, the results of the test sample are determined based on whether there is an amplification curve or whether the final reaction product can produce fluorescence under ultraviolet light. The determination criteria are as follows: Positive control: The appearance of an amplification curve and the final reaction product exhibiting fluorescence under ultraviolet light indicate a valid result; Negative control: No amplification curve appears, and the final reaction product does not produce fluorescence under ultraviolet light, which is a valid result; For the sample to be tested: if an amplification curve appears or the final reaction product fluoresces under ultraviolet light, the sample to be tested can be judged to be positive for Riemerella anatipestifer; if no amplification curve appears or the final reaction product does not fluoresce under ultraviolet light, the sample to be tested can be judged to be negative for Riemerella anatipestifer.

[0047] The amplification results of the positive and negative controls of this invention are as follows: Figure 3 As shown, from top to bottom are the positive control, baseline, and negative control.

[0048] Depend on Figure 3 It is evident that both the positive and negative controls of this invention yield valid results. The negative control design effectively verifies whether the reagents used are contaminated, avoiding false positives, while the positive control design effectively verifies the effectiveness of the reagents used, avoiding false negatives.

[0049] Experimental Example 1: Clinical Sample Testing Sixty-one clinical samples provided by a waterfowl farm in South China were used as test samples. qPCR and the MIRA-CRISPR / Cas12a detection method of Example 4 of this invention were used for detection, and the results were compared.

[0050] The qPCR detection method specifically includes the following steps: Genomic DNA was extracted from the sample according to the instructions of the DNA / RNA Rapid Extraction Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.), and then qPCR detection was performed using the exposed primer pair (SEQ ID NO.10 and SEQ ID NO.11) and the exposed probe (SEQ ID NO.12).

[0051] SEQ ID NO.10: 5'-CCTCACGGAGAACCTATCCC-3'; SEQ ID NO. 11: 5'-ACAGCAGCTAGTGTTACCTT-3'.

[0052] SEQ ID NO. 12: 5'-HEX-ACTCAGCGAATGTACCGAAGGCTCT-BHQ I-3'.

[0053] The qPCR reaction program was as follows: 95℃ for 3 min; denaturation at 95℃ for 15 s; annealing and extension at 60℃ for 40 s with fluorescence signal acquisition; 40 cycles.

[0054] The qPCR reaction system consisted of: RA-F (10 µmol / L) 0.8 µL, RA-R (10 µmol / L) 0.8 µL, ddH2O 6 µL, 2×qPCR Probe Master Mix 10 µL, RA-probe 0.4 µL, and template 2 μL.

[0055] The results of qPCR and MIRA-CRISPR / Cas12a assays are shown in Table 1.

[0056] Table 1 Sample test results

[0057] As shown in Table 1, the detection results of MIRA-CRISPR / Cas12a and qPCR used in this invention are highly consistent, indicating that the method of this invention has good specificity and stability. Moreover, the method of this invention can complete the detection within 50 minutes, and has the characteristics of simple operation, no need to rely on high temperature denaturation procedure, and visualization of detection results. It is more suitable for on-site mobile detection and has advantages that qPCR detection method does not have.

[0058] Experimental Example 2: Verification of Detection Sensitivity A positive standard plasmid for the 16S rRNA gene of Riemerella anatipestifer was constructed by Sangon Biotech (GenBank accession number LUDP01000018.1). The constructed positive standard plasmid was serially diluted, and the results were obtained by diluting the plasmid with 10⁻⁶ ppm. 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 10 0 Using positive standard plasmids at concentrations of 7 copies / μL as templates and ddH2O as a negative control, 2 μL of each plasmid was used as the reaction template. Nucleic acid amplification was performed according to the steps described in Example 4 to test the sensitivity of the method for detecting Riemerella anatipestifer of this invention. The detection results are as follows: Figure 4 As shown.

[0059] Depend on Figure 4 As can be seen, amplification curves appeared for all seven concentration gradients of the positive standard plasmids, and the final reaction products fluoresced under ultraviolet light, indicating that they were positive for *Rimerella anatipestifer*. The results show that the detection method of this invention can detect a minimum concentration of 10... 0 Templates with copies / μL provide high detection sensitivity.

[0060] Experimental Example 3: Validation of Detection Specificity Using the 16S rRNA of *Riemerella anatipestifer* as shown in SEQ ID NO.3 as a positive control and ddH2O as a negative control, nucleic acids of avian pathogenic *Escherichia coli*, *Salmonella enteritidis*, *Pasteurella multocida*, Muscovy duck reovirus, novel Muscovy duck reovirus, and duck Tembusu virus were detected respectively. The reactions were carried out according to the steps described in Example 4 to test the specificity of the method for detecting *Riemerella anatipestifer* of the present invention.

[0061] Test results as follows Figure 5 As shown.

[0062] Depend on Figure 5 It was found that only the experimental group corresponding to the positive control template of *Rimerella anatipestifer* showed a normal fluorescence detection curve and the amplified product fluoresced under ultraviolet light. In contrast, no amplification curve was observed in the experimental groups for other pathogens or the negative control group, and the amplified product did not fluoresce under ultraviolet light. The results indicate that the primer pairs and probes of this invention can achieve specific detection of *Rimerella anatipestifer*, and there is no cross-reactivity with the nucleic acids of avian pathogenic *Escherichia coli*, *Salmonella enteritidis*, *Pasteurella multocida*, Muscovy duck reovirus, novel Muscovy duck reovirus, and duck Tembusu virus.

[0063] In summary, the primer pairs and kits provided by this invention can achieve rapid, convenient, efficient and specific detection of Riemerella anatipestifer in samples, and can assist in the diagnosis of whether Riemerella anatipestifer infection is present. They are suitable for clinical differential detection, animal disease detection and purification.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A duck Riemerella anatipestifer 16S rRNA detection kit based on MIRA-CRISPR / Cas12a, characterized in that, The kit includes forward and reverse primers as shown in SEQ ID NO.1 and SEQ ID NO.2, a MIRA amplification reaction system, and a CRISPR / Cas12a reaction system; The CRISPR / Cas12a reaction system includes crRNA and fluorescent probes; The nucleotide sequence of the crRNA is shown in SEQ ID NO.4; The nucleotide sequence of the fluorescent probe is: 5'-FAM-TTATT-BHQ Ⅰ-3'.

2. The MIRA-CRISPR / Cas12a-based Riemerella anatipestifer 16S rRNA detection kit according to claim 1, characterized in that, The MIRA amplification reaction system includes MIRA amplification reaction dry powder, buffer, positive control, and negative control; The positive control includes the Riemerella anatipestifer 16S rRNA gene, the nucleotide sequence of which is shown in SEQ ID NO.3; The negative control includes ddH2O.

3. The MIRA-CRISPR / Cas12a-based Riemerella anatipestifer 16S rRNA detection kit according to claim 1, characterized in that, The CRISPR / Cas12a reaction system also includes LbCas12a, 10×CasSmart Buffer, and ddH2O.

4. The use of the kit according to any one of claims 1-3 in the detection of Riemerella anatipestifer for non-disease diagnostic purposes.

5. A non-disease diagnostic detection method for Riemerella anatipestifer based on MIRA-CRISPR / Cas12a, characterized in that, The kit described in any one of claims 1-3 specifically includes the following steps: S1. Extract DNA from the sample to be tested; S2. Using the DNA obtained in S1 as a template, perform MIRA amplification using the reagents in the kit to obtain the amplification product; S3. Using the amplification product obtained in S2 as a template, perform the MIRA-CRISPR / Cas12a reaction using the reagents in the kit and collect the fluorescence signal. S4. Based on the fluorescence signal obtained in S3, if an amplification curve appears or the final product fluoresces under ultraviolet light, the sample to be tested is determined to be positive for Riemerella anatipestifer; if no amplification curve appears or the final product does not fluoresce under ultraviolet light, the sample to be tested is determined to be negative for Riemerella anatipestifer.

6. The non-disease diagnostic detection method for Riemerella anatipestifer based on MIRA-CRISPR / Cas12a according to claim 5, characterized in that, In the MIRA amplification reaction system of S2, the mass-to-volume ratio of reaction powder, buffer, magnesium acetate, forward primer, reverse primer, DNA template and ddH2O is 15 mg: 29.4 μL: 2.5 μL: 2 μL: 2 μL: 9.1 μL.

7. The non-disease diagnostic detection method for Riemerella anatipestifer based on MIRA-CRISPR / Cas12a according to claim 6, characterized in that, The concentrations of both the forward and reverse primers are 5-20 μmol / L.

8. The method for detecting Riemerella anatipestifer based on MIRA-CRISPR / Cas12a for non-disease diagnostic purposes according to claim 5, characterized in that, In the reaction system of the MIRA-CRISPR / Cas12a reaction in S3, the volume ratio of LbCas12a, crRNA, 10×CasSmart Buffer, fluorescent probe, amplification product obtained in S2 and ddH2O is 2 μL:0.5 μL:5 μL:0.5 μL:1 μL:41 μL.

9. The method for detecting Riemerella anatipestifer based on MIRA-CRISPR / Cas12a for non-disease diagnostic purposes according to claim 8, characterized in that, The concentration of LbCas12a is 0.05-0.2 μmol / L; The concentration of the crRNA was 0.5-2 ng / μL; The concentration of the fluorescent probe is 0.5-2 μmol / L.

10. The non-disease diagnostic detection method for Riemerella anatipestifer based on MIRA-CRISPR / Cas12a according to claim 5, characterized in that, The reaction program for the MIRA-CRISPR / Cas12a reaction in S3 is: 39℃ for 30 s, 40 cycles.

Images