A genetically engineered strain for producing 5-methyluridine and a construction method and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and discloses a genetically engineered strain for producing 5-methyluridine as well as a construction method and application of the genetically engineered strain. E. coli The genetically engineered strain is obtained by taking Escherichia coli psu-3 as a starting strain, overexpressing a mutant thymidylate synthase gene, a mutant ribose-5-phosphate pyrophosphokinase, a mutant glutamine synthetase, an aspartate transaminase, a serine hydroxymethyltransferase and a dihydrofolate reductase, and not expressing UMP phosphatase and pyrimidine nucleotidase. The application starts from the genomic level of Escherichia coli, mainly uses metabolic engineering technology, overexpresses a heterologous thymidylate synthase, strengthens the PRPP pathway, and strengthens the supply of UMP precursors, glutamine and aspartate to comprehensively optimize the combination, so that the fermentation performance of the strain for producing 5-methyluridine is improved. The strain has high 5-methyluridine yield, stable production performance, and can be used for producing 5-methyluridine.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the breeding of industrial microorganisms, especially a genetically engineered strain for producing 5-methyluridine, its construction method and application. Background Technology

[0002] 5-Methyluridine, also known as 5-methyluridine nucleoside or ribothymidine, has the molecular formula C5. 10 H 14 N2O6-5-methyluridine is a pyrimidine nucleoside, a 5-methylated derivative of uracil nucleoside, with the ribose linked to the N1 of thymine to form a β-D-furanose ribosyl structure. 5-Methyluridine is one of the common nucleosides used to modify RNA, and it is highly conserved at position 54 of the TΨC loop in tRNA, playing a crucial role in maintaining the spatial structure of tRNA and ensuring correct translation. Replacing uridine with 5-methyluridine or its analogues in mRNA can effectively reduce the immunogenicity of mRNA, preventing its recognition and clearance by the innate immune system, while significantly prolonging the in vivo protein expression window. This has significant application value in mRNA vaccine development, tumor immunotherapy, and protein replacement therapy. Furthermore, 5-methyluridine, as a nucleoside pharmaceutical intermediate, is an important intermediate for antiviral drugs such as zidovudine, stavudine, and allovudine, and is also a starting material for the synthesis of the antitumor and antiviral drug β-thymidine. Furthermore, 5-methyluridine, as an RNA metabolite in urine, has potential applications in clinical diagnosis due to changes in its excretion levels that can be used to monitor tumor development and progression. With the rapid development of the mRNA vaccine industry and the continued expansion of the antiviral drug market, the market demand for 5-methyluridine is increasing rapidly, creating an urgent need to develop inexpensive, green, and scalable production processes for 5-methyluridine.

[0003] The main methods for producing 5-methyluridine include chemical synthesis, enzymatic catalysis, and microbial fermentation. Chemical synthesis typically uses thymine and tetraacetylribose as starting materials, proceeding through silanyl methylation protection and condensation reactions, followed by alcoholysis to obtain the target product. In recent years, through continuous process optimization, the overall yield of chemical synthesis can reach over 90%. However, the synthesis process requires the use of protecting groups such as trimethylsilane, involves multiple steps and the generation of harmful byproducts, resulting in significant environmental pollution, and the post-processing is complex. Enzymatic catalysis utilizes nucleoside phosphorylase to catalyze the transglycosylation reaction between ribose donors and thymine to synthesize 5-methyluridine. The reaction conditions are mild and highly specific, but the reaction process requires high purity of raw materials and high enzyme activity, and the separation and recycling of enzymes are challenging and costly. Compared with the above methods, microbial fermentation has advantages such as simple process, readily available raw materials, low cost, and environmental friendliness, and is expected to become a new development direction for 5-methyluridine production. For example, Chinese patent publication CN 114410555A describes a method that knocks out the...rihC , rihB , rihA , deoA , udp , tdk By introducing UMP 5-methyltransferase and alkaline phosphatase genes from Streptomyces into genes related to nucleoside metabolism, an engineered strain capable of producing 5-methyluridine was constructed, with a fermentation yield of 10.71 g / L.

[0004] To increase the fermentation yield of 5-methyluridine, this invention uses overexpression pyr operon E. coli E. coli Using psu-3 as the starting strain, the 5-methyluridine synthesis pathway, precursor supply, methylation modification pathway, and branched metabolic pathway were systematically optimized, resulting in a genetically engineered strain capable of high-yield 5-methyluridine and providing corresponding fermentation methods.

[0005] A search revealed no patent publications related to this invention's patent application. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a genetically engineered strain for producing 5-methyluridine, its construction method, and its application.

[0007] The technical solution adopted by this invention to solve its technical problem is: A genetically engineered strain that produces 5-methyluridine, said strain being overexpressed pyr operon E. coli E. coli psu-3 was derived from a starting strain (construction method can be found in Chinese patent document CN 115806926B), which overexpressed a mutant thymidine synthase gene, a mutant ribose-5-phosphate pyrophosphate synthase, a mutant glutamine synthase, an aspartate transaminase, a serine hydroxymethyltransferase, and a dihydrofolate reductase, and did not express UMP phosphatase and pyrimidine nucleotidase.

[0008] Furthermore, the mutated thymidine synthase is from Streptomyces. STVIR_4548 L113V,S115P Gene-encoded proteins, among which, Streptomyces STVIR_4548 L113V,S115P The nucleotide sequence of the gene is SEQ ID NO.1; The UMP phosphatase is from Escherichia coli. ushA Genes and surE Gene-encoded proteins; among them, Escherichia coli ushA The gene's accession number is NCBI-Gene ID:947331. surEThe gene's accession number is NCBI-Gene ID:947211; The pyrimidine nuclease is Escherichia coli. yjjG Gene-encoded proteins, among which, yjjG The gene's accession number is NCBI-Gene ID:948899; The mutated ribo-5-phosphate pyrophosphate synthase is from *Escherichia coli*. prs D129A Gene-encoded proteins, among which, E. coli prs D129A The nucleotide sequence of the gene is SEQ ID NO.2; The mutated glutamine synthase is from Bacillus subtilis. glnA L159I,E304A Gene-encoded proteins, among which Bacillus subtilis glnA L159I,E304A The nucleotide sequence of the gene is SEQ ID NO.3; The aspartate transaminase is from Escherichia coli. aspC Gene-encoded proteins; among them, Escherichia coli aspC The gene's accession number is NCBI-Gene ID:945553; The serine hydroxymethyltransferase is from Escherichia coli. glyA Gene-encoded proteins; among them, Escherichia coli glyA The gene's accession number is NCBI-Gene ID:947022; The dihydrofolate reductase is Escherichia coli. folA Gene-encoded proteins; among them, Escherichia coli folA The gene's accession number is NCBI-Gene ID:944790.

[0009] Furthermore, "not expressed" means that the amount of the gene expression product is significantly lower than the original level; for example, significantly reduced by 50%, 60%, 70%, 80%, 90%, or 100%.

[0010] Overexpression refers to a significant increase in the amount of the gene's expression product compared to its original level. For example, a significant increase of 50%, 60%, 70%, 80%, 90%, or 100%.

[0011] Furthermore, the gene for the thymidine synthase is linked to a promoter P. trc ; and / or The gene for the ribose-5-phosphate pyrophosphate synthase is linked to a promoter P. trc ; and / or The gene for glutamine synthase is linked to the promoter P. trc ; and / or The aspartate transaminase gene is linked to the promoter P. trc ; and / or The gene for the UMP phosphatase is linked to the promoter P. trc ; and / or The gene for the pyrimidine nuclease is linked to a promoter P. trc ; and / or The serine hydroxymethyltransferase gene is linked to the promoter P. trc ; and / or The gene for dihydrofolate reductase is linked to a promoter P. trc .

[0012] The method for constructing the genetically engineered strain as described above includes the following steps: The strain was obtained by overexpressing mutant thymidine synthase, mutant ribose-5-phosphate pyrophosphate synthase, mutant glutamine synthase, aspartate transaminase, serine hydroxymethyltransferase, and dihydrofolate reductase in the starting strain, while not expressing UMP phosphatase and pyrimidine nucleotidase.

[0013] Furthermore, it includes the following steps: Overexpression of the Streptomyces-derived thymidylate synthase gene in the starting strain STVIR_4548 L113V,S115P Overexpression of E. coli-derived 5-phosphate pyrophosphate synthase gene prs D129A Overexpression of Bacillus subtilis-derived glutamine synthase gene glnA L159I,E304A Gene, overexpression of E. coli-derived aspartate transaminase gene aspC Overexpression of serine hydroxymethyltransferase glyA Overexpression of dihydrofolate reductase folA Knockout or inactivation of the E. coli-derived UMP phosphatase gene ushA Genes and surE Gene, knockout or inactivation of E. coli-derived pyrimidine nuclease gene yjjG .

[0014] Furthermore, the specific steps are as follows: (1) The mutated thymidine synthase gene STVIR_4548 L113V,S115P Linked to plasmid pTrc99a Δ lacI Plasmid U1 and plasmid pTrc99a Δ were obtained. lacI The nucleotide sequence is SEQ ID NO.5; (2) The UMP phosphatase gene ushA and surEFrom the originating bacteria E. coli Knockout or inactivation in psu-3 yielded recombinant strains MU1 and MU2 in sequence; (3) The pyrimidine nuclease gene yjjG Recombinant strain MU3 was obtained by knocking out or inactivating recombinant strain MU2; (4) The mutated ribose-5-phosphate pyrophosphate synthase gene prs D129A Fragment Ptrc fused with promoter Ptrc -prs D129A Integration into recombinant strain MU3 lfhA Pseudogene loci were identified to obtain recombinant strain MU4. (5) The gene of the mutated glutamine synthase glnA L159I,E304A Fusion fragment Ptrc with promoter Ptrc- glnA Integrating into recombinant strain MU4 yeel Pseudogene loci were identified to obtain recombinant strain MU5. (6) The mutated aspartate transaminase gene aspC Fusion fragment Ptrc with promoter Ptrc- aspC Integration into recombinant strain MU5 yjiv Pseudogene loci were identified to obtain recombinant strain MU6. (7) The serine hydroxymethyltransferase gene glyA Fusion fragment Ptrc with promoter Ptrc- glnA Integrated into recombinant strain MU6 rph Pseudogene loci were identified to obtain recombinant strain MU7. (8) The dihydrofolate reductase gene folA Fusion fragment Ptrc with promoter Ptrc- folA Integrating into recombinant strain MU7 ydeU Pseudogene loci were identified to obtain recombinant strain MU8. (9) Electroporate the plasmid U1 constructed in step (1) into recombinant strains MU1 to MU8 to obtain recombinant strains MU9 to MU16; The nucleotide sequence of the promoter Ptrc is shown in SEQ ID NO.4.

[0015] The application of the genetically engineered strains described above in the fermentation production of 5-methyluridine.

[0016] The method for producing 5-methyluridine by fermentation using the genetically engineered strain described above includes the following steps: The genetically engineered strain was cultured under suitable conditions, and 5-methyluridine was collected from its culture to obtain 5-methyluridine; The suitable conditions refer to a culture temperature of 37 ℃, a pH maintained at 7.0±0.5, dissolved oxygen between 25% and 35%, and culture in a fermentation medium for 48 hours. The composition of the fermentation medium is as follows: Glucose 20-25 g / L, yeast extract 4-8 g / L, peptone 5-10 g / L, sodium citrate 1-5 g / L, KH₂PO₄ 2-4 g / L, MgSO₄·7H₂O 1.2-2.0 g / L, FeSO₄·7H₂O 20-30 mg / L, MnSO₄·7H₂O 10-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2, and sterilized at 121℃ for 20 min.

[0017] Furthermore, the specific steps are as follows: (1) Slant activation culture: The genetically engineered strain stored at -80 ℃ was streaked onto the activation slant culture medium, cultured at 37 ℃ for 12 h, and then transferred to a flask for further culture for 12-16 h. (2) Seed culture: Take sterile water into an eggplant-shaped bottle, inoculate the bacterial suspension into the seed culture medium, stabilize the pH at around 7.0, keep the temperature constant at 37 ℃, and keep the dissolved oxygen between 25-35%, and culture until the cell dry weight reaches 5-6 g / L; (3) Fermentation culture: Inoculate fresh fermentation medium at an inoculation rate of 15-20% and start fermentation. During the fermentation process, control the pH to be stable at around 7.0, maintain the temperature at 37 ℃, and the dissolved oxygen at 25-35%. After the glucose in the medium is consumed, add 80% glucose solution to maintain the glucose concentration in the fermentation medium at 0.1-2 g / L. The culture time is 48h. The slant culture medium is formulated as follows: glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L, sodium chloride 1-2.5 g / L, agar 25-30 g / L, with the remainder being water, pH 7.0-7.2, and sterilized at 121℃ for 20 min.

[0018] The seed culture medium formula is as follows: glucose 20-25 g / L, yeast powder 4-8 g / L, peptone 1-5 g / L, KH2PO4 1-4 g / L, MgSO4·7H2O 1.2-2.0 g / L, the remainder being water, pH 7.0-7.2, and sterilized at 121℃ for 20 min.

[0019] The fermentation medium formula is as follows: glucose 20-25 g / L, glycerol 5-10 g / L, yeast extract 4-8 g / L, corn steep liquor 5-10 g / L, sodium citrate 1-5 g / L, KH2PO4 2-4 g / L, glycine 4-6 g / L, MgSO4·7H2O 1.2-2.0 g / L, FeSO4·7H2O 20-30 mg / L, MnSO4·7H2O 10-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2, and sterilized at 121℃ for 20 min.

[0020] The advantages and positive effects of this invention are as follows: 1. This invention relates to a genetically engineered strain that heterologously overexpresses thymidine synthase, ribose-5-phosphate pyrophosphate synthase, glutamine synthase, aspartate transaminase, serine hydroxymethyltransferase, and dihydrofolate reductase, but does not express UMP phosphatase or pyrimidine nucleotidase. Starting from the *E. coli* genome level, this invention primarily utilizes metabolic engineering techniques to systematically and comprehensively optimize the combination of heterologous thymidine synthase overexpression, enhanced PRPP pathway, and improved supply of UMP precursors, glutamine, and aspartate, thereby improving the 5-methyluridine fermentation performance of the strain. This genetically engineered strain exhibits high 5-methyluridine yield, stable production performance, and can be used for 5-methyluridine production.

[0021] 2. Natural thymidine synthase specifically acts on deoxyribonucleotides, resulting in extremely low efficiency in the core step of direct methylation of uridine. This invention utilizes the streptococcal thymidine synthase gene STVIR_4548 and introduces double-point mutations (L113V and S115P) (SEQ ID NO.1) to enable it to efficiently catalyze the methylation of UMP to generate 5-methyluridine, overcoming the core bottleneck of substrate specificity limitation of natural enzymes. In contrast, existing technologies mostly employ wild-type thymidine synthase or flavin-dependent thymidine synthase (…). ThyX This does not involve the specific two-point mutation modification described in this invention.

[0022] 3. PRPP synthase is subject to strict feedback inhibition by ADP / ATP, making it a key rate-limiting step in precursor supply. This invention utilizes... prs The mutant gene (SEQ ID NO.2) effectively relieves the feedback inhibition of ADP / ATP, enhancing the catalytic conversion of ribose-5-phosphate to PRPP; glutamine is an important precursor for UMP synthesis, and its synthase is subject to feedback regulation by adenylate modification. This invention utilizes Bacillus subtilis-derived... glnA The double-point mutant gene (SEQ ID NO.3) effectively removes adenylate modification, improving the utilization rate of glutamine in *E. coli*. While some existing technologies utilize this method... prs D129A、 glnA L159I,E304A While there are reports of the mutant gene being used in the production of other products, there are no reports of systematically integrating the mutation into the 5-methyluridine production system and applying it in synergy with other modification strategies.

[0023] 4. In terms of precursor supply enhancement, this invention achieves a synergistic transformation from PRPP to UMP. Simultaneously, it knocks out… ushA , surE , yjjG Three genes comprehensively block the three branches of UMP degradation pathways; integration prs D129A Point mutations were used to relieve the ADP / ATP feedback inhibition of PRPP synthase; Bacillus subtilis-derived... glnA L159I,E304A Double-point mutations were used to deactivate the negative regulation of adenylation in glutamine synthase; and overexpression was performed. aspC This aims to enhance the supply of aspartic acid. No reports have been found regarding the synergistic modification of the aforementioned precursor supplies in the production of 5-methyluridine.

[0024] 5. The methylation modification of 5-methyluridine requires 5,10-methylenetetrahydrofolate as a methyl donor. This invention simultaneously overexpresses... glyA Genes and folA The gene system enhances the cyclical supply of methyl donors. Among them... glyA Strengthening the conversion of serine to glycine to generate 5,10-methylenetetrahydrofolate. folA Maintaining the tetrahydrofolate cycle and regeneration, both enhance the supply of methyl donors, unlike existing technologies that only overexpress a single gene. glyA The transformation model.

[0025] 6. This invention utilizes rational metabolic engineering to obtain engineered strains with a clear genetic background, using inexpensive carbon sources such as glucose as substrates, and efficiently synthesizing 5-methyluridine de novo. From a construction strategy perspective, this invention employs metabolic engineering techniques to systematically and comprehensively optimize the combination of overexpression of heterologous thymidylate synthase, enhancement of the PRPP pathway, and enhancement of the supply of UMP precursor, glutamine, and aspartate. The overall metabolic modification strategy (see...) Figure 1 No relevant reports were found. The obtained engineered strain can efficiently produce 5-methyluridine, showing good prospects for industrial application. Finally, the MU9 genetically engineered strain obtained in this invention achieved a 5-methyluridine yield of 22.7 g / L in a 5L fermenter after 48 hours, which is significantly better than the 10.71 g / L level reported in the prior art, fully demonstrating the effectiveness and advancement of the combined metabolic strategy of this invention. Attached Figure Description

[0026] Figure 1 This is a diagram illustrating the metabolic modification strategy of the 5-methyluridine engineered strain in this invention. Figure 2 Knockout in this invention ushA Electrophoresis diagrams for fragment construction and validation; where: M: 10kb DNA Marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: overlapping fragment; 4: original bacterial PCR fragment; 5: positive single colony PCR identification fragment; Figure 3 Knockout in this invention surE Electrophoresis diagrams for fragment construction and validation; where: M: 10kb DNA Marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: overlapping fragment; 4: original bacterial PCR fragment; 5: positive single colony PCR identification fragment; Figure 4 Knockout in this invention yjjG Electrophoresis diagrams for fragment construction and validation; where: M: 10kb DNA Marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: overlapping fragment; 4: original bacterial PCR fragment; 5: positive single colony PCR identification fragment; Figure 5 In this invention prs D129A Electrophoresis diagram of gene integration fragment construction and validation; where: M: 10kb DNA Marker; 1: upstream homologous arm; 2: prs D129A Fragment; 3: Downstream homologous arm; 4: Overlapping fragment; 5: Original bacterial PCR fragment; 6: Positive single colony PCR identification fragment; Figure 6 In this invention glnA L159I,E304AElectrophoresis diagram of gene integration fragment construction and validation; where: M: 10kb DNA Marker; 1: upstream homologous arm; 2: glnA L159I,E304A Fragment; 3: Downstream homologous arm; 4: Overlapping fragment; 5: Original bacterial PCR fragment; 6: Positive single colony PCR identification fragment; Figure 7 In this invention aspC Electrophoresis diagram of gene integration fragment construction and validation; where: M: 10kb DNA Marker; 1: upstream homologous arm; 2: aspC Fragment; 3: Downstream homologous arm; 4: Overlapping fragment; 5: Original bacterial PCR fragment; 6: Positive single colony PCR identification fragment; Figure 8 In this invention glyA Integrated fragment construction and validation electrophoresis diagram; where: M: 10kb DNA Marker; 1: upstream homology arm; 2: glyA Fragment; 3: Downstream homologous arm; 4: Overlapping fragment; 5: Original bacterial PCR fragment; 6: Positive single colony PCR identification fragment; Figure 9 In this invention folA Integrated fragment construction and validation electrophoresis diagram; where: M: 10kb DNA Marker; 1: upstream homology arm; 2: folA Fragment; 3: Downstream homologous arm; 4: Overlapping fragment; 5: Original bacterial PCR fragment; 6: Positive single colony PCR identification fragment; Figure 10 This is a graph showing the fermentation process in a 5 L fermenter in Example 4 of this invention. Figure 11 The image shows the high performance liquid chromatogram of the standard sample in this invention, where the peak at 9.108 min is 5-methyluridine. Figure 12 This is a high-performance liquid chromatogram of the fermentation broth in this invention, where the peak at 9.149 min is 5-methyluridine. Detailed Implementation

[0027] The present invention will be further described below with reference to the embodiments. The embodiments described below are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0028] The various experimental operations involved in the specific embodiments are all conventional techniques in the art. For parts not specifically annotated herein, those skilled in the art can refer to various commonly used reference books, scientific and technological literature, or related instructions and manuals prior to the filing date of this invention for implementation. The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0029] A genetically engineered strain that produces 5-methyluridine, wherein the genetically engineered strain heterologously overexpresses thymidylate synthase, overexpresses ribose-5-phosphate pyrophosphate synthase, overexpresses glutamine synthase, overexpresses aspartate transaminase, overexpresses serine hydroxymethyltransferase, overexpresses dihydrofolate reductase, and does not express UMP phosphatase or pyrimidine nucleotidase.

[0030] Preferably, the thymidine synthase is from Streptomyces. STVIR_4548 L113V,S115P The gene, whose nucleotide sequence is SEQ ID NO.1; The UMP phosphatase is from Escherichia coli. ushA Gene (NCBI-Gene ID:947331) and surE The protein encoded by the gene (NCBI-Gene ID: 947211); The pyrimidine nuclease is Escherichia coli. yjjG The protein encoded by the gene (NCBI-Gene ID: 948899); The ribo-5-phosphate pyrophosphate synthase is from *Escherichia coli*. prs D129A Mutant genes, such as the protein encoded by SEQ ID NO.2; The glutamine synthase is Bacillus subtilis. glnA L159I,E304A The protein encoded by gene SEQ ID NO.3; The aspartate transaminase is from Escherichia coli. aspC The protein encoded by the gene (NCBI-Gene ID:945553).

[0031] The serine hydroxymethyltransferase is from Escherichia coli. glyA The protein encoded by the gene (NCBI-Gene ID: 947022); The dihydrofolate reductase is Escherichia coli. folA The protein encoded by the gene (NCBI-Gene ID: 944790); Preferably, Streptomyces STVIR_4548 L113V,S115PThe gene nucleotide sequence is as shown in SEQ ID NO.1, and the fusion fragment Ptrc- with the promoter Ptrc. STVIR_4548 L113V,S115P Linked to plasmid pTrc99a Δ lacI Plasmid U1 was obtained.

[0032] The gene for thymidine synthase STVIR_4548 L113V,S115P Plasmid U1 was obtained by linking plasmid pTrc99a ΔlacI.

[0033] The thymidine synthase gene is linked to the promoter P. trc ; and / or The gene for the ribose-5-phosphate pyrophosphate synthase is linked to a promoter P. trc ; and / or The gene for glutamine synthase is linked to the promoter P. trc ; and / or The aspartate transaminase gene is linked to the promoter P. trc ; and / or The gene for the UMP phosphatase is linked to the promoter P. trc ; and / or The gene for the pyrimidine nuclease is linked to a promoter P. trc ; and / or The serine hydroxymethyltransferase gene is linked to the promoter P. trc ; and / or The gene for dihydrofolate reductase is linked to a promoter P. trc .

[0034] Wherein, the promoter P trc The nucleotide sequence is shown in SEQ ID NO.4.

[0035] Preferably, the starting strain used in the construction of the genetically engineered strain is E. coli psu3 (for details, please refer to Chinese Patent Publication CN115806926,) E. coli psu3 has been disclosed in Chinese patent publication document CN115806926.

[0036] Preferably, the *Escherichia coli* is... E. coli W3110.

[0037] The method for constructing genetically engineered strains as described above, such as Figure 1 As shown, the method includes the following steps: Overexpression of the Streptomyces-derived thymidylate synthase gene in the starting strain STVIR_4548 L113V,S115POverexpression of E. coli-derived 5-phosphate pyrophosphate synthase gene prs D129A Overexpression of Bacillus subtilis-derived glutamine synthase gene glnA L159I,E304A Gene, overexpression of E. coli-derived aspartate transaminase gene aspC Overexpression of serine hydroxymethyltransferase glyA Overexpression of dihydrofolate reductase folA Knockout or inactivation of the E. coli-derived UMP phosphatase gene ushA Genes and surE Gene, knockout or inactivation of E. coli-derived pyrimidine nuclease gene yjjG The genetically engineered bacteria heterologously overexpress thymidine synthase, ribose-5-phosphate pyrophosphate synthase, glutamine synthase, aspartate transaminase, serine hydroxymethyltransferase, and dihydrofolate reductase, but do not express UMP phosphatase or pyrimidine nucleotidase.

[0038] Preferably, the method for constructing the recombinant Escherichia coli strain includes the following steps: Overexpression of the streptococcal thymidylate synthase gene in the starting strain STVIR_4548 L113V,S115P Overexpression of E. coli-derived ribose-5-phosphate pyrophosphate synthase gene prs D129A Overexpression of Bacillus subtilis-derived glutamine synthase gene glnA L159I,E304A Gene, overexpression of E. coli-derived aspartate transaminase gene aspC Knockout or inactivation of the E. coli-derived UMP phosphatase gene ushA Genes and s urE Gene, knockout or inactivation of E. coli-derived pyrimidine nuclease gene yjjG .

[0039] Preferably, the method includes the following steps: (1) The gene for the thymidine synthase STVIR_4548 L113V,S115P Plasmid U1 was obtained by linking plasmid pTrc99a ΔlacI; (2) The gene encoding UMP phosphatase ushA and surE From the starting strain E. coli Knockout or inactivation in psu-3 yielded recombinant strains MU1 and MU2; (3) The gene encoding the pyrimidine nuclease yjjG Recombinant strain MU3 was obtained by knocking out or inactivating recombinant strain MU2; (4) The gene encoding ribose-5-phosphate pyrophosphate synthase prs D129A Fusion fragment Ptrc with promoter Ptrc- prs D129A Integration into recombinant strain MU3 lfhA Pseudogene loci were identified to obtain recombinant strain MU4. (5) The gene encoding glutamine synthase glnA L159I,E304A Fusion fragment Ptrc with promoter Ptrc- glnA L159I,E304A Integrating into recombinant strain MU4 yeel Pseudogene loci were identified to obtain recombinant strain MU5. (6) The gene encoding aspartate transaminase aspC Fusion fragment Ptrc with promoter Ptrc- aspC Integration into recombinant strain MU5 yjiv Pseudogene loci were identified to obtain recombinant strain MU6. (7) The gene encoding serine hydroxymethyltransferase glyA Fusion fragment Ptrc with promoter Ptrc- glnA Integrated into recombinant strain MU6 rph Pseudogene loci were identified to obtain recombinant strain MU7. (8) The gene encoding dihydrofolate reductase folA Fusion fragment Ptrc with promoter Ptrc- folA Integrating into recombinant strain MU7 ydeU Pseudogene loci were identified to obtain recombinant strain MU8. (9) Electroporation transformation of plasmid U1 constructed in (1) into recombinant strain MU8 to obtain recombinant strain MU9.

[0040] The nucleotide sequence of the promoter Ptrc is shown in SEQ ID NO.4.

[0041] Such as the application of the genetically engineered strains mentioned above in the fermentation production of 5-methyluridine.

[0042] A method for producing 5-methyluridine by fermentation using the genetically engineered strain described above, the method comprising the following steps: The genetically engineered strain was cultured under suitable conditions, and 5-methyluridine was collected from its culture to obtain 5-methyluridine; The suitable conditions refer to a culture temperature of 37 ℃, a pH maintained at 7.0±0.5, dissolved oxygen between 25% and 35%, and a culture medium composition of: Glucose 20-25 g / L, glycerol 5-10 g / L, yeast powder 4-8 g / L, corn steep liquor 5-10 g / L, sodium citrate 1-5 g / L, KH2PO4 2-4 g / L, glycine 4-6 g / L, MgSO4·7H2O 1.2-2.0 g / L, FeSO4·7H2O 20-30 mg / L, MnSO4·7H2O 10-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2.

[0043] Specifically, the relevant preparation and testing methods are as follows: A genetically engineered strain of *Escherichia coli* heterologously overexpresses a thymidylate synthase gene derived from *Streptomyces* in the original strain. STVIR_4548 L113V,S115P Overexpression of E. coli-derived ribose-5-phosphate pyrophosphate synthase gene prs D129A Overexpression of Bacillus subtilis-derived glutamine synthase gene glnA L159I,E304A Gene, overexpression of E. coli-derived aspartate transaminase gene aspC Overexpression of serine hydroxymethyltransferase glyA Overexpression of dihydrofolate reductase folA Knockout or inactivation of the E. coli-derived UMP phosphatase gene ushA Genes and s urE Gene, knockout or inactivation of E. coli-derived pyrimidine nuclease gene yjjG .

[0044] Preferably, the thymidine synthase is STVIR_4548 L113V,S115P The nucleotide sequence is SEQ ID NO.1; Preferably, the UMP phosphatase is ushA Gene (NCBI-Gene ID:947331) and s urE The protein encoded by the gene (NCBI-Gene ID:947211).

[0045] Preferably, the pyrimidine nuclease is yjjG The protein encoded by the gene (NCBI-Gene ID:948899).

[0046] Preferably, the ribose-5-phosphate pyrophosphate synthase prs D129A The gene is shown in SEQ ID NO.2.

[0047] Preferably, the glutamine synthase glnA L159I,E304A The gene is shown in SEQ ID NO.3.

[0048] Preferably, the aspartate transaminase is aspC The protein encoded by the gene (NCBI-Gene ID:945553).

[0049] Preferably, the serine hydroxymethyltransferase is glyA The protein encoded by the gene (NCBI-Gene ID: 947022); Preferably, the dihydrofolate reductase is folA The protein encoded by the gene (NCBI-Gene ID:944790).

[0050] According to the present invention, the method of not expressing the above-mentioned gene can be carried out by conventional means in the art, for example, by inactivating or knocking out the gene by conventional means in the art, and by constructing a recombinant plasmid by conventional means in the art.

[0051] According to the present invention, "not expressed" means that the amount of the gene expression product is significantly lower than the original level, for example, significantly reduced by 50%, 60%, 70%, 80%, 90%, or 100%.

[0052] According to the present invention, the overexpression of the above-mentioned gene can be carried out by conventional means in the art, such as increasing the copy number of the gene or connecting the gene to a strong promoter.

[0053] According to the present invention, overexpression refers to the amount of the gene expression product being significantly higher than the original level. For example, a significant increase of 50%, 60%, 70%, 80%, 90%, or 100%.

[0054] According to a preferred embodiment of the present invention, the thymidine synthase gene STVIR_4548 L113V,S115P Connected to the starter P trc ; and / or the ribose-5-phosphate pyrophosphate synthase gene prs D129A Connected to the starter P trc ; and / or the glutamine synthase gene glnA L159I,E304A Connected to the starter P trc ; and / or aspartate transaminase gene aspC Connected to the starter P trc ; and / or the serine hydroxymethyltransferase glyA Connected to the starter P trc; and / or the dihydrofolate reductase folA Connected to the starter P trc Preferably, the nucleotide sequence of the promoter is shown in SEQ ID NO.4.

[0055] According to the present invention, the starting strain used to construct the genetically engineered Escherichia coli strain is E. coli PSU-3 (for details, please refer to Chinese Patent Publication CN115806926B).

[0056] The method for constructing Escherichia coli genetically engineered strains as described above includes: overexpressing Streptomyces-derived thymidylate synthase in the starting strain. STVIR_4548 L113V,S115P Overexpression of E. coli-derived 5-phosphate pyrophosphate synthase gene prs D129A Overexpression of Bacillus subtilis-derived glutamine synthase gene glnA L159I,E304A Gene, overexpression of E. coli-derived aspartate transaminase gene aspC Overexpression of serine hydroxymethyltransferase glyA Overexpression of dihydrofolate reductase folA Knockout or inactivation of the E. coli-derived UMP phosphatase gene ushA Genes and s urE Gene, knockout or inactivation of E. coli-derived pyrimidine nuclease gene yjjG .

[0057] The selection of the aforementioned genes, promoters, and starting strains has been described in detail above, and will not be repeated here.

[0058] One specific implementation of the method includes: enhancing the supply of UMP, enhancing the supply of PRPP, glutamine and aspartic acid, and modifying and optimizing the methylation pathway.

[0059] (1) Strengthen the supply of UMP by E. coli The starting strain was psu-3 (for details, please refer to Chinese Patent Publication CN115806926), and the endogenous UMP phosphatase gene of E. coli was knocked out. ushA and s urE and pyrimidine nucleases yjjG The gene weakens the pathway that catalyzes the dephosphorylation of UMP to uracil nucleoside; it blocks the branching pathway from UMP to uridine to increase the level of intracellular UMP.

[0060] (2) Strengthen the supply of PRPP, glutamine and aspartic acid. The endogenous ribo-5-phosphate pyrophosphate synthase gene in E. coliprs D129A With promoter P trc fusion fragment P trc - prs D129A Integration lfhA The pseudogene site better relieves the feedback inhibition of ADP / ATP, enhancing the catalytic conversion of ribose-5-phosphate to PRPP; and utilizes glutamine synthase from Bacillus subtilis. glnA L159I,E304A Genes and promoters P trc fusion fragment P trc - glnA L159I,E304A Integration yeel Pseudogene sites, undoing adenylate modification, and improving glutamine utilization in E. coli; [the text abruptly shifts to a seemingly unrelated topic:] ...endogenous aspartate transaminase gene in E. coli... aspC With promoter P trc fusion fragment P trc - aspC Integration yjiv The pseudogene site enhances the oxaloacetate-to-aspartate conversion pathway, thereby increasing the supply of aspartate. The principle behind the above construction process of this invention can be found in [reference needed]. Figure 1 As shown.

[0061] (3) Modify and optimize methylation pathways The thymidine synthase gene of Streptomyces STVIR_4548 L113V,S115P With promoter P trc fusion fragment P trc - STVIR_4548 L113V,S115P Connect to pTrc99a Δ lacI Plasmid U1 was obtained from the plasmid; this step enhanced the catalytic pathway of uridine methylation to 5-methyluridine methylation, promoting the synthesis of 5-methyluridine; and the endogenous serine hydroxymethyltransferase in E. coli was used. glyA With promoter P trc fusion fragment P trc - glyA Integration rph Pseudogene loci, which introduce endogenous serine hydroxymethyltransferases from E. coli folA With promoter P trc fusion fragment P trc - folA Integration ydeU The pseudogene locus enhances the conversion of dihydrofolate to 5,10-methylenetetrahydrofolate, strengthens the supply of more methyl groups in the 5,10-methylenetetrahydrofolate cycle, and promotes the synthesis of 5-methyluridine.

[0062] The application of the genetically engineered Escherichia coli strain described above in high-yield production of 5-methyluridine includes: culturing the genetically engineered strain under suitable conditions and collecting 5-methyluridine from its culture.

[0063] In a preferred embodiment, the suitable conditions refer to a culture temperature of 37 °C, a pH maintained at 7.0 ± 0.5, dissolved oxygen between 25% and 35%, and a culture medium composition of: glucose 20-25 g / L, glycerol 5-10 g / L, yeast extract 4-8 g / L, corn steep liquor 5-10 g / L, sodium citrate 1-5 g / L, KH₂PO₄ 2-4 g / L, glycine 4-6 g / L, MgSO₄·7H₂O 1.2-2.0 g / L, FeSO₄·7H₂O 20-30 mg / L, MnSO₄·7H₂O 10-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2.

[0064] The present invention will now be described in more detail through specific embodiments. In the following embodiments: Unless otherwise specified, the gene editing methods involved in the embodiments of this invention refer to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli The procedure was performed using CRISPR-Cas9 meditated genome editing. Metabolic engineering, 2015, 31:13-21. Other specific operational methods involving molecular biology and genetic engineering can be implemented using technical manuals, textbooks, or literature reports that are readily available to those in the field.

[0065] Example 1: Construction of recombinant plasmid U1 In this embodiment, the gene for thymidine synthase STVIR_4548 L113V,S115P Linked to plasmid pTrc99a Δ lacI Plasmid U1 was obtained from (SEQ ID NO.5), and the transcriptional expression of the exogenous gene was initiated by the promoter Ptrc to construct plasmid U1.

[0066] 1. Construction of constitutive plasmids The pTrc99a plasmid used in this invention contains a lactose operon repressor. lacITo express this gene, isopropyl β-D-thiogalactoside (IPTG) is required for induction. However, IPTG easily affects bacterial growth; therefore, the constitutive plasmid pTrc99aΔ was constructed instead. lacI By designing primers with ApaI restriction sites at both ends, PCR was used to amplify a gene containing... lacI The linearized pTrc99a vector was then circularized by the recombinase Exnase® II to construct the constitutive plasmid pTrc99a ΔlacI, the sequence of which is shown in SEQ ID NO.5.

[0067] 2. Construction of recombinant plasmid U1 Based on the desired overexpression of the thymidine synthase gene STVIR_4548 L113V,S115P Select enzyme cleavage sites XbaI and SpeI For plasmid pTrc99a Δ lacI (SEQ ID NO.5 is its sequence) was double-digested; gene synthesis was performed. STVIR_ 4548 L113V,S115P PCR amplification was used to obtain [the following]: XbaI and SpeI The target gene fragment containing restriction enzyme sites and the Ptrc promoter (SEQ ID NO.4 is its sequence) was obtained; the PCR product was purified using a direct recovery kit, and the restriction enzyme products were purified using a gel recovery kit. The obtained target gene fragment was then compared with the linearized plasmid pTrc99a after double restriction enzyme digestion. ΔlacI Homologous recombination was performed using the recombinase Exnase® II, followed by transformation into E. coli DH5α competent cells. After screening and colony PCR identification, cells containing thymidine synthase were obtained. STVIR_4548 L113V,S115P The recombinant plasmid U1.

[0068] Example 2: Construction of recombinant strain MU9 1. Gene Editing Methods This invention employs a CRISPR / Cas9-mediated gene editing method, which can be referenced in the literature (Metabolic Engineering, 2015, 31: 13-21.). CRISPR / Cas9 is a precise and efficient novel gene-targeting modification technology. The two plasmids used in this method are pgRB and pREDCas9. The pREDCas9 plasmid is a temperature-sensitive plasmid carrying a gRNA plasmid elimination system, a λ phage Red recombination system, and a Cas9 protein expression system. It is resistant to zirconia (working concentration: 100 mg / L) and has an optimal incubation temperature of 32 ℃. The pgRB plasmid, with pUC18 as its backbone, contains the promoter J23100, a gRNA-Cas9 binding region sequence, and a terminator sequence. It is resistant to ampicillin (working concentration: 100 mg / L) and has an optimal incubation temperature of 37 ℃.

[0069] 2. Strengthen the supply of UMP 2.1 ushA gene knockout With E . coli Using the W3110 genome as a template, based on its ushA Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene. ushA -S、UP- ushA -A) and downstream homologous arm primer (DN- ushA -S、DN- ushA -A), PCR amplification of its upstream and downstream homologous arm fragments. The above fragments were then fused using overlap PCR. ushA The gene integrates upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm) via primer gRNA- ushA -S and gRNA- ushA Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. ushA .Will ushA The gene upstream and downstream homologous arm integration fragment (upstream homologous arm - downstream homologous arm) and plasmid pgRB- ushA Electroporation to plasmids containing pREDCas9 E. coli PSU-3 competent cells were used to screen for positive strains, and then plasmids were removed to obtain the strains. E. coli MU1. ushA Electrophoresis diagrams of the construction of homologous arm fragments and PCR verification of positive strains are attached. Figure 2The upstream homologous arm is 600 bp in length, the downstream homologous arm is 332 bp in length, and the total length of the overlapping fragment is 932 bp. For PCR validation, the PCR amplification fragment length for positive bacteria should be 932 bp, and the PCR band for negative colonies should be 2312 bp.

[0070] 2.2 s urE gene knockout by E. coli Using the W3110 genome as a template, based on its s urE Design upstream homologous arm primers (UP-s) based on gene upstream and downstream sequences. urE -S、UP-s urE -A) and downstream homologous arm primer (DN-s) urE -S、DN-s urE -A), PCR amplification of its upstream and downstream homologous arm fragments. The above fragments were then fused using overlap PCR to obtain s. urE The integration fragment of the gene (upstream homologous arm - downstream homologous arm) is transmitted via primer gRNA-s urE -S and gRNA-s urE Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-s. urE . s urE Integration fragments of upstream and downstream homologous arms of the gene (upstream homologous arm - downstream homologous arm) and plasmid pgRB-s urE Electroporation to plasmids containing pREDCas9 E. coli MU1 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU2. s urE Electrophoresis diagrams of the construction of homologous arm fragments and PCR verification of positive strains are attached. Figure 3 .in, surE The upstream homologous arm is 275 bp, the downstream homologous arm is 466 bp, the overlapping fragment is 741 bp, the negative colony PCR band is 1111 bp, and the positive colony band is 741 bp.

[0071] 2.3 yjjG gene knockout by E. coli Using the W3110 genome as a template, based on its yjjG Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene. yjjG -S、UP- yjjG -A) and downstream homologous arm primer (DN- yjjG -S、DN- yjjG -A), PCR amplification of its upstream and downstream homologous arm fragments. The above fragments were then fused using overlap PCR.yjjG The integration fragment of the gene (upstream homologous arm - downstream homologous arm) is connected via primer gRNA- yjjG -S and gRNA- yjjG Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. yjjG .Will yjjG Integration fragments of upstream and downstream homologous arms of the gene (upstream homologous arm - downstream homologous arm) and plasmid pgRB- yjjG Electroporation to plasmids containing pREDCas9 E. coli MU2 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU3. yjjG Electrophoresis diagrams of the construction of homologous arm fragments and PCR verification of positive strains are attached. Figure 4 The upstream homologous arm was 855 bp, the downstream homologous arm was 448 bp, the overlapping fragment was 1303 bp, the negative colony PCR band was 1705 bp, and the positive colony band was 1303 bp.

[0072] 3. Increase the supply of PRPP, glutamine, and aspartic acid. 3.1 prs D129A Gene integration by E. coli Using the W3110 genome as a template, based on its lfhA Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene (accession number: Gene ID: 946122). lfhA -S、UP- lfhA -A) and downstream homologous arm primer (DN- lfhA -S、DN- lfhA -A), PCR amplification of its upstream and downstream homologous arm fragments; based on its prs D129A Design primers for gene (SEQ ID NO.2) prs D129A -S、 prs D129A -A), amplification prs D129A Gene fragment, promoter P trc Then design the downstream primer of the upstream homologous arm and prs D129A In the upstream primer of the gene, the terminator T trc (The sequence is SEQ ID NO.6) The upstream primer and downstream homologous arm are designed... prs D129A In the downstream primers of the gene. The above fragments were obtained by fusion using overlap PCR.prs D129A Integration fragment of gene (upstream homologous arm - P) trc - prs D129A -T trc -downstream homologous arm), via primer gRNA- lfhA -S and gRNA- lfhA Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. lfhA .Will prs D129A Integration fragment of gene (upstream homologous arm - P) trc - prs D129A -T trc -downstream homologous arm) and plasmid pgRB- lfhA Electroporation to plasmids containing pREDCas9 E. coli MU3 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU4. prs D129A Electrophoresis diagrams of the construction of the integrated fragment and PCR verification of the positive strain are attached. Figure 5 Among them, the upstream homologous arm is 639 bp, and the downstream homologous arm is 730 bp. prs D129A The target fragment is 1041 bp, the overlapping fragment is 2340 bp, the negative colony PCR band is 1232 bp, and the positive colony band is 2340 bp.

[0073] 3.2 glnA L159I,E304A Gene integration by E. coli Using the W3110 genome as a template, based on its yeel Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene (accession number: Gene ID: 2847764). yeel -S、UP- yeel -A) and downstream homologous arm primer (DN- yeel -S、DN- yeel -A), PCR amplification of its upstream and downstream homologous arm fragments; with B.subtilis168 Using the genome as a template, it is artificially synthesized glnA L159I,E304A Design primers for gene (SEQ ID NO.3) glnA L159I,E304A -S、 glnA L159I,E304A -A), amplification glnA L159I,E304A Gene fragment, promoter Ptrc Then design the downstream primer of the upstream homologous arm and glnA L159I,E304A In the upstream primer of the gene, the terminator T trc (The sequence is SEQ ID NO.6) The upstream primer and downstream homologous arm are designed... glnA L159I ,E304A In the downstream primers of the gene. The above fragments were obtained by fusion using overlap PCR. glnA L159I,E304A Integration fragment of gene (upstream homologous arm - P) trc - glnA L159I,E304A -T trc -downstream homologous arm), via primer gRNA- yeel -S and gRNA- yeel Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. yeel .Will glnA L159I,E304A Integration fragment of gene (upstream homologous arm - P) trc - glnA L159I,E304A -T trc -downstream homologous arm) and plasmid pgRB- yeel Electroporation to plasmids containing pREDCas9 E. coli MU4 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU5. glnA L159I,E304A Electrophoresis diagrams of the construction of the integrated fragment and PCR verification of the positive strain are attached. Figure 6 .in, yeel The upstream homology arm is 533 bp, and the downstream homology arm is 586 bp, containing P. trc The promoter fragment is 1458 bp, the overlapping fragment is 2496 bp, the negative colony PCR band is 1613 bp, and the positive colony band is 2496 bp.

[0074] 3.3 aspC Gene integration by E. coli Using the W3110 genome as a template, based on its yjiv Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene (accession number: Gene ID: 2847764). yjiv -S、UP- yjiv -A) and downstream homologous arm primer (DN- yjiv -S、DN- yjiv-A), PCR amplification of its upstream and downstream homologous arm fragments; with E. coli Using the W3110 genome as a template, based on its aspC Gene design primers ( aspC -S、 aspC -A), amplification aspC Gene fragment, promoter P trc Then design the downstream primer of the upstream homologous arm and aspC In the upstream primer of the gene, the terminator T trc (The sequence is SEQ ID NO.6) The upstream primer and downstream homologous arm are designed... aspC In the downstream primers of the gene. The above fragments were obtained by fusion using overlap PCR. aspC Integration fragment of gene (upstream homologous arm - P) trc - aspC -T trc -downstream homologous arm), via primer gRNA- yjiv -S and gRNA- yjiv Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. yjiv .Will aspC Integration fragment of gene (upstream homologous arm - P) trc - aspC -T trc -downstream homologous arm) and plasmid pgRB- yjiv Electroporation to plasmids containing pREDCas9 E. coli MU5 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU6. aspC Electrophoresis diagrams of the construction of the integrated fragment and PCR verification of the positive strain are attached. Figure 7 .in, yjiv The upstream homology arm is 603 bp, and the downstream homology arm is 684 bp, containing P. trc The promoter fragment is 1314 bp, the overlapping fragment is 2520 bp, the negative colony PCR band is 2641 bp, and the positive colony band is 2520 bp.

[0075] 4. Modification and optimization of methylation pathways 4.1 glyA Gene integration by E. coli Using the W3110 genome as a template, based on its rph Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene (accession number: Gene ID: 948156). rph -S、UP- rph-A) and downstream homologous arm primer (DN- rph -S、DN- rph -A), PCR amplification of its upstream and downstream homologous arm fragments; based on its glyA Gene design primers ( glyA -S、 glyA -A), amplification glyA Gene fragments, promoter Ptrc is designed with downstream primers on the upstream homologous arm and glyA In the upstream primer of the gene, the terminator T trc Then design the upstream primer of the downstream homologous arm and glyA In the downstream primers of the gene. The above fragments were obtained by fusion using overlap PCR. glyA Integration fragment of gene (upstream homologous arm - P) trc - glyA -T trc -downstream homologous arm), via primer gRNA- rph -S and gRNA- rph Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. rph .Will glyA Integration fragment of gene (upstream homologous arm - P) trc - glyA -T trc -downstream homologous arm) and plasmid pgRB- rph Electroporation to plasmids containing pREDCas9 E. coli MU6 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU7. glyA Electrophoresis diagrams of the construction of the integrated fragment and PCR verification of the positive strain are attached. Figure 8 The upstream homologous arm was 525 bp, the downstream homologous arm was 328 bp, the target fragment was 1377 bp, the overlapping fragment was 2149 bp, the negative colony PCR band was 1092 bp, and the positive colony band was 2149 bp.

[0076] 4.2 folA Gene integration by E. coli Using the W3110 genome as a template, based on its ydeU Design upstream homologous arm primers (UP-) based on the upstream and downstream sequences of the gene (accession number: Gene ID: 947796). ydeU -S、UP- ydeU -A) and downstream homologous arm primer (DN- ydeU -S、DN- ydeU -A), PCR amplification of its upstream and downstream homologous arm fragments; based on its folAGene design primers ( folA -S、 folA -A), amplification folA Gene fragments, promoter Ptrc is designed with downstream primers on the upstream homologous arm and folA In the upstream primer of the gene, the terminator T trc Then design the upstream primer of the downstream homologous arm and folA In the downstream primers of the gene. The above fragments were obtained by fusion using overlap PCR. folA Integration fragment of gene (upstream homologous arm - P) trc - folA -T trc -downstream homologous arm), via primer gRNA- ydeU -S and gRNA- ydeU Annealing with -A yields a DNA fragment containing the target sequence of the target gene, which is then recombined with a linearized pgRB vector to obtain recombinant pgRB-. ydeU The recombined fragment is... folA Integration fragment of gene (upstream homologous arm - P) trc - folA -T trc -downstream homologous arm) and plasmid pgRB- ydeU Electroporation to plasmids containing pREDCas9 E. coli MU7 competent cells were used to screen for positive strains, and then the plasmids were removed to obtain the strains. E. coli MU8. folA Electrophoresis diagrams of the construction of the integrated fragment and PCR verification of the positive strain are attached. Figure 9 The upstream homologous arm is 323 bp, the downstream homologous arm is 310 bp, the target fragment is 567 bp, the overlapping fragment is 1155 bp, the negative colony PCR band is 1031 bp, and the positive colony band is 1155 bp.

[0077] 4.3 Plasmid overexpression STVIR_4548 L113V,S115P Gene The plasmid U1 constructed in Example 1 was electroporated into recombinant strain MU8 to obtain recombinant strain MU9.

[0078] Primers used in the construction of 5 strains The primers used in the above construction process are listed in the table below:

[0079] Example 3: Production of 5-methyluridine by fed-batch fermentation using engineered strain MU9 The fermenter cultivation method is as follows: Slant activation culture: Take the -80 ℃ preserved strain MU9 and streak it onto the activation slant, incubate at 37 ℃ for 12 h, then transfer to a flask and continue incubation for 12-16 h; Seed culture: Take an appropriate amount of sterile water into a flask, inoculate the bacterial suspension into the seed culture medium, keep the pH stable at around 7.0, keep the temperature constant at 37 ℃, keep the dissolved oxygen between 25-35%, and culture until the cell dry weight reaches 5-6 g / L; Fermentation culture: Inoculate fresh fermentation medium at an inoculum rate of 15-20% to start fermentation. During fermentation, control the pH to be stable at around 7.0, maintain the temperature at 37 ℃, and the dissolved oxygen at 25-35%. After the glucose in the medium is consumed, add 80% (m / v, mass concentration) glucose solution to maintain the glucose concentration in the fermentation medium at 0.1-2 g / L. The culture time is 48 h.

[0080] Slant culture medium: glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L, sodium chloride 1-2.5 g / L, agar 25-30 g / L, the remainder being water, pH 7.0-7.2, sterilized at 121℃ for 20 min.

[0081] Seed culture medium: glucose 20-25 g / L, yeast extract 4-8 g / L, peptone 1-5 g / L, KH2PO4 1-4 g / L, MgSO4·7H2O 1.2-2.0 g / L, the remainder being water, pH 7.0-7.2, sterilized at 121℃ for 20 min.

[0082] Fermentation medium: glucose 20-25 g / L, glycerol 5-10 g / L, yeast extract 4-8 g / L, corn steep liquor 5-10 g / L, sodium citrate 1-5 g / L, KH₂PO₄ 2-4 g / L, glycine 4-6 g / L, MgSO₄·7H₂O 1.2-2.0 g / L, FeSO₄·7H₂O 20-30 mg / L, MnSO₄·7H₂O 10-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2, and sterilized at 121℃ for 20 min.

[0083] Results of batch feeding fermentation in a 5L fermenter: Figure 10 to Figure 12 As shown, OD 600The concentration reached its peak at 48 h, with 5-methyluridine yield reaching 22.7 g / L. 5-methyluridine peaked at 9.284 min, uridine at 5.262 min, uracil at 4.143 min, and thymine at 7.235 min. This invention utilizes rational metabolic engineering to obtain engineered strains with a clear genetic background, using inexpensive carbon sources such as glucose as substrates, and efficiently synthesizing 5-methyluridine de novo. From a construction strategy perspective, this invention employs metabolic engineering techniques to systematically and comprehensively optimize the combination of overexpression of heterologous thymidylate synthase, enhancement of the PRPP pathway, and enhancement of the supply of UMP precursor, glutamine, and aspartate. The overall metabolic modification strategy (see...) Figure 1 No relevant reports were found. The obtained engineered strain can efficiently produce 5-methyluridine, showing good prospects for industrial application. Finally, the MU9 genetically engineered strain obtained in this invention achieved a 5-methyluridine yield of 22.7 g / L in a 5L fermenter after 48 hours, which is significantly better than the 10.71 g / L reported in the prior art, fully demonstrating the effectiveness and advancement of the combined metabolic strategy of this invention.

[0084] The relevant sequences in this invention are as follows: 1 (SEQ ID NO.1): STVIR_4548 L113V,S115P (Streptomyces) atgaccgttaccccggtgcatccggccgaagccaccaccggtccggaaattgaactgcgcagtcgcattaccgtggaactggttgatcatgcagcaagtgatattggcgttgttcgcgccgcacgtgttagtaccgcaggcgaacgtgcccatcgcgaagaacgtggcgatgattatattggtggcctgattcgttatctgatgcgtagtcgtcatggcagtccgtttgaacataattatatgacctttctggtgaatgcaccgatttttaccattcgccacatgatgcgccatcgcacctggagctttaatgaagaaagcgcacgttataaagatgtggaacccgtgttttatgtgccggatagtgatcgcctgctgaaacaggaaggcaaaccgggccattatcagtatgtgccgggcaccgaagaagatcatgaactggttaccaccagtgcaagcaccgcctatcgcgcagcatttcgtgaatatcagcgtatgctggatgccggcattgcacgcgaactggcacgtaccgtgctgccggttgcaacctatagcaccgtttatgcaacctgtaatgcccgtagcctgatgcattttctgagtctgcgtaccaatcgcgcagatgccacctatgtgagtcatccgcagcgtgaagtggaaattgttgcagaacagatggaaagtgaatttgcccgcctgatgccgctgacccatgccgcatacgaaagttatggtcgcgtgagtccgtaa 2(SEQ ID NO.2): prs D129A atgcctgatatgaagctttttgctggtaacgccaccccggaactagcacaacgtattgccaaccgcctgtacacttcactcggcgacgccgctgtaggtcgctttagcgatggcgaagtcagcgtacaaattaatgaaaatgtacgcggtggtgatattttcatcatccagtccacttgtgcccctactaacgacaacctgatggaattagtcgttatggttgatgccctgcgtcgtgcttccgcaggtcgtatcaccgctgttatcccctactttggctatgcgcgccaggaccgtcgcgtccgttccgctcgtgtaccaatcactgcgaaagtggttgcagacttcctctccagcgtcggtgttgaccgtgtgctgacagtcgctctgcacgctgaacagattcagggtttcttcgacgttccggttgataacgtatttggtagcccgatcctgctggaagacatgctgcagctgaatctggataacccaattgtggtttctccggacatcggcggcgttgtgcgtgcccgcgctatcgctaagctgctgaacgataccgatatggcaatcatcgacaaacgtcgtccgcgtgcgaacgtttcacaggtgatgcatatcatcggtgacgttgcaggtcgtgactgcgtactggtcgatgatatgatcgacactggcggtacgctgtgtaaagctgctgaagctctgaaagaacgtggtgctaaacgtgtatttgcgtacgcgactcacccgatcttctctggcaacgcggcgaacaacctgcgtaactctgtaattgatgaagtcgttgtctgcgataccattccgctgagcgatgaaatcaaatcactgccgaacgtgcgtactctgaccctgtcaggtatgctggccgaagcgattcgtcgtatcagcaacgaagaatcgatctctgccatgttcgaacactaa 3(SEQ ID NO.3): glnA L159I,E304A 4(SEQ ID NO.4):P trc ttgacaattaatcatccggctcgtataatgtgtgaattgtgagcggaatacaatttcacacaggaaacagacc! 5(SEQ ID NO.5):pTrc99a Δ lacI 6 (SEQ ID NO.6): T trc caaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaat Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain for producing 5-methyluridine, characterized in that: The strain is overexpressing pyr operon E. coli E. coli psu-3 was the starting strain, obtained by overexpressing a mutant thymidine synthase gene, overexpressing a mutant ribose-5-phosphate pyrophosphate synthase, overexpressing a mutant glutamine synthase, overexpressing aspartate transaminase, overexpressing serine hydroxymethyltransferase, overexpressing dihydrofolate reductase, and not expressing UMP phosphatase and pyrimidine nucleotidase.

2. The genetically engineered strain according to claim 1, characterized in that: The mutated thymidine synthase is from Streptomyces. STVIR_4548 L113V,S115P Gene-encoded proteins, among which, Streptomyces STVIR_4548 L113V,S115P The nucleotide sequence of the gene is SEQ ID NO.1; The UMP phosphatase is from Escherichia coli. ushA Genes and surE Gene-encoded proteins; among them, Escherichia coli ushA The gene's accession number is NCBI-Gene ID:947331. surE The gene's accession number is NCBI-Gene ID:947211; The pyrimidine nuclease is Escherichia coli. yjjG Gene-encoded proteins, among which, yjjG The gene's accession number is NCBI-Gene ID:948899; The mutated ribo-5-phosphate pyrophosphate synthase is from *Escherichia coli*. prs D129A Gene-encoded proteins, among which, E. coli prs D129A The nucleotide sequence of the gene is SEQ ID NO.2; The mutated glutamine synthase is from Bacillus subtilis. glnA L159I,E304A Gene-encoded proteins, among which Bacillus subtilis glnA L159I,E304A The nucleotide sequence of the gene is SEQ ID NO.3; The aspartate transaminase is from Escherichia coli. aspC Gene-encoded proteins; among them, Escherichia coli aspC The gene's accession number is NCBI-Gene ID:945553; The serine hydroxymethyltransferase is from Escherichia coli. glyA Gene-encoded proteins; among them, Escherichia coli glyA The gene's accession number is NCBI-Gene ID:947022; The dihydrofolate reductase is Escherichia coli. folA Gene-encoded proteins; among them, Escherichia coli folA The gene's accession number is NCBI-Gene ID:944790.

3. The genetically engineered strain according to claim 1, characterized in that: The term "not expressed" refers to a situation where the amount of the gene expression product is significantly lower than the original level. Overexpression refers to the expression level of the gene product being significantly higher than the original level.

4. The genetically engineered strain according to any one of claims 1 to 3, characterized in that: The thymidine synthase gene is linked to the promoter P. trc ; and / or The gene for the ribose-5-phosphate pyrophosphate synthase is linked to a promoter P. trc ; and / or The gene for glutamine synthase is linked to the promoter P. trc ; and / or The aspartate transaminase gene is linked to the promoter P. trc ; and / or The gene for the UMP phosphatase is linked to a promoter P. trc ; and / or The gene for the pyrimidine nuclease is linked to a promoter P. trc ; and / or The serine hydroxymethyltransferase gene is linked to the promoter P. trc ; and / or The gene for dihydrofolate reductase is linked to a promoter P. trc .

5. The method for constructing the genetically engineered strain according to any one of claims 1 to 4, characterized in that: Includes the following steps: The strain was obtained by overexpressing mutant thymidine synthase, mutant ribose-5-phosphate pyrophosphate synthase, mutant glutamine synthase, aspartate transaminase, serine hydroxymethyltransferase, and dihydrofolate reductase in the starting strain, while not expressing UMP phosphatase and pyrimidine nucleotidase.

6. The construction method according to claim 5, characterized in that: Includes the following steps: Overexpression of the Streptomyces-derived thymidylate synthase gene in the starting strain STVIR_4548 L113V,S115P Overexpression of E. coli-derived 5-phosphate pyrophosphate synthase gene prs D129A Overexpression of Bacillus subtilis-derived glutamine synthase gene glnA L159I,E304A Gene, overexpression of E. coli-derived aspartate transaminase gene aspC Overexpression of serine hydroxymethyltransferase glyA Overexpression of dihydrofolate reductase folA Knockout or inactivation of the E. coli-derived UMP phosphatase gene ushA Genes and surE Gene, knockout or inactivation of E. coli-derived pyrimidine nuclease gene yjjG .

7. The construction method according to claim 5 or 6, characterized in that: The specific steps are as follows: (1) The mutated thymidine synthase gene STVIR_4548 L113V,S115P Linked to plasmid pTrc99a Δ lacI Plasmid U1 and plasmid pTrc99a Δ were obtained. lacI The nucleotide sequence is SEQ ID NO.5; (2) The UMP phosphatase gene ushA and surE From the originating bacteria E. coli Knockout or inactivation in psu-3 yielded recombinant strains MU1 and MU2 in sequence; (3) The pyrimidine nuclease gene yjjG Recombinant strain MU3 was obtained by knocking out or inactivating recombinant strain MU2; (4) The mutated ribose-5-phosphate pyrophosphate synthase gene prs D129A Fragment Ptrc fused with promoter Ptrc -prs D129A Integration into recombinant strain MU3 lfhA Pseudogene loci were identified to obtain recombinant strain MU4. (5) The gene of the mutated glutamine synthase glnA L159I,E304A Fusion fragment Ptrc with promoter Ptrc- glnA Integrating into recombinant strain MU4 yeel Pseudogene loci were identified to obtain recombinant strain MU5. (6) The mutated aspartate transaminase gene aspC Fusion fragment Ptrc with promoter Ptrc- aspC Integration into recombinant strain MU5 yjiv Pseudogene loci were identified to obtain recombinant strain MU6. (7) The serine hydroxymethyltransferase gene glyA Fusion fragment Ptrc with promoter Ptrc- glnA Integration into recombinant strain MU6 rph Pseudogene loci were identified to obtain recombinant strain MU7. (8) The dihydrofolate reductase gene folA Fusion fragment Ptrc with promoter Ptrc- folA Integrating into recombinant strain MU7 ydeU Pseudogene loci were identified to obtain recombinant strain MU8. (9) Electroporate the plasmid U1 constructed in step (1) into recombinant strains MU1 to MU8 to obtain recombinant strains MU9 to MU16; The nucleotide sequence of the promoter Ptrc is shown in SEQ ID NO.

4.

8. The use of the genetically engineered strain as described in any one of claims 1 to 4 in the fermentation production of 5-methyluridine.

9. A method for producing 5-methyluridine by fermentation using the genetically engineered strain as described in any one of claims 1 to 4, characterized in that: Includes the following steps: The genetically engineered strain was cultured under suitable conditions, and 5-methyluridine was collected from its culture to obtain 5-methyluridine; The suitable conditions refer to a culture temperature of 37 ℃, a pH of 7.0±0.5, dissolved oxygen of 25%-35%, and culture in a fermentation medium for 48 h. The fermentation medium comprises: glucose 20-25 g / L, yeast extract 4-8 g / L, peptone 5-10 g / L, sodium citrate 1-5 g / L, KH₂PO₄ 2-4 g / L, MgSO₄·7H₂O 1.2-2.0 g / L, FeSO₄·7H₂O 20-30 mg / L, MnSO₄·7H₂O 10-20 mg / L, and V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2; sterilize at 121℃ for 20 min.

10. The method according to claim 9, characterized in that: The specific steps are as follows: (1) Slant activation culture: The genetically engineered strain stored at -80 ℃ was streaked onto the activation slant culture medium, cultured at 37 ℃ for 12 h, and then transferred to a flask for further culture for 12-16 h. (2) Seed culture: Take sterile water into an eggplant-shaped bottle, inoculate the bacterial suspension into the seed culture medium, keep the pH stable at 7.0±0.5, keep the temperature constant at 37 ℃, keep the dissolved oxygen between 25-35%, and culture until the cell dry weight reaches 5-6 g / L; (3) Fermentation culture: Inoculate fresh fermentation medium at an inoculation rate of 15-20% and start fermentation. During fermentation, control the pH to be stable at 7.0±0.5, the temperature to be maintained at 37 ℃, and the dissolved oxygen to be between 25-35%. After the glucose in the medium is consumed, add 80% glucose solution to maintain the glucose concentration in the fermentation medium at 0.1-2 g / L. The culture time is 48 h. The slant culture medium is formulated as follows: glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L, sodium chloride 1-2.5 g / L, agar 25-30 g / L, with the remainder being water, pH 7.0-7.2, and sterilized at 121℃ for 20 min. The seed culture medium formula is as follows: glucose 20-25 g / L, yeast powder 4-8 g / L, peptone 1-5 g / L, KH2PO4 1-4 g / L, MgSO4·7H2O 1.2-2.0 g / L, the remainder being water, pH 7.0-7.2, sterilized at 121℃ for 20 min; The fermentation medium formula is as follows: glucose 20-25 g / L, glycerol 5-10 g / L, yeast extract 4-8 g / L, corn steep liquor 5-10 g / L, sodium citrate 1-5 g / L, KH2PO4 2-4 g / L, glycine 4-6 g / L, MgSO4·7H2O 1.2-2.0 g / L, FeSO4·7H2O 20-30 mg / L, MnSO4·7H2O 10-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 2-4 mg / L, the remainder is water, pH 7.0-7.2, and sterilized at 121℃ for 20 min.

Images