One-tube rpa-crispr / cas13a detection system and its application in high-risk hpv typing detection

Abstract

The application develops a one-tube RPA-CRISPR / Cas13a detection system and application in high-risk HPV typing detection, which is a one-tube HPV detection system based on recombinase polymerase amplification (RPA) and CRISPR / Cas13a, named H-RC13a-OneTube. Compared with two-step method, the system simplifies the operation process, effectively avoids the risk of aerosol pollution and RPA product loss, and realizes the complete integration of nucleic acid amplification and detection. Taking the clinically high-risk types HPV16, 18 and 52 as the verification object, the sensitivity result shows that the detection lower limit of the system for HPV16 and 52 types reaches the single copy level. The system does not need complex instruments, and the operation is simple and rapid, which provides a new technical scheme for the on-site rapid typing detection of HPV16, 18 and 52, and lays a foundation for the subsequent expansion of multi-subtype detection and clinical conversion application.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics technology, specifically to a one-tube closed-tube nucleic acid detection technology based on RPA isothermal amplification-in vitro transcription CRISPR / Cas13a combination, which can be used for rapid, highly sensitive, and highly specific instant detection of high-risk HPV types such as HPV16, 18, and 52. Background Technology

[0002] Persistent infection with high-risk human papillomavirus (HR-HPV) is a core pathogenic factor in the development of cervical cancer. Besides the predominantly pathogenic HPV types 16 and 18, other high-risk types can also lead to cervical lesions and cervical cancer [Cas12a / blocker DNA-based multiplex nucleic acid detection system for diagnosis of high-risk human papillomavirus infection; Human papillomavirus genotype attribution in invasive cervical cancer: a retrospective cross-sectional worldwide study]. Although HPV molecular testing is recommended by the WHO as the preferred initial screening method for cervical cancer, conventional techniques, such as qPCR, are limited by thermal cycling equipment, long testing cycles, and specific laboratory requirements [Analysis of TCT and HPV results in patients with cervical intraepithelial neooplasia; An integrated paper-based sample-to-answer biosensor for nucleic acid testing at the point of care], thus limiting their application in point-of-care testing (POCT) scenarios. Therefore, current mainstream testing technologies cannot simultaneously meet the needs of multi-type simultaneous typing and rapid on-site testing at the grassroots level, becoming a core obstacle restricting the improvement of screening coverage.

[0003] HPV (human papillomavirus) nucleic acid testing is a core method for cervical cancer screening and early diagnosis. Traditional detection methods, such as quantitative real-time PCR (qPCR), while considered the gold standard, suffer from limited sensitivity (lower limit of detection for HPV16: 10 copies / μL; for HPV18: 100 copies / μL) and a tendency to miss low viral load samples. SHERLOCK technology, based on the combination of RPA and CRISPR / Cas13a, has become a research hotspot for HPV detection due to its isothermal amplification and high sensitivity. However, its traditional two-step operation (RPA amplification followed by product transfer to the Cas13a detection system) has significant technical limitations. 1. High risk of aerosol contamination: The process of opening and transferring amplified products can easily lead to the escape of nucleic acid aerosols, causing laboratory environmental contamination and significantly increasing the false positive rate, which is difficult to control in clinical or point-of-care testing (POCT); 2. Low detection efficiency: Step-by-step operation prolongs the total detection time (usually exceeding 60 minutes), and the product transfer process is prone to loss of sensitivity due to adsorption and dilution on the tube wall; 3. High operation requirements: It requires professional personnel to operate and cannot meet the needs of primary healthcare institutions or rapid on-site screening.

[0004] To address the shortcomings of the two-step method, existing technologies attempt to construct a one-pot detection system for RPA-CRISPR / Cas13a, but core technological bottlenecks still exist: 1. Mutual inhibition of system components: When components for RPA amplification, in vitro transcription, and Cas13a detection are directly mixed, the Cas13a protein competitively binds to the DNA template, and the T7 RNA polymerase and the RPA core enzyme exhibit antagonistic activity, resulting in a significant decrease in detection sensitivity compared to the two-step method; 2. Incompatibility of reaction conditions: The optimal temperature and ion concentration of each reaction unit differ, and an unoptimized system can lead to decreased amplification efficiency, transcription efficiency, and Cas13a cleavage activity; 3. Insufficient specificity control: Some one-pot systems are not specifically optimized for common gynecological reproductive tract pathogens, which can easily lead to cross-reactions and false positives.

[0005] Existing improvement methods, such as modifying crRNA ends and designing light-regulated Cas enzymes, all suffer from high design costs, low stability, and the need for external equipment intervention, hindering clinical translation and widespread adoption. Therefore, developing a cap-free, non-contamination-inhibiting, rapid, highly sensitive, and easy-to-use one-tube closed-tube HPV detection technology has become a key requirement for rapid on-site HPV testing and a research hotspot in this field. Summary of the Invention

[0006] To address the shortcomings of existing HPV nucleic acid detection technologies, this invention provides a one-tube closed-tube HPV nucleic acid detection technology based on RPA-transcription-CRISPR / Cas13a, achieving fully enclosed, contamination-free, rapid, highly sensitive, and highly specific HPV detection. It solves the aerosol contamination problem of traditional two-step methods, eliminates the component mutual inhibition phenomenon of one-pot methods, completes detection within 40 minutes under constant temperature conditions of 37℃, and has detection sensitivity superior to qPCR, achieving accurate detection of HPV samples with low viral load. It is suitable for POCT scenarios and lowers the operational threshold.

[0007] This invention addresses the need for one-tube detection by redesigning specific primers for HPV types 16, 18, and 52 containing the T7 promoter (HPV16: H16-F-1 / H16-R-1; HPV18: H18-F-2 / R-18-1; HPV52: H52-F-1 / H52-R-4). Feasibility studies show that the synergistic effect of Cas13a, crRNA, DNA template, and reporter probe allows for rapid activation of the fluorescence signal using the Cas13a one-tube method, effectively avoiding competition between the Cas protein and RPA for the DNA template and resolving the issue of the Cas12a one-tube method's ineffective activation of the Cas protein. The preferred reaction conditions are: reaction temperature 37℃, T7 RNA polymerase concentration 50 U / reaction, final Cas13a to crRNA concentration ratio 1:1.5, and final probe concentration 1.5 μM. Specificity verification shows… The H-RC13a-OneTube system showed no cross-reactivity with the human genome or common gynecological reproductive tract pathogens. In sensitivity validation, the system achieved a detection limit of single copies for HPV16 and 52, and a detection limit of 60 copies / μL for HPV18 after fine concentration gradient refinement, demonstrating overall superior sensitivity compared to qPCR. Notably, in clinical sample validation, the H-RC13a-OneTube system detected all 21 samples, with two HPV52 samples initially missed by qPCR being confirmed as true positives by sequencing.

[0008] The present invention adopts the following technical solution.

[0009] A one-tube RPA-CRISPR / Cas13a detection system includes RPA primers, RPA reaction solution, T7 polymerase, Cas13a protein, crRNA, dNTPs, and RNase inhibitors and probes.

[0010] This invention discloses an HPV nucleic acid detection kit, comprising the above-mentioned one-tube RPA-CRISPR / Cas13a detection system.

[0011] In this invention, the RPA reaction solution includes recombinant enzyme, polymerase, buffer solution, etc., which are commercially available products.

[0012] In this invention, in the one-tube RPA-CRISPR / Cas13a detection system, the T7 polymerase concentration is 45-60 U / reaction, the final concentration ratio of Cas13a protein to crRNA is 1:(1-2), and the final probe concentration is 1-2 μM.

[0013] This invention innovatively introduces the T7 in vitro transcription mechanism, avoiding template competition issues. Simultaneously, this design achieves a fully closed-tube operation, completely eliminating the risk of aerosol contamination. Based on this, this study constructs the H-RC13a-OneTube, a single-tube isothermal detection platform integrating RPA amplification, T7 transcription, and Cas13a detection. It can rapidly detect HPV types 16, 18, and 52 within 40 minutes at a constant temperature of 37℃. This study aims to establish a simple, highly sensitive, highly specific, and contamination-free one-tube HPV detection technology, providing a novel technical solution for high-risk HPV screening in grassroots and resource-limited areas, and contributing to the early prevention and control of cervical cancer.

[0014] Preferably, in the one-tube RPA-CRISPR / Cas13a detection system: The concentration of T7 polymerase is 48–55 U / reaction, or any concentration within this range, such as 50 U / reaction. The final concentration ratio of Cas13a protein to crRNA is 1:(1.2 to 1.7), or any ratio within the range, such as 1:1.5; The final concentration of the probe is 1.3–1.8 μM, or any value within the range, such as 1.5 μM.

[0015] Furthermore, the one-tube RPA-CRISPR / Cas13a detection system also includes NTP, magnesium ions, and detection water, which can be reacted upon the addition of a template.

[0016] This invention discloses the application of the above-mentioned one-tube RPA-CRISPR / Cas13a detection system in the preparation of HPV detection reagents or kits.

[0017] This invention discloses the application of the above-mentioned one-tube RPA-CRISPR / Cas13a detection system in the preparation of one-tube reactive HPV detection reagents or kits.

[0018] This invention discloses the application of the above-mentioned one-tube RPA-CRISPR / Cas13a detection system in the preparation of fully enclosed one-tube reaction HPV detection reagents or kits.

[0019] This invention discloses the application of the above-mentioned one-tube RPA-CRISPR / Cas13a detection system in the preparation of on-site rapid HPV detection reagents or kits.

[0020] This invention discloses an application method for the above-mentioned one-tube RPA-CRISPR / Cas13a detection system, which includes the following steps: after mixing all components, including the template, the mixture is incubated at 35-40°C for 35-45 minutes; then the fluorescence signal is detected; preferably, the mixture is incubated at 37-39°C for 35-45 minutes.

[0021] In this invention, the RPA primers are one or more of the following primer pairs: H16-F-1 / H16-R-1, H18-F-2 / R-18-1, and H52-F-1 / H52-R-4; the specific sequences are described below.

[0022] In this invention, the one-tube RPA-CRISPR / Cas13a detection system can be used in a 50 μL system, employing a closed-tube reaction mode throughout, fundamentally avoiding aerosol contamination that is highly likely to occur during the transfer of amplified products after opening the tube. This invention completes the construction of a one-tube RPA-transcription-CRISPR / Cas13a detection system targeting HPV, integrating three independent reaction steps—isothermal nucleic acid amplification, in vitro transcription, and Cas13a targeted recognition—into a single reaction system. This system uses HPV type-specific RPA primers, T7 RNA polymerase, Cas13a effector protein, and crRNA targeting conserved HPV sequences as core reaction components. The combination of component concentration ratios and reaction temperature lays the methodological foundation for subsequent clinical feasibility.

[0023] Existing technologies have constructed a two-step H-MRC12a detection platform for HR-HPV genotyping, but this platform has many core limitations: (1) the two-tube two-step method requires opening the cap to transfer the amplification product, which can easily cause aerosol contamination and result in false positives; (2) the operation process is cumbersome and requires certain professional skills from the operators, making it difficult to adapt to the grassroots real-time testing scenario; (3) when Cas12a and RPA are directly used together, efficient signal activation and amplification cannot be achieved in a single-tube system, making it difficult to upgrade to a one-tube system. To solve the above problems, this invention innovatively introduces the CRISPR / Cas13a system and the T7 in vitro transcription mechanism, and successfully constructs an H-RC13a-OneTube one-tube detection system that integrates RPA isothermal amplification, in vitro transcription, and Cas13a specific genotyping detection. This system achieves rapid and accurate genotyping of three high-incidence and high-risk HPV types (16, 18, and 52) under a constant temperature of 37℃, effectively breaking through the inherent technical bottlenecks of the traditional two-step method and the Cas12a one-tube system.

[0024] Primer design is the core foundation of nucleic acid amplification detection system and a key factor determining the amplification efficiency and detection stability of the one-tube method. The performance bottleneck of most isothermal amplification detection systems stems from unreasonable primer design. Based on the existing RPA degenerate primer library, a universal one-tube non-genotyping detection system was constructed by modifying the 5' end T7 promoter. Experimental results show that this scheme has obvious defects: (1) The introduction of the T7 promoter sequence will significantly increase the primer length and the probability of complementary pairing between primers, causing severe primer dimerization and non-specific amplification; (2) The universal degenerate primers designed to cover multiple targets have unavoidable base mismatches, which will directly lead to a significant decrease in target amplification efficiency and fail to meet the detection requirements of low-load samples. In response to this problem, this invention redesigns RPA primers containing the T7 promoter and discloses three pairs of genotyping primers with excellent amplification efficiency and good specificity. Among them, the amplification sensitivity of HPV16 and 52 primers can reach the single-copy level, providing core material support for the stable construction of the one-tube method system. This result also suggests that in the isothermal amplification tube system, primers (including primer length, modified sequences and primer interactions) are key factors affecting the stability of the system, and the primers of this invention are better suited to the high requirements of the tube system for amplification efficiency and anti-interference ability.

[0025] This invention demonstrates the unique advantages and feasibility of the Cas13a system in one-tube HPV detection. Results show that, under the same reaction conditions, the one-tube system combining Cas12a and RPA fails to achieve effective signal activation, a common technical challenge in current one-tube systems combining Cas12a and isothermal amplification. The Cas13a one-tube system constructed in this invention fundamentally avoids the DNA template competition problem between the Cas protein and the RPA system, exhibiting significant fluorescence activation within 8-10 minutes of reaction. This invention provides a novel technical approach for constructing one-tube isothermal HPV amplification systems. Furthermore, the signal activation of this system strictly depends on the synergistic effect of Cas13a, crRNA, target template, and reporter probe. Specific signal amplification is achieved only in the presence of the target; no non-specific fluorescence signal is generated in the absence of the target, ensuring specificity of the detection from a molecular mechanism perspective.

[0026] The H-RC13a-OneTube system disclosed in this invention can complete the entire detection process within 40 minutes under a constant temperature of 37℃, without the need for complex thermal cycling equipment and professional experimental operations, fully meeting the technical requirements of point-of-care testing. Methodological performance validation results show that this system has no cross-reactivity with human genomic DNA and common gynecological reproductive tract pathogens, exhibiting excellent detection specificity. The detection limit for HPV types 16 and 52 is as low as single copy level, and the detection limit for HPV type 18 is 60 copies / µL. Overall detection sensitivity is superior to routine clinical qPCR kits. Clinical sample validation results further confirm that this system achieved a 100% detection rate in 21 clinical cervical swab samples, stably detecting low viral load samples missed by qPCR kits. The detection results were verified as 100% accurate by Sanger sequencing, fully demonstrating its reliability in practical clinical applications. Most importantly, the system adopts a fully closed-loop operation mode, which completely eliminates the risk of aerosol contamination caused by the traditional two-step opening and transfer method. At the same time, it greatly simplifies the operation process and can complete the test without professional laboratory equipment, which is highly in line with the POCT testing needs of primary medical institutions and areas with limited resources.

[0027] In summary, the H-RC13a-OneTube integrated single-tube detection system successfully constructed by this invention effectively overcomes the core technical bottlenecks of traditional HPV nucleic acid detection technology, such as cumbersome operation procedures, high dependence on professional instruments and equipment, easy contamination of amplification products, and template competition among multiple targets. It realizes rapid, accurate, and convenient genotyping detection of high-risk HPV. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the H-RC13a-OneTube testing process.

[0029] Figure 2The results show the amplification results of primers used in a single-tube genotyping assay. (a) is a schematic diagram of the RPA amplification process; (b) shows the amplification results of the HPV16 primers, with a plasmid template concentration of 10³ copies / µL. Lanes 1–4 correspond to the primer pairs: H16-F-1 / H16-R-1, H16-F-1 / H16-R-2, H16-F-2 / H16-R-1, and H16-F-2 / H16-R-2, respectively; (c) shows the sensitivity detection results of the primer pair (H16-F-1 / H16-R-1) for HPV16; and (d) shows the amplification results of the HPV18 primers, with a plasmid template concentration of 10³ copies / µL. copies / µL, lanes 1–5 correspond to primer pairs: H18-F-1 / R-18-2, H18-F-2 / R-18-1, H18-F-1 / H18-R-1, H18-F-1 / R-18-3, H18-F-1 / R-18-4; (e) Sensitivity detection results of primer pair (H18-F-2 / R-18-1) for HPV18; (f) Amplification results of HPV52 primers, with a plasmid template concentration of 10. 4 copies / µL, lanes 1–3 correspond to: HF2 / H52-R-4 (NC), T-HF2 / H52-R-4, and HF2 / H52-R-4, respectively; (g) Sensitivity detection results of primer pair (T-HF2 / H52-R-4) for HPV52. M: 100 bp DNA Ladder; NC: negative control, the plasmid template concentration used is consistent with that indicated in the figure.

[0030] Figure 3 In the image, (a) shows the primer amplification results for HPV18, using a plasmid template concentration of 10. 2 (a) Primer pairs for lanes 1-3: H18-F-2 / H18-R-1, H18-F-2 / H18-R-3, and H18-F-2 / H18-R-4, respectively; (b) Amplification results of H18-F-2 / H18-R-1 for different concentrations of HPV18 plasmid templates, with lanes 1-5 being 10 copies / µL. 4 10 3 10 2 10 1 1 copy / µL; (c) Amplification results of H18-F-2 / H18-R-3 for different concentrations of HPV18 plasmid templates, 1-5 are 10 4 10 3 10 2 10 1 1 copy / µL.

[0031] Figure 4In the diagram, a: Primer amplification results for HPV16, where lanes 1-4 are the positive control, HF-1-1 / HR-1-1, HF-1-3 / HR-1-1, HF-1-3 / HF-1-2, and HF-1-1 / HR-1-3, respectively; b: The effect of the T7 promoter on amplification efficiency, with one or two primers containing T7 and a positive control, lanes 1-3 being HF-1-3 / HF-1-2 and HF-1-1 / HR-1-3, HF-1-3(T7) / HR-1-2, HF-1-3(T7) / HF-1-2(T7), and HF-1-1 / HR-1-3, respectively. -1-1 / HR-1-3; c: Compatibility of the T7 promoter with multiple downstream primers, lanes 1-3 are the positive control without T7, HF-1-1 (T7) and HR-1-1 / HR-1-3, HF-1-3 (T7) and HR-1-1 / HR-1-3, respectively; d: Effect of increased temperature on the multiplex amplification system, lanes 1-5 are the positive control, HF-1-3 (T7) / HR-1-2, HF-1-4 (T7) / HR-1-2, HF-1-5 (T7) / HR-1-2, HF-1-6 (T7) / HR-1-2, respectively. M: Marker, 100 bp DNA Ladder; NC: Negative control.

[0032] Figure 5 To validate the necessity of introducing Cas13a protein and the absence of key components (NC) in the detection system, (a, b) compare the necessity of Cas13a and Cas12a protein detection in one-tube and two-step methods, respectively; (c, d) validate the results of the key component absence experiment. Each experiment was independently repeated three times. Data are expressed as mean ± standard deviation. An asterisk indicates the level of significance compared with the negative control (***: P <0.001, ****: P <0.0001, ns: no statistically significant difference).

[0033] Figure 6 This experiment investigated changes in key reaction conditions in a one-tube assay system: (a, e) changes in T7 enzyme concentration; (b, f) changes in reaction temperature; (c, g) changes in the ratio of Cas13a protein to crRNA; and (d, h) changes in ssRNA reporter probe concentration. Each experiment was independently repeated three times. Data are expressed as mean ± standard deviation. An asterisk indicates a significant difference compared to the negative control (**: P <0.01, ***: P <0.001, ****: P <0.0001).

[0034] Figure 7This study evaluates the detection performance of H-RC13a-OneTube against high-risk HPV16, HPV18, and HPV52. (a-c) show the specificity of H-RC13a-OneTube against HPV16, HPV18, and HPV52 subtypes, respectively; (d, e) show the sensitivity analysis of this detection system against HPV16; (g, h) show the sensitivity analysis against HPV18; (j, k) show the sensitivity analysis against HPV52; and (f, i, l) show the sensitivity detection results of commercial qPCR kits against HPV16, HPV18, and HPV52 subtypes. The positive criteria were: Ct value <36.9 for HPV16, <36.2 for HPV18, and <35.1 for HPV52. All other results were considered negative. All experiments were independently repeated three times. Data are expressed as mean ± standard deviation (mean ± SD). An asterisk indicates a statistically significant difference compared to the negative control group (*). P <0.05, **: P <0.01, ***: P <0.001, ****: P <0.0001).

[0035] Figure 8 The clinical manifestations of H-RC13a-OneTube in HPV detection are shown below: (a) Schematic diagram of qPCR detection process; (b) Summary results of fluorescence values ​​of 21 clinical samples (S1–S21) detected by H-RC13a-OneTube; (c–e) Results of qPCR detection of samples S1–S7, S8–S14, and S15–S21 respectively. The positive criteria are: Ct value of HPV16 <36.9, Ct value of HPV18 <36.2, Ct value of HPV52 <35.1, and other cases are judged as negative; (f–h) Results of H-RC13a-OneTube detection of samples S1–S7, S8–S14, and S15–S21 respectively.

[0036] Figure 9 For comparison of clinical sample test results and sequencing verification, (a) the qPCR and H-RC13a-OneTube detection results of 21 clinical samples (S1–S21) were compared. Except for S17 and S19, the results of the two methods were consistent for the remaining samples. (b) Sanger sequencing results of the HPV52 target region of samples S17 and S19 showed that the sequences were completely consistent with the HPV52 reference strain, confirming that the samples detected by the one-tube method but missed by qPCR were HPV52 positive. Detailed Implementation

[0037] Isothermal amplification techniques, such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP), have been applied to the diagnosis of HPV through enzyme-mediated isothermal nucleic acid amplification mechanisms. CRISPR / Cas (Clustered regularly interspaced shortpalindromic repeats / CRISPR associated systems) systems have also become a new core technology for molecular point-of-care testing (POCT) and can be combined with isothermal amplification. However, the design of multiplex detection systems faces inherent challenges such as primer dimer formation and amplification efficiency imbalance. While existing technologies can perform HPV16 / 18 genotyping, their detection throughput is limited and requires sophisticated fluorescence detection equipment; or while they can detect 13 HR-HPV types, they lack genotyping capabilities [CRISPR-Cas12a-assisted nucleic acid detection; CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity]; existing technologies integrate RPA and CRISPR-Cas12a through microfluidic technology to achieve simultaneous detection of 4 HPV types, but this increases system complexity and does not cover high-risk HPV types in the Chinese population (such as HPV52, 53, 58, and 66) [Microfluidic space coding for multiplexed nucleic acid detection via CRISPR-Cas12a and recombinase polymerase amplification; The cervical cancer related distribution, coinfection and risk of 15 HPV types in Baoan, Shenzhen, in 2017-2023]. In summary, existing research has not yet solved the following key issues: (1) the contradiction between amplification type and amplification efficiency in multiple RPA primer design; (2) the cross-reaction control of CRISPR typing system in multi-target detection; and (3) the need for full-process integration of POCT platform in resource-limited environments.

[0038] This invention successfully constructed a one-tube HPV genotyping detection system based on RPA-transcription-CRISPR / Cas13a (H-RC13a-OneTube). This system, through transcription-mediated signal transduction, converts the DNA product of RPA amplification (multiplex recombinase polymerase amplification) into an RNA target recognized by Cas13a, fundamentally avoiding the DNA template competition problem between Cas effector proteins and the RPA system, achieving closed-tube detection. The system has a detection limit as low as single copy, can be completed within 40 minutes, and exhibits no cross-reactivity with common non-target pathogens, combining speed, high specificity, and high sensitivity. This integrated "amplification-transcription-detection" strategy provides a reusable technical framework for single-tube POCT detection of various pathogens, and has broad application prospects at the grassroots level.

[0039] The core of this invention is to construct a closed-tube reaction system integrating RPA amplification, in vitro transcription, and CRISPR / Cas13a detection. By coordinating the concentration, ratio, and reaction conditions of the system components, efficient compatibility of each reaction unit is achieved, completing the entire closed-loop operation from HPV target DNA release to fluorescence signal output. The specific core innovations are as follows: (1) Timing control technology: The CRISPR / Cas13a system of this invention can only recognize RNA. By first amplifying to generate a large amount of DNA, and then transcribing to generate RNA that can be recognized by Cas13a protein, it is ensured that RPA amplification is not affected by CRISPR.

[0040] (2) The fully enclosed one-tube reaction design integrates all components of RPA amplification, T7 in vitro transcription and Cas13a specific detection into a single reaction tube. After the cervical swab sample is pretreated to release the target DNA, it is directly added to the system. The entire process does not require opening the cap, completely avoiding the risk of aerosol contamination and achieving closed detection without false positives.

[0041] The following specific experiments illustrate the technological advancements of this invention. The reagents used are existing products, and the specific preparation operations and performance tests are conventional techniques. Figure 1 The experimental steps of the HPV one-tube nucleic acid detection method of the present invention are presented as follows: After the cervical swab sample is pretreated to release the target DNA (conventional technique), it is directly added to a one-tube reaction system integrating RPA isothermal amplification, in vitro transcription and CRISPR-Cas13a detection unit, and reacted at 37°C for 40 min; the target DNA is amplified and the amplification product is transcribed into RNA simultaneously in the system, thereby activating the trans-cleavage activity of Cas13a protein, and finally generating a readable fluorescent detection signal.

[0042] TwistAmp Basic Recombinase Polymerase Amplification Kit (TwistDx); T7 RNA Polymerase (Yisheng Biotechnology); LwaCas13a Protein (Sangon Biotech), LbaCas12a (NEB); RNase Inhibitor, NTP Mix (Beyotime); HPV16, 18, 52 Positive Plasmids, Primers (Jinweizhi); crRNA, 5' FAM-modified, 3' BHQ1-modified ssRNA Fluorescent Reporter Probe (Sangon Biotech); Nucleic Acid Rapid Extraction Kit, Human Papillomavirus Nucleic Acid Typing Kit (Shuoshi Biotechnology); Standard Strains (Staphylococcus aureus ATCC25923, Escherichia coli ATCC25922, Candida albicans ATCC14053, Suzhou Center for Disease Control and Prevention and the Diagnostic Center of the Second Affiliated Hospital of Soochow University); Clinical Nucleic Acid Samples (Trichomonas vaginalis and Neisseria gonorrhoeae clinical isolates nucleic acid samples, Suzhou Dushu Lake Hospital).

[0043] Singleton amplification experiments: Singleton amplification experiments were performed using various types of pUC plasmid vectors via the TwistAmp Basic Kit. Following the kit instructions and standard laboratory procedures, a 47.5 μL RPA reaction mixture was prepared, containing 29.5 μL RPA rehydration buffer, 0.4 μM forward and reverse primers, 5 μL genomic DNA template, and RNase-free ddH2O. The mixture was transferred to a TwistAmp Basic reaction tube, and 14 mM MgOAc solution was added to trigger the amplification reaction. The tube was incubated at 37°C for 20 minutes. After the amplification reaction, the product was extracted and purified using a chloroform-phenol mixture (1:1 volume ratio). Amplification efficiency and specificity were then analyzed by 2% agarose gel electrophoresis (band brightness, uniformity, and size).

[0044] The crRNA structure comprises two functional domains: a repeating sequence (5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3') that specifically binds to the LwaCas13a protein, and a spacer region complementary to the target nucleic acid sequence. To achieve high sensitivity and visual interpretation of the detection system, this invention further designed a fluorescent reporter RNA probe (FAM-rUrUrUrUrUrU-BHQ1); the specific sequence information of the amplicon DNA used is listed in detail in Table 1.

[0045] Table 1. Detailed sequences of amplicon Example 1

[0046] To achieve rapid and convenient on-site diagnosis of high-risk HPV, this invention develops an integrated detection strategy that combines rapid sample processing, single-tube RPA amplification, T7 transcription, and CRISPR / Cas13a fluorescence detection into a single reaction system. The single-tube reaction design, which requires no opening of the cap, effectively solves the problem of aerosol contamination that easily occurs during stepwise amplification and detection, while also eliminating the cumbersome steps of nucleic acid purification. When used in conjunction with the CRISPR / Cas13a system, through the combination of HPV-specific primers and crRNA, rapid detection of the target high-risk HPV can be completed within 40 minutes under isothermal conditions at 37°C. First, following standard procedures, clinical samples are rapidly lysed at 95°C for 5 minutes to release target HPV DNA, which can then be directly added to a premixed reaction tube without purification. Under constant temperature conditions of 37°C, isothermal RPA amplification and T7-mediated in vitro transcription are simultaneously completed within the system. The generated target HPV RNA can specifically activate the Cas13a / crRNA complex, stimulating its non-specific trans-cleavage activity, which cleaves the fluorescent reporter probe in the system, separating the fluorescent group from the quencher group, and generating a high fluorescence signal that can be monitored in real time or interpreted at the endpoint, thus enabling rapid genotyping detection of the target high-risk HPV.

[0047] After rapid thermal lysis to release target HPV DNA, clinical cervical swab samples are added to a single-tube system containing multiplex RPA amplification, T7 transcription, and CRISPR / Cas13a detection components. The amplification, transcription, and detection reactions are completed simultaneously at 37°C. The results can be interpreted in three ways: real-time fluorescence dynamic curve, endpoint fluorescence intensity bar graph, or fluorescence visualization under ultraviolet light.

[0048] To ensure the specificity, amplification efficiency, and typing accuracy of the detection system, this invention designs typing primers containing the T7 promoter in parallel according to conventional methods. The specific sequences are shown in Table 2.

[0049] Table 2 Detailed sequences of primers for the one-tube method

[0050] Note: The blue sequence is the T7 promoter sequence.

[0051] Single amplification experiments such as Figure 2 As shown, for HPV16, the results showed that the H16-F-1 / H16-R-1 primer pair had the best amplification effect. Figure 2 b) Sensitivity was assessed, and the results showed that it could reach the single-copy level (Figure 2c); for HPV18, the amplification effect is shown in [reference]. Figure 2 d. Sensitivity detection was performed using primer pair H18-F-2 / R-18-1. Gel electrophoresis at a concentration of 80 copies / µL showed distinct bands. Figure 2 e) When constructing a one-tube reaction system subsequently, the introduction of fluorescence signals will further enhance the sensitivity; for HPV52, Figure 2 f shows that the amplification effect of the H52-F-1 / H52-R-1 pair is ideal, and the sensitivity test results show that it can reach the single copy level (Figure 2g).

[0052] For HPV18, this study designed multiple primer pairs for amplification; the results are shown in [link to study]. Figure 3 .

[0053] This invention provides primers containing the T7 promoter with high sensitivity for each HP type: H16-F-1 / H16-R-1 for amplifying HP16 (Accession No. AF125673.1), H18-F-2 / R-18-1 for amplifying HP18 (Accession No. GQ180792.1), and H52-F-1 / H52-R-4 for amplifying HP52 (Accession No. KU298906.1), which can be used for subsequent one-tube method construction.

[0054] Comparative Example 1 Following conventional methods, primer design principles, and T7 promoter sequence characteristics, primers were designed based on the snapgene alignment sequence as follows: HF-1-1GCACAGGGCCATAATAATGGTATTTGTTGG HF-1-2GCACAGGGTCATAACAATGGTGTTTGCTGG HF-1-3GCACAGGGCCACAATAATGGTATTTGTTGG HR-1-1 ATGAATGTATGACATAACGTCTGCAGTTAA HR-1-2 ATGAATATATGTCATAACATCTGCTGTTAG HR-1-3 ATGAATATATGTCGTAAGATCTGCTGTTAG HF-1-1 (T7) TAATACGACTCACTATAGGG GCACAGGGCCATAATAATGGTATTTGTTGG HF-1-2 (T7) TAATACGACTCACTATAGGG GCACAGGGTCATAACAATGGTGTTTGCTGG HF-1-3 (T7) TAATACGACTCACTATAGGG GCACAGGGCCACAATAATGGTATTTGTTGG Amplification experiment results as follows Figure 4 As shown, primer pools HF-1-3 / HF-1-2 and HF-1-1 / HR-1-3 are effective against HPV16 (10) 4 The amplification effect was ideal with 10 copies / µL, but after the introduction of the T7 promoter, the amplification band became increasingly faint as the number of primers containing T7 increased. Figure 4 b) Even if one upstream primer matches two downstream primers, the amplification effect is still not ideal, such as Figure 4 c; Further setting the reaction temperature to 40℃ still did not yield satisfactory results. Figure 4 d).

[0055] In general, conventional primer design cannot rapidly and accurately amplify the target. Example 2

[0056] A one-tube system combining RPA, transcription, and CRISPR / Cas13a was constructed, integrating three key steps: RPA amplification, T7 transcription, and Cas13a-specific genotyping detection. RPA primers containing the T7 promoter, RPA reaction solution (recombinase, polymerase, buffer, etc.), T7 polymerase, Cas13a protein, crRNA, reporter, dNTPs, and RNase inhibitors were mixed in specific proportions. Reaction conditions were set to cover the entire process of RPA amplification (efficiently amplifying target DNA), T7 transcription (converting the DNA target into RNA), and Cas13a-mediated RNA-specific recognition and signal amplification, achieving a closed-loop reaction from target initiation to genotyping signal output. This resulted in the construction of the H-RC13a-OneTube prototype system.

[0057] The basic reaction system includes RPA amplification components, upstream and downstream primers, T7 RNA polymerase, LwaCas13a protein, crRNA, ssRNA reporter probe, inhibitor, and target nucleic acid template. A control experiment was set up to demonstrate that this invention avoids competition between Cas12a and the RPA template. Each reaction system was continuously monitored at 37 °C for 35 min, and the activation effect was analyzed by fluorescence kinetic curves and endpoint fluorescence intensity.

[0058] System comparison experiment: Based on the initially constructed Cas13a one-tube typing system, a parallel CRISPR / Cas12a one-tube typing system was constructed as a control. The two systems used the same reaction conditions. By comparing the amplification efficiency, typing specificity and system compatibility of the two systems, the adaptation advantages of Cas13a in one-tube typing integration were clarified.

[0059] Based on the constructed H-RC13a-OneTube system, a comparative study was designed, setting up experimental groups that lacked components such as Cas13a protein, specific crRNA, ss DNA reporter, and plasmid template, while setting up a complete system as a positive control. The differences in signal intensity and specific bands (or fluorescence signals) of the reactions in each group were observed.

[0060] To verify the feasibility and necessity of this strategy, a preliminary HPV-targeting RPA-transcription-CRISPR / Cas13a one-tube detection system was constructed. This system integrates isothermal amplification, in vitro transcription, and Cas13a recognition into a single closed-tube reaction to avoid aerosol contamination. The core components of this system include HPV-type-specific RPA primers, T7 RNA polymerase, Cas13a protein, and crRNA targeting conserved HPV sequences. The basic components are shown in Table 3, and the specific crRNA sequence information is shown in Table 4. One-tube Cas13a method, one-tube Cas12a method, and a two-step Cas12a method (existing technology, see the inventor's published literature) and negative controls were set up. Analysis was performed using fluorescence kinetic curves and endpoint fluorescence intensity. Figure 5 The results show (). Figure 5 a): The Cas13a one-tube method showed fluorescence signal 8–10 min after the start of the reaction and quickly entered the plateau phase; the fluorescence intensity of the Cas12a one-tube method remained at the baseline level, with no significant difference from the negative control; the Cas12a two-step method required 20 minutes for RPA amplification, resulting in a significantly longer signal detection time than the one-tube method. This indicates that T7-mediated DNA transcription to RNA can activate the trans-cleavage activity of Cas13a, achieving signal amplification; while Cas12a and RPA amplification and activation failed. Endpoint quantification results ( Figure 5 b) Further supports the above conclusions. To clarify the necessity of components such as ssRNA probe, Cas13a, and crRNA, a complete component system and a single component deletion system were set up, and the endpoint fluorescence signal was detected ( Figure 5 c, 5d). The results showed that only the full-component system showed obvious fluorescence activation, while the systems lacking Cas13a, crRNA, DNA template, or reporter probe showed no fluorescence signal, confirming that the signal activation of this system depends on the synergistic effect of the above components.

[0061] Table 3 Preliminary construction of the one-tube reaction system

[0062] Table 4. Detailed information on crRNA Example 3

[0063] Using a single-factor variable method, the relevant parameters of the system (Table 3) were changed to obtain the sensitivity, specificity, and reaction stability of different experimental typing detections: ① T7 RNA polymerase concentration (30, 50, 70 U / reaction); ② Reaction temperature (37, 38, 39℃); ③ Cas13a to crRNA concentration ratio (crRNA fixed at 200 nM, Cas13a concentrations of 100, 150, 200 nM, corresponding ratios of 1:2, 1:1.5, 1:1); ④ ssRNA reporter probe final concentration (0.5, 1, 1.5, 2 μM). Each experiment was independently repeated 3 times. Figure 6 a and 6e indicate that the fluorescence intensity is highest, the plateau phase occurs fastest, and the reaction is most stable at 50 U / . Figure 6 b and 6f show that the real-time fluorescence intensity is the highest and the plateau phase is the fastest at 37℃, which can simultaneously adapt to RPA amplification, transcription and Cas13a activation; Figure 6 c. The results of 6g showed that the signal intensity and the time to reach the plateau phase were similar at each ratio, and the fluorescence signal was most stable when Cas13a:crRNA = 1:1.5; Figure 6 The results of the probe concentration change detection are shown at d and 6h.

[0064] Unless otherwise specified, the reaction conditions for the H-RC13a-OneTube (HPV-RPA-CRISPR / Cas13a-OneTube) system used in this invention are as follows: 37℃, T7 RNA polymerase concentration 50 U / reaction, Cas13a:crRNA ratio 1:1.5, probe concentration 1.5 μM, as detailed in Table 5.

[0065] Table 5 One-tube reaction system

[0066] Example 4: Performance Verification of the H-RC13a-OneTube System Methodology The one-tube method system of this invention is named H-RC13a-OneTube (HPV-RPA-CRISPR / Cas13a-OneTube). To ensure that this system can be adapted to practical applications of HPV genotyping detection, subsequent work will focus on three aspects: detection specificity, analytical sensitivity, and sensitivity comparison with qPCR methods to complete the methodological performance validation of the system.

[0067] Using human blood cell genomic DNA, Staphylococcus aureus, Escherichia coli, Candida albicans, Trichomonas vaginalis, and Neisseria gonorrhoeae nucleic acid as non-specific templates, HPV16, 18, and 52 positive plasmids as positive controls, and a nucleic acid template-free system as a negative control, detection was performed under optimal reaction conditions to evaluate the specificity of the system. This invention's one-tube detection system exhibits excellent specificity, using nucleic acids from human blood cells (removed erythrocytes), Staphylococcus aureus (ATCC 25923), Escherichia coli (ATCC 25922), Candida albicans (ATCC 14053), Trichomonas vaginalis, and Neisseria gonorrhoeae as templates for detection. Experimental results ( Figure 7 a, Figure 7 b and Figure 7 c) shows that only HPV16, HPV18, and HPV52 positive templates showed significant fluorescence signals, while the other pathogens and negative controls showed no signals, indicating that the system had no cross-reaction with the above pathogens and clinical negative samples, and had good specificity.

[0068] The H-RC13a-OneTube system of this invention exhibits excellent sensitivity. Using serially diluted HPV16, 18, and 52 positive plasmids as templates, this optimized system was employed for detection to determine the limit of detection (LOD) for each HPV subtype, thereby evaluating the system's sensitivity. To further compare the sensitivity differences between this system and commercial detection methods, parallel detection of the same treated positive samples was performed using a commercial qPCR kit. By comparing the LOD and detection results of the two methods, the sensitivity performance of the H-RC13a-OneTube system was clarified.

[0069] HPV16, HPV18, and HPV52 positive plasmids were serially diluted (10 4 The sensitivity of the system was assessed by measuring the concentration of the template at 1 copy / μL, and compared with qPCR in parallel. The results showed that as the template concentration decreased, the fluorescence intensity during isothermal amplification decreased, and the time to reach the plateau phase increased. Figure 7 d to Figure 7 l) The results showed that H-RC13a-OneTube had a detection limit of single copies for HPV16 and HPV52; and a detection limit of 60 copies / μL for HPV18. qPCR results showed that the detection limit for HPV16 was 10 copies / μL and for HPV18 was 100 copies / μL.

[0070] (i) Common commensal bacteria, pathogenic microorganisms, and clinically isolated gynecological pathogens of the female reproductive tract were selected as non-target detection objects, and human serum genomic DNA was also included. The specificity of the system was clinically validated by analyzing the detection results of the above non-target substances using a single-tube method.

[0071] (II) Sensitivity Verification For HPV types 16, 18, and 52, serially diluted target templates were prepared and detected under optimal reaction conditions. Each experiment was repeated three times, with a negative control included. Fluorescence signals were observed to determine the limit of detection for each type.

[0072] (III) Comparison and verification with qPCR sensitivity Using the positive control template prepared with the qPCR kit, the concentration was measured on a spectrophotometer, and the copy number was calculated. Then, the target template was serially diluted (10⁻⁶). 4 Sensitivity was evaluated using a standard qPCR kit, ranging from 1 copy / μL to 1 copy / μL. The sensitivity advantage and application potential of the H-RC13a-OneTube system were assessed by comparing the limits of detection of the two methods, ensuring the correlation and reliability of the detection results from both methods.

[0073] This invention included 21 clinical cervical swab samples (approved by the Ethics Committee of the Fourth Affiliated Hospital of Soochow University (batch number: 251175)). The samples were frozen at -80 ℃ and thawed at room temperature before nucleic acid extraction. The sample processing procedure is as follows: Genomic DNA was extracted from the cervical swabs using a fully automated nucleic acid extraction kit, followed by HPV genotyping using the H-RC13a detection platform. Simultaneously, qPCR validation was performed using a commercially available human papillomavirus nucleic acid genotyping kit, and the consistency of the detection results from the two methods was compared.

[0074] To evaluate the clinical performance of the H-RC13a-OneTube system, 21 HPV-positive cervical swab samples were included, of which S1-S7 were HPV16 positive, S8-S15 were HPV18 positive, and S16-S21 were HPV52 positive. A commercially available qPCR genotyping kit was used as a control. qPCR results showed that most samples could be detected. Figure 8 c. Figure 8 d and Figure 8 e). Using the single-tube method established in this invention, 21 samples were simultaneously tested. The results showed that all samples showed type-specific fluorescent signals with no false negatives. Low-viral-load samples with qPCR Ct values ​​as high as 34.55 (HPV16) and 38.70 (HPV18) were reliably detected, and the fluorescence intensity of HPV52-positive samples was positively correlated with viral load. Figure 8 f to Figure 8 h). The two methods yielded inconsistent results: two samples that were detected by the one-tube method but not by qPCR were confirmed as HPV52 positive by Sanger sequencing. Figure 9 The results were consistent with those of the single-tube method. In summary, the H-RC13a-OneTube of this invention achieved a 100% detection rate in 21 clinical samples, and can detect low-load samples missed by qPCR. The sequencing verification was accurate and reliable, demonstrating good clinical application value.

[0075] This invention discloses a one-tube closed-loop nucleic acid detection method for HPV based on RPA-transcription-CRISPR / Cas13a: RPA amplification, T7 in vitro transcription, and CRISPR / Cas13a detection units are integrated into a single reaction tube to construct a fully closed one-tube reaction system. The sample template is directly added to the system without opening the cap. The detection is completed by incubation at 37°C for 40 minutes, and the HPV positive result is determined by the fluorescence signal.

[0076] The total final volume of the above reaction system is 50 μL, which is compatible with the conditions of each reaction unit and eliminates component inhibition. The components include RPA dry powder, buffer, RPA primer, Cas13a protein, HPV-specific crRNA, RNA inhibitor, ssRNA reporter, T7 transcriptase, NTP, Mg²⁺, HPV target DNA template and ultrapure water.

[0077] In the above system, the T7 transcriptase was stored at a concentration of 50 U and added at a volume of 2 μL (50 U / reaction); the Cas13a protein and crRNA were both stored at a concentration of 10 μM and added at a volume of 1 μL, with a concentration ratio of 1:1.5; the ssRNA reporter was stored at a concentration of 50 μM and added at a volume of 1 μL, with a working concentration of 1.5 μM.

[0078] The targets detected are high-risk types of human papillomavirus, including HPV16, HPV18, and HPV52. The detection limit for HPV16 / 52 is 1 copy / μL, and the detection limit for HPV18 is 60 copies / μL.

[0079] The method of this invention is adapted to meet the synergistic reaction requirements of RPA amplification, T7 RNA polymerase transcription, and Cas13a protein activation.

[0080] The method of this invention has no false positive detection in clinical HPV negative samples and no cross-reaction with human blood cell genomes and common gynecological reproductive tract pathogens such as Staphylococcus aureus, Escherichia coli, Candida albicans, Trichomonas vaginalis, and Neisseria gonorrhoeae.

[0081] This invention discloses an HPV one-tube closed-tube nucleic acid detection kit for implementing the above method. The kit contains pre-prepared components of a one-tube reaction system, including RPA dry powder, buffer, RPA primers, Cas13a protein, HPV16 / 18 / 52 specific crRNA, RNA inhibitor, ssRNA reporter, T7 transcriptase, NTP, and Mg²⁺, which can be directly prepared into a 50 μL reaction system.

[0082] The kit is ready to use, requiring no complex preparation. After simple pretreatment to release DNA, the sample is directly added, sealed, and reacted at 37°C for 40 minutes for detection. It is suitable for point-of-care testing (POCT) scenarios. This detection method or kit has proven effective in clinical testing of human papillomavirus (HPV) types 16 / 18 / 52 and cervical cancer screening.

[0083] Early screening for cervical cancer heavily relies on rapid and accurate detection of high-risk human papillomavirus (HR-HPV). Existing quantitative PCR (qPCR) and CRISPR-based two-step methods suffer from limitations such as equipment dependence and aerosol contamination. To overcome these limitations, this invention constructs a single-tube isothermal detection platform, H-RC13a-OneTube. This platform integrates recombinase polymerase amplification (RPA), T7 in vitro transcription, and CRISPR / Cas13a signal recognition, enabling rapid closed-tube detection of HR-HPV. As an example, with a constant temperature of 37°C, 50 U of T7 RNA polymerase per reaction, a Cas13a:crRNA molar ratio of 1:1.5, and a 1.5 μM ssRNA reporter probe, the entire detection process can be completed within 40 minutes. Performance validation showed that the system achieved a detection limit of single copies for HPV16 and HPV52, and 60 copies / μL for HPV18, with overall sensitivity superior to commercial qPCR kits. It exhibited no cross-reactivity with the human genome and common reproductive tract pathogens, demonstrating excellent specificity. In validation with 21 clinical samples, the detection rate reached 100%, and it consistently detected low viral load samples missed by qPCR. The system uses a closed-tube operation, eliminating aerosol contamination and requiring no specialized equipment, making it suitable for point-of-care testing (POCT) at the grassroots level.

Claims

1. A one-tube RPA-CRISPR / Cas13a detection system, characterized in that, It includes RPA primers, RPA reaction solution, T7 polymerase, Cas13a protein, crRNA, dNTPs, and RNase inhibitors and probes.

2. The one-tube RPA-CRISPR / Cas13a detection system according to claim 1, characterized in that, In the one-tube RPA-CRISPR / Cas13a detection system, the T7 polymerase concentration is 45-60 U / reaction, the final concentration ratio of Cas13a protein to crRNA is 1:(1-2), and the final probe concentration is 1-2 μM; the application temperature of the one-tube RPA-CRISPR / Cas13a detection system is 35-40℃.

3. The one-tube RPA-CRISPR / Cas13a detection system according to claim 2, characterized in that, In the one-tube RPA-CRISPR / Cas13a detection system, the T7 polymerase concentration is 45–55 U / reaction, the final concentration ratio of Cas13a protein to crRNA is 1:(1.2–1.8), and the final probe concentration is 1.3–1.7 μM.

4. The one-tube RPA-CRISPR / Cas13a detection system according to claim 1, characterized in that, The RPA primers are one or more of the following primer pairs: H16-F-1 / H16-R-1, H18-F-2 / R-18-1, and H52-F-1 / H52-R-4.

5. An HPV nucleic acid detection or cervical cancer screening kit, comprising the one-tube RPA-CRISPR / Cas13a detection system as described in claim 1.

6. The application of the one-tube RPA-CRISPR / Cas13a detection system as described in claim 1 in the preparation of HPV detection or cervical cancer screening reagents or kits.

7. The application of the one-tube RPA-CRISPR / Cas13a detection system as described in claim 1 in the preparation of one-tube reactive HPV detection or cervical cancer screening reagents or kits.

8. The application of the one-tube RPA-CRISPR / Cas13a detection system as described in claim 1 in the preparation of a fully enclosed one-tube reaction HPV detection or cervical cancer screening reagent or kit.

9. The application of the one-tube RPA-CRISPR / Cas13a detection system as described in claim 1 in the preparation of on-site rapid detection reagents or kits for HPV testing or cervical cancer screening.

10. The application method of the one-tube RPA-CRISPR / Cas13a detection system according to claim 1, comprising the following steps: after mixing all components including the template, incubating at 35-40°C for 35-45 minutes; and then detecting the fluorescence signal.

Images