VIRUS AAV / IGF2, METHOD FOR GENETIC TREATMENT AND USE THEREOF IN PROTEIN MISFOLDING DISEASES, SUCH AS HUNTINGTON'S DISEASE

DE602017094397T2Active Publication Date: 2026-03-18UNIVERSITY OF CHILE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602017094397
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Filing Date
2017-12-21
Publication Date
2026-03-18
Estimated Expiration
2037-12-21

AI Technical Summary

Technical Problem

Current treatments for Huntington's disease focus on alleviating symptoms rather than slowing degeneration or reversing neuronal damage caused by protein misfolding, and there is a lack of effective gene therapy approaches using IGF2 for this condition.

Method used

The use of adeno-associated viruses (AAV) expressing IGF2 or IGF2-HA to induce neuronal overexpression in the brain, particularly in the striatum and cortex, through local administration, to modulate the proteostasis network and reduce mutant huntingtin expression.

Benefits of technology

This approach significantly decreases mutant huntingtin aggregates, enhances neuronal viability, and slows the progression of Huntington's disease, as demonstrated by reduced mHtt expression and improved motor symptoms in animal models.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD OF THE PRESENT DISCLOSURE

[0001] The present disclosure relates to the field of gene therapy, specifically to the use of adeno-associated viruses (AAV) comprising an expression cassette encoding human IGF2 or IGF2-HA for the prevention or treatment of Huntington's disease.BACKGROUND AND DESCRIPTION OF THE STATE OF THE ART

[0002] Scientific research on CNS diseases has been of great interest in recent years, especially diseases related to degenerative neurological disorders. The treatment of diseases related to protein misfolding, such as Huntington's disease, has approaches with allopathic therapies (antipsychotics and antidepressants) to diminish the symptoms triggered by the death of neurons as a consequence of protein misfolding, but none to slow the degeneration or to reverse the damage that it has already caused.

[0003] With respect to Huntington's disease (HD), its genetic cause was discovered over 20 years ago, but the mechanisms that lead to neuronal dysfunction and cell death are just beginning to be determined.

[0004] During the determination of these mechanisms, it has been suggested that the general alteration of the proteostasis network is an important pathological event in the gestation of HD, where the emergence of stress of the endoplasmic reticulum (ER) stands out. In this organelle reside the proteins responsible for the activation of the unfolded protein response (UPR), a reaction signal that controls cell fate under ER stress.

[0005] HD is a neurodegenerative disorder characterized in a first stage by a cognitive deterioration and changes in personality, together with failure in motor control in a more advanced stage, which prevents the performance of daily life tasks, concluding with premature death of the patient. At the protein level, the disease is characterized by an expansion of more than 35 repetitions of glutamine within the huntingtin protein, giving it a dominant toxic function, which leads to the progressive accumulation of mutant huntingtin (mHtt) and the occurrence of neuronal loss in the striatum. Although the mechanisms of the effects generated by mHtt on neuronal function are still discussed, different publications suggest that global alterations to protein homeostasis (1) contribute to pathogenesis (2-5), including the alteration of protein degradation. associated with ER, vesicular traffic in ER and Golgi, axonal transport and disturbances in autophagy (6). All these events increase the protein load of the cells, disturbing their correct folding and maturation in the ER, generating chronic ER stress and neuronal dysfunction (7). The ER stress triggers the activation of the unfolded protein response (UPR), a signaling pathway that allows, in the first place, to mediate cellular adaptation to recover proteostasis.

[0006] However, chronic ER stress can induce cell death and neurodegeneration. It is important to note that ER stress has been linked to several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), and Parkinson's disease (PD) (7-9). Within this signaling, the most conserved branch is controlled by the X-box transcription factor of the binding protein 1 (XBP1) that controls the expression of a group of genes involved in different aspects of the proteostasis network (10). It was previously demonstrated that the deletion of XBP1 in neurons in mouse models with HD had a neuroprotective effect (5). In general, the animals were more resistant to developing the disease, associated with an improvement in neuronal survival and a better motor performance. This phenotype was explained by a drastic decrease in mHtt levels, possibly due to a positive regulation of autophagy (5). Similar observations were obtained in models of ALS (11) and PD (12).

[0007] In the search for a treatment of these protein-misfolding diseases, the insulin-like growth factor II, called IGF2, has been identified, whose function is involved in the biological and molecular mechanisms of fetal growth, as well as involved with some cancerous tumors.

[0008] IGF2 is a secreted growth factor with interesting neuroprotective activities in several models. In summary, some recent studies suggest that IGF, in general, are possible targets for the treatment of neurodegenerative diseases, particularly, considering their functions as neurogenic agents and neuroprotective effects (13). In fact, the delivery of IGF1 in preclinical models of AD and ALS attenuates the pathological characteristics by using gene therapy (14-16). In contrast to IGF1 and insulin, IGF2 has been little studied. Only a few recent reports suggest a neuroprotective role for IGF2, where it reduces amyloid plaques and cognitive impairment in AD models (17, 18). Similarly, in ALS, IGF2 is expressed differentially in motor neurons resistant to the disease and its overexpression by means of gene therapy delays the progression of the same (19). In addition, in humans, IGF2 levels decrease in the hippocampus of AD patients (17, 20), and also shows alterations in CSF samples (21, 22).

[0009] However, there are no functional studies having linked IGF2 with HD.

[0010] In general, the dynamics between the signaling of the UPR and that of the growth factors suppose a new approach linking the proteostasis network with the survival signals that modulate neuronal physiology (23). For these reasons, IGF2 represents an interesting candidate to study in the context of HD that can provide new therapeutic routes for its treatment, in addition to its potential use as a biomarker to monitor the progression of the disease.

[0011] In document CL 3510-2014, having international application WO2014 / 085621, where a fusion protein comprising IGF2 is presented for the treatment of diseases associated with lysosomal proteins, there is no mention of a genetic treatment to cure HD.

[0012] Also, there is a second document, ES 2442242 A1, which mentions a composition based on an extract drawn from blood which comprises different growth factors, where there was no mention either of genetic treatment to cure HD.

[0013] Therefore, there are no documents that use gene therapy linking the IGF2 gene and the treatment of HD.SUMMARY OF THE DISCLOSURE

[0014] The invention is set out in the appended set of claims.DEPOSIT OF MICROORGANISMS

[0015] Plasmids pAAV-IGF2-HA and pAAV-IGF2 were deposited in 2016 at the international depositary authority, contained in the strain of Escherichia coli transformed with the plasmids deposited in the international depositary authority, Chilean Collection of Microbial Genetic Resources (CChRGM), having deposit numbers RGM2335 and RGM2336, respectively.DETAILED DESCRIPTION OF THE INVENTION

[0016] It is to be understood that this disclosure is not limited to the particular methodology, compounds, materials, manufacture techniques, uses and applications described herein, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing a particular embodiment only, and it is merely illustrative.

[0017] It must be noted that as used herein, in the appended claims, and in the entire text, the singular forms include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a use or method" includes reference to one or more uses or methods. Similarly, as a further example, reference to "a step", "a stage", or "a mode" includes reference to one or more steps, stages, or modes, which may include implicit and / or supervening sub steps, stages, or modes.

[0018] Every conjunction used must be understood in its less restrictive and more inclusive possible meaning. For example, the conjunction "or" should be understood in its orthodox logic sense and not as an excluding "or", except when the context or text expressly requires it or states it.

[0019] The expressions used to denote approximations or concepts should be understood in their intrinsically meaning, unless the context is expressing a different reading.

[0020] All technical and / or scientific names and terms used herein have the usual meaning given by a person of ordinary skill in this art, except when a different meaning is clearly expressed.

[0021] Methods, techniques, elements, compounds and compositions are described although similar methods, techniques, elements, compounds and compositions to those already described can be used or preferred in practice and / or trials of the present invention.

[0022] The patents and other publications mentioned herein are provided for the purpose of describing and / or informing methodologies that may be relevant to the present invention.

[0023] The publications included herein are provided solely for their disclosure prior to the filing date of the present application.

[0024] In this regard, nothing should be interpreted as an admission or acceptance, rejection or exclusion that the authors and / or inventors are not entitled or that said publications are dated before other previous ones, or by any other reason,

[0025] The present invention describes vectors based on the serotypes AAV2 that induces neuronal overexpression of IGF2 in the brain of a subject, when administered locally. (Figures 10 / 19, 11 / 19 and 12 / 19).

[0026] Systemic administration of these vectors also leads to efficient gene delivery to both the brain and the striatum and cortex. Although the delivery of genes mediated by vectors AAV2 and AAV2 / 2 are more efficient, the delivery in the case of systemic administration is not restricted only to the brain or the striatum and cortex. The present invention shows that the vector AAV2 and AAV2 / 2 with the gene that encodes for the expression of the growth factor IGF2, allows the generation of a response in a cluster of factors of interest in the brain and, specifically, in the striatum and cortex. Particularly, local administration of the AAV2 / 2 vector comprising an expression cassette in which an Igf2 gene is under the control of the CAG promoter obtains an improvement in the treatment of Huntington's disease in vivo. (Fig. 11 / 19 and 12 / 19).I. Definition of general terms and expressions

[0027] As used in the present document, the terms "adeno-associated virus", "AAV virus", "AAV virion", "AAV viral particle", and "AAV particle", are interchangeable and refer to a viral particle composed of at least one AAV capsid protein and a polynucleotide of the encapsidated AAV genome. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell) flanked by the AAV inverted terminal repeats, which is typically referred to as a "AAV vector particle" or "AAV vector". AAV refers to a virus belonging to the genus Dependovirus of the family Parvoviridae. The AAV genome is approximately 4.7 kilobases long and is composed of single-stranded deoxyribonucleic acid (ssDNA) that can be either positive-sense or negative-sense. The genome comprises inverted terminal repeats (ITR) at both ends of the DNA strand, and two open reading frames (ORFs): REP and CAP (Replicase and Capsid). The REP frame consists of four overlapping genes that encode for REP proteins (REP 78, REP 68, REP 52 and REP 40) required for the AAV life cycle. The CAP frame contains overlapping nucleotides of 20 capsid protein sequences: VP1, VP2, and VP3, which interact with each other to form a capsid having icosahedral symmetry (30), as presented in Figure 15 / 19.

[0028] As used herein, the term "adeno-associated virus ITR" or "AAV ITR", refers to the inverted terminal that is repeated and present at both ends of the DNA strand of an adeno-associated virus genome. ITR sequences are required for efficient multiplication of the AAV genome. Another property of these sequences is their ability to form a fork. This characteristic contributes to its replication, which allows the primary synthesis separately from the second strand of DNA. ITRs also proved to be necessary both for the integration of the wild-type AAV DNA into the host cell genome and the rescue thereof, as well as for the efficient encapsidation of the AAV DNA combined with the generation of its complete assembly (25).

[0029] s used in the present invention, the terms "AAV2" and "AAV2 / 2" refer to serotype 2 of the adeno-associated virus, having a genome sequence as defined in accession number GenBank J01901.1, located on the website: https: / / www.ncbi.nlm.nih.gov / nuccore / J01901.1

[0030] From the eleven serotypes that have been characterized to date, the best characterized and most frequently used is AAV2. The difference between the different serotypes is determined by their cellular tropism, with AAV2 being one of the ones with the highest "affinity" for infecting cells of the central nervous system.

[0031] As used in the present invention, the term "AAV vector" further refers to a vector comprising one or more polynucleotides of interest (or transgenes) that are flanked by AAV terminal repeat (ITR) sequences. Said AAV vectors can be replicated and packaged into infectious viral particles when they are present in a host cell that has been transfected with a vector encoding and expressing the REP and CAP genes (i.e. the AAV proteins REP and CAP), and where the host cell has been transfected with a vector encoding and expressing a protein of the E4orf6 adenovirus reading frame. When an AAV vector is incorporated into a larger polynucleotide (for example, in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the AAV vector is typically referred to as a "pro-vector". The pro-vector can be "rescued" by replication and encapsidation in the presence of the packaging functions of the AAV and the necessary auxiliary functions provided by E4orf6.

[0032] As used in the present invention, the term "CAP gene" or "AAV CAP gene" refers to a gene encoding a CAP protein. The term "CAP protein", as used herein, refers to a polypeptide having activity of at least one functional activity of the CAP protein of a wild-type AAV (VP1, VP2, VP3). Examples of functional activities of VP1, VP2, and VP3 proteins include the ability to induce the formation of a capsid, facilitating the accumulation of single-stranded DNA, facilitating the packaging of AAV DNA in the capsid (i.e., encapsidation), binding to cell receptors and facilitating the entry of the virion to a host.

[0033] As used in the present invention, the term "capsid", refers to the structure in which the viral genome is packaged. A capsid consists of an oligomeric structure with structural subunits of CAP proteins. For example, the AAV has an icosahedral capsid formed by the interaction of three capsid proteins: VP1, VP2 and VP3.

[0034] As used in the present document, the term "cell composition" refers to a composite type material comprising the cells of the invention and at least one other component. The composition can be formulated as a single formulation or be presented as separate formulations of each of the components, which can be combined for the joint use as a combined preparation. The composition can be a parts kit, where each of the components is formulated and packaged individually.

[0035] As used herein, the term "constitutive promoter" refers to a promoter whose activity is maintained at a relatively constant level throughout an organism, or during most of the experimental steps, with little or no consideration to the environmental and external conditions of the cell.

[0036] As used herein, the term "expression cassette" refers to a construction of nucleic acids, generated by recombination or synthetically, having a series of specific elements of the nucleic acids, which allow the transcription of a particular nucleic acid in a target cell.

[0037] As used herein, the term "genes that provide helper functions" refers to genes encoding polypeptides performing functions on which the AAV is dependent for replication (i.e., "helper functions"). Auxiliary functions include those functions necessary for the AAV replication, including the fragments involved in the activation of AAV gene transcription, the specific splicing steps of AAV mRNA, the replication of AAV DNA, the synthesis of CAP products, and the assembly of the AAV capsid. Accessory viral functions can be derived from any of the known helper viruses such as adenovirus, herpes virus, lentivirus, and vaccinia virus. Auxiliary functions include, without limitation, WHV lentivirus.

[0038] As used herein, the term "locally administered" means that the polynucleotides, vectors, polypeptides, and / or pharmaceutical compositions of the invention are administered to the subject at or near a specific site.

[0039] In the present document, the terms "pharmaceutically acceptable carriers", "pharmaceutically acceptable diluents", "pharmaceutically acceptable excipient" or "pharmaceutically acceptable vehicle", are interchangeable and refer to a non-toxic, semi-solid, or liquid filler, diluent, or encapsulation material, or an auxiliary formulation for any conventional type. A pharmaceutically acceptable carrier is essentially non-toxic to the recipients used in the dosages and concentrations, and it is compatible with other ingredients of the formulation. The number and nature of pharmaceutically acceptable vehicles depend on the desired form of administration. Pharmaceutically acceptable carriers are known and can be prepared by methods well known in the art. (24)

[0040] As used herein, the term "promoter" refers to a nucleic acid that serves to control the transcription of one or more polynucleotides, located upstream from the polynucleotide(s) sequence, and which is structurally identified by the presence of a DNA-dependent RNA-polymerase binding site, transcription initiation sites, and any other DNA sequence, including, but not limited to, transcription factors binding sites, repressor, and activator protein binding sites, and any other nucleotide sequences known in the art that act directly or indirectly to regulate the amount of transcription from the promoter. A "tissue-specific" promoter is only activated in certain types of differentiated cells or tissues.

[0041] As used herein, the term "polynucleotide" refers to a nucleic acid molecule, either DNA or RNA, that contains deoxyribonucleotides or ribonucleotides, respectively. The nucleic acid may be double stranded, single stranded, or contain parts of either double stranded or single stranded sequences. The term "polynucleotide" includes, but is not limited to, nucleic acid sequences with the ability to encode a polypeptide and nucleic acid sequences partially or wholly complementary to an endogenous polynucleotide of the cell or the subject treated therewith so that, after transcription thereof, it generates an RNA molecule (for example, microRNA, shRNA, siRNA) capable of hybridizing and inhibiting the expression of the endogenous polynucleotide.

[0042] In this document, the term "strand" refers to a sequence of continuous nucleotides (including or not including modified natural nucleotides or unnatural nucleotides). The two or more strands can be, or each can form part of, separate molecules, or they can be covalently interconnected, for example, by means of a coupling, for example, a linker such as polyethylene glycol, to form a molecule. At least one of the chains can include a region that is sufficiently complementary to a target RNA.

[0043] As used herein, the term "recombinant viral genome", refers to an AAV genome in which at least one polynucleotide cassette foreign to the expression in the wild-type AAV genome is inserted.

[0044] As used herein, the term "rep gene" or "AAV rep gene", refers to a gene encoding a Rep protein. The term "Rep protein," as used herein, refers to a polypeptide having at least one functional activity of an AAV native rep protein (e.g., Rep 40, 52, 68, 78). A "functional activity" of a Rep protein (e.g. Rep 40, 52, 68, 78) is any activity associated with the physiological function of the protein, including the facilitation of DNA replication through recognition, binding, and cleavage of the AAV DNA replication origin, as well as the DNA helicase activity. Additional functions include modulation of AAV (or other heterologous) transcription promoters, and the site-specific integration of AAV DNA into a host chromosome.

[0045] As used herein, the term "subject" refers to an individual, plant, mammal or animal, such as a human, a non-human primate (e.g., chimpanzee or other ape and species of monkeys), an animal (e.g., birds, fish, cattle, sheep, pigs, goats, and horses), a mammal (e.g., dogs and cats), or a laboratory animal (e.g., rodents, such as mice, rats, mice with silenced genes (knockout mice), mice that overexpress a gene (transgenic mice) and guinea pigs). The term does not denote a particular age or sex. The term "subject" includes an embryo, with the exception of a human one-cell embryo, and a fetus.

[0046] As used herein, the term "systemically administered" and "systemic administration" means that the pharmaceutical compositions of the present invention are administered to a subject in an unlocalized form. The systemic administration of the pharmaceutical compositions of the invention can reach various organs or tissues throughout the body of the subject or reach new specific tissues or organs of the subject. For example, intravenous administration of a pharmaceutical composition of the invention can result in transduction in more than one tissue or organ in a subject. For the present invention, it also means that the pharmaceutical compositions of the invention that act systemically, operate close to or with neuronal nerve cells or with non-neuronal nerve cells, as well as intra- or extracellularly.

[0047] As used herein, the term "transduction" refers to the process by which a sequence of foreign nucleotides is introduced into the cell by a virus.

[0048] As used herein, the term "transfection" refers to the introduction of DNA into the recipient eukaryotic cells.

[0049] As used herein, the term "vector" refers to a construct capable of delivering, and optionally expressing, one or more polynucleotides of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, DNA or naked RNA expression vectors, plasmid, cosmid or phage vectors, RNA or DNA expression vectors associated with cationic condensation agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. Vectors can be stable and can be self-replicating. There are no limitations as to the type of vector that can be used. The vector can be a cloning vector, suitable for propagation and for obtaining polynucleotides, gene constructs, or expression vectors incorporated into various heterologous organisms. Suitable vectors include prokaryotic expression vectors, phage and shuttle vectors, and eukaryotic expression vectors based on viral vectors (e.g., adenoviruses, adeno-associated viruses, as well as retroviruses and lentiviruses), as well as non-viral vectors.

[0050] As used herein, the term "DARPP" is a dopamine-regulated phosphoprotein that is used as a marker of medium spiny neurons (MSNs), which are the major neurons affected by the expression of mHtt. Its expression is used as a viability marker.

[0051] The term IGF2, used in the document, refers to the IGF2 polypeptide per se, or to IGF2 bound to the HA epitope as claimed.

[0052] For the term "amelioration of Huntington's disease", we refer to the improvement of psychiatric, behavioral, and motor symptoms, as well as a decrease in huntingtin aggregates in different species and / or subjects as defined in the present invention.

[0053] The term "cDNA" or "complementary DNA" refers to a DNA sequence totally complementary to an RNA, from which it is synthesized by RT-PCR.

[0054] As used in this document, the term "complementary" is used to indicate such a sufficient degree of complementarity that a stable and specific binding occurs between a compound and a target RNA molecule, the specific binding requires a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target sequences under conditions where the specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays under conditions in which the assays have been carried out.Ligands

[0055] The following section relating to ligand-conjugated AAVs is provided for illustrative purposes only and does not describe subject-matter according to the present invention as claimed.

[0056] The properties of a virus, including its pharmacological properties, can be influenced and tailored, for example, by the introduction of ligands. In addition, the pharmacological properties of a viral agent can be enhanced by the incorporation of a ligand in a formulation of the agent and a virus.

[0057] Ligands can bind to a wide variety of entities, for example, ligands that bind to a viral agent, or that can be used as a conjugate or formulation additive, for example, with the vehicle of a ligand-conjugated monomer subunit. The examples are described below in the context of a ligand-conjugated monomer subunit, but that is only preferred, and entities can be coupled at other points with a virus.

[0058] A ligand alters the distribution, direction, or lifetime of a viral agent in which it is incorporated. In the preferred embodiments, a ligand provides a better affinity for a selected target, for example, a molecule, cell, or cell type, a compartment, for example, a cell or organ compartment, a tissue, or region of the body, for example, as compared to a species in which this ligand is absent.

[0059] Ligands can improve the transport, hybridization, and specificity properties of the target molecule, for the present invention, of the virus.

[0060] Ligands, in general, can include therapeutic modifiers, for example, to improve the absorption of the molecule in the individual; diagnostic compounds or reporter groups, for example, to monitor distribution; crosslinking agents; moieties that confer resistance to immune reactions; and natural or unusual nucleobases.

[0061] General examples include lipophilic molecules, lipids, lectins, (e.g., hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelanol derivatized lithocholic acid), vitamins, carbohydrates (e.g., a dextran, pullulan, chitin, chitosan, synthetic polymers [e.g., oligo-lactate 15-mer] and natural polymers [e.g., with low and medium molecular weight], inulin, cyclodextrin, or hyaluronic acid), proteins, protein binding agents, integrin targeting molecules, polycations, peptides, polyamines, and peptide mimetics. Other examples include epithelial cell or folic acid receptor ligands, such as transferrin.

[0062] The ligand can be a molecule presented in a natural, recombinant, synthetic form, such as a synthetic polymer, for example, a synthetic polyamino acid. Examples of polyamino acids include poly-L-lysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(lactic-co-glycolic acid) copolymer, divinyl ether-maleic anhydride, N-(2-hydroxypropyl)methacrylamide (HMPA) copolymer, polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazine. Examples of the polyamines include: polyethyleneimine, poly-L-lysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic moieties, e.g., cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha-helical peptide.

[0063] Ligands can also include targeting groups, for example, a targeting agent to a cell or tissue, for example, a thyrotropin, melanotropin, surfactant protein A, mucin carbohydrate, a glycosylated polyamino acid, bisphosphonate, polyglutamate, polyaspartate, or a Arg-Gly-Asp (RGD) peptide, or a RGD peptide mimic.

[0064] Ligands can be proteins, for example, glycoproteins; lipoproteins, for example, low-density lipoprotein (LDL); or albumins, for example, serum albumin; or peptides, for example, molecules having a specific affinity for a co-ligand; or antibodies, for example, an antibody that binds to a specified cell type. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as cofactors, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetylglucosamine, multivalent mannose, or multivalent fucose.

[0065] The ligand can be a substance, for example, a drug, that can increase the absorption of the viral agent within the cell, for example, by altering the cytoskeleton of the cell, for example, by altering microtubules, microfilaments, and / or filaments intermediates of the cell.

[0066] In one aspect, the ligand is a lipid, or a lipid-based molecule. This lipid or this lipid-based molecule is preferably linked to a whey protein, for example serum albumin.

[0067] In an alternative embodiment, to those previously named, the viruses will be packed.

[0068] The injectable solutions of virus are prepared by diluting the necessary concentration of virus in PBS (phosphate-buffered saline) whose formulation is as follows: PBS 1x 1. Dissolve the viral dose in 800 ml of distilled water with: 8 g of NaCl 0.2 g of KCl 1.44 g of Na2HPO4 0.24 g of KH2PO4 2. Adjust the pH to 7.4 with HCl. 3. Adjust the volume to 1L with additional distilled water H2O. 4. Sterilize and autoclave. Design and Selection

[0069] Controlling the expression of the mutant version of huntingtin is key to ameliorate or cure Huntington's disease.

[0070] In the cell, there are several mechanisms capable of degrading misfolded proteins, including the degradation associated with ER and autophagy. However, it is very difficult to selectively degrade a particular protein. Nevertheless, studies carried out to date indicate that IGF2 is able to reduce, in some way, the expression of huntingtin, thus reducing its toxic function.

[0071] In addition to requiring the modulation of local protein synthesis, the amelioration or cure for Huntington's disease involves other aspects in the secretory pathway including the synthesis and trafficking of various membrane receptors and ion channels, the increase in calcium signaling, the synthesis of membranes, and the assembly of protein complexes. However, a unique function of IGF2 was found preferentially, but not exclusively, in the striatum and cortex.

[0072] The application example, described herein, provides proof that IGF2 decreases the expression of mHtt and increases neuronal viability, slowing down the development of Huntington's disease.

[0073] When analyzing the biomedical scope of its use as therapy, an effective and innovative method was provided to ameliorate or treat Huntington's disease, in which the use of this technology produces surprising results in its application.

[0074] Experimentally, it has been reported that overexpression of IGF2 in the context of HD, drastically decreases the aggregates of polyglutamine peptides, as well as mutant huntingtin. In addition, a neuroprotective effect was observed, with an increase in the survival of medium spiny neurons.

[0075] Previous studies with an HD model concluded that the deficiency of transcription factor XBP1 in CNS neurons had a neuroprotective effect in this disease, decreasing the amount of aggregates and improving neuronal viability. (This can be seen in the application examples).

[0076] In order to define the possible mechanisms underlying the protective effects observed in animals with XBP1 deficiency in the nervous system, a global profile analysis was conducted regarding the gene expression of 53 animals, including the striatum and cerebral cortex of XBP1-deficient mice, in a context of HD using Huntington model YAC128. From this study, IGF2 was obtained as the gene whose expression was most affected by XBP1 deletion, as seen in Figure 1 / 19. In addition, it was the only one that coincided with a study conducted in parallel where the mRNA of XBP1-deficient mice was sequenced.

[0077] These results were confirmed by measuring by qPCR (quantitative PCR) the levels of Igf2 in different regions of the brain of XBP1-deficient mice. It was observed that the endogenous levels of Igf2 mRNA increased significantly in the cortex and in the striatum, as presented in Figure 2 / 19, respectively. These data show that IGF2 is involved, in some way, in the protection observed in XBP1 KO mice.

[0078] In order to study the contribution of IGF2 to HD, its activity in cellular models that transiently express the polyQ79 peptide fused with GFP in Neuro2a cells was explored. The co-expression of IGF2 and polyQ79-GFP in Neuro2a cells drastically decreased the number of protein inclusions and aggregates according to the evaluation of three different methodologies, including fluorescent images, Western blot and filter trap, a technique that allows to evaluate large-size aggregates (Figures 3 / 19, 4 / 19, 5 / 19) respectively).

[0079] Next, it was tested whether the observed effects were due to the secreted IGF2 or its intracellular accumulation. Thus, the peptide polyQ79 or mHTTQ85-GFP was expressed in Neuro2a cells in the presence of a medium enriched with IGF2. Consistently, IGF2 reduced the aggregates of polyQ and mHtt (Figures 6 / 19 and 7 / 19).

[0080] On the other hand, it was determined whether IGF2 was able to "undo" the preexisting mHtt aggregates. To this end, Neuro2a cells that already express polyQ79-GFP or GFP-mHTTQ85 were treated with an IGF2 enriched medium. As observed in previous experimental scenarios, IGF2 significantly decreased protein aggregation in both experimental parameters (Figure 8 / 19, 9 / 19).

[0081] Altogether, the previously obtained results demonstrate a strong anti-aggregation effect in cell culture assays.

[0082] A natural continuation of the present development was the conduction of preliminary experiments in vivo, using an adeno-associated virus of AAV2 / 2 type (26). Within the sequence of this virus, a version of IGF2 marked with the HA epitope was cloned in order to better detect the expression of the peptide. In the first approach, viral particles expressing mHtt were injected in the presence or absence of IGF2. Two weeks later, the striatum of these animals was analyzed, observing a decrease in mutant huntingtin expression levels, as shown in Figure 10 / 19.

[0083] In a more physiological approach, transgenic animals expressing mutated human huntingtin (YAC128 models) were treated. Neonatal animals of 1-2 days of age were injected intraventricularly with AAV-IGF2 / HA. Six months later, the animals were sacrificed to obtain tissue. After treatment with AAV, a marked decrease in mHtt expression was observed in animals injected with IGF2 / HA versus the control condition as shown in Figure 11 / 19. Similarly, adult individuals were treated; these animals were injected with AAV-IGF2 / HA at three months of age and sacrificed at six months of age to obtain tissue. As seen in Figure 12 / 19, treatment with IGF2 / HA reduced mHtt expression levels compared to the control condition.

[0084] Also, within said studies, some studies were conducted to verify motor improvement in mice with HD exposed to the AAV modified with IGF2, as shown in Figure 13 / 19.

[0085] On the other hand, experiments were conducted where IGF2 levels were measured in protein extracts of caudate / putamen from HD patients and control individuals. The results showed that in patients with HD the content of IGF2 is hardly expressed, suggesting its implication in the development of the pathology. According to what is proposed in this patent, we consider that the present patent also achieves the restoration of IGF2 physiological levels, improving the symptomatology of the disease, as shown in Figure 19 / 19.

[0086] With respect to the development of the adeno-associated virus (AAV), it comprises the viral recombinant genome comprising an expression cassette that includes a hippocampal tissue-specific transcriptional regulatory region operably linked to the polynucleotide of interest.

[0087] Adeno-associated viruses (AAV), in general, correspond to 42 serotypes and are derived from parvoviruses. In general, the different AAV serotypes are genomic sequences with a significant homology at amino acids and nucleic acids level, which provide identical genetic functions, provide vibrations that are essentially identical in functional and physical terms, and their replication and assembly use practically the same mechanisms.

[0088] Particularly, AAV serotype 2 / 2 having access number J01901.1 (AAV2 / 2) was used in the present invention, as presented in Table I.

[0089] The AAV genome according to the present invention comprises a cis 5' actuator and an inverted terminal repeat sequence in 3', and an expression cassette. The ITR or LTR sequences are 141 base pairs long. Preferably, the entire sequence of the LTRs is used in the molecule and only slight modifications of the sequences are allowed. In a preferred embodiment of the present invention, the AAV recombinant genome comprises the 5 'and 3' AAV LTRs.

[0090] On the other hand, ITRs can come from other AAV serotypes.

[0091] The AAV of the present invention comprises a capsid of any serotype. Particularly, for the present invention, the capsid derived from serotype 2 is preferred.

[0092] In some embodiments, an AAV cap for use in the method of the invention can be generated by mutagenesis (i.e., insertions, deletions, or substitutions) of one of the AAV caps or its encoding nucleic acids. In some embodiments, the AAV cap is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% or more, similar to said AAV cap.

[0093] In some embodiments, the AAV cap is chimeric, it comprises the domains of two, three, four, or more of said AAV caps. In some embodiments, the AAV cap is a mosaic of monomers VP1, VP2, VP3, and derived from two or three different AAVs or a recombinant AAV (rAAV). In some embodiments, a rAAV composition comprises more than one of the aforementioned CAPS.

[0094] In some embodiments, an AAV CAP for use in a rAAV composition is designed to contain a heterologous sequence or other modification. For example, a peptide or protein sequence conferring selective targeting or immune evasion can be modified by genetic engineer into a Cap protein. Alternatively, or in addition, the Cap can be chemically modified so that the surface of the rAAV presents specific chemical modifications, for example, polyethylene glycol, which can facilitate immune evasion. The Cap protein can also be mutagenized (for example, to remove its natural binding receptor, or to mask an immunogenic epitope).

[0095] In one embodiment, the AAV vector contains a promoter with the addition of an Igf2 or Igf2-HA sequence of murine origin that can be selected from the following tables: Table IV (Igf2) and Table V (Igf2-HA), NCBI reference sequences NM_010514.3, NM_001122736.2, NM_001122737.2, NM_001315488.1, and NM_001315489.1, corresponding to transcriptional variants 1, 2, 3, 4, and 5 whose protein product is the same and is encoded by the sequence shown in the tables.

[0096] In one embodiment, the AAV vector contains a promoter with the addition of an Igf2 or Igf2-HA sequence of human origin that can be selected from the following table: Table VII (human Igf2), NCBI reference sequences NM_000612.5, NM_001007139.5, NM_001127598.2, NM_001291861.2, and NM_001291862.2 corresponding to the transcriptional variants 1, 2, 3, 4, and 5 whose protein product is the same and is encoded by the sequence represented in the table.

[0097] In one embodiment, the AAV vector contains a eukaryotic expression promoter with the addition of at least one Igf2 sequence, which can be selected from Table IV, obtaining a sequence as shown in Table II.

[0098] In one embodiment, the AAV vector contains a eukaryotic expression promoter with the addition of at least one Igf2-ha sequence that can be selected from Table V, obtaining a sequence as shown in Table III.

[0099] In one embodiment, the AAV vector contains a eukaryotic expression promoter with the addition of at least one human Igf2 sequence, which can be selected from Table VII.

[0100] In one embodiment, the AAV vector contains a promoter with the addition of at least one sequence having 85% homology to a sequence selected from the aforementioned lists, Table II and Table III.

[0101] In one embodiment, the AAV vector contains a promoter with the addition of at least one sequence having 70% homology to a sequence selected from the aforementioned tables.

[0102] The transcriptional regulatory region may comprise a promoter and an enhancer region. The promoter is a eukaryotic gene expression promoter, selected from the following list: CAG (CAG is a promoter that contains sequences corresponding to the cytomegalovirus (CMV) immediate-early enhancer element, the promoter, the first exon, and the first intron of the chicken beta-actin gene, and the splicing acceptor of the rabbit beta-globin gene), CMV, b-globin, CBA, elFalpha.

[0103] In another embodiment, the expression cassette forming part of the AAV of the invention further comprises a post-transcriptional regulatory region, consisting of the Woodchuck hepatitis virus post-transcriptional region (WPRE).

[0104] The packaging size limit of AAV vectors is limited to the size of the wild-type AAV genome, which varies in size according to the AAV serotype (i.e., between 4087 to 4767). For example, wild-type AAV-2 has an approximate genome size of 4.7 kB. In some embodiments, the cloning capacity of the recombinant RNA vector may be limited, and a desired coding sequence may involve the complete replacement of 4.8 kilobases of the virus genome. Large-sized genes may, therefore, not be suitable for use in a standard recombinant AAV vector, in some cases. An average expert will appreciate that options are available in the art for overcoming a limited coding capability. For example, the AAV IRT of two genomes can hybridize to form head to tail concatemers, almost doubling the capacity of the vector. The insertion of the splice sites allows the removal of the ITR after transcription. Other options for overcoming a limited cloning capacity will be evident to an expert in the field.Routes of administration

[0105] Routes of administration of the virus are subject to its crossing the blood-brain barrier to infect target neurons.

[0106] In order to achieve this purpose, two routes of administration have been defined in the present invention.

[0107] The first of these routes is nasal (27); normally, medicines administered through nasal route can enter the blood to the general circulation, can penetrate the brain directly, or in some cases can follow both routes. However, many of the factors that control drug flow through each of these pathways are not completely defined. Generally, there are three routes by which a drug administered in the nasal cavity can travel. These routes (27) include direct entry into the systemic circulation through the nasal mucosa (28), entry into the olfactory bulb by axonal transport through the neurons, and direct entry into the brain (29). The evidence supporting the role of each of these routes for a variety of model substrates is summarized below for different types of viruses. Transport routes followed by several viral solutes through nasal administration SoluteAnimal ModelRoute of AdministrationFollowed routeVirusHepatitis virusMouseNasal inoculationOlfactory nerveHerpes Simplex virusMouseNose dropsDirect, Systemic, Olfactory nerveEncephalitis virusMouseNasal inoculationOlfactory nervePneumococcusMouseNose dropsDirect

[0108] This table is not intended to be exhaustive in nature, but rather to emphasize that some of the solutes of different classes have shown to follow one or more pathways.

[0109] Other routes of administration into CNS cells include (28): Direct injection into fluid spaces, such as the vitreous humor of the eye; or into the cerebrospinal fluid through different routes, intraventricular or intrathecal (**), for its delivery to the choroid plexus, the ependymal / meningeal layers, and from there in the adjacent brain through processes extending within these layers; and its crossing the blood-brain barrier or blood-tumor barriers by intra-arterial injection combined with a temporary osmotic or pharmacological disruption.

[0110] The term (**) intrathecal (intra+teca, "within a sheath") is an adjective that refers to something that occurs or is introduced into an anatomical space or potential space within a sheath, most commonly the arachnoid membrane of the brain or spinal cord.Dose Calculation

[0111] According to Ulusoy et al (29), the titration of the vector requires a range between 10 9< to 10 13< copies of genome (CG) per ml with a dose tested between 10 10< -10 12< gc / ml. On the other hand, at any rate of dilution of vectors to titrate, they must have a low-medium range of 10 11< gc / ml, which results in the disappearance of toxicity.Dosage in humans

[0112] Dose range in humans would be in the range between 10 9< to 10 30< viral units / Kg of weight, without restricting this range to the application in different age groups or with volumes of distribution modified by age or pathology.

[0113] The maximum concentration or level of a substance is found experimentally or by observation, and does not cause detectable adverse alterations in the morphology, functional capacity, growth, development, or life span of the target organisms, distinguishable from those observed in normal (control) organisms of the same species and strain, under defined conditions of exposure.Application Method

[0114] rAAV2 vectors were injected bilaterally into the striatum using a 5µl Hamilton syringe equipped with a glass capillary with a tip diameter of about 60-80 microns. Two microliters of buffer containing the appropriate concentrations of viral particles were injected at a rate of 0.4 µl / minute. The needle is removed slowly 5 minutes after the injection is given.Description of Figures

[0115] Figure 1 / 19 This figure presents the set of outstanding genes whose expression varied in the study of gene expression performed in XBP1-deficient animals in the context of HD. Levels of Igf2, Mmp14, Lrp4, and Uhrf, changed in the different groups, both in the cortex and in the striatum, in transgenic mice with human mutant huntingtin (YAC128), in XBP1-deficient litters, and control animals. An upregulation for the Igf2 gene is clearly seen, both in the cortex and in the striatum. Figure 2 / 19 The results obtained in the study presented in Figure 1 / 19 were confirmed by quantitative PCR (qPCR). This figure presents on the left results in cortex, and on the right results in striatum, the up-regulation of Igf2 mRNA in XBP1-deficient mice models in their brain. By this technique, it was observed that endogenous Igf2 mRNA levels are significantly increased in cortex and striatum in XBP1-deficient animals. For all in vivo experiments, an n=5, t-student **p<0.05 was used. Figure 3 / 19 This figure shows how IGF2 expression decreases the levels of mHTT aggregates in a Neuro2a cell model for Huntington's disease. Particularly, Neuro2a cells were transiently transfected with vectors for polyQ79-EGFP and IGF2 or control. Subsequently, the aggregation of polyQ was evaluated and quantified. This figure presents the photograph by fluorescence microscopy and the quantification of said fluorescence to its right, at 24 and 48 hours after transfection. For all in vivo experiments, an n=3, t-student ***p<0,001 was used. Figure 4 / 19 This figure shows how IGF2 expression decreases the levels of polyQ peptide aggregates in a Neuro2a cell model for Huntington's disease. Particularly, Neuro2a cells were transiently transfected with vectors for polyQ79-EGFP and IGF2 or control. Subsequently, the aggregation of polyQ was evaluated and quantified. This figure presents the photograph of the Western Blots and the quantification to its right, at 24 and 48 hours after transfection. For all in vitro experiments, an n=3, t-student ***p<0.001 was used. Figure 5 / 19 This figure shows how IGF2 expression decreases the levels of polyQ peptide aggregates in a Neuro2a cell model for Huntington's disease. Particularly, Neuro2a cells were transiently transfected with vectors for polyQ79-EGFP and IGF2 or control. Subsequently, the aggregation of polyQ was evaluated and quantified. This figure presents the photograph of the filter trap and the quantification on its right, at 24 and 48 hours after transfection. For all in vitro experiments, an n=3, t-student ***p<0.001 was used. Figure 6 / 19 This figure shows how IGF2 expression decreases the levels of mHTT aggregates in a Neuro2a cell model for Huntington's disease. Particularly, Neuro2a cells were transiently transfected with vectors for polyQ79-EGFP, mHTTQ85-GFP in the presence of an IGF2-enriched medium or control. Protein aggregation was evaluated and quantified 24 hours later. This figure presents the photograph by fluorescence microscopy and the quantification of that fluorescence on its right, after 24 hours of transfection. For all in vitro experiments, an n=3, t-student ***p<0.001 was used. Figure 7 / 19 This figure shows how IGF2 expression decreases the levels of mHTT aggregates in a Neuro2a cell model for Huntington's disease. Particularly, Neuro2a cells were transiently transfected with vectors for polyQ79-EGFP, mHTTQ85-GFP in the presence of an IGF2-enriched medium or control. Protein aggregation was evaluated and quantified 24 hours later. This figure presents the photograph by Western Blot and the quantification on its right, after 24 hours of the transfection. For all in vitro experiments, an n=3, t-student ***p<0.001 was used. Figure 8 / 19 This figure shows how IGF2 expression decreases the levels of mHTT aggregates in a Neuro2a cell model for Huntington's disease. Particularly, in order to test whether IGF2 was able to reduce the previously formed inclusions of polyQ or mHTTQ85-GFP, cells expressing detectable inclusions were treated with an IGF2-enriched medium or control. Protein aggregation was evaluated and quantified 24 hours later. This figure presents the photograph by Western Blot and its quantification on the right, after 24 hours of transfection. For all in vitro experiments, an n=3, t-student ***p<0.001 was used. Figure 9 / 19 This figure shows how IGF2 expression decreases the levels of mHTT aggregates in a Neuro2a cell model for Huntington's disease. Particularly, in order to test whether IGF2 was able to reduce the previously formed inclusions of polyQ or mHTTQ85-GFP, cells expressing detectable inclusions were treated with an IGF2-enriched medium or control. Protein aggregation was evaluated and quantified 24 hours later. This figure presents the photograph of a filter trap and its quantification on the right, after 24 hours of the transfection. For all in vitro experiments, an n=3, t-student ***p<0.001 was used. Figure 10 / 19 This figure shows how IGF2 expression decreases the levels of mHTT aggregates in a YAC128 murine model for Huntington's disease. Particularly, wild animals were co-injected by stereotaxy into the striatum with AAVs that expressed a fragment of the mHtt with IGF2-HA or control. Protein aggregation of mHTT was evaluated and quantified 2 weeks later. This figure presents the photograph of a Western Blot and its quantification on the right, after two weeks of transduction. For all in vivo experiments, an n=5, t-student **p<0.05 was used. Figure 11 / 19 This figure shows how IGF2 expression from the AAV virus decreases the levels of the polyQ aggregates in a YAC128 murine model for Huntington's disease. Particularly, AAVs expressing IGF2 or control were injected into the striatum of 90-day adult YAC128 mice. Three months after the injection, the levels of mHtt aggregation as well as DARPP-32 were evaluated as a reflection of the viability of the striatum neurons. In a manner similar to that observed in vitro, there was a decrease in mHtt expression and an increase in DARPP levels, where this protein is representative of the viability of the neurons mainly affected by Huntington's disease. Therefore, it is concluded that the more DARPP there are, the less neuronal death happens. For all in vivo experiments, an n=5, t-student **p<0.05 was used. Figure 12 / 19 This figure shows how IGF2 expression from the AAV virus decreases the levels of the polyQ aggregates in a YAC128 murine model for Huntington's disease. Particularly, AAVs expressing IGF2 or control were injected intraventricularly in YAC128 neonatal animals of 1 or 2 days of age. Aggregation levels of mHtt were evaluated six months after the injection. In a manner similar to that observed in vitro, a decrease in mHtt expression was found. Figure 13 / 19 This figure shows how the expression of IGF2 in a YAC128 murine model for Huntington's disease manages to correct the motor problems generated by the disease. Particularly, motor tests were performed on YAC128 mice bilaterally injected by stereotaxy with AAV-IGF2 / HA or AAV-Control. Records were taken every two weeks, for two months. This figure presents a behavior graph in response to the Rotarod test over time under the effect of AAV2 / IGF2-HA. Figure 14 / 19 The upper figure indicates the injection place in neonatal mice. The lower figure shows the place where the AAVs are intra-cerebrally injected into the striatum of an adult mouse. Figure 15 / 19 The present figure shows a scheme of the AAV genome. REP: Genes involved in the AAV replication mechanism. VP: Genes involved in capsid formation and assembly. ITR: It is the equivalent to LTR, inverted terminal repeated sequence. Figure 16 / 19 This figure presents the AAV virus vector with the IGF2-HA insert with the following specific description according to Table II. Figure 17 / 19 This figure presents the AAV virus vector with the IGF2 insert with the following specific description according to Table III. Figure 18 / 19 This figure presents the confirmation of the expression of the viral constructs generated. TO this end, HEK cells were transfected with the different constructs, after 24 hours of transfection, the proteins that were evaluated by WB were extracted using anti-IGF2 and anti-HA antibodies. Finally, a band of the expected molecular weight for IGF2 (17 kDa) and IGF2-HA (18 kDa) is detected in the cells transfected with the plasmids pAAV-IGF2 and pAAV-IGF2-HA respectively. Figure 19 / 19 This figure shows the protein levels of IGF2 in patients with HD and with control individuals. It was found that in patients with HD, IGF2 is hardly expressed suggesting an involvement in the development of the pathology. The figures on the left have a Western blot for IGF2, to the right of the figure shows the quantification of the brand and the marked low of it in patients with HD. EXAMPLE OF APPLICATION EXPERIMENTAL TEST 1

[0116] An in vivo experiment was performed in models of young adult WT mice. The AAV transformed virus expressing a large fragment of the human mHtt (588 bis) coupled to RFP and AAV / IGF2-HA or control was co-injected into the striatum by brain stereotaxy (Figure 14 / 18).

[0117] After two weeks, the animals were sacrificed and the striatum was dissected. As expected from previous in vitro results, a clear decrease in mHtt aggregation was observed after IGF2 administration (Figure 10 / 18).EXPERIMENTAL TEST 2

[0118] In order to evaluate the effectiveness of IGF2 treatment, a more physiological model expressing human mHtt under its own promoter was used.

[0119] In this experimental strategy, it was demonstrated that treatment with AAV-IGF2 significantly decreased the levels of mutant huntingtin. In addition, greater neuronal viability was observed, as shown by the increase in DARPP32 levels (Figure 11 / 18).

[0120] Particularly, it was tested whether the AAVs expressing IGF2-HA, compared to the control, injected by stereotactic surgery into the striatum, achieved the effect of decreasing the aggregation, thus improving neuronal viability.

[0121] Three months later, mHtt expression and DARPP-32 protein expression levels were evaluated and quantified.

[0122] A decrease in mHtt expression and an increase in DARPP levels were clearly observed, where this protein is representative of the viability of neurons mainly affected by Huntington's disease. Therefore, it was concluded that in the more DARPP there are, the less neuronal death happens.

[0123] For all in vivo experiments, at least one n=4, t-student **p<0.05 was used.EXPERIMENTAL TEST 3

[0124] In this experiment, it was intended to study whether the treatment with AAV-IGF2-HA manages to correct the motor problems generated by the disease (Figure 13 / 18). To this end, the animals were bilaterally injected by stereotaxy into the striatum with AAV-IGF2-HA or AAV-control.

[0125] For three months and every two weeks, they were subject to this motor test in order to quantify the progression of the disease. It was observed that the animals treated with AAV-IGF2-HA showed a better motor activity than their siblings treated with the AAV-control.

[0126] For all in vivo experiments, an n=5, t-student **p<0.05 was used.Materials and methods Cell cultures

[0127] Neuro2a cells are derived from a murine neuroblastoma and are widely used as cellular models. The cells were maintained in DMEM supplemented with 10% FBS, 100 U / ml glutamine penicillin, and 100 µg / ml streptomycin in a 5% CO 2 atmosphere at 37°C. The cells are stored frozen at -80°C in 10% FBS DMSO in the case of N2a. For the maintenance of the line, passages were given every two or three days by trypsinizing the cells of the culture flasks, and after collecting the cells and centrifuging, they were reseeded in passes 1:3-1:6 according to the needs.Cellular transfections

[0128] Cell transfections were performed using the cationic reagent Effectene following the manufacturer's instructions.Animals and Surgical Procedures:

[0129] Mice injected in adulthood were injected at 90 days of age. Mice injected in the neonate state were injected between postnatal days 1 and 2. According to the experiment, wild mice (WT) or YAC mice and their wild siblings were used as control.

[0130] In all cases, the strain used was C57BL / 6. Mice were kept in a 12:12 h light-dark cycle of and had free access to food and water.

[0131] For all animal experiments presented in the development of this invention, the guidelines established by the animal care and use committee at the University of Chile, Chile were used.Generation of YAC 128 transgenic mice.

[0132] From a yeast artificial chromosome (YAC) that contained the complete human huntingtin gene, it was modified with an expansion of 128 glutamine repeats in exon 1. The resulting construct, YAC128, was injected into pronuclei of the FVB / N strain. Founding line number 53 was established as transgenic line. In order to obtain the c57BL / 6 strain, backcrosses were made to ensure the animals background.Immunoblot or "Western blot".

[0133] The extraction of total proteins was done from cultures of N2a cells, or tissues dissected from wild or transgenic animals, as the case may be. The cells were harvested in 1% PBS-Triton buffer with protease and phosphatases inhibitors.

[0134] The samples were prepared at the desired concentration in loading buffer. Between 25 and 100 ug of protein were loaded in polyacrylamide gels. Electrophoresis was developed in a mini-Protean 3 system in glycine electrophoresis buffer. After the electrophoretic separation, the proteins were transferred to PVDF membranes previously hydrated in methanol and equilibrated for 5 minutes in transfer buffer, using a mini-Trans Blot system.

[0135] The filter trap assays were performed from the same protein extracts prepared in 1% SDS. Between 25-50 ug of protein were loaded onto the filter trap support using a membrane whose pore is <0.22 um.Behavioral tests

[0136] All experiments were conducted blind, and different animal cohorts were used for each behavioral test.Rotarod

[0137] In summary, mice undergo a training of 4 days during which the animals make contact with the rotarod, the task and the experimenter. On day 5, the test is carried out measuring the time that the animal remains in the rotarod with an acceleration of 4 to 40 rpm in 120s. The test continued until all the mice fell off the rod. The latency in falling and the rpm at the time of the fall were recorded for each mouse. Three assays were performed per mouse and averaged.Production of Adeno-associated vectors

[0138] AAV Serotype 2 (AAV2 / 2) particles were produced by the transfection of 293-AAV cells (Agilent Technologies, Santa Clara, CA) and purified on a gradient of iodixanol followed by column affinity chromatography. The number of AAV particles containing the genome in the suspension, as well as the infectivity of the vector suspension in HEK293T cells were determined by TaqMan qPCR assays.Preparation of the adenoviral plasmid (pAAV) for IGF2-HA

[0139] For the development of this objective, the murine IGF2 sequence was cloned into the adenoviral plasmid pAAV-MCS, which expresses the transgene under the CAG promoter. From the cDNA cloned in a pSPORT6 vector, kindly donated by Dr. Oliver Bracko, we performed PCRs that allowed us to obtain Igf2 and Igf2-HA to subclone into the pAAV-MCS vector. The IGF2-HA cDNA, which encodes HA-tagged C-terminus, was generated by PCR amplification of Igf2-EcoR1, SN2 and, Igf2-HA-Bgl II AS. sense primer 5'GGCGAATTCCCTGGCTATGGGGATCCCAGTG3'; anti-sense-HA primer anti-sense primer GGCAGATCTTCACTGATGGTTGCTGG

[0140] Due to the low efficiency of antibodies that recognize IGF2 in murine tissue, the sequence of the HA tag was included in the cloning strategy, which then allowed the identification of transduced cells and the expression of IGF2 (without excluding other epitope sequences to identify the cells transduced such as FLAG, GFP, His and Myc, among others). Therefore, IGF2 was amplified with the HA tag sequence at the 3' end. The obtained clones were confirmed by DNA sequencing. In this way, we generated the pAAV-CAG-IGF2-HA and pAAV-CAG-IGF2 constructs encoding for the IGF2 fusion protein with and without the tag, respectively. The empty adenoviral plasmid pAAV CAG was used as a control.

[0141] In order to confirm the expression of the generated constructs, we transfected HEK cells with the different constructs, after 24 hours of transfection we performed the extraction of proteins that were evaluated by WB using anti-IGF2 and anti-HA antibodies.

[0142] Finally, as shown in Figure 18 / 18, we detected a band of the expected molecular weight for IGF2 (17 kDa) and IGF2-HA (18 kDa) in cells transfected with the plasmids pAAV-IGF2 and pAAV-IGF2-HA respectively.Stereotactic injections

[0143] Mice were anesthetized using ketamine / xylazine anesthesia (Ketamine: 100 mg / kg, xylazine: 10 mg / kg, Vetcom, Chile), and placed on a stereotaxic frame with their mouths, noses and ears fastened (David Kopf Instruments, USA). According to the experiment, unilateral or bilateral injections of AAV-mHTT-RFP, AAV-IGF2-HA, or AAV-empty (control) were made, with the following concentrations: 1.96x10 12< , 1x10 13< , and 1.2x10 13< units of transduction / µl respectively. 2µl of AAV were injected at a single point in the striatum region using a Hamilton syringe of 5 µl (Hamilton, USA) in the following coordinates: AP: +0.07 cm, ML: -0.2 cm, DV: -0.31cm (according to the atlas of Paxinos and Franklin, 1997). The injection was administered at a speed of 0.5 µl / min and the needle is left in place for 5 min before retraction of the needle. The mHTT expression was studied by WB as shown in Figure 10 / 18. The IGF2 expression was verified by conventional PCR.Preparation of tissues for biochemical analysis

[0144] The mice were sacrificed by CO 2 narcosis, the brains were removed, and the cortex and striatum of both hemispheres were rapidly dissected on a plate on ice. The tissue was homogenized in phosphate buffered saline (PBS) (pH 7.4) supplemented with a mixture of protease and phosphatase inhibitors (Roche applied science, USA). The homogenate was divided to obtain mRNA and protein extraction was followed by standard purification and quantification protocols.RNA extraction, real-time PCR and conventional PCR

[0145] Total RNA was isolated from the cortex and the striatum. After homogenization in PBS, Trizol RNA extraction protocol recommended by the manufacturer was followed. The cDNA was synthesized with a high capacity cDNA reverse transcription kit (Applied Biosystems). For the quantitative RT-PCR, Eva Green and the Mx3005P equipment from Stratagene were used. The relative amount of cDNA was calculated by means of comparative threshold cycle method with β-actin as a control. For the conventional PCR, we used the GoTaq ®< Green master mix from Promega. Primers sequences were obtained from PrimerBank (Table VI). Table VIObjectiveSenseAntisenseIgf2GTC GCA TGC TTG CCA AAG AGGGT GGT AAC ACG ATC AGG GGIpf2-HAGTC GCA TGC TTG CCA AAG AGTAG ACG TAA TCT GGA ACA TCGActinTAC CAC CAT GTA CCC AGC ACTC AGG AGGAGC AAT GAT CTT GAT Western blot

[0146] Protein extraction from mouse tissue was carried out in RIPA buffer (20 mM Tris pH 8.0, 150 mM NaCl, 0.1% SDS, 0.5% deoxycholate, 0.5% Triton X-100) containing a mixture of protease inhibitors and a mixture of phosphatase inhibitors (Sigma, USA). The extraction of proteins from cell lines was carried out in 1% Triton in PBS containing of protease and phosphatase inhibitors. The samples were quantified with the BCA assay kit (Pierce, USA). Total cellular extracts were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes. The following antibodies were used for the immunoblot analysis: anti-Hsp90 (1:3000, Santa Cruz), anti-IGF2 (1:1000 Abcam), anti-polyQ (1:1000 Sigma), anti-GFP (1:1000 Santa Cruz), anti-DARPP32 (1:1000 Cell Siganlling), anti-tubulin (1:3000, Millipore).Neuronal cultures and transfections

[0147] Neuro2A cells were obtained from the ATCC and cultured in DMEM medium supplemented with 5% bovine serum and antibiotics (10000 U / ml penicillin, 10 mg / ml streptomycin), at 37°C and 5% CO 2 .Statistics

[0148] The data are expressed as mean and SEM. Based on the experiments, the results were statistically compared using the Student's T test or the Mann-Whitney test, two-way ANOVA followed by Holm-Sidak or Bonferroni as a post-hoc test or Kruskal-Wallis, one-way ANOVA in ranges followed by the Dunn or Bonferroni Method as a post-hoc test.References

[0149] 1. W. E. Balch, R. I. Morimoto, A. Dillin, J. W. Kelly, Science. 319, 916-919 (2008). 2. J. Leitman et al., PLoS One. 9, e90803 (2014). 3. H. Lee et al., Hum. Mol. Genet. 21, 101-114 (2012). 4. J. R. Naranjo et al., J. Clin. Invest. 126, 627-638 (2016). 5. R. L. Vidal et al., Hum Mol Genet. 21, 2245-2262 (2012). 6. R. Vidal, B. Caballero, A. Couve, C. Hetz, Curr. Mol. Med. 11, 1-12 (2011). 7. C. Hetz, B. Mollereau, Nat Rev Neurosci. 15, 233-249 (2014). 8. H. L. Smith, G. R. Mallucci, Brain (2016), doi:10.1093 / brain / aww101. 9. W. Scheper, J. J. M. Hoozemans, Acta Neuropathol. 130, 315-31 (2015). 10. P. Walter, D. Ron, Science (80-. ). 334, 1081-1086 (2011). 11. C. Hetz et al., Genes Dev. 23, 2294-2306 (2009). 12. P. Valdés et al., Proc. Natl. Acad. Sci. U. S. A. 111, 6804-9 (2014). 13. A. M. Fernandez, I. Torres-Alemán, Nat. Rev. Neurosci. 13, 225-239 (2012). 14. E. Carro et al., Neurobiol. Aging. 27, 1250-1257 (2006). 15. B. K. Kaspar, J. Lladó, N. Sherkat, et al, Science. 301, 839-42 (2003). 16. C. K. Franz et al., Neurobiol. Dis. 33, 473-81 (2009). 17. M. Pascual-Lucas et al., EMBO Mol. Med. 6, 1246-1263 (2014). 18. T. J. Mellott, S. M. Pender, R. M. Burke, et al, PLoS One. 9, e94287 (2014). 19. I. Allodi et al., Sci. Rep. 6, 25960 (2016). 20. E. J. Rivera et al., J. Alzheimers. Dis. 8, 247-68 (2005). 21. W. E. Heywood et al., Mol. Neurodegener. 10, 64 (2015). 22. D. Åberg et al., J. Alzheimers. Dis. 48, 637-46 (2015). 23. P. Garcia-Huerta, P. Troncoso-Escudero, C. Jerez, C. Hetz, R. L. Vidal, Brain Res. (2016), doi:10.1016 / j.brainres.2016.02.052. 24. Faulí Trillo C, "Tratado de Farmacia Galénica" (Ed Luzán 5, SA, Madrid, ES, 1993.) and Gennaro A, Ed., "Remington: The Science and Practice de Farmacia" 20a ed. (Lippincott Williams Wilkins, Philadelphia, PA, Estados Unidos, 2003). 25. Product Data Sheet Paav-MCS Expression vector, Catalog Number: VPK-410. 26. A. Zuleta, R. L. Vidal, D. Armentano, G. Parsons, C. Hetz, Biochem Biophys Res Commun. 420, 558-563 (2012). 27. Candace et al (2005) Journal of Pharmaceutical Sciences, volume 94 number (6), pages 1187-1195. 28. Constantini et al (2000) Gene Therapy volume 7, pages 93-10. 29. Ulusoy et al (1999) Molecular Theraphy volume 17, no 9, pages 1574-1584. 30. Carter B, asociados-A.deno para la entrega de genes, Lassic D, et al, Eds, "Gene" Therapy: Mecanismos y estrategias terapéuticas ".. (Marcel Dekker, Inc., Nueva York, NY, Estados Unidos, 2000) and Gao et al., J. Virol. 2004; 78 (12): 6381-6388. Table I Characteristics and sequence of pAAV / 2-MCS plasmid.GenBank: AF043303.1Origin Table II pAAV2-IGF2 vector sequence Characteristics:

[0150] IGF2: [1339 : 1878 - CW]F1 origin: [3066 : 2626 - CW]Stop: [1339 : 1878 - CW]L-ITR: [2430 : 2528 - CW]R-ITR: [12 : 106 - CW]M13 origin: [2621 : 3076 - CW]ColE1 origin: [4472 : 5100 - CW]AmpR: [3661 : 4320 - CW]Amp Prom: [3393 : 3421 - CW]hGH polyA signal: [1889 : 2369 - CW]CMV immediate-early promoter: [170: 721 - CW]Internal b Glob and CAG enhancer: [820: 1312 - CW] Table III AAV2-IGF2-HA vector sequence Characteristics:

[0151] IGF2: [1339 : 1878 - CW]F1 origin: [3093 : 2653 - CW]HA: [1879 : 1908 - CW]L-ITR: [89 : 196 - CW]R-ITR: [12 : 106 - CW]T7: [2587 : 2606 - CW]T7: [3532 : 3551 - CW]M13 origin: [2648 : 3103 - CW]ColE1 origin: [4499 : 5127 - CW]AmpR: [3688 : 4347 - CW]Amp Prom: [3420 : 3448 - CW]hGH polyA signal: [1916 : 2396 - CW]CMV immediate-early promoter: [170: 721 - CW]Internal b Glob y CAG enhancer: [820 : 1312 - CW] Table IV Igf2 (Murine) Table V Igf2-HA (Murine) Table VII IGF2 (Human)

Claims

1. An adeno-associated virus (AAV) for use in the prevention or treatment of Huntington's disease in a subject in need thereof, wherein said AAV is an AAV2 serotype comprising a recombinant viral genome, wherein said genome comprises an expression cassette comprising a transcription regulatory region operably linked to a polynucleotide of interest that encodes for human IGF2 or human IGF2 bound to a hemagglutinin (HA) epitope (IGF2-HA), wherein the administration of said AAV induces neuronal overexpression of IGF2 in the brain of said subject.

2. The adeno-associated virus for use according to claim 1, wherein the regulatory region comprises a promoter region selected from the group comprising CAG, CMV, b-globin, CBA, elFalpha and PGK.

3. The adeno-associated virus for use according to any preceding claim, wherein the expression cassette comprises a post-transcriptional regulatory region, which is the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

4. A pharmaceutical composition for use in the prevention or treatment of Huntington's disease in a subject in need thereof, wherein said pharmaceutical composition comprises the adeno-associated virus as described in any preceding claim and a pharmaceutically acceptable excipient.

5. The pharmaceutical composition for use according to claim 4, comprising a dose of the virus in a range between 109 to 1013 genome copies (GC) per ml of composition.

6. A plasmid comprising the AAV of claim 1, wherein said plasmid is one of those deposited at the international agent of biological deposit, the Chilean Collection of Microbial Genetic Resources (CChRGM), having deposit numbers RGM2335 and RGM2336.