A simplified molecular diagnostic workflow for detecting human immunodeficiency virus 1 (HIV-1) and hepatitis c virus (HCV)

A simplified molecular diagnostic workflow using CRISPR guide RNAs and RT-LAMP primers with a battery-powered heating device allows for efficient, portable, and cost-effective detection of HIV-1 and HCV in resource-limited settings, overcoming the limitations of existing technologies by eliminating the need for cold storage and electrical power.

WO2026081001A1PCT designated stage Publication Date: 2026-04-23HIS MAJESTY THE KING IN RIGHT OF CANADA AS REPRESENTED BY THE MINISTER OF HEALTH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
HIS MAJESTY THE KING IN RIGHT OF CANADA AS REPRESENTED BY THE MINISTER OF HEALTH
Filing Date
2025-09-16
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Existing molecular diagnostics for HIV-1 and HCV require costly equipment, reliable power sources, and cold-chain storage, making them impractical for resource-limited settings and point-of-care testing.

Method used

A simplified molecular diagnostic workflow using CRISPR guide RNAs and RT-LAMP primers that can be stored at ambient temperatures, combined with a battery-powered heating device for isothermal amplification and lateral flow dipstick detection, allowing for rapid on-site testing of HIV-1 and HCV directly from whole blood without extraction.

Benefits of technology

Enables efficient, portable, and cost-effective detection of HIV-1 and HCV in resource-limited settings with high sensitivity and specificity, achieving a lower limit of detection comparable to or better than existing methods while eliminating the need for cold storage and electrical power.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CA2025051223_23042026_PF_FP_ABST
    Figure CA2025051223_23042026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein is a singleplex RT-LAMP-based tests using modified primer sets. Contrived whole blood samples containing HIV-1 or HCV virions were diluted in equal parts water and loaded directly into optimized RT-LAMP master mixes. To mitigate cold-chain storage dependence, RT-LAMP reactions were performed using a lyophilized master mix. The reactions were heated for, for example 30 minutes using a hand-held, battery-powered heating device for simultaneous virion lysis and amplification.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] A SIMPLIFIED MOLECULAR DIAGNOSTIC WORKFLOW FOR DETECTING HUMAN IMMUNODEFICIENCY VIRUS 1 (HIV-1 ) AND HEPATITIS C VIRUS (HCV) PRIOR APPLICATION INFORMATION

[0002] The instant application claims the benefit of US Provisional Patent Application Serial Number 63 / 709,016, filed October 18, 2024 and entitled “A SIMPLIFIED MOLECULAR DIAGNOSTIC WORKFLOW FOR DETECTING HUMAN IMMUNODEFICIENCY VIRUS 1 (HIV-1 ) AND HEPATITIS C VIRUS (HCV) FROM WHOLE BLOOD” is hereby incorporated herein by reference for all purposes.

[0003] SEQUENCE LISTING XML

[0004] Sequence Listing XML file entitled “88514-1 OPCT.xml”, created September 8, 2025, 45,056 bytes is incorporated herein by reference for all purposes.

[0005] BACKGROUND OF THE INVENTION

[0006] Early diagnosis of human immunodeficiency virus-1 (HIV-1 ) and hepatitis C virus (HCV) is key to preventing viral transmission and improving linkage to treatment. Isothermal amplification methods, such as reverse transcription looped-mediated amplification (RT-LAMP), have enabled molecular diagnostics to expand beyond centralized laboratories. Despite the advances in molecular point-of-care (POC) testing, many of these tests are costly and still depend on a reliable power-source, specialized equipment, or cold-chain storage, making them impractical for portable use. To overcome these barriers, there is a need for innovative molecular diagnostics for blood-borne pathogens, which can be utilized in resource-limited settings.

[0007] SUMMARY OF THE INVENTION

[0008] According to an aspect of the invention, there is provided one or more CRISPR guide RNAs selected from the group consisting of: UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 ); UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2); UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3); UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5).

[0009] According to another aspect of the invention, there is provided a method for detecting human immunodeficiency virus (HIV-1 ) and / or Hepatitis C virus (HCV) in a sample comprising: providing a reaction mix comprising: a reverse transcriptase and a DNA polymerase; adding at least one RT-LAMP primer set specific for amplification of a region of HIV genome conserved across HIV-1 subtypes and / or at least one RT-LAMP primer set specific for amplification of a region of HCV genome conserved across HCV subtypes; adding a sample suspected of comprising HIV-1 virions and / or HCV virions; heating the sample to a suitable temperature for a suitable period of time for RT-LAMP reaction to occur; and detecting on target amplicons from the RT-LAMP reaction.

[0010] For example, as used herein, the term “a conserved region of the HIV-1 genome” refers to a contiguous nucleotide sequence of HIV, for example, of HIV-1 subtype B that exhibits at least 80% sequence identity to a subtype B consensus sequence, for example as represented in the Los Alamos HIV Sequence Database or GenBank. In certain embodiments, such conserved regions span at least 120 nucleotides, more preferably about 150-400 nucleotides. By way of example, a conserved region within gag may span about 167 nucleotides, and a conserved region within pol may span about 359 nucleotides. Oligonucleotides, including primers and guide RNAs, may hybridize to sub-segments of these conserved regions, and such oligonucleotides are typically 15-30 nucleotides in length.

[0011] For example, as used herein, the term “a conserved region of the HCV genome” refers to a contiguous nucleotide sequence within an HCV genome, for example, an HCV genotype 1a that exhibits at least 80% sequence identity to a genotype 1a consensus sequence, with demonstrated suitability for detection of genotype 1 b and, in certain embodiments, genotype 3a. In certain embodiments, such conserved regions span at least 200 nucleotides, more preferably about 250-350 nucleotides. By way of example, a conserved region within the HCV 5' UTR may span about 313 nucleotides.

[0012] For example, RT-LAMP primer sets known in the art can have target gene and genomic coordinates of: (i) HCV 5’-UTR, nucleotides 127-313 (Kargar et al., 2012); (ii) HCV 5’UTR, nucleotides 103-337 (DN2 from Nyan and Swinson, 2016); (iii) HCV 5’UTR, nucleotides 24-297 (Witkowska McConnell et al., 2021 ); (iv) HIV-1 gag, nucleotides 770-937 (Zeng et al., 2014); (v) HIV-1 pol, nucleotides 4267-4409 (Hosaka et al., 2009); (vi) HIV-1 pol, nucleotides 4472-4626 (Ocwieja et al., 2015); and (vii) HIV-1 pol, nucleotides 4447-4615 (Rudolph et al., 2015). Other suitable conserved regions of a respective HCV or HIV genome will be readily apparent to one of skill in the art based on these definitions and examples and are held to he within the scope of the invention.

[0013] BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 . Schematic of one embodiment of the invention that has a 32-minute runtime workflow and simultaneously detects HIV-1 subtype B and HCV 1 a directly from contrived blood using reagents stored at room temperature and a handheld battery-powered heating device. Reagents are shipped and stored at ambient temperatures. Use nuclease-free water to rehydrate LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDGTM(L4401 S). Rehydrate pathogen-specific primer sets. Assemble HIV-1 and HCV RT-LAMP master mixes with the addition of betaine (top panel). Dilute contrived blood containing HIV-1 and / or HCV with equal volume of nuclease-free water (left-most panel). 25 ul singleplex extraction-free HIV-1 and HCV RT-LAMP (left middle panel). Incubate the strip tube at 62C for 30 minutes using the Genie III™, a battery-powered heating device (right middle panel). Add 30 ul of nuclease-free water to each reaction. Submerge dipstick and read results after two minutes (right most panel). Figure 2. Diagnosis of a contrived co-infected HIV-1 subtype B and HCV 1a blood sample using ambient stored reagents, a handheld battery-powered heating device, lateral flow dipsticks and 32-minutes of runtime.

[0015] DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference.

[0017] Described herein are singleplex RT-LAMP-based tests, each using a modified primer set. Contrived whole blood samples containing HIV-1 or HCV virions were diluted in equal parts nuclease-free water and then 5 uL was loaded directly into optimized RT-LAMP master mixes. To mitigate cold-chain storage dependence, RT- LAMP reactions were performed using a lyophilized master mix. The reactions were heated for, for example 30 minutes using a hand-held, battery-powered heating device for simultaneous virion lysis and amplification, shown schematically in Figure 1.

[0018] Specifically, as shown therein, the process uses reagents that can be shipped and stored at ambient temperatures. For use, nuclease-free water is used to rehydrate the reaction buffer as defined herein. In some embodiments of the invention, the reaction buffer is LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401 S). As will be appreciated by those of skill in the art, prior to use, pathogen-specific primer sets are also rehydrated with nuclease-free water if necessary. In some embodiments of the invention, pathogen-specific, for example, HIV-1 and HCV-RT-LAMP master mixes are prepared from these reagents and added betaine.

[0019] As known to those of skill in the art, “betaine” generally refers to any neutral chemical compound with a positively charged cationic functional group that bears no hydrogen atom, such as a quaternary ammonium or phosphonium cation and with a negatively charged functional group, such as a carboxylate group that may not be adjacent to the cationic site. In some embodiments, the betaine is trimethylglycine. Betaine and its derivatives are known in the art as compatible solutes and chemical additives that can influence nucleic acid stability, hybridization, and enzymatic activity. In molecular amplification reactions, including but not limited to polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP), betaine may function to reduce secondary structure formation in nucleic acids, enhance primertemplate interactions, and promote more efficient and specific amplification.

[0020] As shown in Figure 1 , blood suspected of containing HIV-1 and / or HCV is then diluted with an equal volume of nuclease-free water.

[0021] The diluted blood sample is then mixed with the appropriate master mixes or control mixes, prepared as described above. For example, about 5 pl of diluted blood sample may be mixed with about 20 pl of appropriate master mix, thereby producing an appropriate reaction mix.

[0022] Each of the respective reaction mixes are then incubated at a suitable temperature for a suitable period of time, that is, at a suitable temperature for a suitable period of time that results in lysis of the virus particles. In the embodiment shown in Figure 1 , the reaction mixes are heated at about 62°C for about 30 minutes using a suitable battery powered heating device, which demonstrates the portability of the process, specifically, that the process can be carried out outside of laboratory environments, allowing for rapid, efficient on-site testing. In the embodiment shown in Figure 1 , the battery powered heating device is the Genie III™ battery powered heating device.

[0023] In general, as used herein, the term “suitable battery-powered heating device” refers to any portable, electrically powered apparatus capable of maintaining an amplification reaction at a predetermined temperature for a sufficient period of time to permit target nucleic acid amplification. In some embodiments, the heating device maintains the reaction mixture at a predetermined, suitable temperature of about 60°C to about 70°C, for a duration of or a sufficient period of time of about 10 minutes to about 90 minutes, depending on the amplification chemistry employed (e.g., RT- LAMP). A suitable device may include, but is not limited to, battery-powered heat blocks, insulated reaction chambers, chemical heating packs with controlled regulation, or other portable heating elements configured to provide stable isothermal conditions. The heating device may further comprise features such as temperature regulation, insulation, and compatibility with standard reaction vessels (e.g., PCR tubes, strips, or microfluidic cartridges).

[0024] Once the reactions have completed in this embodiment, detection is carried out by adding nuclease-free water, for example, about 30 pl of nuclease-free water and then submerging a dipstick into the reaction mix. In these embodiments, a result can be read within 2 minutes.

[0025] According to an aspect of the invention, there is provided one or more CRISPR guide RNAs from the group consisting of: UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 ); UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2); UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3); UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5).

[0026] Specifically, SEQ ID No:1 , also referred to as HCV gRNA 1 and SEQ ID No:2, also referred to as HCV gRNA 2, both target HCV 1a. SEQ ID No: 3, also referred to herein as guide HIV-1 gRNA 1 , SEQ ID No:4, referred to herein as HIV-1 gRNA 2 and SEQ ID No: 5, referred to herein as HIV-1 guide RNA 3, all target HIV-1 subtype B.

[0027] As discussed herein, the CRISPR guide RNAs can be used for HIV-1 subtype differentiation. One of our HIV-1 gRNAs has three mismatches towards the target region in HIV-1 subtype C and only one mismatch for HIV-1 subtype B. We have confirmed from internal experiments that this gRNA can detect subtype B. This gRNA could be used for HIV-1 subtyping (amplification positive, CRISPR positive = HIV-1 subtype B; amplification positive, CRISPR negative = HIV-1 non-subtype B).

[0028] Alternatively, our Cas12a gRNA design methodology can be used for HIV-1 drug resistance mutation detection. Specifically, as will be understood by one of skill in the art, the overall concept uses RT-LAMP to amplify a region containing the HIV-1 drug resistance singlenucleotide polymorphism (SNP), then interrogate the amplicons with allele-specific CRISPR reactions with readout that can be fluorescence of lateral flow.

[0029] In this example, the first step is to select the target SNP by identifying a clinically relevant HIV-1 drug-resistance mutation to serve as the detection target.

[0030] The next step is to design the amplification primers by creating an RT-LAMP primer set that robustly amplifies a fragment encompassing the SNP, accounting for subtype variability.

[0031] The next step is to design allele-specific gRNAs by generating two guide RNAs compatible with LbCas12a — one perfectly matching the wild-type allele, the other perfectly matching the mutant sequence, with the SNP positioned in the guide RNA’s seed region for maximal discrimination.

[0032] The next step is to prepare synthetic controls by synthesizing short DNA fragments representing the wild-type sequence and the SNP-containing mutant sequence to serve as positive controls and to validate assay specificity.

[0033] The next step is to perform RT-LAMP reactions by running parallel amplifications using (i) the wild-type fragment, (ii) the mutant fragment, (iii) a mixture of both, and (iv) a no-template control. These establish the expected amplification profiles and guard against contamination.

[0034] CRISPR-Cas12 detection: An aliquot of each post-RT-LAMP product is split into two downstream reactions — one containing Cas12a with the wild-type gRNA, and the other with Cas12a and the mutant gRNA. Each reaction includes a short singlestranded DNA reporter labeled with a 5' fluorophore and a 3' quencher. When the Cas12a-gRNA complex binds its target amplicon, Cas12a becomes activated and cleaves the reporter non-specifically, separating fluorophore from quencher and producing a measurable fluorescence signal. An increase in fluorescence over time indicates that the gRNA recognized its matching amplicon, while the absence of a signal indicates no recognition. The table below shows the expected results and interpretation:

[0035] Alternatively, these CRISPR guide RNAs may be combined with other isothermal amplification methods, such as recombinase polymerase amplification helicase-dependent amplification.

[0036] Furthermore, as discussed herein, the HIV-1 and HCV CRISPR-Cas12a guide RNAs can be used with the workflow described herein as a step after an RT-LAMP assay to increase diagnostic specificity or as an inexpensive and high-throughput method to visualize and verify target-specific amplicons during RT-LAMP assay development and optimization

[0037] According to another aspect of the invention, there is provided a method for detecting HIV-1 and HCV in a sample comprising: providing an RT-LAMP reaction mix comprising: a reverse transcriptase and a DNA polymerase; adding at least one RT-LAMP primer set specific for amplification of a region of HIV-1 genome conserved across HIV-1 subtypes and / or at least one RT-LAMP primer set specific for amplification of a region of HCV genome conserved across HCV subtypes; adding a sample suspected of comprising HIV-1 virions and / or HCV virions to the RT-LAMP reaction mix; heating the RT-LAMP reaction mix to a suitable temperature for a suitable period of time for RT-LAMP reaction to occur; and detecting on target amplicons from the RT-LAMP reaction mix. The DNA polymerase may be Bst DNA polymerase.

[0038] The reaction mixture may further comprise a suitable amplification buffer, for example, a 10x isothermal amplification buffer, dNTPs, nucleic acid fluorescence stain and magnesium sulphate.

[0039] The RT-LAMP primers used in the examples are shown in Table 10. As discussed herein, other suitable primers may be used and are within the scope of the invention.

[0040] The RT-LAMP reaction may be heated to the suitable temperature by a battery-powered heating device, for example, by a hand-held, battery-powered heating device, as discussed herein.

[0041] In some embodiments, the suitable temperature is from about 62°C to about 63°C.

[0042] In some embodiments of the invention, one or more of the RT-LAMP primers is labelled. Specifically, as discussed herein, the RT-LAMP primers may be labelled such that target amplicons may be detected following subjecting the RT-LAMP reaction mix for time and temperature conditions suitable to produce the target amplicons if either HIV-1 and / or HCV virions are present in the sample.

[0043] The CRISPR mix may be incubated at about 37°C for about 10 to about 30 minutes for the CRISPR reaction to occur. The target amplicons may be detected by adding CRISPR enzymes and CRISPR guide RNA to an aliquot of the RT-LAMP reaction mix, thereby forming a CRISPR mix. The CRISPR enzymes may be Cas12a enzymes.

[0044] The CRISPR guide RNA may comprise one or more CRISPR guide RNAs selected from the group consisting of: UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 ); UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2); UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3); UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5). The magnesium sulphate may be, for example, about 5 to about 7 mM magnesium sulphate.

[0045] The RT-LAMP reaction mix may further comprise about 0.5M betaine.

[0046] The RT-LAMP reaction mix may be lyophilized, for example, like LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG™ (L4401 S).

[0047] In some embodiments, the RT-LAMP reaction mix is LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG™ (L4401 S) that is lyophilized further comprises at least one RT-LAMP primer set specific for amplification of a region of HIV-1 genome conserved across HIV-1 subtypes and / or the at least one RT-LAMP primer set specific for amplification of a region of HCV genome conserved across HCV subtypes and / or further comprising CRISPR enzymes and one or more CRISPR guide RNAs selected from the group consisting of: UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 ); UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2); UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3); UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5).

[0048] In some embodiments, the blood sample is diluted prior to addition to the RT- LAMP reaction mix, as discussed herein, for example, the blood may be about 5% to about 10% v / v of the RT-LAMP reaction mix.

[0049] As discussed herein, for detection, one or more of the RT-LAMP primers may be labelled or two or more of the primers may be labeled with a unique label for differentiation. For example, one primer may be labelled with biotin, and the corresponding primer labelled with 6-Carboxyfluorescein (FAM). The amplified genetic material will then contain both biotin and FAM. The labelled amplicons are then compatible and visualized with a commercially purchased lateral flow dipstick, as discussed herein.

[0050] Furthermore, in those reactions that comprise both at least one RT-LAMP HIV- 1 primer set and at least one RT-LAMP HCV primer set; one primer set can be labelled with biotin and FAM, while the other primer set can be labelled with digoxigenin and FAM.

[0051] In those embodiments wherein the reaction mix is the lyophilized master mix (LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDGTM(L4401 S)), this mix is rehydrated with water. The pathogen-specific labelled RT-LAMP primer mix and betaine are added to this rehydrated mix. 20 uL of the prepared mix is used per RT- LAMP reaction. The addition of betaine improves the test sensitivity in crudely extracted blood, presumably due to the relaxation of secondary structures within the target RNA, as discussed herein.

[0052] As discussed herein, the blood sample may be from for example a finger prick or taken from the heel of the individual / patient who may be a human.

[0053] In some embodiments, , the blood sample is used directly and is diluted from about 5% to about 10% v / v, as discussed herein, wherein “about” indicates the base value plus or minus 10%. As such, “about 10%” means “from 9%-11 %”.

[0054] For example, in some embodiments, a whole blood sample is diluted with an equal volume of water and is mixed by pipette. Dilution is necessary as we have observed poor amplification (verified with CRISPR) when using 5 uL undiluted blood in 20 uL of master mix (25 uL reaction). Five microliters of the diluted blood is added directly to the 20 uL of master mix (Table 11 ).

[0055] In other embodiments, the finger or heel poke blood may be spotted on a paper card, such as, for example but by no means limited to Whatman 903 or Flinders Technology Associates (FTA) specialized paper-based collection cards. This has several benefits: less painful, faster and easier to collect blood than venipuncture; self-collection is an option; ambient temperature shipment; envelope shipment; non- infectious shipment; the dried blood spot (DBS) contains viral and host total nucleic acids and proteins for molecular and serological testing.

[0056] As will be appreciated by those of skill in the art, DBS cards are useful in remote locations, for example, where sample collection is available but diagnostic testing is unavailable. In that case, the DBS cards can be more easily handled and shipped to another nearby or far away location where diagnostic testing is available. For example, a 3mm punch-out disc (or even larger) of a DBS on a Whatman 903 card or FTA classic card, or similar cards, is compatible with our extraction-free HIV-1 RT-LAMP and HCV RT-LAMP workflow with lateral flow dipstick readout.

[0057] For example, a 3mm punch-out disc (or even larger) placed inside a 2 mL tube can be subjected to a lysis solution and washed with one or more solutions. After washing, the 3mm punch is transferred to another tube containing 25 uL (or more volume) HIV-1 RT-LAMP or HCV RT-LAMP master mix (pathogenic specific primer set can label target amplicons with FAM and biotin), and incubated according to an optimized temperature and duration. Post-RT-LAMP, nuclease-free water is added to the tube, a lateral flow dipstick is submerged, and the results are read.

[0058] For example, a 3mm punch-out disc (or even larger) placed directly into a 25 uL (or more volume) HIV-1 RT-LAMP or HCV RT-LAMP master mix (pathogenic specific primer set can label target amplicons with FAM and biotin), and incubated according to an optimized temperature and duration. Post-RT-LAMP, nuclease-free water is added to the tube, a lateral flow dipstick is submerged, and the results are read.

[0059] In some embodiments, the liquid patient blood sample may need pretreatment before spotting onto a DBS card. For example, blood is collected into a vial via heel prick or finger prick or venipuncture, then some volume of collected blood is pipetted into another vial containing some volume of nuclease-free water, or chemical solution. By doing so, blood components inhibiting RT-LAMP may be diluted or lysed, and viruses may be lysed before spotting on a DBS card, thereby increasing the sensitivity and reproducibility of an RT-LAMP assay.

[0060] As will be apparent to those of skill in the art, extraction-free HIV-RT-LAMP can detect both proviral DNA and HIV viral RNA from a 3mm punch-out disc (or even larger) and liquid form of blood that is not pretreated or pretreated with nuclease-free water or a chemical solution.

[0061] In some embodiments, the samples are heated to a suitable temperature of about 62°C to about 63°C; however, in some embodiments of the invention, the “suitable temperature” is determined as shown in for example Tables 6 and 7 which show how the temperature with the best detection sensitivity is determined.

[0062] RT-LAMP: the final 25 uL RT-LAMP reactions are heated at 62°C for 30 minutes. The heat during isothermal amplification is lysing the HIV-1 and HCV virions, thereby releasing the viral RNA. The reverse transcriptase present within the master mix converts the RNA to complementary DNA (cDNA). The Bst DNA polymerase present within the master mix displaces the strands in the cDNA, allowing the LAMP primers to bind to and exponentially amplify the template. The fluorescent dye present within the master mix non-specifically binds to the generated amplicons, allowing for real-time fluorescence detection.

[0063] In some embodiments, for simple visual detection, amplification was coupled with a lateral flow-based dipstick test. Following amplification, 30 uL of water is added to the post RT-LAMP reaction to allow enough sample to travel up the dipstick. The dipstick is directly inserted into the well / tube containing the diluted amplicons. The sample travels up the dipstick and results are observed within three minutes. As labelled amplicons travel up the dipstick, gold-particles attached to anti-FAM antibodies present on the surface of the dipstick will bind to the FAM label on the amplicon. The gold-particle attached to the amplicon will continue flowing up the dipstick until it reaches a line of biotin ligands. The presence of gold-particles at this test line can be observed by eye. Any gold-particles that do not bind to FAM-labelled amplicons will continue flowing up the dipstick and accumulate at an upper control line. The presence of both the test line and control line indicates that the sample is positive for the particular pathogen. The presence of a single control line indicates that the reaction is negative.

[0064] Alternatively, a CRISPR master mix is prepared by adding the pathogenspecific guide RNA (gRNA) and the Cas12a enzyme to a buffer. The mix is incubated at 37°C for 30 minutes. During this incubation, the gRNA will form a ribonucleocomplex with the Cas12a enzyme. A fluorescent reporter (single-stranded DNA with a quencher on one end and FAM on the other end) and additional buffer are added to the ribonucleoprotein complex. 98 uL of this final mix is used per reaction. Two microlitres of the post-RT-LAMP material are added to the 98 uL CRISPR mix, and the reactions are incubated at 37°C for 15 minutes in a real-time fluorescence reader. During this incubation, the gRNAs of the complex will specifically bind to the target amplicons and the Cas12a enzymes will cleave the target amplicon. Once the target is cleaved, Cas12a is activated and non-specifically cleaves surrounding singlestranded DNA. Therefore, once the HIV-1 or HCV-specific amplicons are cleaved, the Cas12a enzyme cleaves the single-stranded DNA reporter, releasing the fluorophore. The increase in fluorescence over time is measured and indicates that the target amplicon was present within the reaction. In the absence of the target amplicon, Cas12a will not be activated, and the reporter will not be cleaved.

[0065] The analytical sensitivity of each detection test was evaluated using contrived whole blood samples ranging in HIV-1 and HCV 1 a viral loads. Additionally, HCV detection was evaluated on genotypes 1 b, 2b, and 3a. For result confirmation, a custom CRISPR-Cas12a-based assay was used to verify the presence or absence of pathogen-specific amplicons following amplification.

[0066] Pauly et al., 2023 stated their lower limit of detection (LLOD) to be 4.7 logw ILI / mL (genotype 1 b). In contrast, our LLOD is 3.77 logio lU / mL (genotype 1 a) and 4.16 log lU / mL (genotype 1 b).

[0067] Our LLOD of 3.77 log lU / mL (genotype 1 a) was impressive for two reasons. First, it shows that with no cold chain storage, no plug-in power, no extraction, and 32 minutes of run-time, that level of sensitivity is achievable. Secondly, because HCV 1a is the most prevalent genotype in North America, we set a new benchmark for 1 a detection sensitivity.

[0068] Detection sensitivity described in Curtis et al., 2009 is slightly better than ours, but frozen and thawed HIV-1 positive blood was used.

[0069] While not wishing to be bound to a particular theory or hypothesis, the inventors believe that using frozen and thawed blood improves detection. For example, it is believed that red blood cells and / or RT-LAMP-inhibiting proteins present in the blood are structurally affected by freeze-thaw, reducing their inhibitory effect. We conducted an experiment to show that extraction-free HCV RT-LAMP shows higher detection sensitivity when input material is frozen and thawed blood spiked with HCV 1a compared to room-temperature blood (collected a few hours prior) spiked with HCV 1a. Notably, the real world usage of our assay for molecular detection of HCV / HIV would not include freeze / thaw cycles meaning our experiments are closer to real-world conditions compared to Curtis et al., 2009.

[0070] For use, the method requires for example a heating block that can hold temperature up to 63°C for 30 minutes for isothermal amplification. After that, the detection of amplicons can be done by lateral flow-based dipstick test, which does not require a device. If detection is done by CRISPR fluorescence assay, the method requires a machine capable of holding temperature 37°C and the same machine or a separate machine capable of detecting fluorescence.

[0071] As will be appreciated by those of skill in the art, verification using the CRISPR assay is important because false positive amplicons can occur with RT-LAMP because of the nature of a primer set and its behaviour within a master mix composition. RT-LAMP utilizes six primers (not two like PCR), of which two are long (>40 nucleotides), so there is a higher probability of primer dimerization occurring (i.e. primers binding to each other rather than the desired viral target).

[0072] For example, primer dimers can become an amplifiable template and lead to a false positive signal (Kim et al., 2023). Specifically, some primer sets are inherently more likely to produce primer dimers than others due to their nucleotide makeup.

[0073] In addition, a primer set's behaviour can be greatly affected by a master mix composition. For example, a higher magnesium concentration generally increases detection speed; however, a higher magnesium concentration can also increase the frequency and start time of non-specific amplification as shown in Table 1 .

[0074] Complicating the matter is that some primer sets are more prone to the effects of magnesium than others.

[0075] As a result, during RT-LAMP assay development and optimization, it is critical to test all reactions with a custom CRISPR fluorescence detection test to determine the time window and frequency of target and non-specific amplicons. That method is faster and / or cheaper than confirmation by sequencing, agarose gel electrophoresis or lateral-flow based dipstick.

[0076] As will be appreciated by those of skill in the art, the frequency of non-specific amplification was a significant metric to assess when we were developing HIV-1 and HCV singleplex RT-LAMP using cold-stored reagents.

[0077] When using LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401 S), an all-in-one lyophilized master mix, the requirement of optimizing the concentration of magnesium sulphate to delay the frequency and start time of nonspecific amplicons was no longer required. When we evaluated various published primer sets in L4401 S, we noticed that target amplicons occurred within 30 minutes while non-specific amplicons rarely occurred. If they did, the occurrence was 59 minutes and after as shown in Tables 4 and 5.

[0078] As will be apparent to those of skill in the art, a suboptimal RT-LAMP assay may have a higher frequency of false positives. In addition, during assay optimization for input material that was blood with virions, fluorescence signal of target amplicons was very often not detectable using benchtop real-time PCR machines and always not detectable on a handheld two-colour fluorescence detection system. Such handheld devices are commercially available, one example of which is the Optigene Genie II™. We speculate that the turbidity of the reaction mixture (due to red blood cells) interfered with fluorescence excitation, emission or machine’s optical detection. To resolve this detection issue, we subjected two microliters of post-RT-LAMP material from each reaction to our 98 uL custom CRISPR test (total 100 uL). We speculate the red blood cells become diluted within the CRISPR detection reaction and do not interfere with fluorescence detection. By doing so, we were able to determine if amplification occurred, and if so, whether amplicons were specific or nonspecific as shown in Tables 6 and 7.

[0079] We used a web tool called CHOPCHOP (Labun et al., 2019), to design the CRISPR RNA (crRNA) sequence, which is the segment of the guide RNA that binds to the target DNA. CHOPCHOP was created for crRNA design for genome editing (knock-in or knockout) with CRISPR-Cas9, 12 or 13. However, we figured out how to use the program to satisfy our design goals for CRISPR viral diagnostics.

[0080] As discussed herein, an RT-LAMP primer set can be designed to target a conserved region of the pathogen of interest provided that there are sufficient nucleotides between F1c and B1c because a crRNA must be 20 nucleotides long and the nucleotides between F1c and B1c must satisfy design requirements of LbaCas12a and CHOPCHOP. As discussed herein, the guide RNA does not bind to non-specific amplicons (generated from primer dimer templates) and activate LbaCas12a but the guide RNA binds to target amplicons and activates LbaCas12a.

[0081] We reverse designed the guide RNAs from Broughton et al., 2020. We noticed a linear region within RT-LAMP amplicons (between F1c and B1c) was a target site for their SARS-CoV-2 guide RNA. guideRNA sequences for CRISPR-Cas12a detection of HIV-1 and HCV RT- LAMP amplicons

[0082] HCV 1a

[0083] UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (HCV guide RNA 1 , SEQ ID No: 1 )

[0084] HCV 1a

[0085] UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (HCV guide RNA 2, SEQ ID No: 2)

[0086] HIV-1 subtype B

[0087] UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (HIV-1 guide RNA 1 , SEQ ID No: 3)

[0088] HIV-1 subtype B

[0089] UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (HIV-1 guide RNA 2, SEQ ID No:4)

[0090] HIV-1 subtype B

[0091] UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (HIV-1 guide RNA 3, SEQ ID No:5) We speculated that the linear region is advantageous for two reasons. First, there is a less steric hindrance interfering with the binding of guide RNA and LbaCas12a complex. RT-LAMP amplicons contain loops and branches, unlike PCR. Second, by designing a guide RNA that targets the area between F1 c and B1 c, the guide RNA has been shown experimentally to have limited sequences that bind to either of the two longest RT-LAMP primers (FIP, which contain sequences of F1 c and F2 and BIP, which contain sequences of B2 and B1c) or non-specific amplicons that originated from FIP and BIP primer dimer templates. If the guide RNA and LbaCas12a complex binds to a non-specific amplicon (originated from primer dimer template) or a primer, depending on the total number of base pairing, the complex can be activated and chew up the reporter molecule in the CRISPR detection reaction, thereby resulting in a false positive signal. We speculate dimers are most likely from FIP and BIP because those primers are the longest (~49 nucleotides) out of the six primers. We provided data that showed as few as 17 base pairs between the guide RNA and a primer, triggered activation of the ribonucleocomplex with the Cas12a enzyme (table 9).

[0092] Specifically, we figured out the parameters to set in CHOPCHOP to design a crRNA that: 1 ) binds to the F1 c and B1 c area within RT-LAMP amplicons that contain viral target sequences and 2) is compatible with LbaCas12 (a Cas12 variant within the CRISPR-Cas12 system) in our CRISPR fluorescence detection protocol (modified from Broughton et al., 2020). The parameters we stated in our protocol can be varied.

[0093] Some parameters, if not set correctly, would design a crRNA that would not be compatible with LbaCas12a. Therefore, in the presence of target-specific amplicons, the guide RNA and LbaCas12a complex may not bind to the target sequence and activate the endonuclease function of LbaCas12a. If LbaCas12a is not activated, the reporter (DNA sequence with 5’ end FAM fluorophore and 3’ end quencher) will not be cleaved. The harm is false negative CRISPR detection results.

[0094] Some guide RNAs activated LbaCas12a in the absence of target RT-LAMP amplicons. Thus, CRISPR-Cas12 detection is an alternative to Sanger sequencing to verify whether RT-LAMP amplicons are target or non-specific. Compared to Sanger sequencing, CRISPR-Cas12 detection requires less hands-on time, waiting time and money. Those benefits are compounded when developing and optimizing an RT- LAMP diagnostic assay using input material that is purified RNA or pathogenic blood.

[0095] As will be appreciated by those of skill in the art, blood is a complex substance including nucleic acids, proteins, and chemical compounds that may interfere with the master mix of components and excipients (which replace water and protect enzymes) within L4401 S. Some publications have shown blood with virions can be used as input material for master mixes that were assembled from cold stored reagents (5 unique tubes, not all-in-on mix), but it has not been used as input material for L4401S, which is more complicated to manufacture and contains proprietary excipients. We found that an RT-LAMP reaction containing L4401 S can tolerate up to about 10% v / v blood (Table 11 ).

[0096] Furthermore, CRISPR-Cas12 detection can be used to detect specific amplicons even in assays that contain non-specific amplification, thereby expanding feasible master mix options and conditions, reducing the need for optimization of conditions. For example, as shown in Table 1 , before incorporating the custom CRISPR detection assay post-RT-LAMP, the HCV RT-LAMP master mix condition with 6mM magnesium sulphate was not usable because the time window of detectable amplicons in the no template control (NTC) reactions and viral input test reactions overlapped entirely. Within the NTC reactions, the earliest time to positivity (TTP) was 8 minutes, which meant anything detected later in test reactions with viral RNA may have been false positives. However, by incorporating the custom CRISPR detection assay post-RT-LAMP, specific and non-specific amplicons were deciphered, rendering the master mix condition with 6mM magnesium sulphate usable. That condition is useful because it yielded the fastest average TTP compared to other conditions as shown in Table 1. Blood containing both HCV and HIV-1 virions can be simultaneously lysed and amplified by singleplex HIV-1 and HCV RT-LAMP reactions using the same temperature (62°C) and same duration (30 minutes) (Figure 2).

[0097] Specifically, in the embodiment shown in Figure 2, contrived blood samples were no virions / basematrix negative diluent; HCV 1 a (5.01 Iog10 ILI / mL); both HCV 1 a (4.96 Iog10 ILI / mL) and HIV-1 subtype B together (5.63 Iog10 copies / mL); HIV-1 subtype B (5.24 Iog10 copies / mL). To obtain the viral load of each contrived blood sample, an aliquot was tested on the Cepheid GeneXpert machine using the cartridges Xpert HCV VL Fingerstick and Xpert HIV-1 Qual. Each contrived blood sample was diluted twofold with nuclease-free (NF) water before using 5 pL as input material HCV RT-LAMP and HIV-1 RT-LAMP. The strip tube was incubated at 62°C for 30 minutes on the Genie III. Post-RT-LAMP, two readout methods were used. For the first readout method, 2 pL from each reaction was used for HCV CRISPR-Cas12 detection (with HCV guide RNA 1 ) and 2 pL was used for HIV-1 CRISPR-Cas12 (with HIV-1 guide RNA 1 ) detection to confirm the presence of target amplicons. Reactions were incubated at 37°C for 10 minutes and fluorescence was monitored. For the second readout method, 30 pL of NF water was added to each post-RT-LAMP reaction before submerging a lateral flow dipstick. After two minutes, the lateral flow dipstick was imaged.

[0098] No publications have shown RT-LAMP diagnostics on a dual-infected blood sample. No publications have run two singleplex HCV and HIV RT-LAMP reactions within the same temperature and same duration on one test run, on one heat block. Curtis et al., 2009 used 60°C for 60 minutes for HIV-RT-LAMP. Pauly et al., 2023 used 55°C for 10 minutes then 65°C for 40 minutes (not isothermal) for HCV-RT- LAMP.

[0099] For HCV diagnostics, we have shown that three published primer sets target a similar region within the 5’-UTR. We then designed two guide RNAs targeting that region we showed that the HCV guide RNA 1 detected target amplicons generated by different primer sets (Witkowska McConnell et al., 2021 and Nyan and Swinson et al., 2016) in addition to Kargar et al., 2012. Similarly, the HCV guide RNA 2 and HIV-1 guide RNA 3 detected target amplicons generated by another primer set. This is significant because it proves that each of the guide RNAs we designed (HCV guide RNA 1 and 2 and HIV-1 guide RNA 1 , 2 and 3) will detect target amplicons generated by one or more future RT-LAMP primer sets. We also showed that our custom guide RNAs are pathogen-specific; for example, HCV guide RNAs do not react to target amplicons generated by three published HIV-1 primer sets and vice versa.

[0100] For example, the lyophilized master mix may comprise our HIV-1 or HCV primer set, so that, for example, amplicons can be detected by a lateral-flow dipstick. The lyophilized master mix may comprise a guide RNA and CRISPR-Cas12 complex too, to increase speed, sensitivity and specificity.

[0101] Some master mix conditions give high detection speed and sensitivity but poor specificity. By including a custom guide RNA, Cas12a, and a reporter molecule into the RT-LAMP master mix, CRISPR detection can simultaneously occur during amplification, thereby improving specificity.

[0102] The diagnostic workflow can be completed within 40 minutes, including less than 10 minutes of hands-on time. At optimal conditions, the HIV-1 and HCV RT- LAMP singleplex tests had lower limits of detections of 4.89 logio copies / mL (subtype B) and 3.77 logw lU / mL (HCV 1 a), respectively. Evaluation of the published literature showed that these viral loads are within the ranges observed during acute HIV-1 and HCV infection (McKellar et al., 2023; Robb et al., 2016; Mohamed et al., 2020). HCV detection was also observed for genotypes 1 b and 3a, albeit at a lower sensitivity than genotype 1a. No detection was observed for genotype 2b, presumably due to the lower viral loads of the samples. No cross-reactivity between HIV-1 RT-LAMP and HCV 1 a RNA and HCV RT-LAMP and HIV-1 subtype B RNA was observed.

[0103] The HIV-1 and HCV CRISPR-Cas12a detection workflow can be used as a cheap and high-throughput method to verify target-specific amplicons during RT- LAMP assay development.

[0104] The invention will now be further explained and / or elucidated by way of examples; however, the invention is not necessarily limited to or by the examples. EXAMPLE 1 - Utility of a custom HCV CRISPR-Cas12a fluorescence assay to understand the effect of magnesium sulfate and betaine concentration on RT-LAMP specificity.

[0105] The results of this experiment are shown in Table 1 . Specifically, each rectangle box represents a technical replicate from an RT-LAMP condition and input amount. The digits within each rectangle box are the time to positive, which indicates the time when the yield of fluorescently stained amplicons (specific and or nonspecific) surpassed a set threshold level. Post RT-LAMP, 2 uL of amplicons were inputted into a CRISPR-Cas12a assay that utilized a custom-designed guide RNA to confirm the presence of target-specific amplicons. A bolded value within a rectangle box indicates a negative HCV CRISPR-Cas12 assay result indicating the positive result observed by fluorescence detection was a false positive. Meanwhile, an italicized value within a rectangle box indicates a positive HCV CRISPR-Cas12 assay result indicating a true positive result.

[0106] As can be seen, higher inputs are required to produce positive results at lower magnesium concentrations. Increasing magnesium from 4.5 mM to 6 mM overcomes this somewhat, as does the addition of 0.5 M betaine.

[0107] EXAMPLE 2 - Utility of a custom HCV CRISPR-Cas12a fluorescence assay to confirm target amplicons generated by HCV RT-LAMP.

[0108] Results of this experiment are shown in Table 2. As shown therein, individual RT-LAMP master mix components were assembled to customize the concentration of magnesium sulfate and betaine. A higher final concentration (6mM) of magnesium sulfate was used to increase the frequency of non-specific amplicons to evaluate the specificity of the custom HCV guide RNA, as shown in bold and underline. Betaine at a final concentration of 0.5M had two benefits. First, specificity increased, and the time when non-specific amplicons began to occur was delayed. Secondly, the lower limit of detection improved. Bolded in italics is the lower limit of detection (LLOD) of HCV RT-LAMP when the master mix contains betaine at a final concentration of 0.5M. Bolded is the LLOD of HCV RT-LAMP when the master mix contains no betaine. An input amount of an RT-LAMP condition was designated as the LLOD based on two criteria. First, the LLOD is the lowest input amount, where all replicates have a time- to-positive (TTP) and a positive CRISPR detection. Second, all replicates of input amounts above the LLOD must also have a TTP and a positive CRISPR detection. The second criterion does not apply if the LLOD is the highest input amount within the input series.

[0109] EXAMPLE 3 - Utility of a custom HIV-1 CRISPR-Cas12a fluorescence assay to confirm target amplicons generated by HIV-1 RT-LAMP.

[0110] The results of this experiment are shown in Table 3. As shown therein, individual RT-LAMP master mix components were assembled to customize the concentration of magnesium sulfate and betaine. An increased final concentration of magnesium sulfate increased the frequency of non-specific amplicons, which was used to evaluate the specificity of the custom HIV-1 guide RNA, as shown in bolded italics.

[0111] Bolded is the lower limit of detection (LLOD) of each HIV-1 RT-LAMP condition. An input amount of an RT-LAMP condition was designated as the LLOD based on two criteria. First, the LLOD is the lowest input amount, where all replicates have a time-to-positive (TTP) and a positive CRISPR detection. Second, all replicates of input amounts above the LLOD must also have a TTP and a positive CRISPR detection. The second criterion does not apply if the LLOD is the highest input amount within the input series.

[0112] EXAMPLE 4 - Determination of the lower limit of detection of HCV 1a RNA for each RT-LAMP condition.

[0113] The results of this experiment are shown in Table 4. Therein, the bold values are the lower limit of detection (LLOD) of each RT-LAMP condition. An input amount of an RT-LAMP condition was designated as the LLOD based on two criteria. First, the LLOD is the lowest input amount, where all replicates have a time-to-positive (TTP) and a positive CRISPR detection. Second, all replicates of input amounts above the LLOD must also have a TTP and a positive CRISPR detection. The second criterion does not apply if the LLOD is the highest input amount within the input series.

[0114] EXAMPLE 5 - Determination of the lower limit of detection of HIV-1 subtype B RNA for each RT-LAMP condition.

[0115] The results of this experiment are shown in Table 5. Therein, bold and underlined values are the lower limit of detection (LLOD) of each RT-LAMP condition. An input amount of an RT-LAMP condition was designated as the LLOD based on two criteria. First, the LLOD is the lowest input amount, where all replicates have a time- to-positive (TTP) and a positive CRISPR detection. Second, all replicates of input amounts above the LLOD must also have a TTP and a positive CRISPR detection.

[0116] EXAMPLE 6

[0117] Blood (red blood cells, buffy coat, no plasma) was frozen and thawed. An aliquot was used, mixed with equal volume of plasma containing HCV 1a virions (SeraCare), to form contrived blood.

[0118] 5 ul of contrived HCV 1a blood was pipetted onto a 3 mm punched out disc (from an FTA classic card) that resided in a 2 mL tube. The disc with contrived blood was incubated at ambient temperature for 20 minutes. Washing solution was added into the tube with the disc, inverted several times, then removed with a pipette. The washing step was repeated four more times.

[0119] The disc was transferred to a tube that contained HCV RT-LAMP (containing L4401S, 0.5M betaine, and modified Kargar et al., 2012 primer set that labels target amplicons with FAM and biotin), and incubated at 62°C for 60 minutes.

[0120] After RT-LAMP, 5 uL of post-RT-LAMP reaction material was added as input material into CRISPR detection with HCV guide RNA 1 to confirm the presence of target amplicons.

[0121] After aliquoting 5 uL out a reaction post-RT-LAMP, 80 uL of nuclease-free water was added to the reaction tube, then a lateral flow dipstick was submerged into the reaction tube. Following 2 minutes allowed for absorption, the results were then read.

[0122] LLOD was 5.20 logw ILI / mL from a 3mm punched-out disc containing 5 uL of contrived HCV 1a blood.

[0123] We extracted genomic DNA from 8E5 cells (widely used cell clone, derived from T-lymphoblastoid cell line and modified to contain one integrated copy of HIV-1 proviral DNA per cell), quantified the genomic DNA using the Qubit 1x dsDNA high sensitivity kit, , serially diluted the DNA, then loaded 5 uL into our extraction-free HIV- 1 RT-LAMP recipe (L4401 S, 0.5M betaine, modified Zeng et al., 2014 to contain biotin and FAM). By doing so, we found 0.08 ng of 8E5 genomic DNA, which is approximately 12 copies of HIV-1 proviral DNA, as the lower limit of detection (Table 12)This indicates that depending on the amount of proviral DNA from white blood cells in liquid blood, or in a DBS punched-out disc, our extraction-free HIV-1 RT-LAMP assay may be able to detect proviral DNA.

[0124] While not wishing to be bound to a particular theory or hypothesis, it is possible that red blood cells or other blood components that inhibit RT-LAMP are lysed or modified by freeze-thaw.

[0125] While the preferred embodiments of the invention have been described above, it will be recognized and understood that various modifications may be made therein, and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention.

[0126] Table 1 : Utility of a custom HCV CRISPR-Cas12a fluorescence assay to understand the effect of magnesium sulfate and betaine concentration on RT- LAMP specificity. Abbreviations: IU, international units; ND, no detectable time to positiveAReference sample was Amplichek I, level 3 (Bio-Rad Laboratories Inc.), a human plasma matrix that contains intact inactivated Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Human Immunodeficiency Virus Type 1 (HIV-1 ). The estimated input international units was based on the sample’s HCV viral load (provided by vendor), the sample volume used for nucleic extraction and the assumption that viral RNA was not lost during extraction and elution.

[0127] BIndividual RT-LAMP master mix components were assembled to form a master mix (i.e. a ready mix was not used.). The primer set was from Kargar et al., 2012. Reactions were incubated at 62°C for 60 minutes. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.

[0128] Table 2: Utility of a custom HCV CRISPR-Cas12a fluorescence assay to confirm target amplicons generated by HCV RT-LAMP.

[0129] Abbreviations: IU, international units; temp., temperature; avg., average; TTP, time-to-positive; mins., minutes

[0130] AIndividual RT-LAMP master mix components were assembled to form a master mix (i.e. a ready mix was notsed ) The primer set was from Kargar et al., 2012. Reactions were incubated at 62°C for 60 minutes. The master ix

[0131] contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.

[0132] BReference sample was Amplichek I, level 3 (Bio-Rad Laboratories Inc.), a human plasma matrix that contains intact inactivated Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Human Immunodeficiency Virus Type 1 (HIV-1 ). The estimated input international units was based on the sample’s HCV viral load (provided by vendor), the sample volume used for nucleic extraction and the assumption that viral RNA was not lost during extraction and elution.cFor each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized HCV guide RNA 1

[0133] Table 3: Utility of a custom HIV-1 CRISPR-Cas12a fluorescence assay to confirm target amplicons generated by HIV-1 RT-LAMP.

[0134] Abbreviations: temp., temperature; cone., concentration; avg., average; TTP, time-to-positive; NA, not applicable; mins., minutes;

[0135] AIndividual RT-LAMP master mix components were assembled to form a master mix (i.e. a ready mix was not used.).

[0136] The primer set was from Zeng et al., 2014. Reactions were incubated at 62°C for 60 minutes. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.

[0137] BReference sample was cultured HIV-1 subtype B virions diluted in defibrinated human plasma (The Duke Human Vaccine Institute). The estimated input copies were based on the sample’s viral load (provided by the vendor), the

[0138] sample volume used for nucleic extraction, the elution volume and the assumption that viral RNA was not lost during the extraction and elution. c For each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12aorescence reaction that utilized HIV-1 guide RNA 1.

[0139] Table 4. Determination of the lower limit of detection of HCV 1a RNA for each RT-LAMP condition.

[0140]

[0141] Abbreviations: temp., temperature; cone., concentration; avg., average; TTP, time-to-positive; NA, not applicable; mins., minutes;

[0142] AReference sample was HCV 1a positive plasma, with known viral load (SeraCare). The estimated input international units was based on the sample’s viral load, the sample volume used for nucleic extraction and the assumption that viral RNA was not lost during extraction and elution.

[0143] BRehydrated LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401S), with the primer set from Kargar et al. ,2012. Reactions were incubated at 62°C for 60 minutes. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.cFor each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized HCV guide RNA 1 .

[0144] Table 5. Determination of the lower limit of detection of HIV-1 subtype B RNA for each RT-LAMP condition.

[0145]

[0146] Abbreviations: temp., temperature; cone., concentration; avg., average; TTP, time-to-positive; NA, not applicable; mins., minutes;

[0147] AReference sample was cultured HIV-1 subtype B virions diluted in defibrinated human plasma (The Duke Human

[0148] Vaccine Institute). The estimated input copies were based on the sample’s viral load provided by the vendor, the sample volume used for nucleic extraction, the elution volume and the assumption that viral RNA was not lost during the extraction and elution.

[0149] BRehydrated LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401S), with the primer set from Zeng et al., 2014. Reactions were incubated at 62°C for 60 minutes. The master mix contained a double-stranded

[0150] DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold. c For each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized HIV-1 guide RNA 1.

[0151] Table 6. Determination of optimal reaction temperature and betaine concentration for extraction -free HCV RT- LAMP

[0152] Abbreviations: TTP, time to positive; LLOD, lower limit of detection

[0153] ALyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401 S) with the addition of the modified Kargar et al., 2012 primer set. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.

[0154] BPlasma in human donor EDTA blood was replaced with HCV 1a positive plasma (SeraCare). Blood samples of various viral loads were contrived and tested on two separate occasions. For each blood sample, two aliquots were made. A 100 uL aliquot was quantified on the Cepheid GeneXpert with the HCV VL Fingerstick assay (60-minute runtime). The second aliquot was diluted with equal parts of nuclease-free water, of which 5 uL were then inputted into an HCV RT-LAMP reaction done in triplicate. Based on the HCV VL Fingerstick assay quantification, the average viral load of each contrived blood sample was 5.41 , 3.92, 3.77, 3.35, 3.09 and 0 logiolU / mL.cFor each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized HCV guide RNA 1 .

[0155] Table 7. Determination of optimal reaction temperature and betaine concentration for extraction -free HIV-1 RT- LAMP

[0156] Abbreviations: TTP, time to positive; LLOD, lower limit of detection

[0157] ALyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401S) with the addition of the modified Zeng et al., 2014 primer set. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.

[0158] BPlasma in human donor EDTA blood was replaced with HIV-1 subtype B positive plasma (The Duke Human Vaccine Institute). Blood samples of various viral loads were contrived and tested on two separate occasions. For each blood sample, two aliquots were made. A 100 uL aliquot was quantified on the Cepheid GeneXpert with the Xpert HIV-1 Qual assay (93-minute runtime). The second aliquot was diluted with two parts nuclease-free water, of which 5 uL were then inputted into an HIV-1 RT-LAMP reaction done in triplicate. Each sample's viral load was extrapolated based on the cycle threshold value provided by the Xpert HIV-1 Qual assay. The average viral load of each contrived blood sample was 5.90, 5.30, 4.89, 4.65, 4.32 and 0 logwcopies / mL c For each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized HIV-1 guide RNA 1. CRISPR-Cas12 detection results for one of two experimental runs were not available due to a technical error

[0159]

[0160] AReference sequences were AF033819.3 (HIV-1 subtype B) and AF009606.1 (HCV 1a)

[0161] Table 9. Compatibility between custom-designed LbaCas12a guide RNAs and published RT-LAMP primer sets

[0162] A guide RNA was deemed compatible with a primer set when: 1 ) a positive CRISPR detection (bolded P) occurred with 2 uL of post-RT-LAMP material that contained amplicons and 2) a negative CRISPR detection (bolded N) occurred with 2 uL of post-RT-LAMP material that did not contain amplicons. A guide RNA was deemed incompatible with a primer set when a positive CRISPR detection (bold italicized P) occurred with 2 uL of post-RT-LAMP material that did not contain amplicons. To deduce whether a primer (carried over from the 2 uL of post-RT-LAMP material) bound with the guide RNA and Lba Cas12a complex and falsely activated that complex, sequence alignment was done. The RNA spacer sequence (20 nucleotides) of the HIV-1 guide RNA 1 had 17 basepairs with the DN2-FIP primer (46 nucleotides) from Nyan and Swinson., 2016. Meanwhile the RNA spacer sequence (20 nucleotides) of the HCV guide RNA 3 had 19 basepairs with the loop B primer (22 nucleotides) from Rudolph et al., 2015. Overall, the custom-designed guide RNAs are compatible with one or more published primer sets. It is likely that the custom-designed RNAs will be compatible with future RT-LAMP primer sets.

[0163]

[0164] Abbreviations: TTP, time to positive; mins., minutes; NF water, nuclease-free water; ND, no time to positive detected; P, positive CRISPR fluorescence detection; N, negative CRISPR fluorescence detection

[0165] ALyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401 S) with the addition of a primer set and betaine at a final concentration of 0.5M. Reactions were incubated at 62°C for 60 minutes. The master mix contained a doublestranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold. The primer set used from Ocwieja et al., 2015 was ACelN-F3_c, ACelN-B3a, ACelN-B3b, ACelN-FIPe, ACelN-FIPf, ACelN-BIP, ACelN-LF, ACelN-LB

[0166] BReference sequences were AF033819.3 (HIV-1 subtype B) and AF009606.1 (HCV 1a).cReference samples were HIV-1 subtype B positive plasma (The Duke Human Vaccine Institute) and HCV 1a positive plasma (SeraCare). The estimated input amounts were based on the sample’s viral load provided by the vendor, the sample volume used for nucleic extraction, the elution volume and the assumption that viral RNA was not lost during the extraction and elution.

[0167] DFor each RT-LAMP reaction, 2 uL of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized a custom-designed guide RNA. Reactions were incubated at 37°C for 10 minutes and fluorescence was monitored.

[0168] Table 10. RT-LAMP primer sequences

[0169]

[0170]

[0171] Table 11. The effects of blood diluents and dilution ratios on extraction-free HCV RT-LAMP

[0172] RBC, red blood cell; ACK, Ammonium-Chloride-Potassium; TTP, time-to-positive; min, minutes; SD, standard deviation

[0173] APlasma in human donor EDTA blood was replaced with HCV 1 a positive plasma with known viral load (SeraCare) B Parts of blood to parts of diluent

[0174] cLyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401 S) with the addition of betaine (0.5M final concentration in the RT-LAMP reaction) and modified primer set from Kargar et al., 2014. Reactions were incubated at 62°C for 60 minutes, and fluorescence was monitored. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold

[0175] DFor each RT-LAMP reaction, two microlitres of post-RT-LAMP material were inputted into a CRISPR-Cas12a fluorescence reaction that utilized HCV guide RNA 1

[0176] Table 12. Detection of Proviral HIV-1 DNA in 8E5 Cell Genomic DNA Using Extraction-Free RT-LAMP and Lateral Flow Dipstick Readout

[0177] Abbreviations: gDNA, genomic DNA; ng, nanogram; N / A, not applicable; TTP, time-to-positive; minutes, min; SD, standard deviation; NT, not tested by lateral flow dipstick

[0178] ARehydrated LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG (L4401 S), with the modified primer set from Zeng et al., 2014, which contains biotin and FAM). Reactions were incubated at 62°C for 60 minutes. The master mix contained a double-stranded DNA-binding fluorescence dye that allowed for real-time monitoring of amplification. The time to positive was when the amplification curve reached the fluorescence threshold.

[0179] BThe post-RT-LAMP reaction mixture was diluted with 30 pL of nuclease-free water before insertion of the Milenia HybriDetect Universal Lateral Flow dipstick (TwistDx, Cambridge, UK). Within two minutes, biotin and FAM labeled target amplicons were captured at the test line and visualized by a conjugated detection reagent embedded within the lateral flow dipstick. The control line captured excess detection reagent, confirming proper dipstick functionality.

[0180] REFERENCES

[0181] Broughton, J. P., Deng, X., Yu, G., Fasching, C. L., Servellita, V., Singh, J., Miao, X., Streithorst, J. A., Granados, A., Sotomayor-Gonzalez, A., Zorn, K., Gopez, A., Hsu, E., Gu, W., Miller, S., Pan, C. Y., Guevara, H., Wadford, D. A., Chen, J. S., & Chiu, C. Y. (2020). CRISPR-Cas12-based detection of SARS-CoV-2. Nature Biotechnology, 38(7), 870-874. https: / / doi.org / 10.1038 / s41587-020-0513-4

[0182] Curtis, K. A. (2009). Sequence-Specific Detection Method for Reverse Transcription, Loop-Mediated Isothermal Amplification of HIV-1. Antiviral Therapy, 55(November 2005), 52-55. https: / / doi.org / 10.1002 / jmv

[0183] Hosaka, N., Ndembi, N., Ishizaki, A., Kageyama, S., Numazaki, K., & Ichimura, H. (2009). Rapid detection of human immunodeficiency virus type 1 group M by a reverse transcription-loop-mediated isothermal amplification assay. Journal of Virological Methods, 157(2), 195-199. https: / / doi.Org / 10.1016 / j.jviromet.2009.01 .004

[0184] Kargar, M., Askari, A., Doosti, A., & Ghorbani-Dalini, S. (2012). Loop-mediated isothermal amplification assay for rapid detection of hepatitis c virus. Indian Journal of Virology, 23(1 ), 18-23. https: / / doi.org / 10.1007 / s13337-012-0067-2

[0185] Kim, S.-H., Lee, S.-Y., Kim, U., & Oh, S.-W. (2023). Diverse methods of reducing and confirming false-positive results of loop-mediated isothermal amplification assays: A review. Analytica Chimica Acta, 1280, 341693. https: / / doi.Org / 10.1016 / j.aca.2023.341693

[0186] Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., & Valen, E. (2019). CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research, 47( \I1 ), W171-W174. https: / / doi.Org / 10.1093 / nar / gkz365

[0187] Mckellar, M. S., Cope, A. B., Gay, C. L., McGee, K. S., Kuruc, J. D., Kerkau, M. G., Hurt, C. B., Fiscus, S. A., Ferrari, G., Margolis, D. M., Eron, J. J., & Hicks, C. B. (2013). Acute HIV-1 Infection in the southeastern United States: A cohort study. AIDS Research and Human Retroviruses, 29(1), 121-128. https: / / doi.org / 10.1089 / aid.2012.0064

[0188] Mohamed, Z., Mbwambo, J., Rwegasha, J., Mgina, N., Doulla, B., Mwakale, P., Tuaillon, E., Chevaliez, S., Shimakawa, Y., Taylor-Robinson, S. D., Thursz, M. R., Brown, A. S., & Lemoine, M. (2020). In-field evaluation of Xpert® HCV viral load Fingerstick assay in people who inject drugs in Tanzania. Liver International, 40(3), 514-521. https: / / doi.org / 10.1111 / liv.14315

[0189] Nyan, D. C., & Swinson, K. L. (2016). A method for rapid detection and genotype identification of hepatitis C virus 1 -6 by one-step reverse transcription loop- mediated isothermal amplification. International Journal of Infectious Diseases, 43, 30-36. https: / / doi.Org / 10.1016 / j.ijid.2015.12.002

[0190] Ocwieja, K. E., Sherrill-Mix, S., Liu, C., Song, J., Bau, H., & Bushman, F. D. (2015). A reverse transcription loop-mediated isothermal amplification assay optimized to detect multiple HIV subtypes. PLoS ONE, 10(2), 1-11. https: / / doi.Org / 10.1371 / journal, pone.0117852

[0191] Pauly, M. D., Weis-Torres, S., Hayden, T. M., Ganova-Raeva, L. M., & Kamili, S. (2023). Development of simple, rapid, and sensitive methods for detection of hepatitis C virus RNA from whole blood using reverse transcription loop-mediated isothermal amplification. Journal of Clinical Microbiology, 67(11). https: / / doi.Org / 10.1128 / jcm.00771 -23

[0192] Robb, M. L., Eller, L. A., Kibuuka, H., Rono, K., Maganga, L., Nitayaphan, S., Kroon, E., Sawe, F. K., Sinei, S., Sriplienchan, S., Jagodzinski, L. L., Malia, J., Manak, M., de Souza, M. S., Tovanabutra, S., Sanders-Buell, E., Rolland, M., Dorsey- Spitz, J., Eller, M. A., ... Michael, N. L. (2016). Prospective Study of Acute HIV-1 Infection in Adults in East Africa and Thailand. New England Journal of Medicine, 374(22), 2120-2130. https: / / doi.org / 10.1056 / nejmoa1508952

[0193] Rudolph, D. L., Sullivan, V., Owen, S. M., & Curtis, K. A. (2015). Detection of acute HIV-1 infection by RT-LAMP. PLoS ONE, 10(5), 1-13. https: / / d0i.0rg / l 0.1371 / journal, pone.0126609

[0194] Witkowska McConnell, W., Davis, C., Sabir, S. R., Garrett, A., Bradley-Stewart, A., Jajesniak, P., Reboud, J., Xu, G., Yang, Z., Gunson, R., Thomson, E. C., & Cooper, J. M. (2021 ). Paper microfluidic implementation of loop mediated isothermal amplification for early diagnosis of hepatitis C virus. Nature Communications, 12(1). https: / / doi . org / 10.1038 / s41467 -021-27076-z

[0195] Zeng, Y., Zhang, X., Nie, K., Ding, X., Ring, B. Z., Xu, L., Dai, L., Li, X., Ren, W., Shi, L., & Ma, X. (2014). Rapid quantitative detection of Human immunodeficiency virus type 1 by a reverse transcription-loop-mediated isothermal amplification assay. Gene, 541(2), 123-128. https: / / doi.Org / 10.1016 / j.gene.2014.03.015

Claims

CLAIMS1. One or more CRISPR guide RNAs selected from the group consisting of:UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 );UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2);UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3);UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5).

2. A method for detecting human immunodeficiency virus (HIV) and / or Hepatitis C virus (HCV) in a sample comprising: providing an RT-LAMP reaction mix comprising: a reverse transcriptase and a DNA polymerase; adding at least one RT-LAMP primer specific for amplification of a region of HIV genome conserved across HIV subtypes and / or at least one RT-LAMP primer specific for amplification of a region of HCV genome conserved across HCV subtypes; adding a sample suspected of comprising HIV virions and / or HCV virions to the RT-LAMP reaction mix; heating the RT-LAMP reaction mix to a suitable temperature for a suitable period of time for RT-LAMP reaction to occur; and detecting on target amplicons from the RT-LAMP reaction mix.

3. The method according to claim 2 wherein the on target amplicons are detected by adding CRISPR enzymes and CRISPR guide RNA to an aliquot of the RT-LAMP reaction mix, thereby forming a CRISPR mix.

4. The method according to claim 3 wherein the CRISPR enzymes are Cas12a enzymes.

5. The method according to claim 3 or 4 wherein the CRISPR guide RNA comprises one or more CRISPR guide RNAs selected from the group consisting of: UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 );UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2);UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3);UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5).

6. The method according to claim 2 wherein the RT-LAMP reaction is heated to the suitable temperature by a battery-powered heating device.

7. The method according to claim 6 wherein the battery-powered heating device is a hand-held, battery-powered heating device.

8. The method according to claim 2 wherein the suitable temperature is from about 62°C to about 63°C.

9. The method according to claim 2 wherein one or more of the RT- LAMP primers is labelled.

10. The method according to claim 3 wherein the CRISPR mix is incubated at about 37°C for about 15 to about 30 minutes.11 . The method according to claim 2 wherein the RT-LAMP reaction mix further comprises magnesium sulphate.

12. The method according to claim 11 wherein the magnesium sulphate comprises about 5 to about 7 mM magnesium sulphate.

13. The method according to claim 2 wherein the RT-LAMP reaction mix comprises about 0.5 mM betaine.

14. The method according to claim 2 wherein the RT-LAMP reaction mix is lyophilized.

15. The method according to claim 2 wherein the RT-LAMP reaction mix is LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG™.

16. The method according to claim 15 wherein the RT-LAMP reaction mix is LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG™ further comprising the at least one RT-LAMP primer specific for amplification of a region of HIV genome conserved across HIV subtypes and / or the at least one RT-LAMP primer specific for amplification of a region of HCV genome conserved across HCV subtypes.

17. The method according to claim 16 wherein the RT-LAMP reaction mix is LyoPrime Warmstart Fluorescent LAMP / RT-LAMP Mix with UDG™ further comprising CRISPR enzymes and one or more CRISPR guide RNAs selected from the group consisting of: UAAUUUCUACUAAGUGUAGAUUUGGAUCAACCCGCUCAAUG (SEQ ID No:1 );UAAUUUCUACUAAGUGUAGAUGGCGUGCCCCCGCGAGACUG (SEQ ID No:2); UAAUUUCUACUAAGUGUAGAUAAUCUUGUGGGGUGGCUCCU (SEQ ID No: 3); UAAUUUCUACUAAGUGUAGAUCCCUGCACUGUACCCCCCAA (SEQ ID No: 4); and UAAUUUCUACUAAGUGUAGAUCAUAAUCCCUAAUGAUCUUU (SEQ ID No:5).

18. The method according to claim 2 wherein the sample is a blood sample.

19. The method according to claim 18 wherein the blood sample is diluted prior to addition to the RT-LAMP reaction mix.

20. The method according to claim 19 wherein the blood is about 5% to about 10% of the RT-LAMP reaction mix.