Fatp2 in t cells as a target molecule for treatment of juvenile idiopathic arthritis in children

Abstract

The present invention relates to the role of the FATP2 protein (fatty acid transport protein 2) in T cells in the development of autoimmune diseases, in particular rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel disease, such as ulcerative colitis, and other autoimmune diseases involving T cells. The present invention relates in particular to methods for identifying compounds which bind to the FATP2 protein and to the use of FATP2 protein for screening and identifying FATP2-interacting and FATP2-inhibiting compounds. The present invention further relates to pharmaceutical compositions for use in the treatment of autoimmune diseases, in particular pharmaceutical compositions comprising active ingredients which bind to and / or inhibit the FATP2 protein.

Description

[0001] FATP2 in T cells as a target molecule for the treatment of juvenile idiopathic arthritis in children

[0002] Technical field of the invention

[0003] The present invention relates to the role of the FATP2 protein (Fatty Acid Transport Protein 2) in T cells in the development of autoimmune diseases, in particular rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases such as ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement. The present invention particularly relates to methods for identifying compounds that bind to the FATP2 protein and to the use of FATP2 protein for screening and identifying FATP2-interacting and FATP2-inhibiting compounds. The present invention further relates to pharmaceutical compositions for use in the treatment of autoimmune diseases, in particular pharmaceutical compositions comprising active ingredients that bind to and / or inhibit the FATP2 protein.

[0004] Background and state of the art

[0005] Autoimmune diseases affect approximately 5 to 8% of the worldwide population. They are associated with high morbidity and premature mortality; after cardiovascular and tumor diseases, they represent the third most common group of diseases. In autoimmune diseases, the immune system attacks healthy, endogenous tissue because it can no longer distinguish between "foreign" and "self." Systemic autoimmune diseases include rheumatic joint inflammation; they affect approximately 20,000 children in Germany as juvenile idiopathic arthritis (JIA), and approximately 1.5 million adults in Germany as rheumatoid arthritis. Both diseases are autoimmune diseases of unknown origin that cause intermittent chronic inflammation of the joints.In addition to the cells of the innate immune system such as neutrophils and monocytes, which trigger the inflammatory processes, cells of the adaptive immune system such as T cells also determine the chronic inflammatory reactions in the joints.

[0006] Despite increasing therapeutic options, autoimmune diseases remain incurable. The significant involvement of T cells has been demonstrated in a variety of autoimmune diseases, such as rheumatoid arthritis, juvenile idiopathic arthritis, ulcerative colitis, and multiple sclerosis. So-called "memory" T cells play a particularly important role. These are primarily found in tissues and are not always susceptible to immunosuppression.

[0007] Their inflammatory potential cannot be controlled by regulatory T cells (Treg cells) within inflamed joints. Almost all T cells within the joints of patients with juvenile idiopathic arthritis exhibit the phenotype of memory T cells.

[0008] The metabolism of T cells in patients with (childhood) rheumatism differs significantly from that of healthy individuals; a fundamental dysregulation of fatty acid metabolism is found in patients with childhood rheumatism, particularly in the inflamed joint. This primarily affects memory T cells, which account for up to 95% of the T cells in the inflamed joint.

[0009] The functions of memory T cells are determined by metabolic conditions, which can also be accompanied by a reprogramming of their functions (so-called "metabolic reprogramming"). For the necessary energy metabolism, T cells essentially use the three energy resources glucose, glutamine, and fatty acids. The transport proteins for neither glutamine nor fatty acids have yet been clearly identified and defined. The metabolic properties of memory T cells differ significantly from those of naive and effector T cells (Geltink et al. 2018). Resting naive T cells utilize oxidative metabolism to efficiently produce energy; they take up glucose at a very low rate to provide the energy necessary to maintain their operational metabolic functions.Naive T cells use pyruvate from glucose breakdown to generate ATP through oxidative phosphorylation or fatty acid oxidation. Activated T cells, on the other hand, must proliferate and therefore switch to an anabolic growth program to perform their effector functions. The predominant metabolic state of activated T cells (both CD4 and CD8 positive T cells) is aerobic glycolysis, characterized by the conversion of pyruvate from glucose breakdown to lactate, even though sufficient oxygen is available for complete glucose oxidation (Geltink et al. 2018). This process, known as the "Warburg effect" from previous studies in tumor biology, is a common feature of actively proliferating cells. After effector cells have fulfilled their functions, they either perish or transform into memory T cells.

[0010] Memory T cells constitute the immune system's "immunological memory" in that they respond to repeated encounters with the antigen with a stronger immune response ("secondary immune response"). The signal transduction and metabolic pathways that regulate the formation of memory T cells are therefore of great interest. Mitochondrial fatty acid oxidation is necessary for the development of CD8-positive memory T cells and is dependent on tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) (Pearce et al. 2009). Fatty acid oxidation generates acetyl-coenzyme A (CoA), which can be further metabolized in the citric acid cycle, as well as FADEL and NADH+H. +, which can be used directly to generate adenosine triphosphate (ATP) via the electron transport chain. Free fatty acids are energy-rich molecules, and fatty acid oxidation may represent a preferred energy source for memory T cells (“Tmem”), as they rely on metabolic pathways dependent on oxidative phosphorylation. Furthermore, a higher mitochondrial content confers a bioenergetic advantage to memory T cells by enhancing the rapid immune response in response to reinfection. In contrast to effector T cells, which rely primarily on glycolysis, CD8-positive memory T cells therefore possess a higher respiratory reserve capacity and rely predominantly on fatty acid oxidation.In tissue-resident CD8-positive memory T cells, genes encoding fatty acid-binding proteins (FABP4 and FABP5) are among the most highly upregulated genes, as is the gene encoding CD36, a so-called "lipid-scavenger cell-surface receptor" (Pan et al. 2017). Data on CD4-positive T cells regarding their fatty acid metabolism are still scarce. However, it has been shown that genetic deletion of ACC1, a rate-limiting enzyme of fatty acid biosynthesis, increases the generation of CD4-positive memory T cells, and that inhibition of ACC1 function increases the generation of memory T cells during parasite infection in mice (Endo et al. 2019).

[0011] Until now, nothing was known about the uptake mechanism of fatty acids in T cells and the identity of transport molecules for fatty acids in T cells. Therapeutic options for autoimmune diseases are currently limited, and a cure is not possible. In particular, no treatment option targeting the metabolism of immune cells is available.

[0012] Thus, one object underlying the present invention was to provide methods and means for identifying active substances, compounds and compositions, as well as their use in the treatment of autoimmune diseases.

[0013] This application discloses the identification of a novel molecular target for the treatment of autoimmune diseases. Within the scope of the present invention, fatty acid transport protein 2 (FATP2), encoded by the SLC27A2 gene, was identified as a fatty acid transporter in T cells, and it was demonstrated for the first time that its blockade influences the function of T cells with regard to their production of cytokines, the activation of their effector functions, and their proliferation.

[0014] Expression of fatty acid transport protein 2 (FATP2) has been demonstrated in the liver, small intestine, kidney, pancreas, and placenta (Falcon et al. 2010; Perez et al. 2020; Khan et al. 2020). The protein is encoded by solute carrier family 27 member 2 (SLC27A2')-G&n and has two main functions: the activation of long-chain fatty acids as a very long-chain acyl-coenzyme A (CoA) synthetase (ACSVL) and the transport of coenzyme A-activated long-chain fatty acids as a fatty acid transport protein (Falcon et al. 2010; Khan et al. 2020; Melton et al. 2013).

[0015] The transport molecule FATP2 was linked to the development of non-alcoholic fatty liver disease in mice by Falcon et al. (2010). Other studies suggest that the molecule may be partly responsible for the pathogenesis of diabetic kidney disease (Khan et al. 2020). Furthermore, it has been shown that upregulation of the expression of the SLC27A2 gene or the FATP2 protein in differentiated thyroid carcinomas can be associated with increased tumor cell proliferation and migration (Feng et al. 2021), and that the FATP2 protein in tumors may be involved in neutrophil reprogramming (Veglia et al. 2019).W02020 / 172510 (Wistar Institute) discloses methods for tumor therapy by inhibiting, blocking, or downregulating FATP2 in MDSCs (myeloid-derived suppressor cells), a heterogeneous population of immature and pathologically activated myeloid cells that accumulate in large numbers in tumor patients, suppress the activity and proliferation of T cells and natural killer (NK) cells, and promote tumor growth through this immunosuppressive effect.

[0016] The present application discloses the SLC27A2 gene or the FATP2 protein for the first time as a target molecule and thus a new therapeutic approach for the development of therapeutics for the treatment of patients with autoimmune diseases.

[0017] Summary of the invention

[0018] The inventors have surprisingly identified, for the first time, FATP2, a fatty acid transporter in T cells, particularly memory T cells, whose blockade significantly influences the functions of these T cells (proliferation, cytokine production). This fundamental step in understanding T cell function offers the first opportunity to specifically influence this T cell function and reprogram it by altering metabolism.

[0019] Until now, the receptor / transporter for T cells that uptake free fatty acids, which, along with glucose, are an essential energy source, especially in inflamed tissue, was unknown. The fatty acid transport protein identified as FATP2 is upregulated 10-fold in T cells in inflamed joints of patients, for example, with childhood rheumatism, compared to the blood of the same patients and healthy controls. Furthermore, it has been demonstrated that in memory T cells that are induced to proliferate, FATP2 expression is upregulated 30-fold, and at the same time, the cells' fatty acid uptake increases dramatically.

[0020] The present invention provides methods and means for identifying drugs, compounds and compositions for use in the treatment of autoimmune diseases, in particular for identifying highly effective drugs, compounds and compositions for use in the treatment of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement.

[0021] In view of the prior art, it was an object of the present invention to provide a method for inhibiting or reducing fatty acid uptake into a T cell, activation and / or proliferation of a T cell.

[0022] Another object of the present invention was to provide a method for identifying an active compound that binds to and / or inhibits the FATP2 protein or a fragment thereof.

[0023] It was a further object of the present invention to provide a method for using a nucleic acid encoding the FATP2 protein, or a fragment thereof, or the FATP2 protein itself, or a fragment thereof, for the identification of an active substance that binds to FATP2, or a fragment thereof.

[0024] It was a further object of the present invention to provide active ingredients for use in the treatment of an autoimmune disease, in particular for use in the treatment of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement, based on the findings described above. A further object of the present invention is to provide pharmaceutical compositions containing these agents and methods for preparing such pharmaceutical compositions based on the findings described above.

[0025] The described and other technical objects are achieved by the devices and methods according to the independent claims of the current invention. The dependent claims describe preferred embodiments. Value ranges limited by numerical values ​​are always intended to include said limit values.

[0026] The invention and general advantageous embodiments are explained in more detail below.

[0027] Description of the drawings

[0028] Figure 1 shows that T cells present in the synovial fluid of juvenile idiopathic arthritis (JIA) patients exhibit enhanced fatty acid uptake, which is associated with increased expression of FATP2 / SLC27A2. The fatty acid receptor FATP2 is primarily expressed in CD4+ memory cells.

[0029] Fig. 1A: Uptake of free fatty acids into CD4+ T cells from the blood or synovium of JIA patients. The measurement was performed after 15 minutes of incubation of the cells with Bodipye™FL C 12 (2 pM) and subsequent flow cytometric analysis. The mean fluorescence intensity (MFI) is shown minus the respective FMO control (AMFI). The data represent the mean expression in 4 patients ± standard error, **p < 0.01.

[0030] Fig. 1B: FATP2 protein expression in CD4+ T cells from peripheral blood (PB) or synovium (SF) of JIA patients (flow cytometric analysis). A representative image is shown. Fig. 1C: Expression of SLC27A2 RNA in synovium CD4+ T cells from JIA patients compared to blood from the same patients.

[0031] Fig. ID: Protein expression of FATP2 in CD4+ T cell subtypes (effector memory T cells (Tem), tissue-resident memory T cells (T m) and naive T cells (Tnaive)) from the blood or synovium of JIA patients (flow cytometric analysis). The mean fluorescence intensity (MFI) is shown minus the respective FMO control (AMFI). The data show the mean expression in 5 patients ± standard error, ***p < 0.001. ****p < 0.0001.

[0032] Fig. 1E: mRNA expression of FATP2 compared to other metabolic proteins in CD4+ memory T cells after 48 h and 72 h stimulation with anti-CD3 and anti-CD28 antibodies and in unstimulated CD4+ memory T cells. CD4+ memory T cells were isolated from the blood of healthy controls using magnetic cell separation. Data show the mean expression of four experiments with different donors ± standard error, **p < 0.01, ***p < 0.001.

[0033] Fig. 2 shows that the FATP2 inhibitor Lipofermata inhibits fatty acid uptake in CD4+ T cells and inhibits IFN-γ expression and proliferation without inducing apoptosis.

[0034] Fig. 2A: Uptake of free fatty acids into CD4+ T cells after addition of Lipofermata in increasing concentrations (0, 2, 5, 7.5, and 10 pM). For this purpose, the cells were stimulated with anti-CD3 and anti-CD28 antibodies for 48 hours. Measurements were taken after 15 minutes of incubation of the cells with Bodipye™ FL C12 (2 pM) and subsequent flow cytometric analysis. The mean fluorescence intensity (MFI) is shown minus the respective FMO control (AMFI). The data represent the mean expression measured in three experiments ± standard error.

[0035] Fig. 2B: Exemplary histogram of fatty acid uptake in CD4+ T cells without addition of Lipofermata (right) and after addition of Lipofermata (left).

[0036] Fig. 2C Percentage of IFN-γ positive CD4+ T cells after addition of Lipofermata in increasing concentrations (0, 2, 5, 7.5, and 10 pM). For this purpose, the cells were stimulated for 48 hours with anti-CD3 and anti-CD28 antibodies. IFN-γ positive cells were determined by flow cytometry after 5 hours of restimulation with PMA and lonomycin in the presence of GolgiPlug™. Data show mean expression measured in 5-6 experiments ± standard error, *p < 0.01.

[0037] Fig. 2D: Exemplary dot plot of IFN-γ expression without addition of lipofermata (left, control) and after addition of lipofermata (right).

[0038] Fig. 2E: Percentage of proliferated CD4+ T cells after addition of Lipofermata at increasing concentrations (0, 2, 5, 7.5, and 10 pM). Cells were stained with eFlour™ cell proliferation dye and stimulated with anti-CD3 and anti-CD28 antibodies for 48 hours. Proliferated cells were determined using flow cytometry. Data represent mean expression measured in 5 experiments ± standard error, *p < 0.01.

[0039] Fig. 2F: Exemplary dot plot of cell proliferation without addition of Lipofermata (left, control) and after addition of Lipofermata (right).

[0040] Fig. 2G: Exemplary dot plot of dead cells with Lipofermata treatment (right) and without (left, control). The cells were stimulated with anti-CD3 and anti-CD28 antibodies for 72 hours and stained with propidium iodide (PI) for flow cytometric live / dead discrimination.

[0041] Detailed description of the invention

[0042] Before the invention is described in detail, it is to be understood that this invention is not limited to specific components of the described devices or described steps of the methods, as these methods or devices may vary. It is also to be understood that the terminology employed herein is for the purpose of identifying particular embodiments described and is not intentionally limiting. It should be noted that throughout the description and the appended claims, the simple form such as "a" or "an" or "the" includes singular and / or plural items unless the context clearly dictates otherwise. Where a range of parameters is specified, the limiting numerical values ​​are to be considered as limits to the disclosed or claimed numerical range.

[0043] It should also be noted that the embodiments disclosed herein are not to be understood as individual embodiments that would not relate to one another. Features discussed in connection with one embodiment are also intended to be disclosed in connection with other embodiments shown herein. If in one case a certain feature is not disclosed with one embodiment but with another, the person skilled in the art will understand that this does not necessarily mean that this feature should not be disclosed with the other embodiment. The person skilled in the art will understand that it is in accordance with the principle of this application to also disclose the feature in question for the other embodiment, but that this has not been done for reasons of clarity and in order to keep the specification within a manageable scope.

[0044] Furthermore, the content of the prior art documents cited herein is incorporated by reference. This applies in particular to prior art documents that disclose standard or routine processes. In this case, the primary purpose of incorporation by reference is to enable sufficient disclosure and avoid tedious repetition.

[0045] According to a first aspect, the present invention relates to a method for inhibiting or reducing fatty acid uptake into a T cell, activation and / or proliferation of a T cell, wherein the method comprises at least one step selected from the group consisting of

[0046] (i) Inhibiting or reducing T cell SLC27A2 gene expression,

[0047] (ii) Inhibiting or reducing the activity of fatty acid transport protein-2 (FATP2), and / or

[0048] (iii) Promoting the degradation of FATP2 protein. As used herein, the term “T cells” refers to cells including T precursor cells, T lymphocytes, cytotoxic (possibly CD8-positive) T cells, (possibly CD4-positive) T “helper” cells (Th cells), Th1 cells, Th2 cells, Th3 cells, Th9 cells, Th17 cells, Th22 cells, Tfh cells, memory T cells, regulatory T cells (Treg), suppressor T cells (Tsup), “natural killer” T cells (NKT cells), naive T cells, activated T cells, mucosa-associated invariant T cells, alpha-beta T cells, gamma-delta T cells, thymocytes, double-positive (CD4 / CD8-positive) thymocytes, primary T cells, mature immunocompetent T cells, autoreactive T cells, peripheral T cells, synovial T cells, and T cell lines.

[0049] The said inhibition or reduction of 6ZC 742 gene expression may, for example, comprise a 6ZC 742 gene knock-down, a knock-out, a conditional gene knock-out, a gene modification or mutation in the sense of an insertion, deletion and / or substitution, a gene modification by means of a gene editing system, an RNA interference, siRNA and / or antisense RNA.

[0050] As used herein, the term "gene editing system" or "gene editing systems" refers to molecular biological techniques for the targeted modification of DNA, for example, at the SLC27A2 gene. Classic gene editing systems include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), the CRISPR / Cas method, the CRISPR / Cpfl system, and so-called meganucleases. In zinc finger nuclease, TALEN, and meganuclease, specific DNA recognition occurs through a specific protein fragment, whereas in CRISPR systems, it is mediated by a specific RNA (Zhu and Zhu, 2022).

[0051] Zinc finger nucleases (ZFNs) are artificially engineered restriction enzymes. They contain a zinc finger domain that binds to DNA and a nuclease domain that cleaves the DNA. The zinc finger domain can be engineered to recognize a specific DNA sequence.

[0052] TALENs are fusion proteins consisting of a Z4Z-£^ector DNA-binding domain and an endonuclease domain. The DNA-binding domain, introduced during protein design, enables sequence-specific binding, followed by a sequence-specific cleavage by the endonuclease. The CRISPR / Cas method (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated protein) is a molecular biological technique for the targeted cutting and modification of DNA. Genes can be inserted, removed, or switched off using the CRISPR / Cas system, as well as nucleotides within a gene can be altered. The DNA-cutting enzyme Q / .s binds to a specific RNA sequence. This RNA sequence is followed by another RNA sequence, which can bind to DNA with a complementary sequence via base pairing. The RNA serves as a bridge between Cas and the DNA to be cut.Through the complexation of Cas, the RNA, and the DNA, the DNA-cutting enzyme / s is brought into close proximity to the bound DNA, whereupon the enzyme cuts the (indirectly bound) DNA. If DNA is inserted into the cleavage site, another DNA fragment is added, each with overlapping sequences for one of the two ends of the cleavage site. The inserted DNA is joined to the ends of the cleavage site by the cell's own DNA repair mechanism (Nidhi et al. 2021).

[0053] These endonucleases are used to introduce targeted changes into the genome of individual cells or complex organisms. The enzymes cut double-stranded DNA at a predetermined target sequence, creating double-strand breaks. These double-strand breaks, in turn, activate DNA repair processes in the cell, such as non-homologous end-joining (NHEJ) or homologous repair, also known as homology-directed repair (HDR). While NHEJ specifically inactivates genes, HDR can be used to insert defined mutations or entire DNA segments into the genome. Genome editing can be used to specifically destroy a gene (gene knockout), to insert a gene at a specific location in the genome (gene knockin), or to introduce a point mutation into a gene.

[0054] So-called "base editing" is a new, precise method of genome editing that involves altering individual bases in the DNA sequence. This involves coupling a mutated form of Cas9 nuclease, which can no longer cleave DNA, with a deaminase in the form of a fusion protein. This fusion protein is capable of specifically recognizing a desired DNA sequence with an sgRNA ("single-guide" RNA) and altering a base by deamination. In the case of fusion with cytidine deaminase, the cytidine is converted to uracil, which is replaced by thymidine during DNA repair and replication. This mutates the CG base pair to TA. Alternatively, Cas9 can be coupled with an adenosine deaminase, converting the adenosine to inosine, which is replaced by guanosine after DNA repair and replication. In this case, the base pair AT is converted to GC (Zhu and Zhu, 2022).

[0055] RNA interference (RNAi, RNA silencing) is a natural mechanism in eukaryotic cells that serves to selectively silence genes in the cell nucleus. It allows for so-called "gene silencing." RNA interference is based on the interaction of short RNA fragments with mRNA involving several enzyme complexes. As a result of the activity of these enzyme complexes, the mRNA is cleaved into several fragments, thus destroying the encoded information and preventing translation into protein.

[0056] So-called "small interfering RNA" (siRNA) are short RNA fragments that lead to the selective degradation of complementary mRNA in the organism. They thus specifically prevent gene expression and protein formation.

[0057] Antisense RNA is a single-stranded RNA that is complementary to a protein-coding mRNA. Almost all antisense RNAs exhibit secondary structures such as stem loops and, in some cases, more complex tertiary structures such as pseudoknots between these secondary structures. These structural elements determine the rate of degradation by intracellular ribonucleases as well as the rate at which the antisense RNA pairs with the complementary mRNA. This pairing inhibits gene translation.

[0058] Said inhibition or reduction of FATP2 (fatty acid transport protein 2) protein activity may comprise the use of an agent that binds to the FATP2 protein and / or inhibits or reduces its activity.

[0059] Preferably, said T cell is a synovial T cell, particularly preferably a synovial memory T cell. The FATP2 protein can be a mammalian, non-primate, primate, and in particular a human FATP2 protein or a fragment thereof.

[0060] According to a second aspect, the present invention relates to a method for identifying an active substance that binds to the FATP2 protein of a T cell, or a fragment thereof, and / or inhibits or reduces the activity of the FATP2 protein of a T cell, or a fragment thereof.

[0061] The procedure includes at least the following steps:

[0062] (i) providing the FATP2 protein or a fragment thereof,

[0063] (ii) adding at least one active substance to be tested for binding to the FATP2 protein or a fragment thereof, and

[0064] (iii) identifying the at least one active substance that has bound to the FATP2 protein or a fragment thereof.

[0065] Preferably, the active ingredient to be screened and identified according to the present invention is a FATP2 inhibitor or FATP2 antagonist, an agent that inhibits or reduces the activity of the FATP2 protein or a fragment thereof.

[0066] The active ingredient according to the present invention can be selected from the group consisting of a low molecular weight compound, a peptide, in particular a natural or synthetic peptide or peptide derivative, and a biological or biologically active ingredient.

[0067] In the context of the present invention, the term "small molecule," "small molecule" ("smol"), or "chemical drug" refers to an organic compound with a low molecular weight (<10,000 Daltons, especially <1,000 Daltons), often with a size on the order of 1 nm. Many drugs are small molecules. Such small molecules can regulate a biological process. Small molecules can be capable of inhibiting a specific function of a protein. In the field of pharmacology, the term "small molecule" refers in particular to molecules that bind to specific biological macromolecules and act as an effector, altering the activity or function of a target. For example, acetylsalicylic acid (ASA) is considered a small molecule, measuring 180 Daltons and consisting of 21 atoms.Such low molecular weight compounds often have only a low ability to trigger an immune response and remain relatively stable over time.

[0068] The low molecular weight compound according to the present invention may comprise, in addition to other chemical backbones, substituents, groups or radicals, for example, alkyl, alkenyl, alkynyl, alkoxy, aryl, alkylene, arylene, amino, halogen, carboxylate derivative, cycloalkyl, carbonyl derivative, heterocycloalkyl, heteroaryl, heteroarylene, sulfonate, sulfate, phosphonate, phosphate, phosphine, phosphine oxide groups.

[0069] The "biologic", "biological drug", "biological therapeutic", "biopharmaceutical" or "biological agent" according to the present invention is preferably an antibody, or an antigen-binding fragment thereof, or an antigen-binding derivative thereof, or an antibody-like molecule or protein, or an aptamer, or a nucleic acid.

[0070] In a preferred embodiment of the method for identifying an active compound that binds to the FATP2 protein or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein or a fragment thereof, the active compound is a member of a "library" of compounds.

[0071] The "library" (mixture) of compounds may include, for example, low molecular weight compounds, natural or synthetic peptides or peptide derivatives, or biologics or biologically active substances or biological compounds.

[0072] In the context of the present invention, the term "(combinatorial) compound library" or "library of compounds" refers to collections of chemical compounds, small molecules, natural or synthetic peptides or peptide derivatives, or macromolecules such as proteins or other biologics, respectively, each containing a large number of related chemical, peptide or biological species of molecules that can be used together in particular screening assays or identification steps.

[0073] Methods for the preparation of compound libraries and for high-throughput screening of compounds for interaction with the target molecule are described in the prior art (e.g., Volochnyuk et al. 2019). These methods also include so-called "focus libraries," highly annotated and pre-selected chemical molecule libraries (Wassermann et al. 2014), DNA-encoded libraries of chemical compounds (Martin et al. 2020), and chemoinformatics-based virtual molecule libraries (Saldivar-Gonzalez et al. 2020). The use of so-called "phage display" technologies to identify suitable small-molecule drugs has been described, for example, by Takakusagi et al. 2020.Numerous other peptide and antibody display technologies such as bacterial display, yeast surface display, mammalian surface display, and ribosome display are described in Valldorf et al.,.

[0074] Methods for the preparation of molecular libraries, their immobilization and their high-throughput screening of biological molecules, for example peptides, peptide derivatives, proteins, antibodies, antigen-binding antibody fragments, antigen-binding antibody derivatives, or antibody-like molecules, are also described in the prior art (for peptide libraries, for example, in Bozovicar and Bratkovic 2019; Schwaar et al. 2019; for antibody libraries in Lin and Lerner 2021).

[0075] In a preferred embodiment of the method for identifying an active agent that binds to the FATP2 protein or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein or a fragment thereof, the biological agent is an antibody, an antigen-binding fragment thereof, an antigen-binding derivative thereof, an antibody-like molecule or protein, an aptamer, or a nucleic acid.

[0076] In a preferred embodiment of the method for identifying an active substance that binds to the FATP2 protein or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein or a fragment thereof, the FATP2 protein is bound to a solid phase or is in solution.

[0077] According to a third aspect, the present invention relates to the use of a nucleic acid encoding the FATP2 protein or a fragment thereof, or the use of the FATP2 protein or a fragment thereof, in a method for identifying an active substance that binds to the FATP2 protein or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein or a fragment thereof.

[0078] To express the FATP2 protein or a fragment thereof, a nucleic acid encoding the FATP2 protein or a fragment thereof is cloned into a suitable expression vector, e.g., a suitable expression plasmid, as described (Green and Sambrook 2012). The recombinant expression protein is introduced by transfection into a cell suitable for the expression of the FATP2 protein or a fragment thereof, the cell is propagated in cell culture using a suitable cell culture medium, and the expressed protein is purified from the cells and / or the cell culture medium.

[0079] As used herein, the term "transfection" refers to any method for intentionally introducing a foreign nucleic acid into a eukaryotic cell. Various types of nucleic acids can be used for transfection into eukaryotic cells, particularly deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and small non-coding RNAs such as siRNA, shRNA, and miRNA.

[0080] With regard to transfection, a distinction is made between stable and transient transfection. In stable transfection, long-term expression of the transgene is achieved by integration of the nucleic acid introduced into the cell into the cellular genome. Transient transfection, in which the expression of the transgene occurs only temporarily, does not require integration of the nucleic acid into the cellular genome (Fus-Kujawa et al. 2021).

[0081] The selection of the optimal transfection method depends on various factors, in particular the type and origin of the target or production cell and the type of nucleic acid being introduced. Physical, chemical, and viral vector-based transfection methods can be used to introduce foreign (modified homologous and / or heterologous) nucleic acid encoding the desired transgene(s) into eukaryotic cells. Physical transfection methods include, for example, electroporation, sonoporation, magnetofection, microinjection, and biolistic methods. Chemical transfection methods include the calcium phosphate method, the use of dendrimers, cationic polymers such as diethylaminoethyl dextran (DEAE-dextran), nanoparticles, non-liposomal nanoparticles, and liposomal transfection. Transfection using viral vectors (so-calledIn particular, genetically modified retroviruses and lentiviruses, adenoviruses, and adeno-associated viruses (AAV) are used for transduction (Fus-Kujawa et al. 2021).

[0082] According to a fourth aspect, the present invention relates to an active ingredient obtained by said method for identifying an active ingredient that binds to the FATP2 protein of a T cell or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein of a T cell, or a fragment thereof, or obtained by one of the above-described embodiments of said method.

[0083] Furthermore, the present invention relates to an active ingredient that binds to the FATP2 protein or a fragment thereof in a T cell, and / or inhibits or reduces the activity of the FATP2 protein, or a fragment thereof, and / or promotes the degradation of the FATP2 protein.

[0084] Furthermore, the present invention relates to an active ingredient which inhibits or reduces the expression of the SLC27A2 gene in a T cell, preferably wherein the T cell is a synovial T cell.

[0085] In a preferred embodiment, the present invention relates to an active ingredient, wherein the active ingredient is a low molecular weight compound (smol), a peptide or peptide derivative, or a biological, preferably wherein the biological is an antibody or an antigen-binding fragment thereof, or an antigen-binding derivative thereof, or an antibody-like protein, or an aptamer or a nucleic acid.

[0086] In a preferred embodiment, the active ingredient binds specifically with a high or particularly high affinity and / or avidity to the FATP2 protein or a fragment thereof. In a preferred embodiment, the active ingredient, when bound to FATP2, reduces or inhibits FATP2 activity.

[0087] The term "specifically binding" as used herein means that the drug has a dissociation constant KD with respect to its binding to the FATP2 protein molecule or an epitope thereof of at most about 100 pM. In one embodiment, the KD is about 100 pM or lower, about 50 pM or lower, about 30 pM or lower, about 20 pM or lower, about 10 pM or lower, about 5 pM or lower, about 1 pM or lower, about 900 nM or lower, about 800 nM or lower, about 700 nM or lower, about 600 nM or lower, about 500 nM or lower, about 400 nM or lower, about 300 nM or lower, about 200 nM or lower, about 100 nM or lower, about 90 nM or lower, about 80 nM or lower, about 70 nM or lower, about 60 nM or lower, about 50 nM or lower, about 40 nM or lower, about 30 nM or lower, about 20 nM or lower, or about 10 nM or lower, about 1 nM or lower, about 900 pM or lower,about 800 pM or lower, about 700 pM or lower, about 600 pM or lower, about 500 pM or lower, about 400 pM or lower, about 300 pM or lower, about 200 pM or lower, about 100 pM or lower, about 90 pM or lower, about 80 pM or lower, about 70 pM or lower, about 60 pM or lower, about 50 pM or lower, about 40 pM or lower, about 30 pM or lower, about 20 pM or lower, or about 10 pM or lower, or about 1 pM or lower.

[0088] According to a fifth aspect, the present invention relates to an antibody, or an antigen-binding fragment or antigen-binding derivative thereof, or an antibody-like protein that specifically binds to the FATP2 protein, preferably to the FATP2 protein in a T cell.

[0089] In a preferred embodiment, the present invention relates to said antibody, or antigen-binding fragment or antigen-binding derivative thereof, or antibody-like protein, wherein the antibody, or the antigen-binding fragment or derivative thereof, or the antibody-like protein inhibits FATP2 activity, ie acts as an inhibitor or antagonist of FATP2.

[0090] As used herein, the term "antibody" refers to a protein consisting of one or more polypeptide chains encoded by immunoglobulin genes or fragments of immunoglobulin genes, or cDNAs derived therefrom. These immunoglobulin genes include the light chain kappa, lambda, and heavy chain alpha, delta, epsilon, gamma, and mu genes of the constant region, as well as any of the many different variable region genes.

[0091] The basic structural unit of immunoglobulin (antibody) is usually a tetramer consisting of two identical pairs of polypeptide chains, the light chains (L, with a molecular weight of about 25 kDa) and the heavy chains (H, with a molecular weight of about 50-70 kDa). Each heavy chain consists of a heavy chain variable region (abbreviated as VH or VH) and a heavy chain constant region (abbreviated as CH or CH). The heavy chain constant region consists of three domains, namely CH1, CH2, and CH3. Each light chain contains a light chain variable region (abbreviated as VL or VL) and a light chain constant region (abbreviated as CL or CL).The VH and VL regions can be further subdivided into regions of hypervariability, also called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL region consists of three CDRs and four FRs arranged from the amino terminus to the carboxyl terminus in the order FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains form a binding domain that interacts with an antigen.

[0092] The CDRs are most important for binding the antibody or its antigen-binding portion. The FRs can be replaced by other sequences, provided the three-dimensional structure required for antigen binding is retained.

[0093] The term "antigen-binding portion" of a (monoclonal) antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to the antigen in its native form. Examples of antigen-binding portions of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CHI domains; an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments joined by a disulfide bond at the hinge region; an Fd fragment consisting of the VH and CHI domains; an Fv fragment consisting of the VL and VH domains of a single arm of an antibody; and a dAb fragment consisting of a VH domain and an isolated complementarity-determining region (CDR).

[0094] The antibody, antibody fragment, or antibody derivative thereof according to the present invention may be a monoclonal antibody. The antibody may be of the IgA, IgD, IgE, IgG, or IgM isotype. As used herein, the term "monoclonal antibody (mAb)" refers to an antibody composition having a homogeneous antibody population, i.e., a homogeneous population consisting of a whole immunoglobulin or a fragment or derivative thereof. Particularly preferably, such an antibody is selected from the group consisting of IgG, IgD, IgE, IgA, and / or IgM, or a fragment or derivative thereof.

[0095] As used herein, the term "fragment" refers to fragments of such an antibody that retain their target binding capacities, e.g., a CDR (complementarity determining region), a hypervariable region, a variable domain (Fv), an IgG heavy chain (consisting of VH, CHI, hinge, CH2, and CH3 regions), an IgG light chain (consisting of VL and CL regions), and / or an Fab and / or F(ab)2.

[0096] As used herein, the term "derivative" refers to protein constructs that are structurally different from, yet still exhibit some structural similarity to, the current antibody concept, e.g., scFv, Fab, and / or F(ab)2, as well as bi-, tri-, or higher-specific antibody constructs. All of these elements are discussed below.

[0097] Other antibody derivatives known to those skilled in the art are diabodies, camelid antibodies, domain antibodies, bivalent homodimers with two chains consisting of scFvs, IgAs (two IgG structures linked by a J chain and a secretory component), shark antibodies, antibodies consisting of New World primate scaffold plus non-New World primate CDR, dimerized constructs comprising CH3+VL+VH, other scaffold protein formats comprising CDRs, and antibody conjugates.

[0098] As used herein, the term "antibody-like protein" refers to a protein that has been modified (e.g., by mutagenesis of Ig loops) to specifically bind to a target molecule. Typically, such an antibody-like protein comprises at least one variable peptide loop attached at both ends to a protein scaffold. This dual structural constraint increases the binding affinity of the antibody-like protein to a level comparable to that of an antibody. The length of the variable peptide loop typically consists of 10 to 20 amino acids. The scaffold protein can be any protein with good solubility properties. Preferably, the scaffold protein is a small globular protein. Antibody-like proteins include, without limitation, affibodies, anticalins, and designed ankyrin and affilin proteins. Antibody-like proteins can be derived from large libraries of mutants, e.g.,by panning from large phage display libraries, and can be isolated analogously to regular antibodies. Antibody-like binding proteins can also be obtained by combinatorial mutagenesis of surface-exposed residues in globular proteins. Antibody-like proteins have been described, for example, in Binz et al. (2005) and Hosse et al. (2006).

[0099] As used herein, the term "Fab" refers to an IgG fragment comprising the antigen binding region, the fragment being composed of a constant and a variable domain of the heavy and light chains of the antibody, respectively.

[0100] As used here, the term "F(ab)2" refers to an IgG fragment consisting of two Fab fragments joined by disulfide bonds.

[0101] The term "scFv" used here refers to a single-chain variable fragment, which is a fusion of the variable regions of the heavy and light chains of immunoglobulins joined by a short linker, typically comprising serine (S) and / or glycine (G) residues. This chimeric molecule retains the specificity of the original immunoglobulin despite the removal of the constant regions and the introduction of a linker peptide.

[0102] Modified antibody formats include bi- or tri-specific antibody constructs, antibody-based fusion proteins, immunoconjugates, and the like.

[0103] IgG, scFv, Fab, and / or F(ab)2 are antibody formats well known to those skilled in the art. Detailed explanations and techniques can be found in relevant textbooks.

[0104] According to preferred embodiments of the present invention, the antibody or antigen-binding fragment thereof or antigen-binding derivative thereof is a murine, chimeric, humanized, or human antibody, antigen-binding fragment, or antigen-binding derivative thereof. Monoclonal antibodies (mAbs) derived from mice can cause undesirable immunological side effects because they contain a protein from another species that can induce an immune response. To overcome this problem, methods for humanizing and maturing antibodies have been developed to generate antibody molecules with minimal immunogenicity when applied to humans, while ideally preserving the specificity and affinity of the non-human parent antibody. In these methods, for example, the framework regions of a mouse mAb are replaced with corresponding human framework regions (so-called CDR grafting).W0200907861 discloses the generation of humanized forms of mouse antibodies by linking the CDR regions of non-human antibodies to human constant regions using recombinant DNA technology. US6548640 describes CDR transplantation techniques, and US5859205 describes the production of humanized antibodies.

[0105] As used herein, the term "humanized antibody" refers to an antibody, a fragment, or a derivative thereof, in which at least a portion of the constant regions and / or the framework regions, and optionally a portion of the CDR regions of the antibody are derived from or adapted to human immunoglobulin sequences.

[0106] According to a sixth aspect, the present invention relates to an active ingredient as described above or an antibody, an antigen-binding fragment or an antigen-binding derivative thereof, or an antibody-like protein as described above for use in the treatment of an autoimmune disease.

[0107] The autoimmune diseases preferably include rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement.

[0108] Furthermore, the present invention relates to a pharmaceutical composition comprising the active ingredient as described above, or the antibody, the antigen-binding fragment or antigen-binding derivative thereof, or an antibody-like protein as described above, and one or more pharmaceutically acceptable excipients, for use in the treatment of an autoimmune disease, preferably wherein said autoimmune disease is selected from the group consisting of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cellular involvement.

[0109] In a preferred embodiment of the present invention, said pharmaceutically acceptable excipient(s) is / are selected from the group consisting of pharmaceutically acceptable buffers, surfactants, diluents, carriers, excipients, fillers, binders, lubricants, glidants, disinfectants, adsorbents and / or preservatives.

[0110] Said pharmaceutical composition can be administered in the form of powder, tablets, pills, capsules, or pearls. In aqueous form, the pharmaceutical formulation may be ready for administration, whereas the lyophilized formulation must be converted into a liquid form prior to administration, e.g., by adding water for injections, which may or may not contain a preservative such as, but not limited to, benzyl alcohol; antioxidants such as vitamin A, vitamin E, vitamin C, retinyl palmitate, and selenium; the amino acids cysteine ​​and methionine; citric acid and sodium citrate; and synthetic preservatives such as the parabens methylparaben and propylparaben.

[0111] The pharmaceutical formulation may further contain one or more stabilizers, which may be, for example, an amino acid, a sugar polyol, a disaccharide, and / or a polysaccharide. The pharmaceutical formulation may further contain one or more surfactants, one or more isotonic agents, one or more metal ion chelators, and / or one or more preservatives.

[0112] The pharmaceutical formulation as described herein may be suitable for at least oral, parenteral, intravenous, intramuscular, or subcutaneous administration. Alternatively, the active ingredient or antibody according to the present invention may be provided in a depot formulation, allowing the delayed release of the active ingredient over a specific period of time. Furthermore, a primary packaging, such as a prefilled syringe or pen, a vial, or an infusion bag, comprising said pharmaceutical formulation according to this aspect of the invention is provided.

[0113] The prefilled syringe or pen can contain the formulation either in freeze-dried form (which must then be dissolved with, for example, water for injections before administration) or in aqueous form. The syringe or pen is often disposable and can have a volume between 0.1 and 20 ml. However, the syringe or pen can also be a reusable syringe or a multi-dose pen.

[0114] Furthermore, the present invention relates to the use of an active ingredient that binds to the FATP2 protein in a method for treating an autoimmune disease, preferably wherein said autoimmune disease is selected from the group consisting of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement. Preferably, the active ingredient, when bound to FATP2, inhibits FATP2 activity.

[0115] Furthermore, the present invention relates to the use of an active ingredient that binds to the FATP2 protein for the preparation of a medicament for treating an autoimmune disease, wherein the autoimmune disease is preferably selected from the group consisting of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement. When bound to FATP2, the active ingredient preferably inhibits FATP2 activity.

[0116] Furthermore, the present invention relates to a method for treating or preventing an autoimmune disease, which method comprises administering an active ingredient that binds to and / or inhibits the FATP2 protein in a therapeutically effective dose or amount to a human or animal subject. As used herein, the term "effective dose" or "effective amount" means a dose or amount of the active ingredient necessary, in terms of dosages and administration times, to achieve the desired therapeutic result in a patient. Effective amounts may vary depending on factors such as the disease state, the age, sex and / or weight of the patient, the pharmaceutical formulation, the subtype of the disease to be treated, and the like, but can nevertheless be routinely determined by one of skill in the art.

[0117] According to a seventh aspect, the present invention relates to a process for producing an active compound according to the process for identifying said active compound which binds to the FATP2 protein or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein or a fragment thereof as described above, further comprising purifying said active compound.

[0118] Furthermore, the present invention relates to a process for the preparation of a pharmaceutical composition comprising

[0119] (i) the method for identifying said active substance which binds to the FATP2 protein or a fragment thereof and / or inhibits or reduces the activity of the FATP2 protein or a fragment thereof, as described above, and further

[0120] (ii) mixing the identified active ingredient with a pharmaceutically acceptable carrier.

[0121] According to an eighth aspect, the present invention relates to a composition comprising a combination of

[0122] (i) the active ingredient that binds to the FATP2 protein or a fragment thereof in a T cell and / or inhibits or reduces the activity of the FATP2 protein, or a fragment thereof, in a T cell, as described above, or the antibody or antigen-binding fragment or antigen-binding derivative thereof or the antibody-like protein as described above, or the pharmaceutical composition comprising the active ingredient as described above, or the antibody, the antigen-binding fragment or antigen-binding derivative thereof, or an antibody-like protein as described above, and one or more pharmaceutically acceptable excipients, and

[0123] (ii) one or more further therapeutically active compounds. According to a ninth aspect, the present invention relates to a therapeutic kit comprising:

[0124] (i) the pharmaceutical composition as described above,

[0125] (ii) a device for administering said composition, and

[0126] (iii) optionally, instructions for use.

[0127] Examples

[0128] The present invention will be explained in more detail by the examples and drawings shown and discussed below. It should be noted that the examples and drawings are for illustrative purposes only and are not intended to limit the invention in any way.

[0129] The invention is not limited to the disclosed embodiments. Other variations of the disclosed embodiments may be understood and practiced by those skilled in the art in practicing the claimed invention from a study of the drawings, the disclosure, and the appended claims. In the claims, the word "comprising" does not exclude other elements or steps, and the indefinite article "a" or "an" does not exclude a plurality. The mere fact that certain measures are recited in mutually different dependent claims does not mean that a combination of those measures cannot be advantageously employed. Any reference signs in the claims are not to be understood as limiting the scope of application.

[0130] All amino acid sequences disclosed here are presented from N-terminus to C-terminus; all nucleic acid sequences disclosed here are presented 5'->3'.

[0131] Example 1: Increased fatty acid uptake by T cells in the synovial fluid of JIA patients using the transport protein FATP2

[0132] The inventors were able to show that T cells found in the synovial fluid of juvenile idiopathic arthritis (JIA) patients promote increased uptake of fat

[0133] ZI acids, which is associated with increased expression of FATP24S7T '27 / 42. The fatty acid receptor FATP2 is expressed primarily in CD4+ memory cells (Fig. 1).

[0134] Example 1A: Uptake of free fatty acids in CD4-positive T cells from the blood or synovium of JIA patients

[0135] The uptake of free fatty acids into CD4+ T cells from the blood or synovium of juvenile idiopathic arthritis (JIA) patients was determined (Fig. 1 A). The measurement was performed after 15 minutes of incubation of the cells with Bodipye™FL C12 (2 pM) and subsequent flow cytometric analysis. The mean fluorescence intensity (MFI) is shown minus the respective FMO control (AMFI). The data show the mean expression in four patients ± standard error, **p < 0.01.

[0136] The data show that the uptake of free fatty acids by CD4-positive T cells is dramatically increased in the synovial fluid of JIA patients compared to peripheral blood. The data also suggest that fatty acid oxidation plays an important role in the ability of memory T cells to perform their functions.

[0137] This confirms a previous publication by Andreas Radbruch's group, which showed that T cells in synovial fluid depend on fatty acids for proliferation (Hradilkova et al. 2019). However, Andreas Radbruch's group proposed that this dependence is dependent on the transcription factor TWIST1, which is predominantly expressed in PD1-positive T cells. However, TWIST1 was not found to be upregulated in normal CD4-positive effector cells in synovial fluid, and its expression in synovial fluid regulatory T cells (Tregs) was not detectable (RNAseq single-cell data, Bas Vastert, UMC Utrecht, personal communication).Furthermore, the expression of CD36, another receptor for lipid uptake, is drastically reduced in synovial fluid regulatory T cells (Tregs) and synovial fluid T cells (data not shown) compared to peripheral blood, which contrasts with published data for murine CD8-positive resting memory T cells (Pan, Tian et al., 2017, Survival of tissue-resident memory T cells requires exogenous lipid uptake and metabolism, Nature Vol. 543, pp. 252-256). This is also interesting because CD36 is usually upregulated in Treg cells in hypoxic environments (such as in tumors) with increased glycolysis and lactate concentration (around 5 mmol / liter, which roughly corresponds to the concentration present in the synovial fluid of JIA patients), where it is critical for the suppression of CD8-positive T cells.

[0138] Instead, the inventors surprisingly found a specific upregulation of fatty acid transporter 2 (FATP2, also called SLC27A2) in CD4-positive T effector cells in the synovial fluid and even more so in CD4-positive Treg cells of the synovial fluid compared to the peripheral blood of healthy children, healthy adults and children with JIA (Fig. 2), which may be responsible for the effect the inventors observed regarding fatty acid transport.

[0139] Example 1B: FATP2 protein expression in CD4-positive T cells from the blood or synovium of JIA patients

[0140] FATP2 protein expression in CD4+ T cells from peripheral blood (PB) and synovium (SF) of JIA patients was determined by flow cytometric analysis (Fig. 1 B). A representative image is shown. Furthermore, the expression of 5ZC2742 RNA was determined in CD4+ T cells from synovium of JIA patients compared to blood from the same patients (Fig. 1 C).

[0141] Furthermore, the protein expression of FATP2 was determined in CD4+ T cell subtypes (effector memory T cells (T em ), tissue-resident memory T cells (T m ) and naive T cells (Tnaive)) from the blood and synovium of JIA patients were determined by flow cytometric analysis (Fig. 1 D). The mean fluorescence intensity (MFI) is shown minus the respective FMO control (AMFI). The data show the mean expression in five patients ± standard error, ***p < 0.001. ****p < 0.0001.

[0142] Example IC: SLC2 Z42 mRNA expression in stimulated and non-stimulated CD4-positive memory T cells from the blood of healthy controls

[0143] The mRNA expression of 5ZC 742 / FATP2 compared to other metabolic proteins in CD4+ memory T cells after 48-hour and 72-hour stimulation with anti-CD3 and anti-CD28 antibodies, as well as in unstimulated CD4+ memory T cells, was determined (Fig. 1 E). CD4+ memory T cells were isolated from the blood of healthy control subjects using magnetic cell separation. The data show the mean expression of four experiments with different donors ± standard error, **p < 0.01, ***p < 0.001.

[0144] The data demonstrate that SLC27A21F ATP2 is strongly upregulated in stimulated memory T cells compared to other metabolic proteins. SLC27A2 / F ATP2 mRNA expression was dramatically higher in MACS-isolated human naive CD4+ and CD45R0 CD4+ memory T cells from the peripheral blood of healthy donors after stimulation than without stimulation. The data suggest a specific role for this transport protein in the activation of memory T cells.

[0145] Example 2: Blockade of fatty acid uptake in memory T cells reduces IFNγ production and proliferation of the cells

[0146] Several small-molecule antagonists of FATP2 that inhibit fatty acid uptake in cells have already been described, for example, Lipofermata (Adeshakin et al. 2021) and Grassofermata (Saini et al. 2015). The inventors were able to show that the FATP2 inhibitor Lipofermata inhibits fatty acid uptake in CD4+ T cells and inhibits fFN-γ expression and proliferation of T cells without inducing apoptosis (Fig. 2). Using Lipofermata, the function of FATP2 in T cells was thus clearly confirmed.

[0147] Using Lipofermata (5-bromo-5'-phenyl-spiro[3H-indole-3,2'(3'H)-[l,3,4]thiadiazol]-2(lH)-one), fatty acid uptake in memory T cells can be effectively blocked and the proliferation and production of inflammatory mediators inhibited. This uptake pathway is therefore of central importance for the metabolism of T cells, which play a key role in the pathogenesis of childhood rheumatism, as well as other autoimmune diseases. Targeted blockade of this signaling pathway opens the door to exploiting a completely new mechanism of action in the treatment of autoimmune diseases.

[0148] The uptake of free fatty acids into CD4+ T cells after the addition of Lipofermata in increasing concentrations of 0, 2, 5, 7.5, and 10 pM was investigated (Fig. 2 A). For this purpose, the cells were stimulated with anti-CD3 and anti-CD28 antibodies for 48 hours. Measurements were taken after 15 minutes of incubation of the cells with Bodipye™FL C12 (2 pM) and subsequent flow cytometric analysis. The mean fluorescence intensity (MFI) is shown minus the respective FMO control (AMFI). The data represent the mean expression measured in three experiments ± standard error.

[0149] Fig. 2 B shows an exemplary histogram of fatty acid uptake in CD4+ T cells without addition of Lipofermata (right) and after addition of Lipofermata (left).

[0150] In addition, the percentage of IFN-γ-positive CD4+ T cells was examined after the addition of Lipofermata at increasing concentrations of 0, 2, 5, 7.5, and 10 pM (Fig. 2 C). For this purpose, the cells were stimulated with anti-CD3 and anti-CD28 antibodies for 48 hours. IFN-γ-positive cells were determined by flow cytometry after 5 hours of restimulation with PMA and ionomycin in the presence of GolgiPlug™. The data show the mean expression measured in 5-6 experiments ± standard error, *p < 0.01.

[0151] Fig. 2 D shows an exemplary dot plot of IFN-γ expression without addition of lipofermata (left) and after addition of lipofermata (right).

[0152] Furthermore, the percentage of proliferated CD4+ T cells was determined after adding Lipofermata at increasing concentrations of 0, 2, 5, 7.5, and 10 pM (Fig. 2 E). For this purpose, the cells were stained with "Cell proliferation dye eFlour™" and stimulated for 48 hours with anti-CD3 and anti-CD28 antibodies. The determination of proliferated cells was performed using flow cytometry. The data show the mean expression measured in five experiments ± standard error, *p < 0.01.

[0153] Fig. 2 F shows an exemplary dot plot of cell proliferation without addition of Lipofermata (left) and after addition of Lipofermata (right).

[0154] Fig. 2 G shows an exemplary dot plot of dead cells with Lipofermata treatment (right) and without (left). The cells were stimulated with anti-CD3 and anti-CD28 antibodies for 72 hours and stained with propidium iodide (PI) for flow cytometric live / dead discrimination. In summary, the present data demonstrate a drastically increased uptake of free fatty acids by T cells in the synovial fluid of JIA patients, which could be related to the specific upregulation of SLC 27A2-encoded FATP2, indicating a change in the metabolism and thus the function of these cells. It should be noted that virtually all effector T cells in the synovium represent the memory phenotype. The increased expression of SLC 27A2-encoded FATP2 could be blocked by a specific inhibitor (Lipofermata, Veglia et al. 2019).To test the effect of this inhibitor on T cells, CD4+ T cells were isolated from the blood of healthy donors and stimulated with anti-CD3 and anti-CD28 antibodies in the presence or absence of Lipofermata. It was shown that Lipofermata virtually completely blocked T cell proliferation and reduced IFN-γ production in a concentration-dependent manner without inducing apoptosis.

[0155] Example 3: Screening for drugs that bind to and / or inhibit the transport protein FATP2

[0156] Screening experiments enable the identification and validation of small molecule therapeutic compounds, peptides and / or biologics that bind to the FATP2 protein and / or inhibit its activity.

[0157] DNA-encoded compound libraries are generated and screened as described (Kunig et al. 2018). Furthermore, phage display technologies (Takakusagi et al. 2020), cell surface display or ribosome display technologies (Valldorf et al. 2022), and / or combinatorial peptide libraries (Bozovicar and Bratkovic 2019) are used. For this purpose, recombinant FATP2 protein or fragments thereof, which may carry a tag for labeling, identification, or purification, e.g., a His-tag or a FLAG-tag, are expressed in bacterial expression systems such as E. coli, or in insect or mammalian cells.

[0158] The purified FATP2 protein is incubated with substances from the compound library and isolated by immunoprecipitation. Compounds bound to the FATP2 protein are identified, for example, by Sanger sequencing of DNA barcodes. The identified agents and compounds are then tested in appropriate bioassays for their effects on FATP2 function, its fatty acid transport activity, as well as IFN-γ production and memory T cell proliferation. Experimental mouse zzz-vzvo models are also used for this purpose.

[0159] For the identification and validation of small-molecule therapeutic compounds, peptides, and / or biologics that affect FATP2 activity or expression, a zzz-vz7ro fluorochrome reporter system based on human cells is established. For example, the expression of the eGFP-FATP2 fusion protein or a luciferase-based reporter system is used to screen compound libraries in 384- to 1,536-well assays for the identification of compounds that reduce eGFP fluorescence or luciferase levels as a readout. Expression of these human FATP2 fusion reporter constructs in these cells can be achieved, for example, by transfection and selection via resistance gene cassettes or by viral transduction. Human cell lines such as 293 T cells are used for these assays.In parallel with this screening, cytotoxicity assays are performed to exclude compounds that have an effect on reporter fluorescence or activity due to nonspecific toxicity or induction of apoptosis.

[0160] Literature:

[0161] Adeshakin AO et al. (2021). Lipidomics data showing the effect of lipofermata on myeloid-derived suppressor cells in the spleens of tumor-bearing mice. Data in letter. https: / / doi.Org / 10.1016 / j.dib.2021.106882.

[0162] Binz HK, Amstutz P., and Plückthun A. (2005). Engineering novel binding proteins from nonimmunoglobulin domains. Nature Biotechnology Vol. 23 No. 10, p. 1257-1268.

[0163] Bozovicar K. and Bratkovic T. (2019). Evolving a peptide: Library platforms and diversification strategies. Int. J. Mol. Be. Vol. 21 No. 215; doi: 10.3390 / ijms21010215.

[0164] Chen Y. et al. (2020). Involvement of FATP2-mediated tubular lipid metabolic reprogramming in renal fibrogenesis. Cell Death and Disease Vol. 11, No. 994 https: / / doi.org / 10.1038 / s41419-020-03199-x. Endo Y. et al. (2019). ACC1 determines memory potential of individual CD4+ T cells by regulating de novo fatty acid biosynthesis. Nature Metabolism Vol. 1, p. 261-275.

[0165] Falcon A. et al. (2010). FATP2 is a hepatic fatty acid transporter and peroxisomal very long- chain acyl-CoA synthetase. Am J Physiol Endocrinol Metab Vol. 299, p. E384-E393.

[0166] Feng K. et al. (2022). Upregulated 5ZC2742 / FATP2 in differentiated thyroid carcinoma promotes tumor proliferation and migration. J Clin Lab Anal. Vol. 36, p. e24148. https: / / doi.org / 10.1002 / jcla.24148.

[0167] Fus-Kujawa A. et al. (2021). An overview of methods and tools for transfection of eukaryotic cells in vitro. Front. Bioeng. Biotechnol. Vol. 9:701031.

[0168] Green M.R. and Sambrook J. (2012). Molecular Cloning. A Laboratory Manual. Fourth Edition. Cold Spring Harbor Laboratory Press.

[0169] Hradilkova K. et al. (2019). Regulation of fatty acid oxidation by Twist 1 in the metabolic adaptation of T helper lymphocytes to chronic inflammation. Arthritis & Rheumatology Vol. 71 No. 10, p. 1756-1765.

[0170] Hosse R.J., Rothe A., und Power B.E. (2006). A new generation of protein display scaffolds for molecular recognition. Protein Science Vol. 15, p. 14-27.

[0171] Khan S. et al. (2020). Fatty acid transport protein-2 regulates glycemic control and diabetic kidney disease progression. JCI Insight Vol. 5 No. 15, p. el36845. https: / / doi.org / 10.1172 / j ci. insight.136845.

[0172] Kunig V. et al. (2018). DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences. Biol. Chem. Vol. 399 No. 7, p. 691-710.

[0173] Lin C.-W. und Lerner R.A. (2021). Antibody libraries as tools to discover functional antibodies and receptor pleiotropism. Int. J. Mol. Sei. Vol. 22 No. 4123. https: / / doi.org / 10.3390 / ijms22084123. Martin A. et al. (2020). Navigating the DNA encoded libraries chemical space.

[0174] Communications Chemistry Vol. 3 No. 127. https: / / doi.org / 10.1038 / s42004-020-00374-l.

[0175] Melton E.M. et al. (2013). Overexpression of human fatty acid transport protein 2 / very long chain acyl-CoA synthetase 1 (FATP2 / Acsvll) reveals distinct patterns of trafficking of exogenous fatty acids. Biochem Biophys Res Commun. Vol. 440 No. 4, p. 743-748.

[0176] Nidhi S. et al. (2021). Novel CRISPR-Cas Systems: an updated review of the current achievements, applications, and future research perspectives. Int. J. Mol. Set. Vol. 22, p. 3327. https: / / doi.org / 10.3390 / ijms22073327.

[0177] Ohl K. et al. (2018). The transcription factor CREM drives an inflammatory phenotype of T cells in oligoarticular juvenile idiopathic arthritis. Pediatric Rheumatology Vol. 16 No. 39. https: / / doi.org / 10.1186 / sl2969-018-0253-x.

[0178] Pearce E.L. et al. (2009). Enhancing CD8 T cell memory by modulating fatty acid metabolism. Nature Vol. 460 No. 7251, p. 103-107.

[0179] Perez V.M. et al. (2020). Deletion of fatty acid transport protein 2 (FATP2) in the mouse liver changes the metabolic landscape by increasing the expression of PPARa-regulated genes. J. Biol. Chem. Vol. 295 No. 17, p. 5737-5750.

[0180] Saini N. et al. (2015). Fatty acid transport protein-2 inhibitor Grassofermata / CB5 protects cells against lipid accumulation and toxicity. Biochem Biophys Res Commun. Vol. 465 No. 3, p. 534-541.

[0181] Saldivar-Gonzalez F.I. et al. (2020). Chemoinformatics-based enumeration of chemical libraries: a tutorial. Journal of Cheminformatics Vol. 12 No. 64. https: / / doi.org / 10.1186 / sl3321-020-00466-z. Schwaar T. et al. (2019). Effcient screening of combinatorial peptide libraries by spatially ordered beads immobilized on conventional glass slides. High-Throughput Vol. 8 No. 11. doi: 10.3390 / ht8020011.

[0182] Takakusagi T. el al. (2020). Phage display technology for target determination of smallmolecule therapeutics: an update. Expert Opinion on Drug Discovery Vol. 15 No. 10, p. 1199-1211.

[0183] Valldorf B. et al., Antibody display technologies: selecting the cream of the crop. Biol. Chem. Vol. 403 No. 5-6, p. 455-477.

[0184] Veglia F. et al. (2019). Fatty acid transporter 2 reprograms neutrophils in cancer. Nature Vol. 569 No. 7754, p. 73-78.

[0185] Volochnyuk D.M. et al. (2019). Evolution of commercially available compounds for HTS. Drug Discovery Today Vol. 24 No. 2, p. 390-402.

[0186] Wassermann A.M. et al. (2014). Composition and applications of focus libraries to phenotypic assays. Frontiers in Pharmacology Vol. 5 No. 164. doi: 10.3389 / fphar.2014.00164.

[0187] Zhu G. und Zhu H. (2022). Modified gene editing systems: diverse bioengineering tools and crop improvement. Front. Plant Sei. Vol. 13, p. 847169. doi: 10.3389 / fpls.2022.847169.

[0188] Sequenzen:

[0189] Humanes FATP2, Nukleotid- bzw. Aminosäuresequenzen

[0190] (SLC27A2, Solute Carrier Family 27 Member 2, Homo sapiens, human;

[0191] NCBI Entrez Gene Nr. 11001)

[0192] SEQ ID No. 1, Nukleotid-Sequenz-Eintrag enthaltenend die humane FATP2-Sequenz: aatacgacta cacctgctcc ggagcccgcg gcggtacctg cagcggagga getetgtett 60 ccccttcatc tcacgcgagc ccggcgtccc gccgcgtgcg ccccggcgca gcccgccagt 120 ccgccccggag cccgcccagt cgccgcgctg cacgccggg gtgaaccctc tgccctcgct 180 gggacagagg gccccgcagc egteatgett tccgccatct acacagtcct ggcgggactg 240 ctgttcctgc cgctcctggt gaacctctgc tgcccatact tcttccagga cataggctac 300 ttcttgaagg tggccgccgt gggccggagg gtgcgcagct acgggcagcg gcggccggcg 360 cgcaccatcc tgcgggcgtt cctggagaaa gcgccgccaga cgccacacaa gcctttctg 420 ctcttccgcg acgagactct cacctacgcg caggtggacc ggcgcagcaa tcaagtggcc 480 cgggcgctgc acgaccacct cggcctgcgc cagggagact gcgtggcgct ccttatgggt 540 aacgagccgg cctacgtgtg gggtgtggctg gggctggtga agctggggctg tgccatggcg 600 tgcctcaatt acaacatccg cgcgaagtcc ctgctgcact gcttccagtg ctgcggggcg 660 aaggtgctgc tggtgtcgcc agaactacaa gcagctgtcg aagagatact gccaagcctt 720 aaaaaagatg atgtgtccat ctattatgtg agcagaactt ctaacacaga tgggattgac 780 tctttcctggacaaagtgga tgaagtatca actgaaccta tcccagagtc atggaggtct 840 gaagtcactt tttccactcc tgccttatac atttatactt ctggaaccac aggtcttcca 900 aaagcagcca tgatcactca tcagcgcata tggtatggaa ctggcct tttcactca 960 cagatgatgt catctatatc actctgccct tttaccacag tgctgcacta 1020 ctgattggca ttcacggatg tattgtggct ggtgctactc ttgccttgcg gactaaattt 1080 tcagccagcc agttttggga tgactgcaga aaatacaacg tcagatctc 140 ggtgaactgc ttcggtattt atgcaactca ccacagaaac caaatgaccg tgatcataaaa 1200 gtgagactgg cactgggaaa tggcttacga ggagatgtgt ggagacaatt tgtcaagaga 1260 tttggggaca tatgcatcta tgagttctat gctgcactat aggccat1320 aattatgcga gaaaagttgg tgctgttgga agagtaaact acctacagaa aaaaatcata 1380 acttatgacc tgattaaata tgatgtggag aaagatgaac ctgtccgtga tgaaaatgga 1440 tattgcgtca gagttcccaa aggtgaagtt ggactctt cagc acaccattta atggctatgc tggagcaaag gctcagacag agaagaaaaa actgagagat 1560 gtctttaaga aaggagacct ctatttcaac agtggagatc tcttaatggt tgaccatgaa 1620 aatttcatctatttccacga cagagttgga gatacattcc ggtggaagg ggaaaatgtg 1680 gccaccactg aagttgctga tacagttgga ctggttgatt ttgtccaaga agtaaatgtt 1740 tatggagtgc atgtgccaga tcatgagggt cgcattggca tggcctccat caaaatgaaa 1800 gaaaccatg aatttgatgg aaagaaactc tttcagcaca ttgctgatta cctacctagt 1860 tatgcaaggc cccggtttct aagaatacag gacaccattg agatcactgg aacttttaaa 1920 caccgcaaaa tgaccctggt ggagggggc tttaaccctg ctgtcatcaa agatgccttg 1980 tatttctgg atgacacagc aaaaaatgtat gtgcctatga ctgaggacat ctataatgcc 2040 ataagtgcta aaaccctgaa actctgaata ttcccaggag gataactcaa catttccaga 2100 aagaaactga atggacagcc acttgatata atccaacttt aatttgattg aagattgtga 2160 ggaaattttg taggaaattt gcatacccgt aaagggagac ttttttaaat aacagttgag 2220 tctttgcaag taaaaagatt tagagatt tatttttcag tgtgcaccta ctgtttgtat 2280 ttgcaaactg agcttgttgg agggaaggca ttatttttta aaatacttag taaattaaat 2340 gaac 2344

[0193] SEQ ID No. 2, coding nucleotide sequence of human FATP2 (nuclei 205 - 2067 of SEQ ID No. 1): atgctttccg ccatctacac agtcctggcg ggactgctgt tcctgccgct cctggtgaac 60 ctctgctgcc catacttctt ccaggacata ggctacttct tgaaggtggc cgccgtgggc 120 cggagggtgc gcagctacgg gcagcggcgg ccggcgcgca ccatcctgcg ggcgttcctg 180 gagaaagcgc gccagacgcc acacaagcct ttctgctct tccgcgacga gactctcacc 240 tacgcgcagg tggaccggcg cagcaatcaa gtggcccggg cgctgcacga ccacctcgg 300 ctgcgccagg gagactgcgt ggcgctcctt atgggtaacg agccggcta cgtgtggctg 360 tggctggggc tggtgaagct gggctgtgcc atggcgtgcc tcaattacaa catccgcgcg 420 aagtccctgc tgcactgctt ccagtgctgc ggggcgaagg tgctgctggt gtcgccagaa 480 ctacaagcag ctgtcgaaga gatactgcca agccttaaaa aagatgatgt gtccatctat 540 tatgtgagca gaacttctaa cacagatggg attgactctt tcctggacaa agtggatgaa 600 gtatcaactg aacctatccc agagtcatgg aggtctgaag tcactttttc cactcctgcc 660 ttatacattt atacttctgg aaccacaggt cttccaaaag cagccatgat cactcatcag 720 cgcatatggt atggaactgg cctcactttt gtaagcggat tgaaggcagatgatgtcatc 780 tatatcactc tgccctttta ccacagtgct gcactactga ttggcattca cggatgtatt 840 gtggctggtg ctactcttgc cttgcggact aaattttcag ccagccagtt ttgggatgac 900 tgcagaaaat acaacgtcac tgtcattcag tatatcggtg aactgcttcg gtatttatgc 960 aactcaccac agaaaccaaa tgaccgtgat cataaagtga gactggcact gggaaatggc 1020 ttacgaggag atgtgtggag acaatttgtc aagagatttg gggacatatg catctatgag 1080 ttctatgctg ccactgaagg caatattgga tttatgaatt atgcgagaaa agttggtgct 1140 gttggagaag taaactact agaaaaaaa atcataactt atgacctgat taaatatgat 1200 gtggagaaag atgaacctgt ccgtgatgaa aatggatatt gcgtcagagt tcccaaaggt 1260 gaagttggac ttctggtttg caaaatcaca caacttacac catttaatgg ctatgctgga 1320 gcaaaggctc agagagagaa gaaaaaactg agagatgtct ttaagaaagg agacccttat 1380 ttcaacagtg gagatctctt aatggttgac catgaaaatt tcatctattt ccacgacaga 1440 gttggagata cattccggtg gaaaggggaa aatgtggcca ccactgaagt tgctgataca 1500 gttggactgg ttgattttgt ccaagaagta aatgtttatg gagtgcatgt gccagatcat 1560 gagggtcgca ttggcatggc ctccatcaaa atgaaagaa accatgaatt tgatggagaaag1620 aaactctttc agcacattgc tgattaccta cctagttatg caaggccccg gtttctaaga 1680 atacaggaca ccattgagat cactggaact tttaaacacc gcaaaatgac cctggtggag 1740 gagggcttta accctgctg catcagatt gcttggatt cacagcaaaa 1800 atgtatgtgc ctatgactga ggacatctat aatgccataa gtgctaaaac cctgaaactc 1860 tga 1863

[0194] SEQ ID No. 3, Amino acid sequence of human FATP2:

[0195] Met Leu Ser Ala Ile Tyr Thr Val Leu Ala Gly Leu Leu Phe Leu Pro

[0196] Leu Leu Val Asn Leu Cys Cys Pro Tyr Phe Phe Gin Asp Ile Gly Tyr

[0197] Phe Leu Lys Val Ala Ala Val Gly Arg Arg Val Arg Ser Tyr Gly Gin 35 40 45

[0198] Arg Arg Pro Ala Arg Thr Ile Leu Arg Ala Phe Leu Glu Lys Ala Arg 50 55 60

[0199] Gin Thr Pro His Lys Pro Phe Leu Leu Phe Arg Asp Glu Thr Leu Thr 65 70 75 80

[0200] Tyr Ala Gin Val Asp Arg Arg Ser Asn Gin Val Ala Arg Ala Leu His

[0201] 85 90 95

[0202] Asp His Leu Gly Leu Arg Gin Gly Asp Cys Val Ala Leu Leu Met Gly

[0203] 100 105 110

[0204] Asn Glu Pro Ala Tyr Val Trp Leu Trp Leu Gly Leu Val Lys Leu Gly 115 120 125

[0205] Cys Ala Met Ala Cys Leu Asn Tyr Asn Ile Arg Ala Lys Ser Leu Leu

[0206] 130 135 140

[0207] His Cys Phe Gin Cys Cys Gly Ala Lys Val Leu Leu Val Ser Pro Glu 145 150 155 160

[0208] Leu Gin Ala Ala Val Glu Glu Ile Leu Pro Ser Leu Lys Lys Asp Asp

[0209] 165 170 175

[0210] Val Ser Ile Tyr Tyr Val Ser Arg Thr Ser Asn Thr Asp Gly Ile Asp 180 185 190

[0211] Ser Phe Leu Asp Lys Val Asp Glu Val Ser Thr Glu Pro Ile Pro Glu

[0212] 195 200 205

[0213] Ser Trp Arg Ser Glu Val Thr Phe Ser Thr Pro Ala Leu Tyr Ile Tyr 210 215 220

[0214] Thr Ser Gly Thr Thr Gly Leu Pro Lys Ala Ala Met Ile Thr His Gin 225 230 235 240

[0215] Arg Ile Trp Tyr Gly Thr Gly Leu Thr Phe Val Ser Gly Leu Lys Ala

[0216] 245 250 255

[0217] Asp Asp Val Ile Tyr Ile Thr Leu Pro Phe Tyr His Ser Ala Ala Leu 260 265 270

[0218] Leu Ile Gly Ile His Gly Cys Ile Val Ala Gly Ala Thr Leu Ala Leu

[0219] 275 280 285

[0220] Arg Thr Lys Phe Ser Ala Ser Gin Phe Trp Asp Asp Cys Arg Lys Tyr 290 295 300

[0221] Asn Val Thr Val Ile Gin Tyr Ile Gly Glu Leu Leu Arg Tyr Leu Cys 305 310 315 320

[0222] Asn Ser Pro Gin Lys Pro Asn Asp Arg Asp His Lys Val Arg Leu Ala

[0223] 325 330 335 Leu Gly Asn Gly Leu Arg Gly Asp Val Trp Arg Gin Phe Val Lys Arg

[0224] 340 345 350

[0225] Phe Gly Asp Ile Cys Ile Tyr Glu Phe Tyr Ala Ala Thr Glu Gly Asn

[0226] 355 360 365

[0227] Ile Gly Phe Met Asn Tyr Ala Arg Lys Val Gly Ala Val Gly Arg Val

[0228] 370 375 380

[0229] Asn Tyr Leu Gin Lys Lys Ile Ile Thr Tyr Asp Leu Ile Lys Tyr Asp 385 390 395 400 Val Glu Lys Asp Glu Pro Val Arg Asp Glu Asn Gly Tyr Cys Val Arg

[0230] 405 410 415

[0231] Val Pro Lys Gly Glu Val Gly Leu Leu Val Cys Lys Ile Thr Gin Leu

[0232] 420 425 430

[0233] Thr Pro Phe Asn Gly Tyr Ala Gly Ala Lys Ala Gin Thr Glu Lys Lys

[0234] 435 440 445

[0235] Lys Leu Arg Asp Val Phe Lys Lys Gly Asp Leu Tyr Phe Asn Ser Gly

[0236] 450 455 460

[0237] Asp Leu Leu Met Val Asp His Glu Asn Phe Ile Tyr Phe His Asp Arg 465 470 475 480 Val Gly Asp Thr Phe Arg Trp Lys Gly Glu Asn Val Ala Thr Thr Glu

[0238] 485 490 495

[0239] Val Ala Asp Thr Val Gly Leu Val Asp Phe Val Gin Glu Val Asn Val

[0240] 500 505 510

[0241] Tyr Gly Val His Val Pro Asp His Glu Gly Arg Ile Gly Met Ala Ser

[0242] 515 520 525

[0243] Ile Lys Met Lys Glu Asn His Glu Phe Asp Gly Lys Lys Leu Phe Gin

[0244] 530 535 540

[0245] His Ile Ala Asp Tyr Leu Pro Ser Tyr Ala Arg Pro Arg Phe Leu Arg 545 550 555 560 Ile Gin Asp Thr Ile Glu Ile Thr Gly Thr Phe Lys His Arg Lys Met

[0246] 565 570 575

[0247] Thr Leu Val Glu Glu Gly Phe Asn Pro Ala Val Ile Lys Asp Ala Leu

[0248] 580 585 590

[0249] Tyr Phe Leu Asp Asp Thr Ala Lys Met Tyr Val Pro Met Thr Glu Asp

[0250] 595 600 605

[0251] Ile Tyr Asn Ala Ile Ser Ala Lys Thr Leu Lys Leu

[0252] 610 615 620

Claims

Patent claims:

1. A method for inhibiting or reducing fatty acid uptake into a T cell, activation and / or proliferation of a T cell, wherein the method comprises at least one step selected from the group consisting of (i) Inhibiting or reducing T cell SLC27A2 gene expression, (ii) Inhibiting or reducing the activity of fatty acid transport protein 2 (FATP2), and / or (iii) Promoting the degradation of the FATP2 protein.

2. The method of claim 1, wherein the inhibition or reduction of SLC27A2 gene expression comprises 5ZC2742 gene knockdown, knockout, conditional gene knockout, gene modification by insertion, deletion and / or substitution, gene modification by means of a gene editing system, RNA interference, siRNA and / or antisense RNA.

3. The method of claim 1, wherein the inhibition or reduction of FATP2 activity comprises the use of an active substance that binds to the FATP2 protein.

4. Method according to any one of claims 1 to 3, wherein said T-cell is a synovial T-cell.

5. Method for identifying an active substance that binds to the FATP2 protein of a T cell, or a fragment thereof, and / or inhibits or reduces the activity of the FATP2 protein of a T cell, or a fragment thereof.

6. The method of claim 5, comprising at least the following steps: (i) Providing the FATP2 protein or a fragment thereof, (ii) Addition of at least one active substance to be investigated for binding to the FATP2 protein or a fragment thereof, and (iii) Identification of the at least one active substance that has bound to the FATP2 protein or a fragment thereof. A method according to any one of claims 5 and 6, wherein the active ingredient is a FATP2 inhibitor. A method according to any one of claims 5 to 7, wherein the active ingredient is a member of a library of compounds. A method according to any one of claims 5 to 8, wherein the active ingredient is selected from the group consisting of a small molecule, a peptide, and a biologic. A method according to claim 9, wherein the biologic is an antibody, an antigen-binding fragment thereof, an antigen-binding derivative thereof, an antibody-like molecule, or an aptamer. A method according to any one of claims 5 to 10, wherein the FATP2 protein is bound to a solid phase or is in solution. Use of a nucleic acid encoding the FATP2 protein or a fragment thereof, or of the FATP2 protein or a fragment thereof, in a method for identifying an active ingredient that binds to the FATP2 protein or a fragment thereof, according to any one of claims 5 to 11.Active ingredient obtained by the method according to any one of claims 5 to 11. Active ingredient that inhibits or reduces the expression of the SLC27A2 gene in a T cell, preferably wherein the T cell is a synovial T cell. Active ingredient that binds to the FATP2 protein or a fragment thereof in a T cell, and / or inhibits or reduces the activity of the FATP2 protein, or a fragment thereof, and / or promotes the degradation of the FATP2 protein. Active ingredient according to any one of claims 13 to 15, wherein the active ingredient is a small molecule, a peptide, or a biologic, preferably wherein the biologic is an antibody or a A fragment thereof, a derivative thereof, an antibody-like protein, or an aptamer. An antibody, or an antigen-binding fragment or an antigen-binding derivative thereof, or an antibody-like protein that specifically binds to the FATP2 protein in a T cell. An antibody, or an antigen-binding fragment or an antigen-binding derivative thereof, or an antibody-like protein, according to claim 17, wherein the antibody, or the antigen-binding fragment or derivative thereof, or the antibody-like protein inhibits FATP2 activity. An active ingredient according to any one of claims 13 to 16, or an antibody, an antigen-binding fragment or an antigen-binding derivative thereof, or an antibody-like protein, according to any one of claims 17 and 18, for use in the treatment of an autoimmune disease.Active ingredient or antibody, antigen-binding fragment or antigen-binding derivative thereof, or antibody-like protein, for use according to claim 19, wherein said autoimmune disease is selected from the group consisting of rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement. Use of an active ingredient that binds to the FATP2 protein in a method for treating an autoimmune disease, wherein said autoimmune disease is preferably selected from the group consisting of rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement.Use of an active substance that binds to the FATP2 protein for the manufacture of a drug for the treatment of an autoimmune disease, wherein said. The autoimmune disease is preferably selected from the group consisting of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement. Use of an active ingredient according to one of claims 21 and 22, wherein the active ingredient, when bound to FATP2, inhibits FATP2 activity. A method for treating or preventing an autoimmune disease, wherein the method comprises administering an active ingredient that binds to and / or inhibits the FATP2 protein in a therapeutically effective dose to a human or animal subject. A method for producing an active ingredient according to a method according to one of claims 5 to 11, further comprising purifying the active ingredient.A pharmaceutical composition comprising the active ingredient according to any one of claims 13 to 16 or the antibody, the antigen-binding fragment or antigen-binding derivative thereof, or an antibody-like protein according to any one of claims 17 and 18, and one or more pharmaceutically acceptable excipients, for use in the treatment of an autoimmune disease, preferably wherein said autoimmune disease is selected from the group consisting of rheumatism, rheumatoid arthritis, juvenile idiopathic arthritis, chronic inflammatory bowel diseases including ulcerative colitis and Crohn's disease, multiple sclerosis, and other autoimmune diseases with T-cell involvement.Pharmaceutical composition according to claim 26, wherein the excipients are selected from the group consisting of pharmaceutically acceptable buffers, surfactants, diluents, carriers, excipients, fillers, binders, lubricants, lubricating agents, disinfectants, adsorbents and / or preservatives. Method for the manufacture of a pharmaceutical composition, comprising (i) the method according to any one of claims 5 to 11, and furthermore (ii) the mixing of the identified active ingredient with a pharmaceutically acceptable carrier. Composition comprising a combination of (i) the active substance that binds to the FATP2 protein in a T cell according to any one of claims 13 to 16, the antibody or antigen-binding fragment or antigen-binding derivative thereof or the antibody-like protein according to any one of claims 17 and 18, or the pharmaceutical composition according to any one of claims 26 and 27, and (ii) one or more other therapeutically active compounds. Therapeutic kit comprising: (i) the pharmaceutical composition according to any one of claims 26, 27 or 29, (ii) a device for administering the composition, and (iii) optionally, instructions for use.

Images