PAPD5 inhibitors and methods of use thereof
Patent Information
- Application Number
- JP2024525486
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-29
- Filing Date
- 2022-10-28
- Publication Date
- 2025-11-06
AI Technical Summary
There is an unmet clinical need for effective treatments for diseases caused by short telomeres, such as aplastic anemia, pulmonary fibrosis, and liver cirrhosis, as current therapies are limited, and telomere length is a critical determinant of cellular self-renewal and human health.
Development of compounds that inhibit PAPD5, a non-canonical poly(A) polymerase, to restore telomere elongation by modulating the 3' end maturation of TERC, thereby enhancing telomerase activity in cells with PARN mutations.
The PAPD5 inhibitors effectively restore telomere length and telomerase activity, potentially treating conditions associated with telomere dysfunction, age-related disorders, and viral diseases like HBV and CMV infections, as well as modulating stem cell proliferation.
Smart Images

Figure 2023086220000001 
Figure 2023086220000002 
Figure 2023086220000003
Abstract
Description
[Technical Field]
[0001] Priority claim This application claims priority to U.S. Provisional Patent Application No. 63 / 273,871, filed October 29, 2021, the entire contents of which are incorporated herein by reference.
[0002] Federally funded research and development This invention was made with government support under Grant Nos. DK107716, HL119145, and HL154133 awarded by the National Institutes of Health; and Grant No. W81XWH-19-1-0572 awarded by the U.S. Department of Energy. The government has certain rights in this invention.
[0003] The present disclosure relates to compounds that inhibit PAP Associated Domain Containing 5 (PAPD5) and methods of using these compounds to treat conditions such as telomere diseases, viral diseases, and age-related and other degenerative disorders. [Background technology]
[0004] Telomeres are regions of repeated nucleotide sequences at each end of chromosomes that protect the ends of chromosomes from degradation or fusion with adjacent chromosomes. Telomere length is an important determinant of a cell's ability to self-renew. The telomerase ribonucleoprotein maintains telomere length in tissue stem cells, and its function is important for human health and longevity.
[0005] Short telomeres, due to genetic or acquired insults, cause a loss of cellular self-renewal, resulting in life-threatening diseases for which there are few, if any, effective drug therapies. These diseases associated with short telomeres, such as aplastic anemia, pulmonary fibrosis, liver cirrhosis, and bone marrow failure, present an unmet clinical need for new therapies. Summary of the Invention
[0006] Poly(A) ribonuclease (PARN) mutations can lead to the accumulation of 3' oligoadenylated forms of nascent telomerase RNA component (TERC) RNA transcripts, which become targets for destruction, thus causing telomerase deficiency and telomere disease. Disruption of non-canonical poly(A) polymerase PAP-associated domain-containing 5 (PAPD5; also known as topoisomerase-related function protein 4-2 (TRF4-2)) can restore TERC levels, telomerase activity, and telomere elongation in PARN mutant patient cells. The present disclosure relates, at least in part, to PAPD5 inhibitors and methods of using such inhibitors.
[0007] In some embodiments, the present disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof.
[0008] In some embodiments, the present disclosure provides a compound of formula (II): [ka] or a pharmaceutically acceptable salt thereof.
[0009] In some embodiments, the present disclosure provides a compound of formula (III): [ka] or a pharmaceutically acceptable salt thereof.
[0010] In some embodiments, the present disclosure provides a compound of formula (IV): [ka] or a pharmaceutically acceptable salt thereof.
[0011] In some embodiments, the present disclosure provides a compound of formula (V): [ka] or a pharmaceutically acceptable salt thereof.
[0012] In some embodiments, the present disclosure provides a compound of formula (VI): [ka] or a pharmaceutically acceptable salt thereof.
[0013] In some embodiments, the present disclosure provides a compound of formula (VII): [ka] or a pharmaceutically acceptable salt thereof.
[0014] In some embodiments, the present disclosure provides a compound of formula (VIII): [ka] or a pharmaceutically acceptable salt thereof.
[0015] In some embodiments, the present disclosure provides a compound of formula (IX): [ka] or a pharmaceutically acceptable salt thereof.
[0016] In some embodiments, the present disclosure provides a compound of formula (X): [ka] or a pharmaceutically acceptable salt thereof.
[0017] In some embodiments, the present disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof.
[0018] In some embodiments, the present disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof.
[0019] In some embodiments, the present disclosure provides a compound of formula (XIII): [ka] or a pharmaceutically acceptable salt thereof.
[0020] In some embodiments, the present disclosure provides a compound of formula (XIV): [ka] or a pharmaceutically acceptable salt thereof.
[0021] In some embodiments, the present disclosure provides a compound of formula (XV): [ka] or a pharmaceutically acceptable salt thereof.
[0022] In some embodiments, the present disclosure provides a compound of formula (XVI): [ka] or a pharmaceutically acceptable salt thereof.
[0023] In some embodiments, the present disclosure provides a compound of formula (XVII): [ka] or a pharmaceutically acceptable salt thereof.
[0024] In some embodiments, the present disclosure provides a compound of formula (XVIII): [ka] or a pharmaceutically acceptable salt thereof.
[0025] In yet another general aspect, the disclosure provides a pharmaceutical composition comprising a compound of any one of the formulae described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0026] In yet another general aspect, the present disclosure provides a method for manufacturing a method of a medical device, comprising: (a) treating a disorder associated with telomere or telomerase dysfunction in a subject; (b) treating an age-related disorder in a subject; (c) treating a preleukemic or precancerous condition in a subject; (d) treating or preventing HBV infection in a subject; (e) treating or preventing a neurodevelopmental disorder in a subject; (f) treating an acquired or inherited disease or condition associated with an alteration in RNA in a subject; (g) reducing PAPD5 activity in a subject; (h) inhibiting the production or secretion of HBsAg in a subject; (i) inhibiting the production of HBV DNA in a subject (j) reducing PAPD5 activity in cells; (k) inhibiting the production or secretion of HBsAg in cells; (l) inhibiting the production of HBV DNA in cells; (m) regulating non-coding RNAs in cells; (n) modulating the ex vivo proliferation of stem cells; (o) treating or preventing HAV infection in a subject; and (p) treating or preventing CMV infection in a subject; providing a method selected from The method includes contacting a cell with an effective amount of a compound of any one of the formulas described herein or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same, or administering to a subject in need thereof a therapeutically effective amount of a compound of any one of the formulas described herein or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same.
[0027] In yet another general aspect, the disclosure provides a method of growing cells, comprising culturing the cells in the presence of an effective amount of a compound of any one of the formulae described herein, or a pharmaceutically acceptable salt thereof.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Methods and materials for use in this application are described herein. Other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0029] Other features and advantages of the present application will become apparent from the following detailed description and drawings, and from the claims. [Brief explanation of the drawings]
[0030] [Figure 1] FIG. 1 is a schematic diagram showing an exemplary model of TERC 3′-end maturation by PARN. [Figure 2] FIG. 1 is a schematic diagram showing an exemplary model of the reciprocal regulation of TERC maturation by PARN and PAPD5. [Figure 3] 1 shows the results of TERC 3′ end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 295A, 302A, 301A, and 300A. [Figure 4] 1 shows the results of TERC 3′ end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 266A, 267A, 269A, and 270A. [Figure 5] TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 129A and 130A. [Figure 6] 1 shows the results of a TERC 3'RLM RACE experiment (patient iPSCs) for exemplified compounds 266A, 295A and 296A compared to DMSO and / or compound RG7834. [Figure 7]
[0023] Figure 1 shows the results of an RNA oligoadenylation assay for compounds 266A and 80A. The exemplified compounds show improved potency compared to Cmpd.1 and RG7834. The chemical structure of RG7834 is also shown. [Figure 8] TERC 3′ end processing—rapid amplification of cDNA ends (RACE)—and maturation with 266A in the low nM range in DC patient iPSCs. [Figure 9] Figure 1 shows telomere elongation in patient iPSCs by 266A at 10 nM. [Figure 10] Figure 1 shows telomere elongation in patient iPSCs by 295A and 296A at 1 nM. [Figure 11] TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 109A, 129A, 130A, 185A, 204A-INT, 211A, 233A, 204A, 205A-INT, 209A, and 226A. [Figure 12] TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 266A, 267A, 269A, 270A, 295A, 297A, 299A, 296A, 307A, 303A, 302A, 301A, 200A, 298A, 308A, 306A, 305A, 304A, 341A. [Figure 13] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 130A and 131A. [Figure 14] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 129A, 132A, and 133A. [Figure 15] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 184A, 205A-INT, and 209A. [Figure 16] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 212A, 216A, 221A, 226A, 231A. [Figure 17] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 185A, 188A, 191A, and 204A-INT. [Figure 18] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 211A and 233A. [Figure 19] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 205A and 204A. [Figure 20] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 266A, 269A, 205A-INT, and 267A. [Figure 21] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compound 270A. [Figure 22]Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 299A, 296A, 298A, 304A, and 306A. [Figure 23] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 208A, 300A, 301A, 302A, 303A, 305A, 308A. [Figure 24] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for the exemplified compound 307A. [Figure 25] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 296A, 297A, 341A, 342A, and 344A. [Figure 26] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for the exemplified compound 295A. [Figure 27] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 121A, 123A, and 123A-CBZ. [Figure 28] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 134A, 138A, 142A, and 129A. [Figure 29] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 87A-Cl, 135A, 136A, 137A, and 144A. [Figure 30] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 145A and 146A-Cl. [Figure 31] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 139A and 140A. [Figure 32] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 127A and 135A-BP. [Figure 33]1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 220A and 232A. [Figure 34] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 275A, 276A, 277A, 278A, and 279A. [Figure 35] Figure 1 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 296A, 297A, 344A, 353A, 354A, 349A, 391A, 392A, 393A, 404A, 361A, 367A, 371A, 339A, 340A, 343A, 394A, and 430A tested at 1 nM in PARN mutant iPSCs at day 4. [Figure 36] Terminal restriction fragment (TRF) telomere length measurements (Southern blot) are shown for exemplary compounds 296A, 297A, 344A, 353A, 354A, 349A, 391A, 392A, 393A, 404A, 361A, 367A, 371A, 339A, 340A, and 343A tested at 1 nM in PARN mutant iPSCs at day 4. [Figure 37] TERC 3′ end processing-rapid amplification of cDNA ends (RACE) of exemplified compounds 296A, 349A, 399A, 411A, 416A, 417A, 418A, 420A, 421A, 422A, 423A, 428A, 396A, 413A, 414A, and 419A tested at 1 nM in PARN mutant iPSCs at day 4. [Figure 38] Terminal restriction fragment (TRF) telomere length measurements (Southern blot) are shown for exemplary compounds 296A, 349A, 399A, 411A, 416A, 417A, 418A, 420A, 421A, 422A, 423A, 428A, 396A, 413A, 414A, and 419A tested at 1 nM in PARN mutant iPSCs at day 4. [Figure 39A] 1 contains a synthetic scheme showing the synthesis of compound 296A. [Figure 39B] 1 contains a synthetic scheme showing the synthesis of compound 339A. [Figure 39C] 1 contains a synthetic scheme showing the synthesis of compound 340A. [Figure 39D] 1 contains a synthetic scheme showing the synthesis of compound 343A. [Figure 39E] 1 contains a synthetic scheme showing the synthesis of compound 349A. [Figure 39F] 1 contains a synthetic scheme showing the synthesis of compound 357A. [Figure 39G] 1 contains a synthetic scheme showing the synthesis of compound 362A. [Figure 39H] 1 contains a synthetic scheme showing the synthesis of compound 371A. [Figure 39I] 1 contains a synthetic scheme showing the synthesis of compound 373A. [Figure 39J] 1 contains a synthetic scheme showing the synthesis of compound 394A. [Figure 39K] 1 contains a synthetic scheme showing the synthesis of compound 396A. [Figure 39L] 1 contains a synthetic scheme showing the synthesis of compound 400A. [Figure 39M] 1 contains a synthetic scheme showing the synthesis of compound 404A. [Figure 39N] 1 contains a synthetic scheme showing the synthesis of compound 404A. [Figure 39O] 1 contains a synthetic scheme showing the synthesis of compound 411A. [Figure 39P] 1 contains a synthetic scheme showing the synthesis of compound 413A. [Figure 39Q] 1 contains a synthetic scheme showing the synthesis of compound 415A. [Figure 39R] 1 contains a synthetic scheme showing the synthesis of compound 416A. [Figure 39S] 1 contains a synthetic scheme showing the synthesis of compound 417A. [Figure 39T] 1 contains a synthetic scheme showing the synthesis of compound 418A. [Figure 39U] 1 contains a synthetic scheme showing the synthesis of compound 419A. [Figure 39V]1 contains a synthetic scheme showing the synthesis of compound 420A. [Figure 39W] 1 contains a synthetic scheme showing the synthesis of compound 421A. [Figure 39X] 1 contains a synthetic scheme showing the synthesis of compound 422A. [Figure 39Y] 1 contains a synthetic scheme showing the synthesis of compound 430A. [Figure 40A] Figure 1 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 296A, 339A, 340A, 371A, 392A, 417A, 420A, 421A, 428A, and 396A tested at 1 μM in CRISPR / Cas9 genetically modified primary human hematopoietic stem and progenitor cells on day 5. [Figure 40B] Figure 1 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 296A, 392A, 396A, 339A, 340A, 371A, 393A, and 404A tested at 100 nM in CRISPR / Cas9 genetically modified primary human hematopoietic stem and progenitor cells on day 5. [Figure 41A] This figure shows maturation of the TERC 3' end in human CD19+ cells recovered from mice xenografted with HSPCs, administered 11 doses of the exemplary compound 296A at 32 mg / kg / dose twice daily, concomitantly with 250 μM 296A in drinking water. Next-generation sequencing of RACE amplicons and analysis of oligoadenylation using a bioinformatics pipeline demonstrated that oral administration of the exemplary compound 296A significantly reversed aberrant TERC oligoadenylation in xenografted PARN-deficient human blood cells in vivo. Engraftment analysis showed no change in the engraftment of CD45+, CD19+, or CD34+ human blood cells after treatment with the exemplary compound 296A. [Figure 41B]This figure shows maturation of the TERC 3' end in human CD19+ cells recovered from xenografted mice with HSPCs treated with the exemplary compound 344A, administered at 32 mg / kg / dose every other day for 4 days. Next-generation sequencing of RACE amplicons and analysis of oligoadenylation using a bioinformatics pipeline demonstrated that aberrant TERC oligoadenylation in xenografted PARN-deficient human blood cells was significantly reversed in vivo by oral administration of the exemplary compound 344A. Engraftment analysis showed no change in the engraftment of CD45+, CD19+, or CD34+ human blood cells after treatment with the exemplary compound 344A. [Figure 41C] Figure 1 shows maturation of the TERC 3' end in human CD19+ cells recovered from HSPC xenografted mice for exemplified compound 339A administered at 1 mM in drinking water for 7 days. Engraftment analysis shows no change in engraftment of CD45+, CD19+, or CD34+ human blood cells after treatment with exemplified compound 339A. [Figure 41D] Figure 1 shows maturation of the TERC 3' end in human CD19+ cells recovered from HSPC xenografted mice for exemplary compounds 297A or 392A administered at 32 mg / kg / dose twice daily for 11 doses. Engraftment analysis shows no change in engraftment of CD45+, CD19+, or CD34+ human blood cells after treatment with exemplary compounds 297A or 392A. [Figure 42] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 339A, 343A, and 345A. [Figure 43] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 346A, 340A, and 349A. [Figure 44] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 391A, 367A, 362A, 361A, 368A, and 354A. [Figure 45]1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 372A, 353A, 395A, and 373A. [Figure 46] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 401A, 355A, 376A, and 399A. [Figure 47] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 357A, 359A, 371A, 392A, 402A, and 403A. [Figure 48] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 393A, 404A, 417A, 422A, 425A, 427A, and 429A. [Figure 49] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 420A, 421A, 423A, and 426A. [Figure 50] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 349A, 417A, 418A, 420A, 422A, 423A, and 428A. [Figure 51] Contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 396A, 413A, 414A, and 419A. [Figure 52] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 400A, 415A, 411A, and 416A. [Figure 53] 1 contains the results of an RNA oligoadenylation assay (rPAPD5) for exemplified compounds 394A and 430A. DETAILED DESCRIPTION OF THE INVENTION
[0031] Telomeres are regions of repeated nucleotide sequences at each end of chromosomes. In vertebrates, the nucleotide sequence of telomeres is TTAGGG. In humans, this TTAGGG sequence is repeated approximately hundreds to thousands of times. Telomerase is a ribonucleoprotein that adds telomeric repeat sequences to the 3' end of telomeres. Cells with telomerase dysfunction often have limited self-renewal capacity, i.e., an abnormal condition or symptom characterized by the inability of cells (e.g., stem cells) to divide efficiently. This deficiency in cells can result, for example, in various diseases and disorders.
[0032] The telomerase RNA component (TERC) serves at least two functions: (1) it encodes the template sequence used by telomerase reverse transcriptase (TERT) to add hexanucleotide repeats to telomeres, and (2) it is a core scaffold for multiple proteins that target telomerase to Cajal bodies where telomeres are elongated.
[0033] The present disclosure provides compounds and methods for modulating TERC levels, for example, by using compounds that target TERC or that modulate the levels or activity of PAP-associated domain-containing 5 (PAPD5) and / or poly(A)-specific ribonuclease (PARN), both of which are involved in the 3'-end maturation of TERC. Various embodiments of these compounds and methods are described herein.
[0034] therapeutic compounds In some embodiments, the present disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres (bioisosteres); R 8 is H and C 1-6 alkyl; R 3 is a halo; and R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0035] In some embodiments, X 1 is O.
[0036] In some embodiments, X 1 is S.
[0037] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0038] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0039] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0040] In some embodiments, W is a carboxylic acid bioisostere.
[0041] In some embodiments, the carboxylic acid bioisostere is selected from a moiety of any one of the following formulas: [ka]
[0042] In some embodiments, the compound of formula (I) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0043] In some embodiments, the compound of formula (I) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0044] In some embodiments, R 3 is selected from Cl, Br and F.
[0045] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0046] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0047] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0048] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0049] In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Br and R7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R 7 is C 1-3 It is an alkoxy.
[0050] In some embodiments, the compound of Formula (I) is selected from any one of the following compounds: [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] or a pharmaceutically acceptable salt thereof.
[0051] In some embodiments, the present disclosure provides a compound of formula (II): [ka] or a pharmaceutically acceptable salt thereof, wherein: R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; R 6 is a 5-membered heteroaryl selected from the group consisting of: [ka] R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0052] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0053] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0054] In some embodiments, W is C(O)OR 8 In some embodiments, R 8is C 1-6 In some embodiments, W is C(O)OH.
[0055] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0056] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0057] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0058] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0059] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0060] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0061] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0062] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0063] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0064] In some embodiments, the compound of formula (II) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0065] In some embodiments, R 3 is selected from Cl, Br, and F. In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3is F. In some embodiments, R 7 is a halo.
[0066] In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0067] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0068] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0069] In some embodiments, R 3 is Cl and R 7 is Cl.
[0070] In some embodiments, the compound of Formula (II) is selected from any one of the following compounds: [Table 2-1] [Table 2-2] or a pharmaceutically acceptable salt thereof.
[0071] In some embodiments, the present disclosure provides a compound of formula (III): [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; R 3 is C 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkylcarbonyl, CN, Halo, C 1-6 Alkoxy, C 1-6 Alkoxy-C 1-6 Alkyl, NO2, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, C 3-10 Cycloalkyl, 4-6 membered heterocycloalkyl, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, carboxy and C 1-6 is a 5-membered heteroaryl optionally substituted with 1, 2, or 3 substituents independently selected from alkoxycarbonyl; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 Alkoxy is selected from:
[0072] In some embodiments, X 1 is O.
[0073] In some embodiments, X 1 is S.
[0074] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0075] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0076] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0077] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0078] In some embodiments, the compound of formula (III) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0079] In some embodiments, R3 is C 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkylcarbonyl, CN, Halo, C 1-6 Alkoxy, 4-6 membered heterocycloalkyl and C 1-6 Alkoxy-C 1-6 and 5-membered heteroaryl optionally substituted with 1, 2, or 3 substituents independently selected from alkyl.
[0080] In some embodiments, R 3 is C 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkylcarbonyl, CN, Halo, C 1-6 Alkoxy, 4-6 membered heterocycloalkyl (e.g., tetrahydrofuranyl) and C 1-6 Alkoxy-C 1-6 and 5-membered heteroaryl optionally substituted with 1 or 2 substituents independently selected from alkyl.
[0081] In some embodiments, R 3 The heteroaryl in is selected from thiophenyl and pyrazolyl.
[0082] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0083] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0084] In some embodiments, R 7 is C 1-3In some embodiments, R 7 is methoxy.
[0085] In some embodiments, the compound of Formula (III) is selected from any one of the following compounds: [Table 3-1] [Table 3-2] or a pharmaceutically acceptable salt thereof.
[0086] In some embodiments, the present disclosure provides a compound of formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; R 3 is selected from pyridinyl and pyrimidinyl, each of which is 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkylcarbonyl, CN, OH, halo, C 1-6 Alkoxy, C 1-6 Alkoxy-C 1-6 Alkyl, C 6-10 Aryl, C 6-10 Aryloxy, NO2, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, C 3-10Cycloalkyl, 4-6 membered heterocycloalkyl, amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, carboxy, C 1-6 Alkylsulfonyl, C 1-6 Alkoxycarbonyl, carbamyl, C 1-6 Alkylcarbamyl and di(C 1-6 optionally substituted with 1, 2, or 3 substituents independently selected from: (alkyl)carbamyl; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 alkoxy.
[0087] In some embodiments, X 1 is O.
[0088] In some embodiments, X 1 is S.
[0089] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0090] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0091] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0092] In some embodiments, W is a carboxylic acid bioisostere (e.g., any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0093] In some embodiments, the compound of formula (IV) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0094] In some embodiments, R 3 is selected from pyridinyl and pyrimidinyl, each of which is 1-6 Alkyl, C 1-4 Haloalkyl, CN, C 1-6 Alkoxy, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 4-6 membered heterocycloalkyl, amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, C 1-6 Alkyl sulfonyl and C 1-6 Optionally substituted with 1, 2, or 3 substituents independently selected from alkylcarbamyl.
[0095] In some embodiments, R 3 is C1-6 Alkyl, C 1-4 Haloalkyl, CN, C 1-6 Alkoxy, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 4-6 membered heterocycloalkyl, amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, C 1-6 Alkyl sulfonyl and C 1-6 and pyridinyl optionally substituted with 1 or 2 substituents independently selected from alkylcarbamyl.
[0096] In some embodiments, R 3 is C 1-6 Alkyl, C 1-4 Haloalkyl, CN, C 1-6 Alkoxy, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 4-6 membered heterocycloalkyl, amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, C 1-6 Alkyl sulfonyl and C 1-6 and pyrimidinyl optionally substituted with 1 or 2 substituents independently selected from alkylcarbamyl.
[0097] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0098] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0099] In some embodiments, R 7 is C1-3 In some embodiments, R 7 is methoxy.
[0100] In some embodiments, the compound of formula (IV) is selected from any one of the following compounds: [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] or a pharmaceutically acceptable salt thereof.
[0101] In some embodiments, the present disclosure provides a compound of formula (V): [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3is a 9-10 membered heteroaryl selected from the group consisting of: [ka] These are, respectively, C 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkylcarbonyl, CN, OH, halo, C 1-6 Alkoxy, C 1-6 Alkoxy-C 1-6 Alkyl, C 6-10 Aryl, C 6-10 Aryloxy, NO2, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, C 3-10 Cycloalkyl, 4-6 membered heterocycloalkyl, amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, carboxy, C 1-6 Alkylsulfonyl, C 6-10 Arylsulfonyl, C 1-6 Alkoxycarbonyl, carbamyl, C 1-6 Alkylcarbamyl and di(C 1-6 optionally substituted with 1, 2, or 3 substituents independently selected from (alkyl)carbamyl; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 Alkoxy is selected from:
[0102] In some embodiments, X 1 is O.
[0103] In some embodiments, X 1 is S.
[0104] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0105] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 In some embodiments, W is selected from C(O)OR alkyl. 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0106] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0107] In some embodiments, the compound of formula (IV) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0108] In some embodiments, R 3 is the group consisting of: [ka] is a 9- to 10-membered heteroaryl selected from Each of these is C1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0109] In some embodiments, R 3 is the expression: [ka] is a 10-membered heteroaryl group of the formula Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0110] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0111] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0112] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0113] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0114] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0115] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0116] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0117] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0118] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0119] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0120] In some embodiments, R 3 is the expression: [ka] is a 9-membered heteroaryl group of Each of these is C 1-6 Alkyl, C 1-4 Haloalkyl, Halo, C 1-6 Alkylamino and C 6-10 Optionally substituted with 1 or 2 substituents independently selected from arylsulfonyl.
[0121] In some embodiments, each R 7 independently, halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0122] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0123] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0124] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0125] In some embodiments, the compound of Formula (V) is selected from any one of the following compounds: [Table 5-1] [Table 5-2] [Table 5-3] or a pharmaceutically acceptable salt thereof.
[0126] In some embodiments, the present disclosure provides a compound of formula (VI) [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1, R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; Each R 9 independently, C 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkylcarbonyl, CN, OH, halo, C 1-6 Alkoxy, C 1-6 Alkoxy-C 1-6 Alkyl, C 6-10 Aryl, C 6-10 Aryloxy, NO2, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, C 3-10 Cycloalkyl, 4-6 membered heterocycloalkyl, 5-6 membered heteroaryl, amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, carboxy, C 1-6 Alkylsulfonyl, C 6-10 Arylsulfonyl, 5-6 membered heterocycloalkylsulfonyl, C 1-6 Alkoxycarbonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl)carbamyl, C 1-6 alkylsulfonylamino, wherein the 6-membered heterocycloalkyl and 5-6-membered heteroaryl are each selected from C 1-6 Alkyl, C 1-4 Haloalkyl, C 1-6 Alkoxy and C 1-4 optionally substituted with 1 or 2 substituents independently selected from haloalkoxy; and Each R 7 Ha, Halo, C1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 Alkoxy is selected from:
[0127] In some embodiments, X 1 is O.
[0128] In some embodiments, X 1 is S.
[0129] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0130] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0131] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0132] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0133] In some embodiments, the compound of formula (VI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0134] In some embodiments, R 9 is a 5- to 6-membered heteroaryl, di(C 1-6 alkyl)amino, carboxy, 5-6 membered heterocycloalkylsulfonyl, di(C 1-6 Alkyl)carbamyl and C 1-6 alkylsulfonylamino, wherein the 5- to 6-membered heteroaryl is selected from C 1-6 Optionally substituted with alkyl.
[0135] In some embodiments, R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0136] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0137] In some embodiments, R 7 is C 1-3In some embodiments, R 7 is methoxy.
[0138] In some embodiments, the compound of formula (VI) is selected from any one of the following compounds: [Table 6-1] [Table 6-2] [Table 6-3] or a pharmaceutically acceptable salt thereof.
[0139] In some embodiments, the present disclosure provides a compound of formula (VII): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 6 is a 5- to 6-membered heterocycloalkyl, C 4-6 cycloalkyl and 5-6 membered heteroaryl, each of which is selected from NO, CN, halo, C 1-3 Alkyl, C 1-4Haloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, Amino, C 1-3 Alkylamino, di(C 1-3 Alkyl)amino, carboxy, C 1-6 Alkylcarbonyl and C 1-6 optionally substituted with 1 or 2 substituents independently selected from alkoxycarbonyl; R 3 is a halo; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 alkoxy.
[0140] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0141] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0142] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6In some embodiments, W is C(O)OH.
[0143] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0144] In some embodiments, the compound of formula (VII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0145] In some embodiments, R 3 is selected from Cl, Br and F.
[0146] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0147] In some embodiments, R 6 is selected from tetrahydropyranyl, cyclohexyl, piperidinyl, and 1,1-dioxotetrahydro-2H-thiopyranyl, pyrimidinyl, oxazolyl, thiooxazolyl, and thiazolyl, which are each selected from NO, CN, halo, C 1-3 Alkyl, C 1-4 Haloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, Amino, C 1-3 Alkylamino, di(C 1-3 Alkyl)amino, carboxy, C 1-6 Alkylcarbonyl, and C 1-6 Optionally substituted with 1 or 2 substituents independently selected from alkoxycarbonyl.
[0148] In some embodiments, R 6 is selected from tetrahydropyranyl, cyclohexyl, piperidinyl, and 1,1-dioxotetrahydro-2H-thiopyranyl, pyrimidinyl, oxazolyl, thiooxazolyl, 1,3,4-oxadiazolyl, and thiazolyl, each of which is optionally substituted with halo.
[0149] In some embodiments, R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0150] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0151] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0152] In some embodiments, the compound of formula (VII) is selected from any one of the following compounds: [Table 7-1] [Table 7-2] or a pharmaceutically acceptable salt thereof.
[0153] In some embodiments, the present disclosure provides a compound of formula (VIII): [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O, S, CF2, C=O, CHCl, CHF, CCl2, C=N—OH, NH, NCH3, Si(OH)2, SO2, and cyclopropylidene; each [ka] are independently a single bond or a double bond, with the proviso that [ka] provided that not more than two of the are double bonds; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 alkoxy.
[0154] In some embodiments, X 1is selected from O, S, CF2, CHCl, CCl2, NH, NCH3, Si(OH)2, SO2, and cyclopropylidene.
[0155] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0156] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0157] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0158] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0159] In some embodiments, X 1 is O. In some embodiments, X 1 is S. In some embodiments, X 1 is CF2. In some embodiments, X1 is CHCl. In some embodiments, X 1 is CCl. In some embodiments, X 1 is NH. In some embodiments, X 1 is NCH3. In some embodiments, X 1 is Si(OH). In some embodiments, X 1 is SO. In some embodiments, X 1 is cyclopropylidene. In some embodiments, X 1 is C=O. In some embodiments, X 1 is CHF. In some embodiments, X 1 is C=N—OH.
[0160] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0161] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0162] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0163] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0164] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0165] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0166] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0167] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0168] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0169] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0170] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0171] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0172] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0173] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0174] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0175] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0176] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0177] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0178] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0179] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0180] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0181] In some embodiments, the compound of formula (VIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0182] In some embodiments, R 3 is selected from Cl, Br, and F. In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0183] In some embodiments, R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0184] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0185] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0186] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0187] In some embodiments, the compound of Formula (VIII) is selected from any one of the following compounds: [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7] [Table 8-8] [Table 8-9] [Table 8-10] [Table 8-11] [Table 8-12] [Table 8-13] [Table 8-14] [Table 8-15] [Table 8-16] [Table 8-17] or a pharmaceutically acceptable salt thereof.
[0188] In some embodiments, the present disclosure provides a compound of formula (IX): [ka] or a pharmaceutically acceptable salt thereof, wherein: R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6alkyl; R 6 is a 5-membered heterocycloalkyl; R 3 is a halo; and R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0189] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0190] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0191] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0192] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0193] In some embodiments, the compound of formula (IX) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0194] In some embodiments, R 3 is selected from Cl, Br, and F. In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0195] In some embodiments, R 6 is selected from tetrahydropyranyl and pyrrolidinyl.
[0196] In some embodiments, R 6 is tetrahydropyranyl.
[0197] In some embodiments, R 6 is pyrrolidinyl.
[0198] In some embodiments, R 7 is a halo.
[0199] In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0200] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl. In some embodiments, R 7 is C 1-3In some embodiments, R 7 is methoxy. In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R 7 is C 1-3 It is an alkoxy.
[0201] In some embodiments, the compound of Formula (IX) is selected from any one of the following compounds: [Table 9-1] [Table 9-2] [Table 9-3] or a pharmaceutically acceptable salt thereof.
[0202] In some embodiments, the present disclosure provides a compound of formula (X): [ka] or a pharmaceutically acceptable salt thereof, wherein: R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 6 is a 6-membered heteroaryl; R 3 is a halo; and R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0203] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2, R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0204] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0205] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0206] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0207] In some embodiments, the compound of formula (X) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0208] In some embodiments, R 6 is selected from pyridinyl, triazinyl and pyridazinyl.
[0209] In some embodiments, the compound of formula (X) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0210] In some embodiments, the compound of formula (X) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0211] In some embodiments, the compound of formula (X) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0212] In some embodiments, the compound of formula (X) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0213] In some embodiments, R 3 is selected from Cl, Br, and F. In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0214] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0215] In some embodiments, R 7 is C 1-3In some embodiments, R 7 is methyl.
[0216] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0217] In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R 7 is C 1-3 It is an alkoxy.
[0218] In some embodiments, the compound of Formula (X) is selected from any one of the following compounds: [Table 10-1] [Table 10-2] [Table 10-3] or a pharmaceutically acceptable salt thereof.
[0219] In some embodiments, the present disclosure provides a compound of formula (XI): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a 5- to 6-membered heterocycloalkyl, C 4-6 cycloalkyl and 5- to 9-membered heteroaryl, each of which is selected from NO, CN, halo, C 1-3 Alkyl, C 1-4 Haloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, Amino, C1-3 Alkylamino, di(C 1-3 Alkyl)amino, carboxy, C 1-6 Alkylcarbonyl and C 1-6 optionally substituted with 1 or 2 substituents independently selected from alkoxycarbonyl; and R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0220] In some embodiments, X 1 is O.
[0221] In some embodiments, X 1 is S.
[0222] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0223] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0224] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6In some embodiments, W is C(O)OH.
[0225] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0226] In some embodiments, the compound of formula (XI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0227] In some embodiments, R 3 is selected from tetrahydropyranyl, cyclohexyl, piperidinyl, 1,1-dioxotetrahydro-2H-thiopyranyl, pyridinyl, pyrimidinyl, oxazolyl, thiooxazolyl, thiazolyl, and benzimidazolyl, which are each selected from NO, CN, halo, C 1-3 Alkyl, C 1-4 Haloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, Amino, C 1-3 Alkylamino, di(C 1-3 Alkyl)amino, carboxy, C 1-6 Alkylcarbonyl, and C 1-6 Optionally substituted with 1 or 2 substituents independently selected from alkoxycarbonyl.
[0228] In some embodiments, R 3 is selected from tetrahydropyranyl, cyclohexyl, piperidinyl, pyridinyl, oxazolyl, and benzimidazolyl, each of which is optionally substituted with halo.
[0229] In some embodiments, R 7 is halo. In some embodiments, R 7is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0230] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0231] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0232] In some embodiments, the compound of formula (XI) is selected from any one of the following compounds: [Table 11-1] [Table 11-2] or a pharmaceutically acceptable salt thereof.
[0233] In some embodiments, the present disclosure provides a compound of formula (XII): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 6 is a 5- to 6-membered heterocycloalkyl, C 4-6 Cycloalkyl, C 6-10 aryl and 5- to 6-membered heteroaryl, each of which is selected from NO, CN, halo, C 1-3 Alkyl, C 1-4 Haloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, Amino, C 1-3 Alkylamino, di(C 1-3 Alkyl)amino, carboxy, C 1-6 Alkylcarbonyl and C 1-6 optionally substituted with 1 or 2 substituents independently selected from alkoxycarbonyl; R 3 is a halo; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 alkoxy.
[0234] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0235] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0236] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0237] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0238] In some embodiments, the compound of formula (XII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0239] In some embodiments, R 3 is selected from Cl, Br and F.
[0240] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0241] In some embodiments, R 6 is selected from tetrahydropyranyl, cyclohexyl, piperidinyl, pyridinyl, phenyl, oxadiazolyl, tetrazolyl, pyrimidinyl, oxazolyl, thiooxazolyl, and thiazolyl, each of which is selected from NO, CN, halo, C 1-3Alkyl, C 1-4 Haloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, Amino, C 1-3 Alkylamino, di(C 1-3 Alkyl)amino, carboxy, C 1-6 Alkylcarbonyl, and C 1-6 Optionally substituted with 1 or 2 substituents independently selected from alkoxycarbonyl.
[0242] In some embodiments, R 6 is selected from tetrahydropyranyl, cyclohexyl, piperidinyl, pyridinyl, phenyl, oxadiazolyl, and tetrazolyl, each of which is selected from halo or C 1-3 Optionally substituted with alkyl.
[0243] In some embodiments, R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0244] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0245] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0246] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0247] In some embodiments, the compound of Formula (XII) is selected from any one of the following compounds: [Table 12-1] [Table 12-2] [Table 12-3] [Table 12-4] or a pharmaceutically acceptable salt thereof.
[0248] In some embodiments, the present disclosure provides a compound of formula (XIII): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O, S, and SO2; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; R 7 C=O(OH), halo, B(OH)2, OH, CN, C1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C 1-3 Alkylcarbonyl, carbamyl, and C 1-3 alkoxy; and R 7 ' and R 7 '' are each independently H, halo, CN, C 1-3 Alkyl, and C 1-3 haloalkyl.
[0249] In some embodiments, X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and R 7 Halo, B(OH)2, OH, CN, C 1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C 1-3 Alkylcarbonyl, carbamyl, and C 1-3 Alkoxy is selected from:
[0250] In some embodiments, the compound has the formula: [ka] have or or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; and R 7 Halo, B(OH)2, OH, CN, C 1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C 1-3 Alkylcarbonyl, carbamyl, and C 1-3 Alkoxy is selected from:
[0251] In some embodiments, X 1 is selected from O and S.
[0252] In some embodiments, X 1 is O.
[0253] In some embodiments, X 1 is S.
[0254] In some embodiments, X 1 is SO2.
[0255] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0256] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0257] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0258] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0259] In some embodiments, the compound of formula (XIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0260] In some embodiments, R 3 is selected from Cl, Br and F.
[0261] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0262] In some embodiments, R 7 Halo, B(OH)2, OH, CN, C 1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C1-3 Alkylcarbonyl, carbamyl, and C 1-3 Alkoxy is selected from:
[0263] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0264] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0265] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0266] In some embodiments, R 7 is B(OH). In some embodiments, R 7 is OH. In some embodiments, R 7 is CN. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is HO-C 1-3 In some embodiments, R 7 is aminosulfonyl. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is carbamyl.
[0267] In some embodiments, R 7’ H, halo, CN, C 1-3 Alkyl, and C 1-3 In some embodiments, R is selected from haloalkyl. 7’’ H, halo, CN, C 1-3 Alkyl, and C 1-3 haloalkyl.
[0268] In some embodiments, R 7’ and R 7’’ are each independently H, halo, and C 1-3 In some embodiments, R 7’ is H. In some embodiments, R 7’ is halo. In some embodiments, R 7’ is C 1-3 In some embodiments, R 7’’ is H. In some embodiments, R 7’’ is halo. In some embodiments, R 7’’ is C 1-3 It is alkyl.
[0269] In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3 is Cl and R 7 is C 1-3In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R 7 is C 1-3 It is an alkoxy.
[0270] In some embodiments, the compound of Formula (XIII) is selected from any one of the following compounds: [Table 13-1] [Table 13-2] [Table 13-3] [Table 13-4] [Table 13-5] [Table 13-6] [Table 13-7] [Table 13-8] [Table 13-9] or a pharmaceutically acceptable salt thereof.
[0271] In some embodiments, the present disclosure provides a compound of formula (XIV): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and R 7 Halo, B(OH)2, OH, CN, C 1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C 1-3 Alkylcarbonyl, carbamyl, and C 1-3 Alkoxy is selected from:
[0272] In some embodiments, X 1 is O.
[0273] In some embodiments, X 1 is S.
[0274] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0275] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0276] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0277] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0278] In some embodiments, the compound of formula (XIV) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0279] In some embodiments, R 3 is selected from Cl, Br and F.
[0280] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0281] In some embodiments, R 7 is halo, B(OH)2, OH, C 1-3 Alkyl, C 1-3 Haloalkyl and C 1-3 Alkoxy is selected from:
[0282] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0283] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0284] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0285] In some embodiments, R 7 is B(OH). In some embodiments, R 7 is OH. In some embodiments, R 7 is CN. In some embodiments, R 7 is C 1-3In some embodiments, R 7 is HO-C 1-3 In some embodiments, R 7 is aminosulfonyl. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is carbamyl.
[0286] In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R7 is C 1-3 It is an alkoxy.
[0287] In some embodiments, the compound of formula (XIV) is selected from any one of the following compounds: [Table 14-1] [Table 14-2] or a pharmaceutically acceptable salt thereof.
[0288] In some embodiments, the present disclosure provides a compound of formula (XV): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and R 7 Halo, B(OH)2, OH, CN, C 1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C1-3 Alkylcarbonyl, carbamyl, and C 1-3 Alkoxy is selected from:
[0289] In some embodiments, X 1 is O.
[0290] In some embodiments, X 1 is S.
[0291] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0292] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0293] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0294] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0295] In some embodiments, the compound of formula (XV) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0296] In some embodiments, R 3 is selected from Cl, Br and F.
[0297] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0298] In some embodiments, R 7 is halo, B(OH)2, OH, C 1-3 Alkyl, C 1-3 Haloalkyl and C 1-3 Alkoxy is selected from:
[0299] In some embodiments, R 7 Halo, OH, C 1-3 Alkyl, C 1-3 Haloalkyl and C 1-3 Alkoxy is selected from:
[0300] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0301] In some embodiments, R 7 is C 1-3 In some embodiments, R7 is methyl.
[0302] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0303] In some embodiments, R 7 is B(OH). In some embodiments, R 7 is OH. In some embodiments, R 7 is CN. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is HO-C 1-3 In some embodiments, R 7 is aminosulfonyl. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is carbamyl.
[0304] In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3is Cl and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R 7 is C 1-3 It is an alkoxy.
[0305] In some embodiments, the compound of Formula (XV) is selected from any one of the following compounds: [Table 15-1] [Table 15-2] or a pharmaceutically acceptable salt thereof.
[0306] In some embodiments, the present disclosure provides a compound of formula (XVI): [ka] or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O, S, CF2, C=O, C=N-OH, CHOH, CHCl, CHF, CH(OCF3), CCl2, NH, NCH3, Si(OH)2, SO2, and cyclopropylidene; each [ka] are independently a single bond or a double bond; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 alkoxy.
[0307] In some embodiments, X 1 is selected from O, S, CF, C=N-OH, CHCl, CCl, NH, NCH, Si(OH), SO, and cyclopropylidene.
[0308] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0309] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0310] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0311] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0312] X 1 is selected from O, S, CF2, C=N-OH, NH, NCH3 and SO2.
[0313] In some embodiments, X 1 is O. In some embodiments, X 1 is S. In some embodiments, X 1 is CF2. In some embodiments, X 1 is CHCl. In some embodiments, X 1 is CCl. In some embodiments, X 1 is NH. In some embodiments, X 1 is NCH3. In some embodiments, X 1 is Si(OH). In some embodiments, X 1 is SO. In some embodiments, X 1 is cyclopropylidene. In some embodiments, X 1 is C=N—OH. In some embodiments, X 1 is C=O. In some embodiments, X 1 is CHOH. In some embodiments, X1 is CHF. In some embodiments, X 1 is CH(OCF3).
[0314] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0315] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0316] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0317] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0318] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0319] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0320] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0321] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0322] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0323] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0324] In some embodiments, the compound of formula (XVI) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0325] In some embodiments, R 3 is selected from Cl, Br, and F. In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0326] In some embodiments, R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0327] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0328] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0329] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0330] In some embodiments, the compound of Formula (XVI) is selected from any one of the following compounds: [Table 16-1] [Table 16-2] [Table 16-3] [Table 16-4] [Table 16-5] [Table 16-6] [Table 16-7] or a pharmaceutically acceptable salt thereof.
[0331] In some embodiments, the present disclosure provides a compound of formula (XVII): [ka] or a pharmaceutically acceptable salt thereof, wherein: [ka] If is a single bond, X 1 is N or CH; [ka] If is a double bond, X 1 is C; X 2 is selected from O and S; R 1 , R 2 , R 4 and R 5 are each independently H, C1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 alkoxy.
[0332] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0333] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0334] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6In some embodiments, W is C(O)OH.
[0335] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0336] In some embodiments, X 1 is O. In some embodiments, X 1 is S.
[0337] In some embodiments, the compound of formula (XVII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0338] In some embodiments, the compound of formula (XVII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0339] In some embodiments, the compound of formula (XVII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0340] In some embodiments, the compound of formula (XVII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0341] In some embodiments, R 3 is selected from Cl, Br, and F. In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0342] In some embodiments, R 7 Ha, Halo, C 1-3 Alkyl and C 1-3 Alkoxy is selected from:
[0343] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0344] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0345] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methoxy.
[0346] In some embodiments, the compound of Formula (XVII) is selected from any one of the following compounds: [Table 17] or a pharmaceutically acceptable salt thereof.
[0347] In some embodiments, the present disclosure provides a compound of formula (XVIII): [ka] The compound or a pharmaceutically acceptable salt thereof, wherein: X 1 is selected from O and S; X 2 is selected from CH2, CHCH3, and C(CH3)2; R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy, halo, CN, and NO2; W is C(O)OR 8 and carboxylic acid bioisosteres; R 8 is H and C 1-6 alkyl; R 3 is a halo; and R 7 Halo, B(OH)2, OH, CN, C 1-3 Alkyl, C 1-3 Haloalkyl, HO-C 1-3 Haloalkyl, aminosulfonyl, C 1-3 Haloalkylcarbonyl, C 1-3 Alkylcarbonyl, carbamyl, and C 1-3 Alkoxy is selected from:
[0348] In some embodiments, X 1 is O. In some embodiments, X 1 is S. In some embodiments, X 2 is CH. In some embodiments, X 2 is CHCH3. In some embodiments, X 2 is C(CH3)2.
[0349] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 selected from haloalkoxy and halo; In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 It is selected from alkoxy and halo.
[0350] In some embodiments, R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 alkyl.
[0351] In some embodiments, W is C(O)OR 8 In some embodiments, R 8 is C 1-6 In some embodiments, W is C(O)OH.
[0352] In some embodiments, W is a carboxylic acid bioisostere (eg, any one of the carboxylic acid bioisostere groups described herein for Formula (I)).
[0353] In some embodiments, the compound of formula (XVIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0354] In some embodiments, the compound of formula (XVIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0355] In some embodiments, the compound of formula (XVIII) has the formula: [ka] have or or a pharmaceutically acceptable salt thereof.
[0356] In some embodiments, R 3 is selected from Cl, Br and F.
[0357] In some embodiments, R 3 is Cl. In some embodiments, R 3 is Br. In some embodiments, R 3 is F.
[0358] In some embodiments, R 7 is halo. In some embodiments, R 7 is selected from Cl, Br, and F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is Br. In some embodiments, R 7 is F.
[0359] In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is methyl.
[0360] In some embodiments, R 7 is C 1-3 In some embodiments, R7 is methoxy.
[0361] In some embodiments, R 7 is B(OH). In some embodiments, R 7 is OH. In some embodiments, R 7 is CN. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is HO-C 1-3 In some embodiments, R 7 is aminosulfonyl. In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is C 1-3 In some embodiments, R 7 is carbamyl.
[0362] In some embodiments, R 3 is F and R 7 is Cl. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is F and R 7 is F. In some embodiments, R 3 is F and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is Cl. In some embodiments, R 3 is Cl and R 7 is F. In some embodiments, R 3 is Cl and R 7 is C 1-3 In some embodiments, R 3 is Cl and R 7 is C 1-3In some embodiments, R 3 is Br and R 7 is Cl. In some embodiments, R 3 is Br and R 7 is C 1-3 In some embodiments, R 3 is Br and R 7 is F. In some embodiments, R 3 is Br and R 7 is C 1-3 It is an alkoxy.
[0363] In some embodiments, the compound of Formula (XVIII) is selected from any one of the following compounds: [Table 18] or a pharmaceutically acceptable salt thereof.
[0364] In some embodiments, the disclosure provides a compound selected from any one of the following compounds: [Table 19-1] [Table 19-2] [Table 19-3] [Table 19-4] [Table 19-5] [Table 19-6] or a pharmaceutically acceptable salt thereof
[0365] In some embodiments, the disclosure provides a compound selected from any one of the following compounds: [Table 20-1] [Table 20-2] [Table 20-3] or a pharmaceutically acceptable salt thereof
[0366] In some embodiments, the disclosure provides a compound selected from any one of the following compounds: [Table 21] or a pharmaceutically acceptable salt thereof
[0367] In some embodiments, the disclosure provides a compound selected from any one of the following compounds: [Table 22] or a pharmaceutically acceptable salt thereof
[0368] In some embodiments, the disclosure provides a compound selected from any one of the following compounds: [Table 23] or a pharmaceutically acceptable salt thereof.
[0369] In some embodiments, the disclosure provides a compound selected from any one of the following compounds: [Table 24] or a pharmaceutically acceptable salt thereof.
[0370] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed between an acidic group of a compound and a basic group, such as an amino functional group, or between a base of a compound and an acidic group, such as a carboxyl functional group. In some embodiments, the compound is a pharmaceutically acceptable acid addition salt. In some embodiments, acids commonly used to form pharmaceutically acceptable salts of the therapeutic compounds described herein include inorganic acids such as hydrogen bisulfide, hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, and phosphoric acid, as well as organic acids such as para-toluenesulfonic acid, salicylic acid, tartaric acid, bitartaric acid, ascorbic acid, maleic acid, besylic acid, fumaric acid, gluconic acid, glucuronic acid, formic acid, glutamic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, lactic acid, oxalic acid, para-bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid, and acetic acid, and related inorganic and organic acids. Accordingly, such pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, hydrogen phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexahydrate, and the like. Included are syn-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate, and other salts. In one embodiment, pharmaceutically acceptable acid addition salts include those formed with mineral acids such as hydrochloric acid and hydrobromic acid, and particularly those formed with organic acids such as maleic acid.
[0371] In some embodiments, bases commonly used to form pharmaceutically acceptable salts of the therapeutic compounds described herein include hydroxides of alkali metals, including sodium, potassium, and lithium; hydroxides of alkaline earth metals, such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; organic amines, such as ammonia, unsubstituted or hydroxyl-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributylamine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH-(C1-C6)-alkylamines), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids, such as arginine, lysine, and the like.
[0372] In some embodiments, the compound of Formula (I)-(IV) or a pharmaceutically acceptable salt thereof is substantially isolated.
[0373] Manufacturing method Compounds of any one of the formulas disclosed herein (including salts thereof) can be prepared using known organic synthesis techniques and can be synthesized according to any of a number of possible synthetic routes. Those skilled in the art know how to select and carry out appropriate synthetic protocols and recognize that a wide repertoire of synthetic organic reactions is available for potential use in synthesizing the compounds provided herein.
[0374] Suitable synthetic methods for starting materials, intermediates, and products can be identified by reference to the literature, including references such as: Advances in Heterocyclic Chemistry, Vols. 1-107 (Elsevier, 1963-2012); Journal of Heterocyclic Chemistry Vols. 1-49 (Journal of Heterocyclic Chemistry, 1964-2012); Carreira, et al. (Ed.) Science of Synthesis, Vols. 1-48 (2001-2010) and Knowledge Updates KU2010 / 1-4; 2011 / 1-4; 2012 / 1-2 (Thieme, 2001-2012); Katritzky, et al. (Ed.) Comprehensive Organic Functional Group Transformations, (Pergamon Press, 1996); Katritzky et al. (Ed.); Comprehensive Organic Functional Group Transformations II(Elsevier, 2 nd Edition, 2004); Katritzky et al. (Ed.), Comprehensive Heterocyclic Chemistry (Pergamon Press, 1984); Katritzky et al., Comprehensive Heterocyclic Chemistry II, (Pergamon Press, 1996); Smith et al., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 6 th Ed. (Wiley, 2007); Trost et al. (Ed.), Comprehensive Organic Synthesis (Pergamon Press, 1991).
[0375] The reactions for preparing the compounds provided herein can be carried out in a suitable solvent that can be easily selected by one skilled in the art of organic synthesis. A suitable solvent can be substantially non-reactive with the starting materials (reactants), intermediates, or products at the temperature at which the reaction is carried out, which can range, for example, from the freezing temperature of the solvent to the boiling point of the solvent. A given reaction can be carried out in one solvent or a mixture of two or more solvents. Depending on the particular reaction step, a suitable solvent for a particular reaction step can be selected by one skilled in the art.
[0376] Preparation of the compounds provided herein can involve the protection and deprotection of various chemical groups. The need for protection and deprotection, and the selection of appropriate protecting groups, can be readily determined by one skilled in the art. Protecting group chemistry is described, for example, in PGM Wuts and TW Greene, Protective Groups in Organic Synthesis, 4 th Ed., Wiley & Sons, Inc., New York (2006).
[0377] How to use Regulation of the telomerase RNA component (TERC) Telomerase has been a therapeutic target of great interest for the past 20 years due to its activity in multiple cancers. The telomerase RNA component (TERC) contains a box H / ACA domain at its 3' end, a motif that is functionally separable from the template domain and is not essential for telomerase activity in vitro. In vivo, the H / ACA motif is bound by a heterotrimer of dyskerin, NOP10, and NHP2, which stabilizes TERC, as well as TCAB1, which is responsible for localization of the telomerase complex to Cajal bodies (I-Venteicher, AS et al. A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science 323, 644-8 (2009)).Disruption of any of these interactions can also impair telomere maintenance and cause telomere disorders (Mitchell, JR, Wood, E. & Collins, K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 402, 551-5 (1999); Vulliamy, T. et al. Mutations in the telomerase component NHP2 cause the premature aging syndrome dyskeratosis congenita. Proceedings of the National Academy of Sciences of the United States of America 105, 8073-8 (2008); Walne, AJ et al. Genetic heterogeneity in autosomal recessive dyskeratosis congenita with one subtype due to mutations in the telomerase-associated protein NOP10. Human molecular genetics 16, 1619-29 (2007)). The H / ACA motif functions as a guide for the pseudouridylation of other RNAs by dyskerin (Kiss, T., Fayet-Lebaron, E. & Jady, BE Box H / ACA small ribonucleoproteins. Molecular cell 37, 597-606 (2010)).
[0378] Increasing telomerase activity may be beneficial in several degenerative and age-related disorders. Conversely, inhibiting telomerase activity would be significantly useful in the treatment of cancers and disorders in which hyperproliferative cells depend on telomerase for self-renewal.
[0379] Regulation of poly(A)-specific ribonuclease (PARN) PARN is known as a 3'-5' exoribonuclease responsible for degrading the poly(A) tail of eukaryotic mRNAs, which is the rate-limiting step in mRNA turnover (Korner, CG & Wahle, E. Poly(A) tail shortening by a mammalian poly(A)-specific 3'-exoribonuclease. The Journal of Biological Chemistry 272, 10448-56 (1997)). PARN is stimulated by the presence of the m7G cap and requires a minimal substrate of adenosine di- or trinucleotides—in other words, strictly oligo(A) rather than poly(A). PARN is a widely expressed cap-dependent poly(A) deadenylase that plays a canonical role in regulating global mRNA levels during development, with additional, more specialized functions including Dicer-independent end trimming of microRNA (miR)-451 and deadenylation of small nucleolar (sno) RNAs. PARN loss-of-function mutations are involved in idiopathic pulmonary fibrosis and dyskeratosis congenita. The present disclosure provides methods and agents for regulating the level or activity of human PARN. The nucleotide sequence of human PARN is NM_002582, and the amino acid sequence of PARN is O95453 (Table 1). Variants of the nucleotide and amino acid sequences are also shown in Table 1. [Table 25]
[0380] PAP-associated domain-containing 5 (PAPD5) PAPD5, also known as topoisomerase-related function protein 4-2 (TRF4-2), is one of seven members of a family of non-canonical poly(A) polymerases in human cells. PAPD5 has been shown to act as a polyadenylation enzyme on aberrant pre-ribosomal RNA in vivo, in a manner similar to the degradation-mediated polyadenylation by the non-canonical poly(A) polymerase Trf4p in yeast. PAPD5 is also involved in the uridylation-dependent degradation of histone mRNAs.
[0381] Both PARN and PAPD5 are involved in the 3'-end maturation of the telomerase RNA component (TERC). Patient cells, fibroblasts, and transformed fibroblasts in which PARN is disrupted (I-IPS cells) show reduced TERC levels, which can be restored by reducing PAPD5 levels or activity. Deep sequencing of the TERC RNA 3' end reveals that PARN and PAPD5 are crucial for processing the post-transcriptionally acquired oligo(A) tail that targets nuclear RNA for degradation. The decrease in TERC levels and the increase in the oligo(A) form of TERC are normalized by restoring PARN or inhibiting PAPD5. This disclosure identifies PARN and PAPD5 as key players in the regulation and biogenesis of TERC (Figure 1). Figure 1 shows that the 3' end of nascent TERC RNA undergoes PAPD5-mediated oligoadenylation, which targets the transcript for exosomal degradation. PARN counteracts the degradation pathway by removing the oligo(A) tail and / or trimming the genomically encoded bases (green) of nascent TERC to obtain the mature 3' end. Mature TERC is likely protected from further oligoadenylation and exonucleolytic processing by the dyskerin / NOP10 / NHP2 / GAR1 complex and assembles into the telomerase holoenzyme to maintain telomeres. PARN deficiency tips the balance in favor of degradation, resulting in reduced TERC levels and telomere dysfunction. Therefore, the present disclosure also provides compounds and methods for modulating the level or activity of human PAPD5. The nucleotide sequence of the human PAPD5 used is FR872509.1, and the amino acid sequence is CCB84642.1 (Table 1). Variants of the nucleotide and amino acid sequences are also listed in Table 1. The amino acid sequence of the PAPD5 used is as follows: PAPD5 (TRF4-2) (CCB84642.1) (SEQ ID NO: 1) MYRSGERLLG SHALPAEQRD FLPLETTNNN NNHHQPGAWA RRAGSSASSP PSASSSPHPS AAVPAADPAD SASGSSNKRK RDNKASTYGL NYSLLQPSGG RAAGGGRADG GGVVYSGTPW KRRNYNQGVV GLHEEISDFY EYMSPRPEEE KMRMEVVNRI ESVIKELWPS ADVQIFGSFK TGLYLPTSDI DLVVFGKWEN LPLWTLEEAL RKHKVADEDS VKVLDKATVP IIKLTDSFTE VKVDISFNVQ NGVRAADLIK DFTKKYPVLP YLVLVLKQFL LQRDLNEVFT GGIGSYSLFL MAVSFLQLHP REDACIPNTN YGVLLIEFFE LYGRHFNYLK TGIRIKDGGS YVAKDEVQKN MLDGYRPSML YIEDPLQPGN DVGRSSYGAM QVKQAFDYAY VVLSHAVSPI AKYYPNNETE SILGRIIRVT DEVATYRDWI SKQWGLKNRP EPSCNGNGVT LIVDTQQLDK CNNNLSEENE ALGKCRSKTS ESLSKHSSNS SSGPVSSSSA TQSSSSDVDS DATPCKTPKQ LLCRPSTGNR VGSQDVSLES SQAVGKMQST QTTNTSNSTN KSQHGSARLF RSSSKGFQGT TQTSHGSLMT NKQHQGKSNN QYYHGKKRKH KRDAPLSDLC R
[0382] Figure 2 illustrates the reciprocal regulation of TERC levels by PAPD5 and PARN and the potential for therapeutic manipulation of telomerase in degenerative or malignant disorders. As shown in Figure 2, PAPD5 inhibitors can inhibit PAPD5-mediated oligoadenylation, which targets nascent TERC RNA for exosomal degradation, thereby increasing TERC levels or activity. In contrast, PARN counteracts the degradation pathway by removing the oligo(A) tail and / or trimming the genomically encoded bases of nascent TERC to obtain the mature 3' end, so PARN inhibitors reduce TERC levels or activity. Furthermore, increasing PARN levels or activity can increase TERC levels or activity, and increasing PAPD5 levels or activity can reduce TERC levels or activity.
[0383] In one aspect, the present disclosure provides compounds and related methods for modulating TERC levels in cells. The cells can be, for example, primary human cells, stem cells, induced pluripotent cells, fibroblasts, etc. In some embodiments, the cells are within a subject (e.g., a human subject). Accordingly, the present disclosure provides methods for modulating TERC levels in cells in vivo. In some embodiments, the cells can be isolated from a sample obtained from a subject; for example, the cells can be derived from any part of the body, including, but not limited to, skin, blood, and bone marrow. The cells can also be cultured in vitro using routine methods using commercially available cell reagents (e.g., cell culture media). In some embodiments, the cells are obtained from a subject who has, is at risk for developing, or is suspected of having a telomere disorder. In some embodiments, the subject has no apparent symptoms.
[0384] TERC levels or activity can be determined by various means, such as determining telomere size in cells, determining TERC stability, determining RNA levels, measuring telomerase activity, and / or measuring the oligoadenylated (oligo(A)) form of TERC. TERC stability can be assessed, for example, by measuring the TERC decay rate. The oligoadenylated (oligo(A)) form of TERC can be measured, for example, using rapid amplification of cDNA ends (RACE) combined with targeted deep sequencing to detect the oligoadenylated (oligo(A)) form of TERC (e.g., the TERC 3' end). Telomere size can be measured, for example, using flow-fluorescent in-situ hybridization (Flow-FISH) technology.
[0385] In some embodiments, endogenous TERC is regulated. Such methods can include, for example, altering telomerase activity, e.g., increasing or decreasing telomerase activity. The methods can include decreasing RNA expression in cells, e.g., non-coding RNA in TERC. Telomerase activity can be regulated by regulating TERC levels, e.g., by contacting cells with a test compound known to regulate protein synthesis. The methods can include targeting post-processing activity at the endogenous TERC locus. These methods include manipulating TERC, including identifying a subject with a genetic mutation (e.g., a mutation in PARN), isolating cells (e.g., fibroblasts), and treating the cells with an agent that regulates TERC levels. The methods can also include manipulating TERC, including identifying a subject with a genetic mutation (e.g., a mutation in PARN) and treating the subject with an agent that regulates TERC levels. Subjects with genetic mutations (e.g., PARN mutations) can be identified by any diagnostic means commonly known in the art for this purpose.
[0386] The present disclosure shows that TERC levels are regulated at the post-transcriptional level. Thus, in one aspect, a method of modulating the levels or activity of TERC includes modulating the levels or activity of PARN and PAPD5.
[0387] In some embodiments, the method includes an agent that modulates the level or activity of PARN, thereby altering the level or activity of TERC. In some cases, the agent increases the level or activity of PARN. Alternatively, the agent decreases the level or activity of PARN. In some embodiments, the method includes an agent that modulates the level or activity of PAPD5, thereby altering the level or activity of TERC. In some embodiments, the agent increases the level or activity of PAPD5. Alternatively, the agent decreases the level or activity of PAPD5 (e.g., a PAPD5 inhibitor). In some embodiments, the agent is any one of the compounds described herein.
[0388] Thus, the present application provides compounds that modulate TERC levels and are therefore useful in the treatment of a wide range of telomere diseases or disorders associated with telomerase dysfunction, such as dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, hematological disorders, liver diseases (e.g., chronic liver disease), and cancers, such as hematological cancers and hepatocellular carcinoma.
[0389] In some embodiments, to successfully treat telomere diseases, a therapeutic agent must selectively inhibit PAPD5 without inhibiting PARN or other polynucleotide polymerases. PAPD5 inhibitors that are not selective but simultaneously inhibit other polymerases may not be useful in treating telomere diseases. That is, the fact that a compound is a PAPD5 inhibitor (e.g., a non-selective inhibitor) does not indicate its usefulness in preventing and treating telomere diseases. Selectivity for PAPD5 as opposed to other polymerases is required for efficacy. In some embodiments, the compounds of the present application are selective and specific inhibitors of PAPD5 and do not inhibit PARN or other polymerases.
[0390] In some embodiments, it has been surprisingly discovered that to successfully treat telomere diseases, a therapeutic agent must be a selective inhibitor of PAPD5. In other words, a successful therapeutic agent must inhibit PAPD5 without substantially inhibiting PARN and / or other polynucleotide polymerases. In some embodiments, PAPD5 inhibitors that are not selective for PAPD5 and simultaneously inhibit other polymerases may not be useful in treating telomere diseases. That is, the fact that a compound is a PAPD5 inhibitor (e.g., a non-selective inhibitor) does not indicate its usefulness in preventing and treating telomere diseases. Selectivity for PAPD5 as opposed to other polymerases is required for efficacy. In some embodiments, the compounds of the present application are selective and specific inhibitors of PAPD5 and do not substantially inhibit PARN or other polymerases.
[0391] Telomere disorders Telomere diseases or disorders associated with telomerase dysfunction are typically associated with changes in telomere size. Many proteins and RNA components, including TERC, PARN, and PAPD5 (also known as TRF4-2), are involved in the telomere regulatory pathway. Figures 1 and 2 show how these proteins or RNA components function in the regulatory pathway and how they relate to telomere diseases.
[0392] Among these telomere disorders is dyskeratosis congenita (DC), a rare progressive bone marrow failure syndrome characterized by the triad of reticular skin hyperpigmentation, nail dystrophy, and oral leukoplakia. Early death is often related to bone marrow failure, infection, fatal pulmonary complications, or malignancy. Short-term treatment options for patients with bone marrow failure include anabolic steroids (e.g., oxymetholone), granulocyte-macrophage colony-stimulating factor, granulocyte colony-stimulating factor, and erythropoietin. Other treatments include hematopoietic stem cell transplantation (SCT).
[0393] Idiopathic pulmonary fibrosis is a chronic and ultimately fatal disease characterized by a progressive decline in lung function. In some cases, the following drugs are used to treat idiopathic pulmonary fibrosis: nintedanib, a tyrosine kinase inhibitor that targets multiple tyrosine kinases, including vascular endothelial growth factor, fibroblast growth factor, and PDGF receptors; and pirfenidone. Other treatments include lung transplantation. In some cases, lung transplantation for idiopathic pulmonary fibrosis (I-IPF) has been shown to provide a survival advantage over medical treatment.
[0394] Generally, methods for treating a telomere disease involve administering a therapeutically effective amount of a compound described herein to a subject in need of, or determined to be in need of, such treatment.
[0395] In some embodiments, the disorder associated with telomere or telomerase dysfunction is dyskeratosis congenita, aplastic anemia, myelodysplastic syndrome, pulmonary fibrosis, interstitial lung disease, hematological disorder, liver disease, or liver fibrosis.
[0396] In some embodiments, the disorder associated with telomere or telomerase dysfunction is dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, myelodysplastic syndrome, idiopathic pulmonary fibrosis, a hematological disorder, or liver fibrosis.
[0397] cancer The present disclosure also provides compounds, compositions, and methods for treating preleukemia, precancerous conditions, dysplasia, and / or cancer. Preleukemia includes, for example, myelodysplastic syndrome and smoldering leukemia. Dysplasia refers to developmental abnormalities or epithelial abnormalities of growth and differentiation, including, for example, hip dysplasia, fibrous dysplasia, renal dysplasia, myelodysplastic syndrome, and dysplasia of blood-forming cells.
[0398] Precancerous or premalignant conditions are morphological disorders of cells associated with an increased risk of cancer. If left untreated, these conditions can lead to cancer. Such conditions can be dysplasia or benign neoplasms.
[0399] As used herein, the term "cancer" refers to cells having the capacity for autonomous proliferation, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or invasive stage. The term "tumor," as used herein, refers to cancerous cells, e.g., a mass of cancerous cells.
[0400] Many cancer cells have abnormal telomeres. Therefore, the treatments described herein (e.g., PAPD5 inhibitors) can also be used to treat cancer. Cancers that can be treated or diagnosed using the methods described herein include malignancies of various organ systems (e.g., those affecting the lung, breast, thyroid, lymphatic system, gastrointestinal, and genitourinary tract), as well as adenocarcinomas, including malignancies such as most colon cancers, renal cell carcinoma, prostate cancer, and / or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine, and cancer of the esophagus.
[0401] In some embodiments, the methods described herein are used to treat or diagnose carcinoma in a subject. The term "carcinoma" is art-recognized and refers to malignant tumors of epithelial or endocrine tissue, including respiratory system carcinoma, gastrointestinal system carcinoma, genitourinary system carcinoma, testicular carcinoma, breast carcinoma, prostate carcinoma, endocrine system carcinoma, and melanoma. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include carcinomas forming from tissues of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, including malignant tumors composed of carcinoma and sarcoma tissue, for example. "Adenocarcinoma" refers to carcinomas derived from glandular tissue or in which tumor cells form recognizable glandular structures. The term "sarcoma" is art-recognized and refers to malignant tumors of mesenchymal origin. Cancers treatable using the methods described herein are cancers that have increased levels of TERC, increased expression of genes such as TERC and / or TERT, or increased telomerase activity compared to normal tissue or other cancers of the same tissue.
[0402] In some embodiments, tumor cells isolated from a subject diagnosed with cancer can be used to screen for compounds that alter TERC levels. In some embodiments, tumor cells can be used to screen for test compounds that alter the expression or activity of PARN or PAPD5. The cancer cells used in this method can be, for example, cancer stem cells. Such methods can be used to screen a library of test compounds, for example, compounds that alter or change the protein or RNA expression of telomere-related genes (e.g., TERC, PARN, PAPD5 / PAPD5).
[0403] In some embodiments, agents that reduce the level or activity of TERC (e.g., PANR inhibitors) are used to treat cancer. In some embodiments, these agents are used in combination with other cancer treatments, such as chemotherapy, surgery, or radiation therapy.
[0404] Aging Telomeres shorten human lifespan. In large population-based studies, short or shortened telomeres are associated with numerous diseases. Therefore, telomeres play an important role in the aging process and may contribute to various diseases. The role of telomeres as contributory and interactive factors in aging, disease risk, and protection is described, for example, in Blackburn, Elizabeth H., Elissa S. Epel, and Jue Lin. "Human telomere biology: A contributory and interactive factor in aging, disease risks, and protection," Science 350.6265 (2015): 1193-1198, the entire contents of which are incorporated by reference.
[0405] Telomere shortening is also a major driver of senescence-associated responses. In proliferating human cells, progressive telomere erosion eventually exposes uncapped, free, double-stranded chromosome ends, triggering a permanent DNA damage response (DDR). A persistent DNA damage response significantly impacts cellular function. For example, the damage sensor ataxia telangiectasia mutated (ATM) is recruited to uncapped telomeres, leading to the stabilization of tumor suppressor protein 53 (p53) and the upregulation of the p53 transcriptional target p21. p21 then prevents cyclin-dependent kinase 2 (CDK2)-mediated inactivation of RB, subsequently preventing entry into the S phase of the cell cycle. Cellular senescence contributes to various age-related diseases, such as glaucoma, cataracts, diabetic pancreas, type 2 diabetes mellitus, atherosclerosis, osteoarthritis, inflammation, atherosclerosis, diabetic adiposity, cancer, pulmonary fibrosis, and liver fibrosis. The persistent DNA damage response and age-related diseases are described, for example, in Childs, Bennett G., et al. "Cellular senescence in aging and age-related disease: from mechanisms to therapy." Nature medicine 21.12 (2015): 1424 (incorporated herein by reference in its entirety).
[0406] As used herein, the term "aging" refers to the degeneration of organs and tissues over time, resulting in part from insufficient replicative capacity in stem cells that regenerate tissues over time. Aging can result from natural disease processes that occur over time, or from those driven by intrinsic or extracellular pressures that accelerate cell replication and repair. Such pressures include natural chemical, mechanical, and radiation exposure; biological agents such as bacteria, viruses, fungi, and toxins; autoimmunity; medication; chemotherapy; therapeutic radiation; and cell therapy. Because telomeres are an important factor in aging and disease development, the methods described herein can be used to treat, alleviate, or minimize the risk of an age-related disorder (and / or one or more symptoms of an age-related disorder) in a subject. The method includes identifying a subject as having or at risk of an age-related disorder; and administering a pharmaceutical composition to the subject. In some embodiments, the pharmaceutical composition includes an agent that alters the level or activity of TERC, e.g., increases the level or activity of TERC.
[0407] As used herein, the term "ageing-related disorder" or "age-related disease" refers to a disorder associated with the aging process. Exemplary disorders include, for example, macular degeneration, diabetes mellitus (e.g., type 2 diabetes), osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular diseases such as hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, and age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, and hearing.
[0408] The age-related disorder may also be a degenerative disorder, such as a neurodegenerative disorder. Degenerative disorders that can be treated or diagnosed using the methods described herein include degenerative disorders of various organ systems, such as those affecting the brain, heart, lungs, liver, muscle, bone, blood, gastrointestinal, and genitourinary tracts. In some embodiments, the degenerative disorder is a degenerative disorder in which telomeres are shortened, TERC levels are reduced, and / or telomerase levels are reduced compared to normal tissue. In some embodiments, the degenerative disorder is a neurodegenerative disorder. Exemplary neurodegenerative disorders include motor neuron disease, Creutzfeldt-Jakob disease, Machado-Joseph disease, spinocerebellar ataxia, multiple sclerosis (MS), Parkinson's disease, Alzheimer's disease, Huntington's disease, hearing and balance disorders, ataxia, epilepsy, schizophrenia, mood disorders such as bipolar disorder and depression, dementia, Pick's disease, stroke, CNS hypoxia, brain aging, and neurological injuries such as head trauma. Recent studies have shown that shorter telomeres are associated with Alzheimer's disease. The relationship between telomere shortening and Alzheimer's disease is described, for example, in Zhan, Yiqiang, et al. "Telomere length shortening and Alzheimer's disease-a Mendelian Randomization Study," JAMA neurology 72.10 (2015): 1202-1203, which is incorporated by reference in its entirety. In some embodiments, the neurodegenerative disorder is dementia, for example, Alzheimer's disease.
[0409] It has also been determined that there is an inverse correlation between leukocyte telomere length and the risk of coronary heart disease. This relationship is described, for example, in Haycock, Philip C., et al. "Leucocyte telomere length and risk of cardiovascular disease: systematic review and meta-analysis." (2014): g4227; and Codd, Veryan, et al. "Identification of seven loci affecting mean telomere length and their association with disease." Nature Genetics 45.4 (2013): 422-427; each of which is incorporated by reference in its entirety. Thus, there is strong evidence for a causal role of telomere length variation in cardiovascular disease (CVD) or coronary artery disease (CAD). In some embodiments, the disorder is cardiovascular disease (CVD) and / or coronary artery disease (CAD), and the present disclosure provides methods for treating, alleviating, or minimizing the risk of these disorders. In some cases, the disorder is atherosclerotic cardiovascular disease.
[0410] Furthermore, a meta-analysis of 5,759 cases and 6,518 controls showed that shortened telomere length was significantly associated with the risk of type 2 diabetes mellitus. The relationship between telomere length and type 2 diabetes mellitus is described, for example, in Zhao, Jinzhao, et al. "Association between telomere length and type 2 diabetes mellitus: a meta-analysis." PLoS One 8.11 (2013): e79993, which is incorporated by reference in its entirety. In some embodiments, the disorder is a metabolic disorder, for example, type 2 diabetes mellitus.
[0411] In some embodiments, aged cells can be used to screen for test compounds that alter the expression or activity of PARN or PAPD5. The aged cells used in this method can be, for example, cells with genetic lesions in telomere biology genes, cells isolated from elderly subjects, or cells that have undergone multiple rounds of replication in the laboratory. Such methods can be used to screen libraries of test compounds, such as compounds that alter or change the protein or RNA expression of telomere-related genes (e.g., TERC, PARN, PAPD5 / PAPD5). Exemplary methods of screening and screening techniques are described herein.
[0412] In some embodiments, agents that increase the level or activity of TERC (e.g., PAPD5 / PAPD5 inhibitors) are used to treat age-related degenerative disorders of natural or environmental origin, and in some embodiments, these agents are used in combination with other treatments.
[0413] Viral infection Hepatitis B virus (HBV) is an enveloped, partially double-stranded DA virus. The compact 3.2 kb HBV genome consists of four overlapping open reading frames (ORFs) encoding the core, polymerase (Pol), envelope, and X proteins. The Pol ORF is the longest, and the envelope ORF is located within it, while the X and core ORFs overlap with the Pol ORF. The HBV life cycle involves two major events: 1) the generation of closed circular DNA (cccDNA) from relaxed circular (RC DNA), and 2) the generation of RC DNA by reverse transcription of pregenomic RNA (pgRNA). Prior to infection of host cells, the HBV genome exists as RC DNA within virions. The HBV virion arc has been shown to be able to enter host cells by nonspecifically binding to negatively charged proteoglycans present on the surface of human hepatocytes (Schulze, A., P. Gripon & S. Urban. Hepatology, 46. (2007), 1759-68) and by specifically binding the HBV surface antigen (HBsAg) to the hepatocyte sodium-taurocholate cotransporting polypeptide (NTCP) receptor (Yan, H. et al. J Virol, 87, (2013), 7977-91). Once the virion enters the cell, the viral core and encapsidated RC DNA are transported into the nucleus by host factors via a nuclear localization signal via the Impβ / Impα nuclear transport receptor. In the nucleus, host DNA repair enzymes convert the RC DNA to cccDNA. The cccDNA serves as a template for all viral mRNAs and is therefore responsible for HBV persistence in infected individuals. Transcripts produced from cccDNA are divided into two categories: pregenomic RNA (pgRNA) and subgenomic RNA. Subgenomic transcripts encode three envelope (L, M, and S) and X proteins, while pgRNA encodes Pre-Core, Core, and Pol proteins (Quasdorff, M. & U. Protzcr. J Viral Hepat, 1 7, (2010), 527-36).Inhibition of HBV gene expression or HBV RNA synthesis results in the inhibition of HBV viral replication and antigen production (Mao, R. et al. PLoS Pathog, 9, (2013), e1003494; Mao, R. et al. J Virol, 85, (2011), 1048-57). For example, IFN-α has been shown to inhibit HBV replication and viral HBsAg production by reducing the transcription of pgRNA and subgenomic RNA from the HBV covalently closed circular DNA (cccDNA) minichromosome (Belloni, L. et al. J Clin Invest, 122, (2012), 529-37; Mao, R. et al. J Virol, 85, (2011), 1048-57). All HBV viral mRNAs are capped, polyadenylated, and then transported to the cytoplasm for translation. In the cytoplasm, new virus assembly begins, and the nascent pgRNA is packaged with viral Pol, allowing reverse transcription of pgRNA into RC DNA via a single-stranded DNA intermediate. Mature nucleocapsids containing RC DNA are enveloped with cellular lipids and viral L, M, and S proteins, and infectious HBV particles are then released by budding at intracellular membranes (Locarnini, S. Semin Liver Dis, (2005), 25 Suppl 1, 9-19). Interestingly, non-infectious particles are also produced, far exceeding the number of infectious virions. These empty enveloped particles (L, M, and S) are called subviral particles. Importantly, because subviral particles share the same envelope proteins as infectious particles, they are speculated to act as decoys for the host immune system and are used in HBV vaccines. The S, M, and L envelope proteins are expressed from a single ORF containing three different initiation codons. All three proteins share a 226 aa sequence at their C-terminus, the S domain. M and L have additional pre-S domains, Pre-S2 and Pre-S2 and Pre-S1, respectively.However, it is the S domain that contains the HBsAg epitope (Lambert, C. & R. Prangc. Virol J, (2007), 4, 45).
[0414] Controlling viral infection requires strict surveillance of the host innate immune system, which can respond within minutes to hours after infection to influence early viral proliferation and limit the development of chronic and persistent infection. Despite current available treatments based on IFN and nucleoside analogs, hepatitis B virus (HBV) infection remains a major global health problem, with an estimated 350 million chronic carriers at higher risk of liver cirrhosis and hepatocellular carcinoma.
[0415] The secretion of antiviral cytokines by hepatocytes and / or intrahepatic immune cells in response to HBV infection plays a central role in viral clearance from the infected liver.
[0416] However, chronically infected patients exhibit weak immune responses due to various evasion strategies employed by the virus to subvert the host cell recognition system and subsequent antiviral responses.
[0417] Numerous observations have shown that some HBV viral proteins can counteract the initial host cell response by interfering with the virus recognition signaling pathway and subsequent interferon (IFN) antiviral activity. Among these, excessive secretion of HBV empty subviral particles (SVPs, HBsAg) may be involved in maintaining the immune tolerance state observed in chronically infected patients (CHBs). Continuous exposure to HBsAg and other viral antigens can lead to HBV-specific T cell loss and progressive dysfunction (Kondo et al. Journal of Immunology (1993), 150, 4659-4671; Kondo et al. Journal of Medical Virology (2004), 74, 425-433; Fisicaro et al. Gastroenterology, (2010), 138, 682-93). Furthermore, HBsAg has been reported to suppress the functions of immune cells such as monocytes, dendritic cells (DCs), and natural killer (NK) cells through direct interaction (Op den Brouw et al. Immunology, (2009b), 1 26, 280-9; Woltman et al. PLoS One, (201 1), 6, e15324; Shi et al. J Viral Hepat. (2012). 19, c26-33; Kondo et al. ISRN Gastroenterology, (2013), Article ID 935295).
[0418] HBsAg quantification is an important biomarker for prognosis and treatment response in chronic hepatitis B. However, HBsAg loss and seroconversion, rarely observed in chronically infected patients, remain the ultimate (μL) goal of treatment. Current treatments, such as nucleoside(t)ide analogues, are molecules that inhibit HBV DA synthesis but do not target the reduction of HBsAg levels. Nucleoside(t)ide analogues have shown HBsAg clearance rates (-1%-2%) comparable to those observed with natural agents, even with long-term treatment (Janssen et al., Lancet, (2005), 365, 123-9; Marcellin et al., N. Engl. J. Med., (2004), 351, 1206-17; Buster et al., Hepatology, (2007), 46, 388-94). Therefore, targeting HBsAg along with HBV DNA levels in CHB patients can significantly improve immune reactivation and remission in CHB patients (Wieland, SF & FV Chisari. J Virol, (2005), 79, 9369-80; Kumar et al. J Virol, (2011), 85, 987-95; Woltman et al. PLoS One, (2011), 6, e15324; Opden Brouw et al. Immunology, (2009b), 126, 280-9).
[0419] The compounds of the present disclosure are inhibitors of virion production and the production and secretion of the surface proteins HBsAg and HBeAg. The compounds reduce effective HBV RNA production at the transcriptional or post-transcriptional level, such as as a result of accelerated viral RNA degradation in cells. Alternatively, the compounds of the present disclosure inhibit the initiation of viral transcription. In summary, the compounds reduce the overall levels of HBV RNA, particularly HBsAg mRNA, and viral surface proteins. HBsAg may suppress the immune response to viruses or virus-infected cells, and high levels of HBsAg are thought to cause T cell exhaustion and depletion. The disappearance of HBsAg and the subsequent appearance of anti-HBsAg antibodies result in a sustained virological response to HBV, which is considered a sign of functional cure.
[0420] In some embodiments, the compounds may modulate any of the molecular mechanisms described, for example, in Zhou et al., Antiviral Research 149 (2018) 191-201, which is incorporated herein by reference in its entirety. In some embodiments, the compounds may modulate any of the physiological or molecular mechanisms described, for example, in Mueller et al., Journal of Hepatology 68 (2018) 412-420, which is incorporated herein by reference in its entirety. For example, compounds of the present disclosure induce HBV RNA degradation (degradation of HBV pgRNA and HBsAg mRNA occurs in the hepatocyte nucleus and requires de novo synthesis of host proteins).
[0421] In some embodiments, compounds of the present disclosure are useful for inhibiting the production or secretion of HBsAg, inhibiting the production of HBV DNA, and / or treating or preventing hepatitis B virus (HBV) infection (acute, fulminant, or chronic) in a subject. In some embodiments, the subject is in need of such treatment or prevention (e.g., the subject is diagnosed with HBV infection by a treating physician prior to administration of a compound of the present disclosure).
[0422] The compounds are also useful for treating infections caused by viruses in which inhibition of PAPD5 / PAPD7 and / or RNA adenylation and / or guanylation is involved in viral RNA production, protein expression, and / or replication. In addition to HepB, these viruses include hepatitis A (HepA) and cytomegalovirus (CMV). See Kulsuptrakul et al., "A genome-wide CRISPR screen identifies UFMylation and TRAMP-like complexes as host factors required for hepatitis A virus infection," Cell Reports, 2021, 34, 108859; and Kim et al., "Viral hijacking of the TENT4-ZCCHC14 complex protects viral RNAs via mixed tailing," Nature structural & molecular biology, 2020, 27, 581-588.
[0423] In some embodiments, compounds of the present disclosure are useful for treating or preventing Hepatitis A virus (HAV) infection (acute, fulminant, or chronic) in a subject. In some embodiments, the subject is in need of such treatment or prevention (e.g., prior to administration of a compound of the present disclosure, the subject is diagnosed by a treating physician as having an HAV infection).
[0424] In some embodiments, compounds of the present disclosure are useful for treating or preventing a cytomegalovirus (CMV) infection (acute, fulminant, or chronic) in a subject, in some embodiments, the subject is in need of such treatment or prevention (e.g., prior to administration of a compound of the present disclosure, the subject is diagnosed by a treating physician as having a CMV infection).
[0425] Additional Uses In some embodiments, compounds of the present disclosure modulate RNAs whose transcription, post-transcriptional processing, stability, steady-state levels, or function are altered due to acquired or genetic defects in one or more of any cellular pathway. In some embodiments, these include small nucleolar RNAs (snoRNAs), small Cajal body RNAs (scaRNAs), small nuclear RNAs (snRNAs), ribosomal RNAs (rRNAs), Y RNAs, transfer RNAs (tRNAs), microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs), or non-coding RNAs (ncRNAs) that are members of the long non-coding RNA (lncRNA) family. Compounds may also be useful for modulating non-coding RNAs (e.g., scaRNA13, scaRNA8) in cells, and, in turn, may be useful for preventing and treating associated diseases and conditions. In some embodiments, these include ncRNAs affected by any of the molecular mechanisms described, for example, in Lardelli et al., Nature Genetics, 49(3), 2017, 457-464; and Son et al., 2018, Cell Reports 23, 888-898, including those affected by disruption of PARN or TOE1 deadenylase. Thus, the compounds are useful for treating or preventing genetic and other disorders, including neurodevelopmental disorders such as pontocerebellar hypoplasia (pontocerebellar dysplasia). Neurodevelopmental disorders are a group of disorders in which central nervous system development is disrupted. This can include developmental brain dysfunction, which can manifest as neuropsychiatric problems or impairments in motor function, learning, language, or non-verbal communication. In some embodiments, the neurodevelopmental disorder is selected from attention deficit hyperactivity disorder (ADHD), reading disorder (dyslexia), dysgraphia (difficulty with writing), dyscalculia (dyscalculia), expressive disorder (speech expression substantially below an appropriate level for the child's mental age), comprehension disorder (speech comprehension significantly below an appropriate level for the child's mental age), mixed receptive-expressive language disorder, speech disorder (dysarthria) (inability to use developmentally appropriate speech sounds), stuttering (disruption of the normal fluency and temporal structure of speech), and autism spectrum disorder (persistent difficulties in social communication).In some embodiments, the present disclosure provides a method of treating an acquired or genetic disease or condition associated with an alteration in RNA, comprising administering a therapeutically effective amount of any one of the compounds described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition comprising same, to a subject in need thereof. In some embodiments, the RNA comprises ncRNA (e.g., snRNA, scaRNA, snoRNA, rRNA, and miRNA). In some embodiments, the RNA is destroyed by destruction of PARN or TOE1 deadenylase. In some embodiments, the acquired or genetic disease or condition associated with an alteration in RNA comprises a neurodevelopmental disorder, such as pontocerebellar hypoplasia.
[0426] The compounds are PAPD5 inhibitors, which affect TERC, telomerase, telomere maintenance, and stem cell self-renewal, making them useful for regulating the ex vivo proliferation of stem cells and for allograft exhaustion in hematopoietic or other tissues. For example, PAPD5 inhibitors may be useful for the ex vivo proliferation of hematopoietic stem cells, as described in Fares, et al., 2015, Science 345, 1590-1512, and Boitano, et al., 2010 329, 1345-1348 (both of which are incorporated herein by reference in their entirety).
[0427] CRISPR / Cas9 (CRISPR-related 9) Genome engineering and gene regulation through control of individual gene expression can also be used therapeutically. CRISPR (clustered regularly interspaced short palindromic repeats) is a family of DNA sequences found in the genomes of prokaryotes, such as bacteria and archaea. CRISPR / Cas RNA-guided genome targeting and gene regulation in mammalian cells (e.g., using modified bacterial CRISPR / Cas components) can be used to inhibit the expression and / or activity of genes (e.g., PAPD5).
[0428] In some embodiments, catalytically silent Cas-9 mutants (null nucleases) can be tethered to specific gene promoter regions, with the effect of reducing expression of those genes. In some embodiments, the Cas-9 mutants are linked to transcription factors.
[0429] In some embodiments, CRISPR / Cas9 genome targeting can create biallelic null mutations, thus inhibiting the expression and activity of a gene (e.g., PAPD5). Thus, in some embodiments, the PAPD5 inhibitor can be a vector encoding a guide RNA (gRNA) that targets PAPD5 for CRISPR / Cas9, where the CRISPR / Cas9 generates a null mutation in PAPD5, thereby reducing the level and activity of PAPD5. In some embodiments, the PAPD5 inhibitor comprises a CRISPR / Cas9 system and a guide RNA. In some embodiments, the guide RNA can have the following sequence: CCUCUUGUUGCUGCUGCCCG (SEQ ID NO: 2); CGGAGCGAUACAUGCCGGCC (SEQ ID NO: 3); or CCUCUUGUUGCUGCUGCCCG (SEQ ID NO: 4).
[0430] CRISPR / Cas9 targeting can be used in a variety of methods as described herein, such as, for example, modulating telomerase RNA components, screening for, diagnosing, treating, or preventing a disease or condition selected from disorders associated with telomere or telomerase dysfunction, age-related disorders, pre-leukemia or pre-cancerous conditions, viral infections (e.g., HBV infection), neurodevelopmental disorders, and acquired or inherited diseases or conditions associated with RNA alterations.
[0431] Diagnosis of subjects requiring treatment The present specification provides a method for diagnosing a subject in need of treatment (e.g., as having any one of the telomere diseases described herein). By way of example, if the level or activity of TERC, PARN, and / or PAPD5 in the subject is comparable to the level or activity of TERC, PARN, and / or PAPD5 in a subject with a telomere disease, and optionally the subject has one or more symptoms associated with the telomere disease (e.g., aplastic anemia, pulmonary fibrosis, liver cirrhosis), the subject can be diagnosed as having or at risk of developing a telomere disease.
[0432] In some embodiments, if the level or activity of TERC, PARN and / or PAPD5 in a subject is equivalent to the level or activity of TERC, PARN and / or PAPD5 in a control subject who does not have a telomere disease, the subject can be diagnosed as not having or not at risk of developing a telomere disease.
[0433] In some embodiments, if there is a mutation in PARN, the subject is determined to have or be at risk of developing a telomere disease. The mutation may be a missense mutation, a deletion or truncation mutation, an omission of a single or group of nucleotides encoding one or several amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation (see, for example, Nagpal, et al., Cell Stem Cell, See, e.g., 2020. The mutation can be a deletion containing a portion of the PARN gene or the entire PARN gene. The mutation can also be at position 7 and / or 87 of PARN, e.g., the amino acid residue at position 7 is not asparagine and / or the amino acid residue at position 87 of PARN is not serine. For example, the mutation can be the missense variant c.19A>C, resulting in a substitution of the highly conserved amino acid p.Asn7His. Optionally, the mutation is the missense mutation c.260C>T, encoding a substitution of the highly conserved amino acid p.Ser87Leu. In some embodiments, a subject is determined to have or be at risk of developing a telomere disease if they have a mutation in DKC1. The mutation can be a missense mutation, a deletion or truncation mutation, an omission of a single or group of nucleotides encoding one or several amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation (e.g., Fok, et al., Blood, 2019; and Nagpal, et al., Cell (See Stem Cell, 2020). In some embodiments, a subject is determined to have or be at risk for developing a telomere disorder if they have a mutation in any factor that regulates TERC, including NOP10, NHP2, NAF1, GAR1, TCAB1 / WRAP53, ZCCHC8, and TERC itself. The mutation can be a missense mutation of all or part of the gene, a deletion or truncation mutation, or an omission of a single or group of amino acids.In some embodiments, a subject is determined to have or be at risk for developing a telomere disorder if they have a mutation in any factor that regulates telomere biology, such as TERT, TINF2, ACD / TPP1, STN1, CTC1, or POT1. The mutation can be a missense mutation, a deletion or truncation mutation, an omission of a single or group of nucleotides that encodes one or several amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation.
[0434] In some embodiments, a subject does not have overt signs or symptoms of a telomere disease, but the subject is at increased risk for developing a telomere disease if the level or activity of TERC, PARN, or PAPD5 can be correlated with the presence of a telomere disease. In some embodiments, once a person is determined to have or be at increased risk for developing a telomere disease, they can be administered treatment, e.g., with a small molecule (e.g., a PAPD5 inhibitor) or a nucleic acid encoded by a construct, as known in the art or described herein.
[0435] Suitable reference values can be determined using methods known in the art, for example, using standard clinical trial methodologies and statistical analysis. The reference value can have any relevant form. In some cases, the reference comprises a disease reference representing a predetermined value for a meaningful level of PAPD5 protein, for example, a control reference level representing a normal level of PAPD5 protein, for example, the level in an unaffected subject or a subject not at risk of developing a disease described herein, and / or the level of a protein associated with a symptom associated with telomere disease, for example, the level in a subject with telomere disease (e.g., pulmonary fibrosis, cirrhosis, or aplastic anemia). In another embodiment, the reference comprises a disease reference representing a predetermined value for a meaningful level of PARN protein, for example, a control reference level representing a normal level of PARN protein, for example, the level in an unaffected subject or a subject not at risk of developing a disease described herein, and / or the level of a protein associated with a symptom associated with telomere disease, for example, the level in a subject with telomere disease (e.g., pulmonary fibrosis, cirrhosis, or aplastic anemia).
[0436] The predetermined level can be a single cutoff value (threshold), such as the median or mean, or a level defining the boundaries of the upper or lower quartile, tertile, or other segment of the clinical trial population that is determined to be statistically different from other segments. This can be a range of cutoff values (or thresholds), such as a confidence interval. This can be established based on comparison groups, for example, the association between the risk of developing disease or the presence of disease in one defined group is times higher or lower (e.g., approximately 2-fold, 4-fold, 8-fold, 16-fold, or more) than the risk or presence of disease in another defined group. This can be, for example, a range in which a population of subjects (e.g., control subjects) is equally (or unequally) divided into groups such as low-risk, medium-risk, and high-risk groups, or divided into quartiles, with the lowest quartile representing the lowest-risk subjects and the highest quartile representing the highest-risk subjects, or divided into n quartiles (i.e., n equally spaced intervals), with the lowest quartile representing the lowest-risk subjects and the highest of the n quartile representing the highest-risk subjects.
[0437] In some embodiments, the predetermined level is a level or occurrence in the same subject, eg, at a different time point, eg, an earlier time point.
[0438] A subject associated with a predetermined value is typically referred to as a reference subject. For example, in some embodiments, the control reference subject does not have the disorder described herein. In some embodiments, it may be desirable for the control subject to have a defect in the PARN gene (e.g., dyskeratosis congenita), and in other embodiments, it may be desirable for the control subject to have cancer. In some cases, it may be desirable for the control subject to have high telomerase activity, and in other cases, it may be desirable for the control subject to have no substantial telomerase activity.
[0439] In some embodiments, a level of TERC or PARN in a subject that is equal to or less than a reference level of TERC or PARN indicates a clinical condition (e.g., a disorder as described herein, e.g., a telomere disease). In some embodiments, an activity of TERC or PARN in a subject that is equal to or greater than a reference activity level of TERC or PARN indicates the absence of the disease.
[0440] The predetermined value may depend on the particular population of subjects (e.g., human subjects or animal models) selected. For example, an apparently healthy population will have a different "normal" level range of TERC than a population of subjects who have, are likely to have, or are at higher risk of having a disorder described herein. Thus, the selected predetermined value may take into account the category (e.g., gender, age, health, risk, presence of other diseases) that the subject (e.g., human subject) falls into. Appropriate ranges and categories can be selected by those skilled in the art with no more than routine experimentation. When characterizing likelihood or risk, numerous predetermined values can be established.
[0441] In some embodiments, the methods described herein include identifying a subject having, at risk of developing, or suspected of having a disorder associated with telomerase dysfunction. The methods include determining the level or activity of TERC, PARN, or PAPD5 in cells from the subject; comparing the level or activity of TERC, PARN, or PAPD5 to a reference level or activity of TERC, PARN, or PAPD5; and identifying the subject having, at risk of developing, or suspected of having a disorder associated with telomerase dysfunction if the level or activity of TERC, PARN, or PAPD5 is significantly different from the reference level or activity of TERC, PARN, or PAPD5. In some embodiments, the reference level or activity of TERC, PARN, or PAPD5 is determined in cells obtained from a subject without a disorder associated with telomerase dysfunction.
[0442] The level or activity of TERC, PARN, or PAPD5 can be determined in various types of cells from a subject. The method can include obtaining cells from a subject and transforming these cells into induced pluripotent stem cell (I-IPS) cells, and these iPS cells can be used to determine the level or activity of TERC, PARN, or PAPD5. These cells can be, for example, primary human cells or tumor cells. Pluripotent stem cell (I-IPS) cells can be generated from somatic cells by methods known in the art (e.g., somatic cells can be genetically reprogrammed to an embryonic stem cell-like state by expressing genes and factors important for maintaining the defined characteristics of embryonic stem cells). In some embodiments, the method of diagnosing a subject includes analyzing a blood sample from the subject, or a hair, urine, saliva, or feces sample from the subject (e.g., the subject can be diagnosed without a cell culture surgically obtained from the subject).
[0443] The subject may have a mutation in PARN, such as a deletion containing a portion of the PARN gene or the entire PARN gene. For example, the mutation may be such that the amino acid residue at position 7 of PARN is not asparagine or serine. For example, the subject may have the missense variant c.19A>C, resulting in a substitution of the highly conserved amino acid p.Asn7His. The subject may have the missense mutation c.260C>T, encoding a substitution of the highly conserved amino acid p.Ser87Leu.
[0444] induced pluripotent stem cells Induced pluripotent stem cells (I-IPSCs or iPSCs) are somatic cells (e.g., derived from a patient's skin or other cells) that have been genetically reprogrammed to an embryonic stem cell-like state by expressing genes and factors important for maintaining the defined properties of embryonic stem cells. These cells can be generated by methods known in the art.
[0445] Mouse iPSCs are known to exhibit key characteristics of pluripotent stem cells, including expressing stem cell markers when injected into mouse embryos very early in development, forming tumors containing cells from all three germ layers, and being able to contribute to many different tissues.
[0446] Human iPSCs also express stem cell markers and can generate cells characteristic of all three germ layers. iPSCs can be generated from human fibroblasts and are already useful tools for drug development and disease modeling. Viruses are currently used to introduce reprogramming factors into adult cells (e.g., the lentiviral vectors disclosed herein); this process is first carefully controlled and tested in cultured, isolated cells, and then the cells can be treated (e.g., by contacting them with test compounds) to express altered markers; for example, tumor cell-derived iPSCs can be engineered to differentiate, or cardiomyocyte-derived iPSCs can be engineered to dedifferentiate.
[0447] The iPSC manipulation strategy can be applied to any cells obtained from a subject to test whether a compound can alter the level or activity of TERC, PARN, or PAPD5. The cells are contacted with a test compound (e.g., a small molecule). In some embodiments, these iPSC cells can be used to screen for compounds that modulate TERC. In some embodiments, iPSC cells can be converted from patient skin fibroblasts.
[0448] Cell proliferation The present disclosure provides methods for expanding a cell population by culturing one or more cells in the presence of a compound disclosed herein (e.g., a compound of Formula (I), (II), (III), or (IV)). In some embodiments, cell expansion can involve contacting cells with an effective amount of a compound disclosed herein (e.g., a PAPD5 inhibitor of Formula (I), (II), (III), or (IV)). PAPD5 inhibitors can reduce PAPD5 levels and activity, thereby increasing or maintaining telomere length. Telomerase activity and telomere length maintenance are associated with cell proliferation. As cells divide, telomere length gradually shortens, ultimately leading to cellular senescence. Based on the telomere theory, cellular aging is irreversible. Programmed cell cycle arrest occurs in response to telomerase activity, and the total number of cell divisions cannot exceed a certain limit, called the Hayflick limit. Maintaining telomere length during cell replication has been found to be important for cell proliferation (e.g., stem cell proliferation). The present disclosure provides methods for promoting cell proliferation and for inhibiting, slowing, or preventing cellular aging.
[0449] In some embodiments, the cells are stem cells. Stem cells can include, but are not limited to, pluripotent stem cells, embryonic stem cells, hematopoietic stem cells, adipose-derived stem cells, mesenchymal stem cells, umbilical cord blood stem cells, placenta-derived stem cells, exfoliated tooth-derived stem cells, hair follicle stem cells, or neural stem cells. In some embodiments, the cells are peripheral blood mononuclear cells (PBMC) cells.
[0450] The cells can be derived from a subject with a disease or condition associated with any of the disorders described herein, e.g., cancer, telomere or telomerase dysfunction, age-related disorders, pre-leukemia or pre-cancerous conditions, and neurodevelopmental disorders. Cells can be isolated and derived from tissues such as, for example, pancreatic tissue, liver tissue, smooth muscle tissue, striated muscle tissue, cardiac muscle tissue, bone tissue, bone marrow tissue, bone cancellous tissue, cartilage tissue, liver tissue, pancreatic tissue, pancreatic duct tissue, spleen tissue, thymus tissue, lymph node tissue, thyroid tissue, epidermal tissue, dermal tissue, subcutaneous tissue, cardiac tissue, lung tissue, vascular tissue, endothelial tissue, blood cells, bladder tissue, kidney tissue, gastrointestinal tissue, esophageal tissue, stomach tissue, small intestine tissue, large intestine tissue, adipose tissue, uterine tissue, eye tissue, lung tissue, testicular tissue, ovarian tissue, prostate tissue, connective tissue, endocrine tissue, or mesenteric tissue.
[0451] Cells can be isolated from any mammalian organism, such as a human, mouse, rat, dog, or cat, by any means known to those skilled in the art. Those skilled in the art can isolate embryonic or adult tissue and obtain various cells (e.g., stem cells).
[0452] The expanded cell population can be further enriched by using appropriate cell markers. For example, stem cells can be enriched by using specific stem cell markers, such as FLK-1, AC133, CD34, c-kit, CXCR-4, Oct-4, Rex-1, CD9, CD13, CD29, CD34, CD44, CD166, CD90, CD105, SH-3, SH-4, TRA-1-60, TRA-1-81, SSEA-4, and Sox-2. One skilled in the art can enrich for specific cell populations by using antibodies against any of these cell markers known in the art. In some embodiments, expanded stem cells can be purified based on the desired stem cell marker by fluorescence-activated cell sorting (FACS) or magnetic-activated cell sorting (MACS).
[0453] Cells (eg, stem cells) can be cultured and grown in an appropriate growth medium. Commonly used growth media include, but are not limited to, Iscove's Modified Dulbecco's Medium (IMDM), McCoy's 5A Medium, Dulbecco's Modified Eagle's Medium (DMEM), KnockOut™ Dulbecco's Modified Eagle's Medium (KO-DMEM), Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12 (DMEM / F12), Roswell Park Memorial Institute (RPMI) Medium, Minimum Essential Medium Alpha Medium (α-MEM), F-12K Nutrient Mixture (Kaighn's Modification, F-12K), X-VIVO™ 20 Medium, Stemline™ Medium, StemSpan™ CC100 Medium, StemSpan™ H2000 Medium, MCDB 131 Medium, Basal Medium Eagle (BME), Glasgow Minimum Essential Medium (GMEM), Modified Eagle's Medium (MEM), Opti-MEM I Reduced Serum Medium, Waymouth's MB 752 / 1 Medium, and Williams' Medium. E, NCTC-109 medium, neural plasma medium, BGJb medium, Brinster's BMOC-3 medium, Connaught Medical Research Laboratories (CMRL) medium, CO2-independent medium, and Leibovitz's L-15 medium.
[0454] The compounds of the present disclosure (e.g., compounds of Formula (I), (II), or (III)) can be used to grow various cell populations, for example, by adding the compound to cell culture medium in tubes or plates. The concentration of the compound can be determined by the time of cell growth, but is not limited to this. For example, cells can be cultured with a high concentration of the compound for a short period of time, for example, at least or about 1 day, 2 days, 3 days, 4 days, or 5 days. In some embodiments, cells can be cultured with a low concentration of the compound for a long period of time, for example, at least or about 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, or 4 weeks.
[0455] In some embodiments, growth factors are also added to the growth medium to allow cells to proliferate. Examples of suitable growth factors include, but are not limited to, thrombopoietin, stem cell factor, IL-1, IL-3, IL-7, flt-3 ligand, G-CSF, GM-CSF, Epo, FGF-1, FGF-2, FGF-4, FGF-20, IGF, EGF, NGF, LIF, PDGF, bone morphogenetic protein, activin-A, VEGF, forskolin, and glucocorticoids. Furthermore, one skilled in the art can add a feeder layer to the culture medium using methods known in the art. The feeder layer can include cells, such as placental tissue or cells thereof.
[0456] The methods described herein can also be used to generate and expand chimeric antigen receptor (CAR) T cells. CAR-T cell therapy involves genetic modification of a patient's autologous T cells to express a CAR specific for a tumor antigen, followed by ex vivo cell expansion and reinfusion back into the patient. PBMCs can be collected from the patient and cultured in the presence of a compound described herein (e.g., a compound of Formula (I), (II), (III), or (IV)) using an appropriate medium (e.g., complete medium containing 30 U / mL interleukin-2 and anti-CD3 / CD28 beads). The cells can be expanded for approximately 3 to 14 days (e.g., approximately 3 to 7 days). T cell subsets can be sorted by FACS. Gating strategies for cell sorting can exclude other blood cells, including granulocytes, monocytes, natural killer cells, dendritic cells, and B cells. Primary T cells are then transduced by incubating the cells with a CAR-expressing lentiviral vector in culture medium. In some embodiments, the culture medium can be supplemented with a compound described herein. The transduced cells are then cultured for at least several days (e.g., 3 days) before being used in CAR-T cell therapy.
[0457] In some embodiments, the present disclosure provides a method of growing cells, comprising culturing the cells in the presence of an effective amount of a compound described herein (e.g., a compound of Formula (I), (II), (III), or (IV)) or a pharmaceutically acceptable salt thereof.
[0458] In some embodiments, the cells are selected from the group consisting of stem cells, pluripotent stem cells, hematopoietic stem cells, and embryonic stem cells.
[0459] In some embodiments, the cells are pluripotent stem cells.
[0460] In some embodiments, the cells are hematopoietic stem cells.
[0461] In some embodiments, the cells are embryonic stem cells.
[0462] In some embodiments, the cells are collected from a subject having a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction, an age-related disorder, a pre-leukemia or pre-cancerous condition, and a neurodevelopmental disorder.
[0463] In some embodiments, the method further comprises culturing the cells with a feeder layer in the medium.
[0464] In some embodiments, the cells have at least one stem cell marker selected from the group consisting of FLK-1, AC133, CD34, c-kit, CXCR-4, Oct-4, Rex-1, CD9, CD13, CD29, CD34, CD44, CD166, CD90, CD105, SH-3, SH-4, TRA-1-60, TRA-1-81, SSEA-4, and Sox-2.
[0465] In some embodiments, the stem cell marker is CD34.
[0466] In some embodiments, the method further comprises enriching for stem cells by isolating CD34+ cells.
[0467] In some embodiments, the subject is a mammal.
[0468] In some embodiments, the subject is a human.
[0469] In some embodiments, the method comprises culturing the cells in a medium selected from the group consisting of Iscove's Modified Dulbecco's Medium (IMDM), Dulbecco's Modified Eagle's Medium (DMEM), Roswell Park Memorial Institute (RPMI) medium, Minimum Essential Medium Alpha Medium (α-MEM), Basal Medium Eagle's (BME) medium, Glasgow Minimum Essential Medium (GMEM), Modified Eagle's Medium (MEM), Opti-MEM I Reduced Serum Medium, Neural Plasma Medium, CO2-Independent Medium, and Leibovitz's L-15 medium.
[0470] In some embodiments, the cells are chimeric antigen receptor (CAR) T cells.
[0471] In some embodiments, the cells are lymphocytes.
[0472] In some embodiments, the cells are T cells, genetically modified (engineered) T cells, or natural killer cells (NK).
[0473] Pharmaceutical Compositions and Formulations The present application also provides a pharmaceutical composition comprising an effective amount of any one of the compounds disclosed herein or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. The pharmaceutical composition may also include at least one of any one of the additional therapeutic agents described herein. In certain embodiments, the present application also provides pharmaceutical compositions and dosage forms comprising any one of the additional therapeutic agents described herein (e.g., in a kit). The carrier(s) is / are "acceptable" in the sense of being compatible with the other ingredients of the formulation and, in the case of a pharmaceutically acceptable carrier, not deleterious to the recipient thereof in the amounts employed medicaments.
[0474] Pharmaceutically acceptable carriers, adjuvants, and vehicles that can be used in the pharmaceutical compositions of the present application include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.
[0475] A composition or dosage form can contain any one of the compounds and therapeutic agents described herein in the range of 0.005%-100%, with the remainder consisting of suitable pharmaceutically acceptable excipients. Contemplated compositions can contain any one of the compounds and therapeutic agents provided herein in the range of 0.001%-100%, in one embodiment 0.1-95%, in another embodiment 75-85%, and in a further embodiment 20-80%, with the remainder consisting of any pharmaceutically acceptable excipient described herein, or any combination of these excipients.
[0476] Route of administration and dosage form Pharmaceutical compositions of the present application include those suitable for any acceptable route of administration, including buccal, cutaneous, intracervical, intraluminal, intratracheal, enteral, epidural, interstitial, intraperitoneal, intraarterial, intrabronchial, intravesical, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intralingual, intramedullary, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intranasal, intraspinal, intraarticular, intrasynovial, intrathecal, intrathecal, intraureteral, intrauterine, intravascular, intravenous, intranasal, nasogastric, oral, parenteral, transdermal, epidural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral, and vaginal.
[0477] The compositions and formulations described herein may conveniently be provided in unit dosage form, e.g., tablets, capsules (e.g., hard or soft gelatin capsules), sustained-release capsules, and liposomes, and may be prepared by any methods well known in the art of pharmacy. See, e.g., Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore, MD (20th ed. 2000). Such preparative methods include the step of bringing into association with the molecule the components to be administered, such as the carrier, which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, liposomes, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
[0478] In some embodiments, any one of the compounds and therapeutic agents disclosed herein is orally administered. The compositions of the present application suitable for oral administration can be provided as discrete units such as capsules, sachets, granules, or tablets, each containing a predetermined amount (e.g., an effective amount) of the active ingredient; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; as an oil-in-water liquid emulsion; as a water-in-oil liquid emulsion; as a liposome; or as a bolus. Soft gelatin capsules can be useful for containing such suspensions, which can beneficially increase the rate of compound absorption. For oral tablets, commonly used carriers include lactose, sucrose, glucose, mannitol, as well as silicic acid and starch. Other acceptable excipients include: a) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders, such as carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidinone, sucrose, and acacia; c) humectants, such as glycerol; d) disintegrants, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; e) solution retardants, such as paraffin; f) absorption accelerators, such as quaternary ammonium compounds; g) humectants, such as cetyl alcohol and glycerol monostearate; h) absorbents, such as kaolin and bentonite clay; and i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. For oral administration in capsule form, useful diluents include lactose and dried cornstarch. When aqueous suspension is administered orally, active ingredient is combined with emulsifying agent and suspending agent.If desired, certain sweeteners and / or flavorings and / or coloring agents can be added.The composition suitable for oral administration includes lozenges that contain flavor-based ingredients, usually sucrose and acacia or tragacanth; troches that contain active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia.
[0479] Compositions suitable for parenteral administration include aqueous and non-aqueous sterile injection or infusion solutions, which may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions, which may contain suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, such as sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition, requiring only the addition of a sterile liquid carrier, such as water for injection, saline (e.g., 0.9% saline), or 5% dextrose solution, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. Injection solutions may be, for example, in the form of a sterile injectable aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be used are mannitol, water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally used as solvents or suspending media. For this purpose, any non-irritating fixed oil, including synthetic monoglycerides or diglycerides, can be used. Fatty acids such as oleic acid and its glyceride derivatives are useful for preparing injectables, as are natural pharmaceutically acceptable oils such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions can also contain long-chain alcohol diluents or dispersants.
[0480] The pharmaceutical composition of the present application can be administered in the form of suppositories for rectal administration.These compositions can be prepared by mixing the compound of the present application with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, and therefore melts in the rectum to release the active ingredient.Such materials include cocoa butter, beeswax and polyethylene glycol.
[0481] The pharmaceutical compositions of the present application can be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the art of pharmaceutical formulation and can be prepared as solutions in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other solubilizing or dispersing agents known in the art. See, for example, U.S. Patent No. 6,803,031. Additional formulations and methods for intranasal administration can be found in Ilium, L., J Pharm Pharmacol, 56:3-17, 2004 and Ilium, L., Eur J Pharm Sci 11:1-18, 2000.
[0482] The topical compositions of the present disclosure can be prepared and used in the form of an aerosol spray, cream, emulsion, solid, liquid, dispersion, foam, oil, gel, hydrogel, lotion, mousse, ointment, powder, patch, pomade, solution, pump spray, stick, small paper towelette, soap, or other form commonly used for topical administration and / or in the field of cosmetics and skin care formulations. The topical composition can be in emulsion form. Topical administration of the pharmaceutical compositions of the present application is particularly useful when the desired treatment involves areas or organs easily accessible by topical application. In some embodiments, the topical composition comprises any one of the compounds and therapeutic agents disclosed herein in combination with one or more additional ingredients, carriers, excipients, or diluents including absorbents, anti-irritants, anti-acne agents, preservatives, antioxidants, colorants / pigments, emollients (moisturizers), emulsifiers, film forming / retention agents, fragrances, leave-on exfoliants, prescription drugs, preservatives, exfoliants, silicones, skin identity / repair agents, slip agents, sunscreen actives, surfactants / detergent cleaning agents, penetration enhancers, and thickeners.
[0483] The compounds and therapeutic agents of the present application can be incorporated into compositions for coating implantable medical devices, such as prostheses, artificial valves, vascular grafts, stents, or catheters. Suitable coatings and the general preparation of coated implantable devices are known in the art and are exemplified in U.S. Patent Nos. 6,099,562; 5,886,026; and 5,304,121. The coating is typically a biocompatible polymeric material, such as a hydrogel polymer, polydimethylsiloxane, polycaprolactone, polyethylene glycol, polylactic acid, ethylene vinyl acetate, and mixtures thereof. The coating can optionally be further covered with a suitable topcoat of fluorosilicone, polysaccharides, polyethylene glycol, phospholipids, or combinations thereof to impart controlled-release properties to the composition. Coatings for invasive devices are to be included within the definition of pharmaceutically acceptable carrier, adjuvant, or vehicle (as those terms are used herein).
[0484] According to another embodiment, the present application provides an implantable drug release device impregnated or containing a compound or therapeutic agent, or a composition comprising a compound or therapeutic agent of the present application, such that the compound or therapeutic agent is released from the device and is therapeutically active.
[0485] Dosage and Regimen In the pharmaceutical compositions of the present application, the therapeutic compound is present in an effective amount (eg, a therapeutically effective amount).
[0486] The effective dose may vary depending on the condition being treated, the severity of the condition, the route of administration, the sex, age, and general health of the subject, the use of excipients, the possibility of co-administration with other therapeutic treatments such as the use of other drugs, and the judgment of the treating physician.
[0487] In some embodiments, an effective amount of a therapeutic compound can be, for example, from about 0.001 mg / kg to about 500 mg / kg (e.g., from about 0.001 mg / kg to about 200 mg / kg; from about 0.01 mg / kg to about 200 mg / kg; from about 0.01 mg / kg to about 150 mg / kg; from about 0.01 mg / kg to about 100 mg / kg; from about 0.01 mg / kg to about 50 mg / kg; from about 0.01 mg / kg to about 10 mg / kg; from about 0.01 mg / kg to about 5 mg / kg; from about 0.01 mg / kg to about 1 mg / kg; or from about 0.0 The range may be 1 mg / kg to about 0.5 mg / kg; about 0.01 mg / kg to about 0.1 mg / kg; about 0.1 mg / kg to about 200 mg / kg; about 0.1 mg / kg to about 150 mg / kg; about 0.1 mg / kg to about 100 mg / kg; about 0.1 mg / kg to about 50 mg / kg; about 0.1 mg / kg to about 10 mg / kg; about 0.1 mg / kg to about 5 mg / kg; about 0.1 mg / kg to about 2 mg / kg; about 0.1 mg / kg to about 1 mg / kg; or about 0.1 mg / kg to about 0.5 mg / kg).
[0488] In some embodiments, the effective amount of the therapeutic compound is about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, or about 5 mg / kg.
[0489] The aforementioned dosages can be administered daily (e.g., as a single dose or as two or more divided doses, e.g., once daily, twice daily, three times daily) or non-daily (e.g., every other day, every third day, every third day, once a week, twice a week, once every two weeks, once a month). The compounds and compositions described herein can be administered to a subject in any order. A first therapeutic agent, such as a compound of any one of the formulas disclosed herein, can be administered to a subject in need of treatment before or after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before or after) or simultaneously with the administration of a second therapeutic agent, e.g., an anti-cancer therapy described herein. Thus, a compound of any one of the formulas disclosed herein or a composition containing the compound can be administered separately, sequentially, or simultaneously with a second therapeutic agent (e.g., a chemotherapeutic agent described herein). When a compound of any one of the formulas disclosed herein or a pharmaceutically acceptable salt thereof and a second or third therapeutic agent are administered simultaneously to a subject, the therapeutic agents can be administered in a single dosage form (e.g., a tablet, capsule, or solution for injection or infusion).
[0490] Combination therapy In some embodiments, the compounds described herein can be administered to a subject in any combination with a telomere disease treatment known in the art.The combination treatment can be administered to a subject sequentially or simultaneously with a compound of any one of the formulas disclosed herein.When the combination treatment includes an alternative therapeutic agent, the therapeutic agent can be administered to a subject in any one of the pharmaceutical compositions described herein.
[0491] In some embodiments, compounds of the present disclosure may be used in combination with a therapeutic agent useful for treating telomere diseases (e.g., a therapeutic agent that modulates the level or activity of TERC). In some embodiments, the agent useful for treating telomere diseases is a nucleic acid comprising a nucleotide sequence encoding PARN. The agent may also be an anti-PARN antibody or an anti-PARN antibody fragment. In some embodiments, the agent is an antisense molecule or a small interfering nucleic acid specific for a nucleic acid encoding PARN. In some embodiments, the agent is a nucleic acid comprising a nucleotide sequence encoding PAPD5. The agent may also be an anti-PAPD5 antibody or an anti-PAPD5 antibody fragment. In some embodiments, the agent is an antisense molecule or a small interfering nucleic acid specific for a nucleic acid encoding PAPD5. The antisense molecules described herein may be oligonucleotides. In some embodiments, the agent binds to PARN or PAPD5.
[0492] In some embodiments, the therapeutic agent useful for treating telomere diseases is selected from adenosine analogs, aminoglycosides, purine nucleotides, and the like. In some cases, the aminoglycoside can be a member of the neomycin and kanamycin families. The aminoglycoside can be, for example, kanamycin B sulfate, pramycin sulfate, spectinomycin dihydrochloride pentahydrate, ribostamycin sulfate, sisomicin sulfate, amikacin disulfide, dihydrostreptomycin sesquisulfate, hygromycin B, netilmicin sulfate, paromomycin sulfate, kasugamycin, neomycin, gentamicin, tobramycin sulfate, streptomycin sulfate, or neomycin B, or a derivative thereof.
[0493] In some embodiments, therapeutic agents useful for treating telomere diseases are nucleoside analogs, such as adenosine analogs, 8-chloroadenosine (8-Cl-Ado) and 8-aminoadenosine (8-amino-Ado), or their triphosphate derivatives, synthetic nucleoside analogs having a fluoroglucopyranosyl sugar moiety, benzoyl-modified cytosine or adenine, adenosine and cytosine-based glucopyranosyl nucleoside analogs, or glucopyranosyl analogs having uracil, 5-fluorouracil, or thymine.
[0494] Adenosine analogs, aminoglycosides, and purine nucleotides are known in the art and are described, for example, in Kim, Kyumin, et al. "Exosome Cofactors Connect Transcription Termination to RNA Processing by Guiding Terminated Transcripts to the Appropriate Exonuclease within the Nuclear Exosome." Journal of Biological Chemistry (2016): jbc-M116; Chen, Lisa S., et al. "Chain termination and inhibition of mammalian poly(A) polymerase by modified ATP analogues." Biochemical pharmacology 79.5 (2010): 669-677; Ren, Yan-Guo, et al. "Inhibition of Klenow DNA polymerase and poly(A)-specific ribonuclease by aminoglycosides." Rna 8.11 (2002): 1393-1400; Thuresson, Ann-Charlotte, Leif A. Kirsebom, and Anders Virtanen. "Inhibition of poly (A) polymerase by aminoglycosides." Biochimie 89.10 (2007): 1221-1227; AA Balatsos, N., et al. "Modulation of poly (A)-specific ribonuclease (PARN): current knowledge and perspectives." Current medicinal chemistry 19.28 (2012): 4838-4849; Balatsos, Nikolaos AA, Dimitrios Anastasakis, and Constantinos Stathopoulos."Inhibition of human poly(A)-specific ribonuclease (PARN) by purine nucleotides: kinetic analysis." Journal of enzyme inhibition and medicinal chemistry 24.2 (2009): 516-523; Balatsos, Nikolaos AA, et al. "Competitive inhibition of human poly(A)-specific ribonuclease (PARN) by synthetic fluoro-pyranosyl nucleosides." Biochemistry 48.26 (2009): 6044-6051; and Balatsos, Nikolaos, et al. "Kinetic and in silico analysis of the slow-binding inhibition of human poly(A)-specific ribonuclease (PARN) by novel nucleoside analogues." Biochimie 94.1 (2012): 214-221; each of which is incorporated herein by reference in its entirety. Numerous therapeutic agents capable of modulating PARN and / or PAPD5 levels or activity are described, for example, in WO 2017 / 066796, which is incorporated herein by reference in its entirety.
[0495] In some embodiments, the compounds of the present disclosure are used in combination with anti-cancer therapy. In some embodiments, the anti-cancer therapy is selected from the group consisting of surgery, radiation therapy, chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, adjuvant therapy, and immunotherapy. In some embodiments, the anti-cancer therapy is selected from the group consisting of platinum agents, mitomycin C, poly(ADP-ribose) polymerase (PARP) inhibitors, radioisotopes, vinca alkaloids, anti-tumor alkylating agents, monoclonal antibodies, and antimetabolites. In some embodiments, the anti-cancer therapy is an ataxia telangiectasia mutated (ATM) kinase inhibitor. Suitable examples of platinum agents include cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin. Suitable examples of cytotoxic radioisotopes include: 67 Cu, 67 Ga, 90 Y, 131 I, 177 Lu, 186 Re, 188 Re, alpha particle emitter, 211 At, 213 Bi, 225 Ac, Auger electron emitter; 125 I, 212 Pb, and 111 Suitable examples of antitumor alkylating agents include nitrogen mustard, cyclophosphamide, mechlorethamine or mustine (HN2), uramustine or uracil mustard, melphalan, chlorambucil, ifosfamide, bendamustine, nitrosoureas, carmustine, lomustine, streptozocin, alkyl sulfonates, busulfan, thiotepa, procarbazine, altretamine, triazenes, dacarbazine, mitozolomide, and temozolomide. Suitable examples of anti-cancer monoclonal antibodies include necitumumab, dinutuximab, nivolumab, blinatumomab, pembrolizumab, ramucirumab, obinutuzumab, adotrastuzumab emtansine, pertuzumab, brentuximab, ipilimumab, ofatumumab, catumaxomab, bevacizumab, cetuximab, and tositumomab-I. 131Suitable examples of vinca alkaloids include vinblastine, vincristine, vindesine, vinorelbine, desoxyvincanol, vincanol, vinbrunin, vincamazine, vineridine, vinbrunin, and vinpocetine. Suitable examples of antimetabolites include fluorouracil, cladribine, capecitabine, mercaptopurine, pemetrexed, fludarabine, gemcitabine, hydroxyurea, methotrexate, nelabine, clofarabine, cytarabine, decitabine, pralatrexate, floxuridine, and thioguanine.
[0496] kit The present disclosure also includes pharmaceutical kits useful for treating, for example, the disorders, diseases, and conditions mentioned herein, comprising one or more containers containing a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present disclosure. Such kits can optionally further include one or more of various conventional pharmaceutical kit components, such as, for example, a container containing one or more pharmaceutically acceptable carriers, additional containers, etc. Instructions, such as an insert or label, indicating the amounts of components to be administered, guidelines for administration, and / or guidelines for mixing the components, can also be included in the kit. The kit may optionally include instructions for conducting a test to determine whether a subject is in need of treatment with any of the compounds of any one of Formulas (I)-(IV) described herein, and / or reagents and device(s) for conducting such a test. The kit may also optionally include an additional therapeutic agent (e.g., a nucleic acid comprising a nucleotide sequence encoding PARN or PAPD5).
[0497] definition As used herein, the term "about" means "approximately" (eg, plus or minus about 10% of the indicated value).
[0498] As used herein, the term "about" means "approximately" (eg, plus or minus about 10% of the indicated value).
[0499] At various places in the present specification, substituents of compounds of the invention are disclosed in groups or in ranges. It is specifically intended that the invention include any and all individual subcombinations of the members of such groups and ranges. For example, "C 1-6 The term "alkyl" is specifically intended to individually disclose methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl, and C6 alkyl.
[0500] Various aryl, heteroaryl, cycloalkyl, and heterocycloalkyl rings are described in various places herein. Unless otherwise specified, these rings can be attached to the rest of the molecule at any ring member allowed by valence. For example, the term "pyridine ring" or "pyridinyl" can refer to a pyridin-2-yl, pyridin-3-yl, or pyridin-4-yl ring.
[0501] It will be further appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
[0502] The term "aromatic" refers to a carbocyclic or heterocyclic ring having one or more polyunsaturated rings that have aromatic character (i.e., have (4n+2) delocalized π (pi) electrons, where n is an integer).
[0503] The term "n-membered," where n is an integer, typically refers to the number of ring-forming atoms in the moiety where n is the number of ring-forming atoms. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, pyridyl is an example of a 6-membered heteroaryl ring, and 1,2,3,4-tetrahydro-naphthalene is an example of a 10-membered cycloalkyl group.
[0504] As used herein, the phrase "optionally substituted" means unsubstituted or substituted. The substituents are independently selected, and substitution may be at any chemically accessible position. As used herein, the term "substituted" means that a hydrogen atom has been removed and replaced with a substituent. A single divalent substituent, such as oxo, can replace two hydrogen atoms. It should be understood that substitution at a given atom is limited by valence.
[0505] Through definition, "C n-m " denotes an inclusive range, where n and m are integers and indicate the number of carbons. Examples include C 1-4 , C 1-6 Examples include:
[0506] As used herein, "C" used alone or in combination with other terms n-m The term "alkyl" refers to a saturated hydrocarbon group having n to m carbons, which may be straight-chained or branched. Examples of alkyl moieties include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl; and higher homologs such as 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, etc. In some embodiments, an alkyl group contains 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms.
[0507] As used herein, "C" used alone or in combination with other terms n-mThe term "haloalkyl" refers to an alkyl group having from 1 halogen atom to 2s+1 halogen atoms, which may be the same or different, where "s" is the number of carbon atoms in the alkyl group, and the alkyl group has n to m carbon atoms. In some embodiments, the haloalkyl group is exclusively fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0508] As used herein, "C" used alone or in combination with other terms n-m The term "alkylene" refers to a divalent alkyl linking group having n to m carbons. Examples of alkylene groups include, but are not limited to, ethane-1,1-diyl, ethane-1,2-diyl, propane-1,1-diyl, propane-1,3-diyl, propane-1,2-diyl, butane-1,4-diyl, butane-1,3-diyl, butane-1,2-diyl, 2-methyl-propane-1,3-diyl, and the like. In some embodiments, the alkylene moiety contains 2 to 6, 2 to 4, 2 to 3, 1 to 6, 1 to 4, or 1 to 2 carbon atoms.
[0509] As used herein, the term "C" used alone or in combination with other terms n-m "Alkoxy" refers to a group of the formula -O-alkyl, where the alkyl group has n to m carbons. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), butoxy (e.g., n-butoxy and tert-butoxy), and the like. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0510] As used herein, "C n-m "Haloalkoxy" refers to a group of the formula -O-haloalkyl having n to m carbon atoms. An example of a haloalkoxy group is OCF. In some embodiments, the haloalkoxy group is exclusively fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0511] As used herein, the term "amino" refers to a group of formula -NH2.
[0512] As used herein, "C n-m The term "alkylamino" refers to a group of formula -NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylamino groups include, but are not limited to, N-methylamino, N-ethylamino, N-propylamino (e.g., N-(n-propyl)amino and N-isopropylamino), N-butylamino (e.g., N-(n-butyl)amino and N-(tert-butyl)amino), and the like.
[0513] As used herein, "di(C n-m The term "-N(alkyl)amino" refers to a group of formula -N(alkyl)2, where the two alkyl groups each independently have n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0514] As used herein, "C n-m The term "alkoxycarbonyl" refers to a group of formula -C(O)O-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkoxycarbonyl groups include, but are not limited to, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl (e.g., n-propoxycarbonyl and isopropoxycarbonyl), butoxycarbonyl (e.g., n-butoxycarbonyl and tert-butoxycarbonyl), and the like.
[0515] As used herein, "C n-mThe term "alkylcarbonyl" refers to a group of formula -C(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylcarbonyl groups include, but are not limited to, methylcarbonyl, ethylcarbonyl, propylcarbonyl (e.g., n-propylcarbonyl and isopropylcarbonyl), butylcarbonyl (e.g., n-butylcarbonyl and tert-butylcarbonyl), and the like.
[0516] As used herein, "C n-m The term "alkylcarbonylamino" refers to a group of formula -NHC(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0517] As used herein, "C n-m The term "alkylsulfonylamino" refers to a group of formula -NHS(O)2-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0518] As used herein, the term "aminosulfonyl" refers to a group of formula -S(O)2NH2.
[0519] As used herein, "C n-m The term "alkylaminosulfonyl" refers to a group of formula -S(O)NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0520] As used herein, "di(C n-mThe term "(alkyl)aminosulfonyl" refers to a group of formula -S(O)N(alkyl), where each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0521] As used herein, the term "aminosulfonylamino" refers to a group of formula -NHS(O)2NH2.
[0522] As used herein, "C n-m The term "alkylaminosulfonylamino" refers to a group of formula -NHS(O)NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0523] As used herein, "di(C n-m The term "NHS(O)N(alkyl)aminosulfonylamino" refers to a group of formula -NHS(O)N(alkyl), where each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0524] As used herein, the term "aminocarbonylamino," used alone or in combination with other terms, refers to a group of formula -NHC(O)NH2.
[0525] As used herein, "C n-m The term "alkylaminocarbonylamino" refers to a group of formula -NHC(O)NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0526] As used herein, "di(C n-mThe term "NHC(O)N(alkyl)aminocarbonylamino" refers to a group of formula -NHC(O)N(alkyl), where each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0527] As used herein, the term "carbamyl" refers to a group of formula -C(O)NH2.
[0528] As used herein, "C n-m The term "alkylcarbamyl" refers to a group of formula -C(O)-NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0529] As used herein, "di(C n-m The term "(-alkyl)carbamyl" refers to a group of formula -C(O)N(alkyl), where the two alkyl groups each independently have n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0530] As used herein, the term "thio" refers to a group of formula -SH.
[0531] As used herein, "C n-m The term "alkylthio" refers to a group of formula -S-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0532] As used herein, "C n-m The term "alkylsulfinyl" refers to a group of formula -S(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0533] As used herein, "C n-m The term "alkylsulfonyl" refers to a group of formula -S(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0534] As used herein, the term "carbonyl," employed alone or in combination with other terms, refers to a -C(=O)- group, which may also be written C(O).
[0535] As used herein, the term "carboxy" refers to the group --C(O)OH.
[0536] As used herein, "cyano-C" 1-3 The term "alkyl" refers to a group of the formula -(C 1-3 refers to the group alkylene-CN.
[0537] As used herein, "HO-C 1-3 The term "alkyl" refers to a group of the formula -(C 1-3 refers to the group alkylene-OH.
[0538] As used herein, "halo" refers to F, Cl, Br, or I. In some embodiments, halo is F, Cl, or Br.
[0539] As used herein, the term "aryl," used alone or in combination with other terms, refers to an aromatic hydrocarbon group that can be monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings). n-m The term "aryl" refers to an aryl group having n to m ring carbon atoms. Examples of aryl groups include phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, and the like. In some embodiments, an aryl group has 6 to 10 carbon atoms. In some embodiments, an aryl group is phenyl or naphthyl.
[0540] As used herein, "cycloalkyl" refers to a non-aromatic cyclic hydrocarbon, including cyclized alkyl and / or alkenyl groups. Cycloalkyl groups can include monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) groups and spirocycles. The ring-forming carbon atoms of a cycloalkyl group are optionally substituted with one or two independently selected oxo or sulfido groups (e.g., C(O) or C(S)). The definition of cycloalkyl also includes moieties having one or more aromatic rings fused (i.e., having a common bond) to the cycloalkyl ring, e.g., benzo or thienyl derivatives such as cyclopentane, cyclohexane, etc. Cycloalkyl groups containing fused aromatic rings can be bonded through any ring-forming atom, including the ring-forming atoms of the fused aromatic ring. Cycloalkyl groups can have 3, 4, 5, 6, 7, 8, 9, or 10 ring-forming carbon atoms (C 3-10 In some embodiments, the cycloalkyl can have C 3-10 In some embodiments, the cycloalkyl is a monocyclic or bicyclic cycloalkyl. 3-7 Monocyclic cycloalkyl. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, norpinyl, norcarnyl, adamantyl, and the like. In some embodiments, the cycloalkyl is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.
[0541] As used herein, "heteroaryl" refers to a monocyclic or polycyclic aromatic heterocycle having at least one heteroatom ring member selected from sulfur, oxygen, and nitrogen. In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, any ring-forming N in the heteroaryl moiety can be an N-oxide. In some embodiments, the heteroaryl is a 5-10-membered monocyclic or bicyclic heteroaryl having 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a 5-6 monocyclic heteroaryl having 1 or 2 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a 5- or 6-membered heteroaryl ring. A 5-membered heteroaryl ring is a heteroaryl having a ring with 5 ring atoms, where one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary 5-membered heteroaryls are thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, and 1,3,4-oxadiazolyl. A 6-membered heteroaryl ring is a heteroaryl having a ring with 6 ring atoms, wherein one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary 6-membered heteroaryls are pyridyl, pyrazinyl, pyrimidinyl, triazinyl, and pyridazinyl.
[0542] As used herein, "heterocycloalkyl" refers to a non-aromatic monocyclic or polycyclic heterocycle having one or more ring-forming heteroatoms selected from O, N, or S. Included within heterocycloalkyl are monocyclic 4-, 5-, 6-, 7-, 8-, 9-, or 10-membered heterocycloalkyl groups. Heterocycloalkyl groups can also contain spirocycles. Examples of heterocycloalkyl groups include pyrrolidin-2-one, 1,3-isoxazolidin-2-one, pyranyl, tetrahydrofuran, oxetanyl, azetidinyl, morpholino, thiomorpholino, piperazinyl, tetrahydrofuranyl, tetrahydro-thienyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azepanyl, benzazapene, and the like. The ring-forming carbon atoms and heteroatoms of a heterocycloalkyl group are optionally substituted with one or two independently selected oxo or sulfido groups (e.g., C(O), S(O), C(S), or S(O)). A heterocycloalkyl group can be bonded through a ring-forming carbon atom or ring-forming heteroatom. In some embodiments, a heterocycloalkyl group contains zero to three double bonds. In some embodiments, a heterocycloalkyl group contains zero to two double bonds. Also included within the definition of heterocycloalkyl are moieties having one or more aromatic rings fused (i.e., having a common bond) to a cycloalkyl ring, e.g., benzo or thienyl derivatives such as piperidine, morpholine, azepine, and the like. Heterocycloalkyl groups containing fused aromatic rings can be bonded through any ring-forming atom, including a ring-forming atom of the fused aromatic ring. In some embodiments, a heterocycloalkyl is a monocyclic 4- to 6-membered heterocycloalkyl having one or two heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members. In some embodiments, the heterocycloalkyl is a monocyclic or bicyclic 4-10 membered heterocycloalkyl having 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members.
[0543] In certain places, definitions or embodiments refer to specific rings (e.g., azetidine rings, pyridine rings, etc.). Unless otherwise indicated, these rings can be attached to any ring member as long as the valence of the atom is not exceeded. For example, an azetidine ring can be attached at any position on the ring, and a pyridin-3-yl ring is attached at the 3-position.
[0544] As used herein, the term "oxo" refers to an oxygen atom as a divalent substituent, which forms a carbonyl group when attached to carbon (e.g., C=O), or a sulfoxide or sulfone group when attached to a heteroatom.
[0545] As used herein, the term "compound" is meant to include all stereoisomers, geometric isomers, tautomers, and isotopes of the structures depicted. Compounds herein identified by name or structure as one particular tautomeric form are intended to include other tautomeric forms unless otherwise specified.
[0546] The compounds described herein can be asymmetric (e.g., having one or more stereocenters). All stereoisomers, such as enantiomers and diastereomers, are intended unless otherwise indicated. Compounds of the present invention containing asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods for preparing optically active forms from optically inactive starting materials are known in the art, for example, by resolution of racemic mixtures or by stereoselective synthesis. Many geometric isomers of olefins, C=N double bonds, N=N double bonds, and the like can also be present in the compounds described herein, and all such stable isomers are contemplated in the present invention. Cis and trans geometric isomers of the compounds of the present invention are described and can be isolated as a mixture of isomers or as separated isomeric forms. In some embodiments, the compounds have the (R)-configuration. In some embodiments, the compounds have the (S)-configuration.
[0547] The compounds provided herein also include tautomeric forms. Tautomeric forms arise when a single bond and an adjacent double bond swap positions, resulting in the migration of a proton. Tautomeric forms include prototropic tautomers, which are isomeric protonation states with the same empirical formula and total charge. Examples of prototropic tautomers include ketone-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs, and cyclic forms in which a proton can occupy more than one position in a heterocyclic ring system, such as 1H- and 3H-imidazole, 1H-, 2H-, and 4H-1,2,4-triazole, 1H- and 2H-isoindole, and 1H- and 2H-pyrazole. Tautomeric forms may be in equilibrium or sterically locked into one form by appropriate substitution.
[0548] As used herein, the term "cell" is meant to refer to a cell that is in vitro, ex vivo, or in vivo. In some embodiments, an ex vivo cell may be part of a tissue sample excised from an organism, such as a mammal. In some embodiments, an in vitro cell may be a cell in cell culture. In some embodiments, an in vivo cell is a cell that is living within an organism, such as a mammal.
[0549] As used herein, the term "contacting" refers to bringing the indicated moieties together in an in vitro system or in an in vivo system. For example, "contacting" PAPD5 with a compound of the present invention includes administering the compound of the present invention to an individual or patient, such as a human, having PAPD5, as well as introducing the compound of the present invention into a sample containing, for example, a cell or purified preparation containing PAPD5.
[0550] As used herein, the terms "individual," "patient," or "subject," used interchangeably, refer to any animal, including a mammal, preferably a mouse, rat, other rodent, rabbit, dog, cat, pig, cow, sheep, horse, or primate, most preferably a human.
[0551] As used herein, the phrase "effective amount" or "therapeutically effective amount" refers to an amount of an active compound or pharmaceutical agent that elicits the biological or medical response in a tissue, system, animal, individual, or human that is desired by a researcher, veterinarian, physician, or other clinician.
[0552] As used herein, the term "treat" or "treatment" refers to 1) inhibiting a disease; e.g., inhibiting a disease, condition, or disorder in an individual experiencing or exhibiting the pathology or symptomology of the disease, condition, or disorder (i.e., preventing further progression of the pathology and / or symptomology), or 2) ameliorating a disease; e.g., ameliorating a disease, condition, or disorder in an individual experiencing or exhibiting the pathology or symptomology of the disease, condition, or disorder (i.e., reversing the pathology and / or symptomology).
[0553] As used herein, the term "preventing" a disease, condition, or disorder or "prevention" thereof refers to reducing the risk of development of the disease, condition, or disorder in a subject or group of subjects (e.g., a subject or group of subjects predisposed or susceptible to the disease, condition, or disorder). In some embodiments, preventing a disease, condition, or disorder refers to reducing the likelihood of acquiring the disease, condition, or disorder and / or its associated symptoms. In some embodiments, preventing a disease, condition, or disorder refers to completely or nearly completely halting the development of the disease, condition, or disorder. [Example]
[0554] Example 1A - Inhibition of recombinant PAPD5 Recombinant PAPD5 (rPAPD5) was purified for in vitro assays. An in vitro RNA polyadenylation assay was performed using recombinant PAPD5, ATP, and oligonucleotide substrates. For gel-based detection of substrate elongation, polyadenylation reactions were performed in a buffer containing 25 mM Tris-HCl (pH 7.4), 50 mM KCl, 5 mM MgCl, and 50 mM ATP. Per 10 ml of reaction mixture, 1 pmol of 5'-FAM-labeled RNA oligo (CUGC)5 (Integrated DNA Technologies) and 2.5 pmol of purified rPAPD5 were added, followed by 1 hour of incubation at room temperature. Test compounds were added from a 10 mM stock in dimethyl sulfoxide (DMSO) to final concentrations ranging from 0.1 to 100 μM. The reactions were incubated at room temperature for 1 hour, stopped with formamide loading buffer (10 mM EDTA and 83.3% formamide), and separated using a denaturing polyacrylamide gel (15% Criterion TBE-Urea Polyacrylamide Gel, 26 wells, 15 ml, Bio-Rad, 3450093). The gel was imaged using a FLA9000 Imager (GE Healthcare). The RNA oligo elongation inhibition of specific test compounds is shown in the corresponding figures. Referring to these figures, cmpd.1 is expressed as: [ka] It is a compound having the formula:
[0555] Example 1B Figure 3 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 295A, 302A, 301A, and 300A. Data is also shown for compounds 17A, 58A, 82A, 81A, 96A, 122A, 121A, and 120A, the structures of which are shown below. [Table 26-1] [Table 26-2]
[0556] Example 1C Figure 4 shows TERC 3' end processing - rapid amplification of cDNA ends (RACE) for exemplified compounds 266A, 267A, 269A, and 270A. Data is also shown for compound 78A_Br, the structure of which is shown below: [Table 27]
[0557] Example 1D Figure 5 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplified compounds 129A and 130A. Data is also shown for compounds 17A, 58A, 82A, 81A, 96A, 122A, and 81A-INT. The structures of compounds 17A, 58A, 82A, 81A, 96A, and 122A are shown in Example 1B. The structure of compound 81A-INT is shown below. [Table 28]
[0558] Example 1E Compound 266A had approximately 2 logs higher activity in an in vitro RNA oligoadenylation assay compared to the parent compound cmpd.1, approximating the activity of RG7834 (Figure 7). When tested in DC patient-based induced pluripotent stem cells (iPSCs), 266A demonstrated the ability to drive TERC 3'-end processing maturation by rapid amplification of cDNA ends (RACE) assay at 10 nM (Figure 8), again 1-2 logs more potent than cmpd.1. Compounds 295A and 296A had 2-3 logs higher activity in DC patient iPSCs, demonstrating TERC maturation at 1 nM, similar to RG7834 (Figure 6). Consistent with this, telomere elongation in DC patient iPSCs was observed after 3-4 weeks of cell culture with 266A at 10 nM and with 295A and 296A at 1 nM (Figures 9 and 10). These data collectively demonstrate evidence of target engagement and predicted desirable molecular activities downstream of the intended target (i.e., enhancement of TERC maturation and telomere length) in a relevant preclinical cellular model system, i.e., patient-derived stem cells. With reference to Table 1D, "+" indicates activity at 1 μM, "++" indicates activity above 1 nM and below 1 μM, "+++" indicates activity below 1 nM, and "ND" indicates not determined. [Table 29-1] [Table 29-2]
[0559] Example 1F Figure 11 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplary compounds 109A, 129A, 130A, 204A-INT, 211A, 233A, 204A, 205A-INT, 209A, and 226A. Figure 12 shows TERC 3' end processing-RACE for exemplary compounds 266A, 267A, 269A, 270A, 295A, 297A, 299A, 296A, 307A, 303A, 302A, 301A, 200A, 298A, 308A, 306A, 305A, 304A, and 341A.
[0560] Example 1G 13 to 34 and 42 to 53 show the compounds 130A, 131A, 129A, 132A, 133A, 184A, 205A-INT, 209A, 212A, 216A, 221A, 226A, 231A, 185A, 188A, 191A, 204A-INT, 211A, 233A, 205A, 204A, 266A, 269A, 205A-INT, 267A, 270A, 299A, 296A, 298A, 299A, 300A, 301A, 302A, 303A, 304A, 305A-INT, 306A, 307A, 308A, 309A, 310A, 311A, 312A, 313A, 314A, 315A, 316A, 317A, 318A, 319A, 320A, 321A, 322A, 323A, 324A, 325A, 326A, 327A, 328A, 329A, 330A, 331A, 332A, 333A, 334A, 335A, 336A, 337A, 338A, 339A, 340A, 341A, 342A, 343A, 344A, 345A, 346A, 347A, 348A, 349A, 350A A, 298A, 304A, 306A, 208A, 300A, 301A, 302A, 303A, 305A, 308A, 307A, 296A, 297A, 341A, 342A, 344A, 295A, 1 21A, 123A, 123A-CBZ, 134A, 138A, 142A, 129A, 87A-Cl, 135A, 136A, 137A, 144A, 145A, 146A-Cl, 139A, 140A, 1 27A, 135A-BP, 220A, 232A, 275A, 276A, 277A, 278A, 279A, 339A, 343A, 345A, 346A, 340A, 349A, 391A, 367A, 3 62A, 361A, 368A, 354A, 372A, 353A, 395A, 373A, 401A, 355A, 376A, 399A, 357A, 359A, 371A, 392A, 402A, 403A , 393A, 404A, 417A, 422A, 425A, 427A, 429A, 420A, 421A, 423A, 426A, 349A, 417A, 418A, 420A, 422A, 423A, 428A, 396A, 413A, 414A, 419A, 400A, 415A, 411A, 416A, 394A, and 430A.
[0561] Example 1H Figure 35 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) for exemplary compounds 296A, 297A, 344A, 353A, 354A, 349A, 391A, 392A, 393A, 404A, 361A, 367A, 371A, 339A, 340A, and 343A tested at 1 nM in PARN mutant iPSCs at day 4. Figure 36 shows terminal restriction fragment (TRF) telomere length measurements (Southern blot) for exemplary compounds 296A, 297A, 344A, 353A, 354A, 349A, 391A, 392A, 393A, 404A, 361A, 367A, 371A, 339A, 340A, and 343A tested at 1 nM in PARN mutant iPSCs at day 4. Figure 37 shows TERC 3' end processing-rapid amplification of cDNA ends (RACE) of exemplary compounds 296A, 349A, 399A, 411A, 416A, 417A, 418A, 420A, 421A, 422A, 423A, 428A, 396A, 413A, 414A, and 419A tested at 1 nM in PARN mutant iPSCs at day 4. Figure 38 shows terminal restriction fragment (TRF) telomere length measurements (Southern blot) for exemplary compounds 296A, 349A, 399A, 411A, 416A, 417A, 418A, 420A, 421A, 422A, 423A, 428A, 396A, 413A, 414A, and 419A tested at 1 nM in PARN mutant iPSCs at day 4.
[0562] Example 2A Binding and stabilization of rPAPD5 by test compounds was determined using differential scanning fluorimetry (DSF). Protein melting temperatures were determined by DSF assays using the indicator dye SYPRO Orange (Thermo Fisher Scientific, S6651) diluted 1:5000 in 20 mL of buffer containing 20 mM rPAPD5, 100 mM non-extendable ATP analog (Jena Biosciences), 25 mM Tris-HCl, 5 mM MgCl2, and 50 mM KCl. Test compounds were added to the dye-buffer mixture at 10–100 μM and heated from 10°C to 95°C at a rate of 1°C / min. Fluorescence signals were monitored using an A7500 Fast Real-Time PCR System (Applied Biosystems). DMSO was used as a negative control. Each curve was the average of triplicate measurements, and Thermal Shift software (Thermo Fisher Scientific, 4466038) was used for analysis. The results of the DSF binding assay (expressed as temperature shift at 100 μM and / or 10 μM of test compound) are shown in Table 2 below. m ) is a reference to the DMSO control. Referring to Table 2, "+" indicates a ΔT of less than 1°C. m "++" indicates a ΔT of 1 to 5°C m "+++" indicates a ΔT greater than 5°C m Points to a value. [Table 30-1] [Table 30-2] [Table 30-3] [Table 31-1] [Table 31-2]
[0563] Referring to Table 2a, "+" indicates a ΔT of less than 1°C m "++" indicates a ΔT of 1 to 5°C m "+++" indicates a ΔT greater than 5°C m Points to a value.
[0564] Example 2B HepG2.2.15 cells, a hepatitis B virus-expressing cell line (Sells, MA et al., PNAS, 1987), were seeded at 50,000 cells / well in DMEM / F12 medium (Gibco) containing 10% fetal bovine serum (Omega Scientific) in 24- or 96-well plates (Corning) with two to three replicates for each test compound / concentration plus control. The following day, the medium was aspirated, the cells were washed once with phosphate-buffered saline, pH 7.4 (Gibco), and 1 mL of DMEM / F12 medium was replaced. Test compounds were added in 3-fold dilutions ranging from 100 μM to 333 pM, with vehicle (dimethyl sulfoxide (Sigma)) used as a control. After 4 days of incubation in a humidified 5% CO2 chamber at 37°C, the plates were spun down at 300 g for 10 minutes at room temperature. Supernatants from each well were collected and either frozen at -20°C or used directly for quantification of hepatitis B surface antigen (HBSAg) in an enzyme-linked immunosorbent assay (ELISA). Supernatants were tested using an HBSAg ELISA kit (Abnova catalog number KA0286) according to the manufacturer's instructions. Replicate results were averaged and nonlinear curve fitting was used to determine the half-maximal inhibitory concentration (IC) of each test compound. 50 The assay results are shown in Table 3. [Table 32]
[0565] The compounds are also useful for treating infections caused by viruses in which PAPD5 / PAPD7 and / or RNA adenylation and / or guanylation are involved in viral RNA production, protein expression, and / or replication. In addition to HepB, these viruses include hepatitis A (HepA) and cytomegalovirus (CMV). See Kulsuptrakul et al., "A genome-wide CRISPR screen identifies UFMylation and TRAMP-like complexes as host factors required for hepatitis A virus infection," Cell Reports, 2021, 34, 108859; and Kim et al., "Viral hijacking of the TENT4-ZCCHC14 complex protects viral RNAs via mixed tailing," Nature structural & molecular biology, 2020, 27, 581-588.
[0566] Example 3 - Synthesis of Compound 129A [ka] Step 1 - Synthesis of methyl 2-[(6-chloro-3-oxazol-2-yl-4-quinolyl)amino]benzoate (2): A solution of 2-(4,6-dichloro-3-quinolyl)oxazole (170 mg, 641.28 umol, 1 equiv.) and methyl 2-aminobenzoate (96.94 mg, 641.28 umol, 82.85 uL, 1 equiv.) in ACN (4 mL) was stirred at 80 °C for 12 hours. LCMS showed that the starting material was completely consumed and the desired MS was detected. The reaction mixture was concentrated in vacuo. Compound methyl 2-[(6-chloro-3-oxazol-2-yl-4-quinolyl)amino]benzoate (200 mg, crude) was obtained as a yellow solid. MS (M + H) + = 380.2.
[0567] Step 2 - Synthesis of 2-[(6-chloro-3-oxazol-2-yl-4-quinolyl)amino]benzoic acid (129A): A solution of methyl 2-[(6-chloro-3-oxazol-2-yl-4-quinolyl)amino]benzoate (200 mg, 526.60 μmol, 1 equiv.) and LiOH.HO (2 M, 789.90 μL, 3 equiv.) in THF (4 mL) was stirred at 60 °C for 4 h. LCMS showed that the starting material was completely consumed and the desired MS was detected. The reaction mixture was adjusted to pH 4 by adding 2N HCl. The mixture was then directly purified. The mixture was purified by preparative HPLC (column: Phenomenex Luna 80*30 mm*3 μm; mobile phase: [water (0.04% HCl)-ACN]; B%: 20%-45%, 8 min). The compound 2-[(6-chloro-3-oxazol-2-yl-4-quinolyl)amino]benzoic acid (63.4 mg, 153.96 umol, yield 29.24%, purity 97.68%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ = 11.93 - 11.65 (m, 1H), 9.38 (s, 1H), 8.32 (d, J = 0.8 Hz, 1H), 8.13 (br d, J = 9.0 Hz, 1H), 8.03 (dd, J = 1.3, 7.9 Hz, 1H), 7.98 - 7.91 (m, 1H), 7.70 (d, J = 2.3 Hz, 1H), 7.51 (d, J = 0.9 Hz, 1H), 7.48 - 7.40 (m, 1H), 7.35 - 7.26 (m, 1H), 7.01 (br d, J = 8.3 Hz, 1H). MS (M + H) + = 366.0
[0568] Example 4 - Synthesis of Compound 152A [ka] To a solution of 2-[(6-borono-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 87.48 μmol, 1 equiv.) in DMF (0.5 mL) and HO (0.1 mL) was added CsCO (85.50 mg, 262.43 μmol, 3 equiv.), Pd(dppf)Cl (6.40 mg, 8.75 μmol, 0.1 equiv.), and 5-bromo-N,N-dimethyl-pyridin-3-amine (17.59 mg, 87.48 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 5%-25%, 8 min) to give the compound 2-[[6-[5-(dimethylamino)-3-pyridyl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (4.60 mg, 8.02 umol, yield 9.17%, purity 99.39%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 10.64 (br s, 1 H) 9.12 (s, 1 H), 8.31 - 8.36 (m, 1 H), 8.23 - 8.28 (m, 1 H), 8.16 - 8.21 (m, 1 H), 8.15 (s, 1 H), 8.01 (dd, J=7.82, 1.44 Hz, 1 H), 7.97 (d, J=1.63 Hz, 1 H), 7.34 - 7.41 (m, 1 H), 7.30 (s, 1 H), 7.09 (t, J=7.50 Hz, 1 H), 6.84 (d, J=8.00Hz, 1H), 3.49 - 3.54 (m, 2 H), 3.41 - 3.46 (m, 2 H), 3.06 - 3.16 (m, 4 H), 3.01 (s, 6 H). MS (M + H) + =534.1
[0569] Example 5 - Synthesis of Compound 153A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.2 mL) and DMF (1 mL) was added Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), CsCO (79.41 mg, 243.73 μmol, 3 equiv.), and (5-cyclopropyl-3-pyridyl)boronic acid (13.24 mg, 81.24 μmol, 1 equiv.). N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The residue was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min) to give compound 2-[[6-(5-cyclopropyl-3-pyridyl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (23.70 mg, 39.95 umol, yield 49.17%, purity 95.59%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.76 (br s, 1 H), 9.13 (s, 1 H), 8.70 (s, 1 H), 8.64 (s, 1 H), 8.34 - 8.41 (m, 1 H), 8.26 - 8.32 (m, 1 H), 8.03 - 8.09 (m, 1 H), 7.94 (s, 1 H), 7.65 (s, 1 H), 7.43 (t, J=7.76 Hz, 1 H), 7.22 (t, J=7.46 Hz, 1 H), 6.97 (br d, J=8.19 Hz, 1 H), 3.51 - 3.60 (m, 2H), 3.41 - 3.50 (m, 2 H), 3.04 - 3.22 (m, 4 H), 2.07 - 2.17 (m, 1 H), 1.15 (br d, J=8.31 Hz, 2 H), 0.84 (dd, J=4.71, 1.65 Hz, 2 H). MS (M + H) + = 531.2
[0570] Example 6 - Synthesis of Compound 154A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in DMF (1 mL) and HO (0.2 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and pyrimidin-5-ylboronic acid (10.07 mg, 81.24 μmol, 1 equiv.). N was bubbled through for 1 minute, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min). The compound 2-[(3-morpholinosulfonyl-6-pyrimidin-5-yl-4-quinolyl)amino]benzoic acid (18.20 mg, 31.90 umol, yield 39.26%, purity 92.53%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.83 (br s, 1 H), 9.16 (d, J=9.54 Hz, 2 H), 8.73 (s, 2 H), 8.35 - 8.41 (m, 1 H), 8.29 - 8.34 (m, 1 H), 8.04 - 8.10 (m, 1 H), 7.92 (d, J=1.59 Hz, 1 H), 7.41 - 7.47 (m, 1 H), 7.25 (t, J=7.52 Hz, 1 H), 7.04 (br d, J=8.31 Hz, 1 H), 3.53 - 3.61 (m, 2 H), 3.42 - 3.51 (m, 2 H), 3.08 - 3.24 (m, 4 H). MS (M + H) + = 492.2
[0571] Example 7 - Synthesis of Compound 155A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.2 mL) and DMF (1 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[3,4-b]pyridine (19.91 mg, 81.24 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-40%, 8 min). The compound 2-[[3-morpholinosulfonyl-6-(1H-pyrazolo[3,4-b]pyridin-5-yl)-4-quinolyl]amino]benzoic acid (4.60 mg, 8.11 umol, yield 9.99%, purity 100%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 13.80 (br s, 1 H), 10.63 (br s, 1 H), 9.11 (s, 1 H), 8.37 (d, J=2.08 Hz, 1 H), 8.28 - 8.33 (m, 1 H), 8.21 - 8.25 (m, 2 H), 8.19 (s, 1 H), 8.03 - 8.09 (m, 1 H), 7.84 (d, J=1.59 Hz, 1 H), 7.44 (t, J=7.09 Hz, 1 H), 7.20 (t, J=7.46 Hz, 1 H), 6.90 (d, J=8.31 Hz, 1 H), 3.51 - 3.57 (m, 2 H), 3.39 - 3.48 (m, 2 H), 3.02 - 3.20 (m, 4 H). MS (M + H) + = 531.1
[0572] Example 8-Synthesis of Compound 156A
change
[0573] Example 9 - Synthesis of Compound 157A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and (6-pyrrolidin-1-yl-3-pyridyl)boronic acid (15.60 mg, 81.24 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min). The compound 2-[[3-morpholinosulfonyl-6-(6-pyrrolidin-1-yl-3-pyridyl)-4-quinolyl]amino]benzoic acid (10.20 mg, 16.61 umol, yield 20.44%, purity 97.05%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.67 (br s, 1 H), 9.10 (s, 1 H), 8.20 - 8.29 (m, 2 H), 8.03 (d, J=6.72 Hz, 1 H), 7.94 (s, 1 H), 7.87 (br d, J=9.29 Hz, 1 H), 7.78 (s, 1 H), 7.36 (t, J=7.21 Hz, 1 H), 7.08 - 7.19 (m, 2 H), 6.83 (d, J=8.19 Hz, 1 H), 3.49 - 3.64 (m, 6 H), 3.37 - 3.47 (m, 2 H), 3.03 - 3.18 (m, 4 H), 2.01 (br s, 4 H). MS (M + H) + = 560.2
[0574] Example 10 - Synthesis of Compound 158A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and (4-benzyloxy-2-methyl-phenyl)boronic acid (19.67 mg, 81.24 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 30%-50%, 8 min). The compound 2-[[6-(4-benzyloxy-2-methyl-phenyl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (9.10 mg, 14.04 umol, yield 17.28%, purity 99.66%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6+D2O) δ ppm = 9.08 (s, 1 H), 9.00 (d, J=2.00 Hz, 1 H), 8.74 (d, J=2.13 Hz, 1 H), 8.31 (dd, J=8.88, 2.00 Hz, 1 H), 8.21 (d, J=8.76 Hz, 1 H), 8.15 (t, J=2.13 Hz, 1 H), 8.03 (dd, J=7.94, 1.56 Hz, 1 H), 7.87 (d, J=1.88 Hz, 1 H), 7.37 - 7.43 (m, 1 H), 7.15 - 7.21 (m, 1 H), 6.88 (d, J=7.88 Hz, 1 H), 3.46 - 3.55 (m, 2 H), 3.37 - 3.46 (m, 2 H), 3.28 (s, 3 H), 3.00 - 3.16 (m, 4 H). MS (M + H) + = 569.1
[0575] Example 11-Synthesis of Compound 159A
change
[0576] Example 12 - Synthesis of Compound 160A [ka] Step 1 - Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (2): A solution of 6-bromoquinolin-4-ol (6.24 g, 27.84 mmol, 1 equiv.) in HSO3Cl (20 mL) was stirred at 100 °C for 12 hours. LCMS showed that the starting material was completely consumed and the desired MS was detected. The mixture was added dropwise to ice water (approximately 10 mL). Filtration was performed, and the filter cake was concentrated in vacuo. Compound 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (7 g, 21.70 mmol, 77.95% yield) was obtained as a black solid. MS (M + H) + = 323.9.
[0577] Step 2. Synthesis of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (4): To a solution of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (7 g, 21.70 mmol, 1 equiv.) in DCM (70 mL), TEA (6.59 g, 65.10 mmol, 9.06 mL, 3 equiv.) and morpholine (2.08 g, 23.87 mmol, 2.10 mL, 1.1 equiv.) were added and stirred at 25 °C for 2 h. LCMS showed that the starting material was completely consumed, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. Compound 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (3 g, 8.04 mmol, 37.04% yield) was obtained as a white solid. MS (M + H) + = 373.0.
[0578] Step 3. Synthesis of 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (5): A solution of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (3 g, 8.04 mmol, 1 equiv.) in POCl (24.75 g, 161.42 mmol, 15 mL, 20.08 equiv.) was stirred at 100 °C for 16 h. TLC (petroleum ether / ethyl acetate = 3:1, R f=0.41), indicating complete consumption of the starting material and the formation of a new spot. The reaction mixture was poured into water (20 mL). The aqueous phase was extracted with dichloromethane (50 mL*2). The combined organic phases were dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The residue was purified by flash column (ISCO 20 g silica, 30-36% ethyl acetate in petroleum ether, 15 min gradient). Compound 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (1.6 g, 4.09 mmol, 50.82% yield) was obtained as a yellow solid.
[0579] Step 4. Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (6): A solution of 2-aminobenzoic acid (560.21 mg, 4.09 mmol, 1 equiv.) and 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (1.6 g, 4.09 mmol, 1 equiv.) in ACN (20 mL) was stirred at 80 °C for 2 h. LCMS showed that the starting material was completely consumed and the desired MS was detected. The reaction mixture was concentrated in vacuo. The compound 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (2 g, 4.06 mmol, 99.44% yield) was obtained as a yellow solid. MS (M + H) + = 494.0.
[0580] Step 5. Synthesis of 2-[(6-borono-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (7): To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (500 mg, 1.02 mmol, 1 equiv.) in dioxane (10 mL), BPD (309.46 mg, 1.22 mmol, 1.2 equiv.), Pd(dppf)Cl.CHCl (82.93 mg, 101.56 mmol, 0.1 equiv.), and AcOK (299.00 mg, 3.05 mmol, 3 equiv.) were added. N was bubbled through the mixture for 1 min and stirred at 110 °C for 3 h. LCMS indicated complete consumption of the starting material and the desired product was detected. The reaction mixture was poured into water (50 mL). The aqueous phase was extracted with ethyl acetate (100 mL*2). The combined organic phase was dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. Compound 2-[(6-borono-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (900 mg, crude) was obtained as a black oil. MS (M + H) + = 458.1.
[0581] Step 6. Synthesis of 2-[[3-morpholinosulfonyl-6-(1H-pyrrolo[2,3-c]pyridin-4-yl)-4-quinolyl]amino]benzoic acid (160A): 2-[(6-borono-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 87.48 μmol, 1 equiv.) in DMF (1 mL) and HO (0.1 mL) To a stirred solution of 4-bromo-1H-pyrrolo[2,3-c]pyridine (17.24 mg, 87.48 umol, 1 equiv.), Cs2CO3 (85.50 mg, 262.43 umol, 3 equiv.), and Pd(dppf)Cl2 (6.40 mg, 8.75 umol, 0.1 equiv.) were added, and the mixture was bubbled with N2 for 1 minute and stirred at 100 °C for 2 hours. LCMS showed complete consumption of the starting material and the desired MS was detected. The reaction mixture was filtered, and the filtrate was directly purified. The residue was purified by preparative HPLC (column: Welch Xtimate C18 100*25 mm*3 um; mobile phase: [water (0.05% HCl)-ACN]; B%: 5%-35%, 8 min). The compound 2-[[3-morpholinosulfonyl-6-(1H-pyrrolo[2,3-c]pyridin-4-yl)-4-quinolyl]amino]benzoic acid (5.40 mg, 9.33 umol, 10.67% yield, 97.81% purity, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ = 10.47 - 10.34 (m, 1H), 9.16 (d, J = 1.2 Hz, 2H), 8.36 - 8.27 (m, 3H), 8.23 (t, J = 2.9 Hz,1H), 8.11 (d, J = 0.9 Hz, 1H), 8.01 (dd, J = 1.4, 7.9 Hz, 1H), 7.46 (t, J = 7.8 Hz, 1H), 7.15 (br t, J = 7.6 Hz, 1H), 6.94 - 6.83 (m,1H), 6.26 (s, 1H), 3.46 - 3.35 (m, 4H), 3.10 (br d, J = 8.8 Hz, 4H). MS (M / 2 + H) + = 265.7.
[0582] Example 13 - Synthesis of Compound 161A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and 2-isopropoxy-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (22.52 mg, 81.24 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 20%-50%, 8 min). The compound 2-[[6-(6-isopropoxy-4-methyl-3-pyridyl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (5.70 mg, 9.07 umol, yield 11.17%, purity 95.37%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.61 (br s, 1 H), 9.16 (s, 1 H), 8.23 (br d, J=8.75 Hz, 1 H), 7.98 (br d, J=4.25 Hz, 2 H), 7.66 (s, 1 H), 7.54 (s, 1 H), 7.45 (br t, J=7.69 Hz, 1 H), 7.17 (br t, J=7.57 Hz, 1 H), 6.98 (br d, J=8.13 Hz, 1 H), 6.67 (s, 1 H), 5.14 - 5.28 (m, 1 H), 3.52 (br s, 2 H), 3.43 (br s, 2 H), 3.12 (br s, 4 H), 1.97 (s, 3 H), 1.20 - 1.36 (m, 6 H). MS (M + H) += 563.2
[0583] Example 14 - Synthesis of Compound 162A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (69.49 mg, 213.27 μmol, 3 equiv.), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv.), and 2-phenoxy-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (21.12 mg, 71.09 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 20%-50%, 8 min). The compound 2-[[3-morpholinosulfonyl-6-(6-phenoxy-3-pyridyl)-4-quinolyl]amino]benzoic acid (4.80 mg, 7.69 umol, yield 10.82%, purity 99.18%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 10.61 (br s, 1 H), 9.10 (s, 1 H), 8.18 - 8.25 (m, 2 H), 8.08 (d, J=2.25 Hz, 1 H), 8.03 (dd, J=7.88, 1.50 Hz, 1 H), 7.76 - 7.87 (m, 2 H), 7.33 - 7.47 (m, 3 H), 7.19 - 7.28 (m, 1 H), 7.11 - 7.17 (m, 3 H), 7.07 (d, J=8.50 Hz, 1 H), 6.83 (d, J=8.25 Hz, 1 H), 3.51 (br dd, J=5.82, 3.31 Hz, 2 H), 3.37 - 3.45 (m, 2 H), 3.01 - 3.17 (m, 4 H). MS (M + H) + = 583.2
[0584] Example 15-Synthesis of Compound 163A
change
[0585] Example 16 - Synthesis of Compound 164A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine-2-carbonitrile (18.69 mg, 81.24 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-40%, 8 min) to give compound 2-[[6-(6-cyano-3-pyridyl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (5.20 mg, 9.00 umol, yield 11.08%, purity 95.58%, HCl) as a yellow solid. (10.20 mg, 16.61 umol, yield 20.44%, purity 97.05%, HCl) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 10.70 (br s, 1 H), 9.13 (s, 1 H), 8.59 (d, J=1.59 Hz, 1 H), 8.31 - 8.36 (m, 1 H), 8.23 - 8.28 (m, 1 H), 8.08 (d, J=2.08 Hz, 1 H), 8.06 (d, J=1.71 Hz, 1 H), 8.04 (d, J=1.34 Hz, 1 H), 7.95 (d, J=1.59 Hz, 1 H), 7.33 - 7.44 (m, 1 H), 7.18 (t, J=7.58 Hz, 1 H), 6.91 (d, J=8.19 Hz, 1 H), 3.49 - 3.62 (m, 2 H), 3.39 - 3.48 (m, 2 H), 3.02 - 3.21 (m, 4 H). MS (M + H) + = 516.0.
[0586] Example 17-Synthesis of Compound 165A
change
[0587] Example 18 - Synthesis of Compound 166A [ka] To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv) in DMF (0.5 mL) and HO (0.1 mL) was added (5-amino-6-methoxy-3-pyridyl)boronic acid (13.65 mg, 81.24 μmol, 1 equiv), CsCO (79.41 mg, 243.73 μmol, 3 equiv), and Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv), and the mixture was bubbled with N for 1 min and stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). 15 mg of crude product was obtained. The crude product was purified by preparative HPLC (column: Phenomenex Gemini NX-C18 (75*30mm*3um); mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 1%-24%, 10 min). The compound 2-[[6-(5-amino-6-methoxy-3-pyridyl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (8.20 mg, 15.04 umol, yield 18.51%, purity 98.23%) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6+TFA) δ = 9.28 (s, 1H), 8.21 (s, 2H), 8.11 (dd, J = 1.4, 7.9 Hz, 1H), 7.70 (s, 1H), 7.53 (d, J = 2.1 Hz, 1H), 7.51 - 7.48 (m, 1H), 7.42 - 7.37 (m, 1H), 7.34 (d, J = 2.3 Hz, 1H), 7.28 (d, J = 7.9 Hz, 1H), 3.94 (s, 3H), 3.65 - 3.57 (m, 2H), 3.56 - 3.49 (m, 2H), 3.27 - 3.17 (m, 4H). MS (M + H) + = 536.2.
[0588] Example 19 - Synthesis of Compound 167A [ka] To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv) in DMF (0.5 mL) and HO (0.1 mL) was added N-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine-2-carboxamide (21.30 mg, 81.24 μmol, 1 equiv), CsCO (79.41 mg, 243.73 μmol, 3 equiv), and Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv), and the mixture was bubbled with N for 1 minute and stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[[6-[6-(methylcarbamoyl)-3-pyridyl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (30.10 mg, 49.89 umol, yield 61.41%, purity 96.81%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6+D2O) δ = 9.12 (s, 1H), 8.37 (d, J = 1.8 Hz, 1H), 8.30 (dd, J = 1.9, 8.9 Hz, 1H), 8.21 (d, J = 8.8 Hz, 1H), 8.06 (dd, J = 1.5, 7.9 Hz, 1H), 8.02 - 7.98 (m, 1H), 7.95 - 7.90 (m, 1H), 7.83 (d, J = 1.8 Hz, 1H), 7.50 - 7.40 (m, 1H), 7.31 - 7.24 (m, 1H), 7.01 (d, J = 8.1 Hz, 1H), 3.59 - 3.50 (m, 2H), 3.49 - 3.40 (m, 2H), 3.20 - 3.05 (m, 4H), 2.79 (s, 3H). MS (M + H) + = 548.3.
[0589] Example 20-Synthesis of Compound 168A
change
[0590] Example 21 - Synthesis of Compound 169A [ka] To a stirred solution of 2-[(6-borono-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 87.48 μmol, 1 equiv) in DMF (1 mL) and HO (0.2 mL) was added 1-(4-bromo-2-pyridyl)piperazine (21.18 mg, 87.48 μmol, 1 equiv), CsCO (28.50 mg, 87.48 μmol, 1 equiv), and Pd(dppf)Cl (64.01 mg, 87.48 μmol, 1 equiv), and the mixture was bubbled with N for 1 minute and stirred at 100 °C for 2 h. LCMS showed complete consumption of the starting material and the desired MS was detected. The reaction mixture was filtered, and the filtrate was directly purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 5%-35%, 8 min). The compound 2-[[3-morpholinosulfonyl-6-(2-piperazin-1-yl-4-pyridyl)-4-quinolyl]amino]benzoic acid (5.10 mg, 8.35 umol, yield 9.54%, purity 100%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6+D2O) δ = 9.04 (s, 1H), 8.20 (d, J = 1.7 Hz, 1H), 8.18 - 8.14 (m, 1H), 8.09 - 8.03 (m, 2H), 7.82 (d, J = 1.5 Hz, 1H), 7.44 - 7.36 (m, 1H), 7.20 (s, 1H), 6.86 (d, J = 8.3 Hz, 1H), 6.76 (d, J = 5.7 Hz, 1H), 6.67 (s, 1H), 3.70 - 3.58 (m, 4H), 3.55 - 3.47 (m, 2H), 3.44 - 3.37 (m, 2H), 3.20 (br t, J = 5.0 Hz, 4H), 3.07 (br dd, J = 5.6, 18.5 Hz, 4H). MS (M + H) + = 575.2.
[0591] Example 22 - Synthesis of Compound 170A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL), CsCO (69.49 mg, 213.27 μmol, 3 equiv.), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv.), and 6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)indolin-2-one (18.42 mg, 71.09 μmol, 1 equiv.) were added. N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min) to give the crude product (18 mg). The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-30%, 8 min) to give the compound 2-[[3-morpholinosulfonyl-6-(2-oxoindolin-6-yl)-4-quinolyl]amino]benzoic acid (1.60 mg, 2.75 umol, yield 3.87%, purity 100%, HCl) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 10.54 (s, 2 H), 9.11 (s, 1 H), 8.14 - 8.23 (m, 2 H), 8.06 (dd, J=7.95, 1.59 Hz, 1 H), 7.74 (s, 1 H), 7.42 (t, J=6.91 Hz, 1 H), 7.23 (d, J=7.82 Hz, 1 H), 7.18 (t, J=7.64 Hz, 1 H), 6.86 (dd, J=13.88, 7.89 Hz, 2 H), 6.78 (s, 1 H), 3.55 (br d, J=3.79 Hz, 2 H), 3.51 (s, 2 H), 3.42 - 3.47 (m, 2 H), 3.04 - 3.19 (m, 4 H). MS (M + H) + = 545.1
[0592] Example 23 - Synthesis of Compound 171A [ka] To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in DMF (0.5 mL) and HO (0.1 mL) was added N-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinazolin-2-amine (23.17 mg, 81.24 μmol, 1 equiv.), CsCO (79.41 mg, 243.73 μmol, 3 equiv.), and Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and the mixture was bubbled with N for 1 minute and stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[[6-[2-(methylamino)quinazolin-6-yl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (1.40 mg, 2.31 umol, yield 2.84%, purity 100%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ = 10.73 - 10.57 (m, 1H), 9.22 (br d, J = 4.6 Hz, 1H), 9.10 (s, 1H), 8.32 - 8.27 (m, 1H), 8.26 - 8.22 (m, 1H), 8.07 (dd, J = 1.5, 7.9 Hz, 1H), 7.93 (br s, 1H), 7.86 - 7.75 (m, 2H), 7.48 - 7.37 (m, 1H), 7.21 (t, J = 7.5 Hz, 1H), 6.89 (d, J = 8.3 Hz, 1H), 3.44 (br s, 4H), 3.05 (br s, 7H). MS (M + H) += 571.3.
[0593] Example 24 - Synthesis of Compound 172A [ka] To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv) in DMF (0.5 mL) and HO (0.1 mL) was added (4-morpholinosulfonylphenyl)boronic acid (22.03 mg, 81.24 μmol, 1 equiv), CsCO (79.41 mg, 243.73 μmol, 3 equiv), and Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv), and the mixture was bubbled with N for 1 min and stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[[3-morpholinosulfonyl-6-(4-morpholinosulfonylphenyl)-4-quinolyl]amino]benzoic acid (22.20 mg, 32.88 umol, yield 40.47%, purity 100%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6+D20) δ = 9.08 (s, 1H), 8.28 - 8.23 (m, 1H), 8.22 - 8.18 (m, 1H), 8.05 (dd, J = 1.5, 7.9 Hz, 1H), 7.85 (d, J = 1.8 Hz, 1H), 7.73 (d, J = 8.4 Hz, 2H), 7.56 (d, J = 8.4 Hz, 2H), 7.44 - 7.36 (m, 1H), 7.19 (t, J = 7.4 Hz, 1H), 6.84 (d, J = 8.1 Hz, 1H), 3.64 - 3.58 (m, 4H), 3.55 - 3.47 (m, 2H), 3.44 - 3.35 (m, 2H), 3.16 - 3.01 (m, 4H), 2.90 - 2.81 (m, 4H). MS (M + H) + = 639.2.
[0594] Example 25-Synthesis of Compound 173A
change
[0595] Example 26 - Synthesis of Compound 174A [ka] To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv) in DMF (0.5 mL) and HO (0.1 mL) was added [4-(diethylcarbamoyl)phenyl]boronic acid (17.96 mg, 81.24 μmol, 1 equiv), CsCO (79.41 mg, 243.73 μmol, 3 equiv), and Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv), and the mixture was bubbled with N for 1 min and stirred at 100 °C for 2 h. LCMS showed complete consumption of the starting material and the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[[6-[4-(diethylcarbamoyl)phenyl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (15.70 mg, 25.11 umol, yield 30.91%, purity 100%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6+TFA) δ = 9.20 (s, 1H), 8.31 (dd, J = 1.7, 8.9 Hz, 1H), 8.17 (d, J = 8.8 Hz, 1H), 8.11 (dd, J = 1.3, 7.8 Hz, 1H), 7.71 (d, J = 1.6 Hz, 1H), 7.56 - 7.51 (m, 1H), 7.49 - 7.42 (m, 1H), 7.37 (d, J = 7.8 Hz, 1H), 7.30 (d, J = 8.2 Hz, 2H), 7.19 (d, J = 8.3 Hz, 2H), 3.65 - 3.50 (m, 4H), 3.39 (br d, J = 4.5 Hz, 2H), 3.30 - 3.07 (m, 6H), 1.18 - 0.91 (m, 6H). MS (M + H) + = 589.3.
[0596] Example 27 - Synthesis of Compound 175A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (69.49 mg, 213.27 μmol, 3 equiv.), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv.), and 1,3-benzodioxol-5-ylboronic acid (11.80 mg, 71.09 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-40%, 8 min). The compound 2-[[6-(1,3-benzodioxol-5-yl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (9.00 mg, 15.68 umol, yield 22.06%, purity 99.33%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.62 (br s, 1 H), 9.09 (s, 1 H), 8.14 - 8.21 (m, 2 H), 8.06 (dd, J=7.88, 1.50 Hz, 1 H), 7.68 (d, J=1.38 Hz, 1 H), 7.41 - 7.47 (m, 1 H), 7.20 (t, J=7.44 Hz, 1 H), 6.90 - 6.97 (m, 2 H), 6.81 - 6.85 (m, 1 H), 6.79 (d, J=1.75 Hz, 1 H), 6.05 (d, J=3.00 Hz, 2 H), 3.51 - 3.59 (m, 2 H), 3.41 - 3.49 (m, 2 H), 3.05 - 3.19 (m, 4 H). MS (M + H) + = 534.0.
[0597] Example 28 - Synthesis of Compound 176A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (79.41 mg, 243.73 μmol, 3 equiv.), Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and (4-benzyloxy-2-methyl-phenyl)boronic acid (19.67 mg, 81.24 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 30%-50%, 8 min). The compound 2-[[6-(4-benzyloxy-2-methyl-phenyl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (9.10 mg, 14.04 umol, yield 17.28%, purity 99.66%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6+D2O) δ ppm = 9.09 (s, 1 H), 8.13 (d, J=8.63 Hz, 1 H), 7.96 (dd, J=7.88, 1.50 Hz, 1 H), 7.87 (dd, J=8.69, 1.81 Hz, 1 H), 7.46 (d, J=1.75 Hz, 1 H), 7.36 - 7.43 (m, 5 H), 7.29 - 7.34 (m, 1 H), 7.11 (t, J=7.25 Hz, 1 H), 6.87 - 6.89 (m, 1 H), 6.85 (s, 1 H), 6.78 - 6.84 (m, 2 H), 5.06 (s, 2 H), 3.45 - 3.53 (m, 2 H), 3.32 - 3.42 (m, 2 H),2.99 - 3.14 (m, 4 H), 1.96 (s, 3 H). MS (M + H) + = 610.2
[0598] Example 29 - Synthesis of Compound 177A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (69.49 mg, 213.27 μmol, 3 equiv.), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv.), and (1-methylindazol-6-yl)boronic acid (12.51 mg, 71.09 μmol, 1 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The mixture was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min) to give compound 2-[[6-(1-methylindazol-6-yl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (17.10 mg, 29.48 umol, yield 41.47%, purity 100%, HCl) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 10.72 (br s, 1 H), 9.12 (s, 1 H), 8.36 (dd, J=8.80, 1.59 Hz, 1 H), 8.25 (d, J=8.68 Hz, 1 H), 8.10 (dd, J=7.89, 1.28 Hz, 1 H), 8.05 (s, 1 H), 7.85 (d, J=1.71 Hz, 1 H), 7.76 (d, J=8.31 Hz, 1 H), 7.53 (t, J=7.64 Hz, 1 H), 7.41 (s, 1 H), 7.29 (t, J=7.64 Hz, 1 H), 7.07 (br d, J=8.44 Hz, 2 H), 3.54 - 3.62 (m, 2 H), 3.44 - 3.52 (m, 2 H), 3.06 - 3.25 (m, 4 H). MS (M + H) + = 544.1.
[0599] Example 30-Synthesis of Compound 178A
change
[0600] Example 31 - Synthesis of Compound 179A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (69.49 mg, 213.27 μmol, 3 equiv), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv), and [4-(methanesulfonamido)phenyl]boronic acid (15.29 mg, 71.09 μmol, 1 equiv), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS showed complete consumption of the starting material and MS of the desired product was detected. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min) to give compound 2-[[6-[4-(methanesulfonamido)phenyl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (16.60 mg, 26.15 umol, yield 36.78%, purity 97.52%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.62 (br s, 1 H), 9.95 (s, 1 H), 9.10 (s, 1 H), 8.16 - 8.26 (m, 2 H), 8.08 (d, J=7.88 Hz, 1 H), 7.75 (s, 1 H), 7.44 (br t, J=7.75 Hz, 1 H), 7.26 - 7.31 (m, 2 H), 7.13 - 7.25 (m, 3 H), 6.90 (br d, J=8.13 Hz, 1 H), 3.51 - 3.59 (m, 2 H), 3.40 - 3.51 (m, 2 H), 3.06 - 3.20 (m, 4 H), 3.02 (s, 3 H). MS (M + H) + = 583.0.
[0601] Example 32 - Synthesis of Compound 180A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv) in HO (0.1 mL) and DMF (0.5 mL) was added CsCO (69.49 mg, 213.27 μmol, 3 equiv), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv), and [4-(4-methylpiperazin-1-yl)phenyl]boronic acid (15.64 mg, 71.09 μmol, 1 equiv), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS showed complete consumption of the starting material and MS of the desired product was detected. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 5%-35%, 8 min). The compound 2-[[6-[4-(4-methylpiperazin-1-yl)phenyl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (10.90 mg, 16.85 umol, yield 23.70%, purity 96.47%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.52 (br s, 2 H), 9.05 (s, 1 H), 8.11 - 8.26 (m, 2 H), 8.05 (br d, J=7.82 Hz, 1 H), 7.71 (s, 1 H), 7.39 (br t, J=7.70 Hz, 1 H), 7.24 (br d, J=7.58 Hz, 2 H), 7.14 (br t, J=7.58 Hz, 1 H), 7.01 (br d, J=7.58 Hz, 2 H), 6.82 (br d, J=7.58 Hz, 1 H), 3.91 (br s, 2 H), 3.76 - 3.81 (m, 2 H), 3.43 - 3.52 (m, 4 H), 3.09 (br d, J=8.44 Hz, 8 H), 2.80 (br d, J=2.93 Hz, 3 H). MS (M + H) + = 588.3
[0602] Example 33 - Synthesis of Compound 181A [ka] To a stirred solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (40 mg, 81.24 μmol, 1 equiv.) in DMF (0.5 mL) and HO (0.1 mL) was added 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3-benzothiazole (21.22 mg, 81.24 μmol, 1 equiv.), CsCO (79.41 mg, 243.73 μmol, 3 equiv.), and Pd(dppf)Cl (5.94 mg, 8.12 μmol, 0.1 equiv.), and the mixture was bubbled with N for 1 minute and stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the desired MS was detected. The reaction mixture was filtered, and the filtrate was directly purified. The filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[[6-(1,3-benzothiazol-5-yl)-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (19.30 mg, 32.01 umol, yield 39.40%, purity 96.71%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ = 9.38 (s, 1H), 9.08 (s, 1H), 8.32 (dd, J = 2.0, 8.8 Hz, 1H), 8.18 (dd, J = 8.6, 11.9 Hz, 2H), 8.05 (dd, J = 1.5, 7.9 Hz, 1H), 7.93 (d, J = 1.4 Hz, 1H), 7.84 (d, J = 1.9 Hz, 1H), 7.48 - 7.39 (m, 2H), 7.22 (t, J = 7.6 Hz, 1H), 6.90 (d, J = 8.1 Hz, 1H), 3.57 - 3.49 (m, 2H), 3.45 - 3.38 (m, 2H), 3.10 (dt, J = 3.3, 6.2 Hz, 4H). MS (M + H) + = 547.0.
[0603] Example 34-Synthesis of Compound 182A
change
[0604] Example 35 - Synthesis of Compound 183A [ka] To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (35 mg, 71.09 μmol, 1 equiv.) in HO (0.1 mL) and DMF (0.5 mL), CsCO (69.49 mg, 213.27 μmol, 3 equiv.), Pd(dppf)Cl (5.20 mg, 7.11 μmol, 0.1 equiv.), and [4-(dimethylamino)phenyl]boronic acid; hydrochloride (14.32 mg, 71.09 μmol, 1 equiv.) were added. N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and detection of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min). The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 10%-40%, 8 min) to give the compound 2-[[6-[4-(dimethylamino)phenyl]-3-morpholinosulfonyl-4-quinolyl]amino]benzoic acid (8.90 mg, 15.24 umol, yield 21.44%, purity 97.45%, HCl) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 10.74 (br s, 1 H), 9.09 (s, 1 H), 8.18 - 8.30 (m, 2 H), 8.10 (dd, J=7.88, 1.50 Hz, 1 H), 7.66 (d, J=1.50 Hz, 1 H), 7.45 - 7.51 (m, 1 H), 7.31 (t, J=7.44 Hz, 1 H), 7.18 (br d, J=8.50 Hz, 2 H), 7.08 (br d, J=8.25 Hz, 1 H), 6.90 (br s, 2 H), 3.55 - 3.63 (m, 2 H), 3.45 - 3.53 (m, 2 H), 3.07 - 3.30 (m, 4 H), 2.96 (s, 6 H). MS (M + H) + = 533.2.
[0605] Example 36 - Synthesis of Compound 184A [ka] 2-[(3-Bromo-6-chloro-4-quinolyl)amino]benzoic acid (50 mg, 132.41 μmol, 1 equiv.), tetrahydropyran-4-amine (20.09 mg, 198.61 μmol, 1.5 equiv.), Pd(OAc) (2.97 mg, 13.24 μmol, 0.1 equiv.), DPPF (7.34 mg, 13.24 μmol, 0.1 equiv.), and t-BuONa (38.17 mg, 397.23 μmol, 3 equiv.) were placed in a microwave tube in DMF (2 mL). The sealed tube was heated in a microwave oven at 120 °C for 30 min. LCMS showed complete consumption of the starting material and the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-35%, 8 min). The compound 2-[[6-chloro-3-(tetrahydropyran-4-ylamino)-4-quinolyl]amino]benzoic acid (4.58 mg, 10.33 umol, yield 7.80%, purity 98.33%, HCl) was obtained as a brown oil.1 H NMR (400 MHz, DMSO-d6) δ = 9.59 (br s, 1H), 8.92 (s, 1H), 8.11 (br d, J = 8.9 Hz, 1H), 7.97 (dd, J = 1.1, 7.8 Hz, 1H), 7.65 - 7.57 (m, 2H), 7.38 - 7.25 (m, 1H), 6.92 (t, J = 7.6 Hz, 1H), 6.36 (br d, J = 8.3 Hz, 1H), 3.83 (br d, J = 10.5 Hz, 3H), 3.38 (br s, 2H), 1.79 (br d, J = 1.9 Hz, 2H), 1.53 - 1.37 (m, 2H). MS (M + H) + = 398.1.
[0606] Example 37-Synthesis of Compound 185A
change
[0607] Step 2. Synthesis of 2-[[6-chloro-3-[(4,4-difluorocyclohexyl)amino]-4-quinolyl]amino]benzoic acid (185A): To a solution of methyl 2-[[6-chloro-3-[(4,4-difluorocyclohexyl)amino]-4-quinolyl]amino]benzoate (15 mg, 33.64 μmol, 1 equiv.) in THF (0.3 mL), LiOH (2 M, 33.64 μL, 2 equiv.) was added and the mixture was stirred at 20 °C for 2 h. LCMS showed complete consumption of the starting material and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.05% HCl)-ACN]; B%: 30%-70%, 8 min) to give compound 2-[[6-chloro-3-[(4,4-difluorocyclohexyl)amino]-4-quinolyl]amino]benzoic acid (2.87 mg, 6.13 umol, yield 18.22%, purity 100%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 9.42 (br s, 1 H), 8.88 (s, 1 H), 7.94 - 8.03 (m, 2 H), 7.44 - 7.58 (m, 2 H), 7.28 (t, J =7.58 Hz, 1 H), 6.75 - 6.91 (m, 1 H), 6.22 (br s, 1 H), 5.62 (br s, 1 H), 3.88 (br s, 1 H), 1.83 - 2.04 (m, 6 H), 1.56 (br d, J =9.05 Hz, 2 H). MS (M + H) + = 432.1
[0608] Example 38 - Synthesis of Compound 186A [ka] Step 1. Synthesis of tert-butyl 4-[[6-chloro-4-(2-methoxycarbonylanilino)-3-quinolyl]amino]piperidine-1-carboxylate (2): To a solution of methyl 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoate (200 mg, 510.67 umol, 1 equiv.) in toluene (3 mL), tert-butyl 4-aminopiperidine-1-carboxylate (102.27 mg, 510.67 umol, 1 equiv.), BRETTPHOS (27.41 mg, 51.07 umol, 0.1 equiv.), BrettPhos Pd G3 (46.29 mg, 51.07 umol, 0.1 equiv), sodium; 2-methylpropan-2-olate (98.15 mg, 1.02 mmol, 2 equiv) were added, and N2 was bubbled through the mixture for 1 minute. The mixture was stirred at 100 °C for 12 hours. LCMS showed that the starting material was completely consumed, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25 mm*3 um; mobile phase: [water (0.04% HCl)-ACN]; B%: 40%-60%, 8 min) to give the compound tert-butyl 4-[[6-chloro-4-(2-methoxycarbonylanilino)-3-quinolyl]amino]piperidine-1-carboxylate (25 mg, 48.92 umol, 9.58% yield) as a yellow solid. MS (M + H) + =511.3
[0609] Step 2. Synthesis of methyl 2-[[6-chloro-3-(4-piperidylamino)-4-quinolyl]amino]benzoate (3): A solution of tert-butyl 4-[[6-chloro-4-(2-methoxycarbonylanilino)-3-quinolyl]amino]piperidine-1-carboxylate (15 mg, 29.35 umol, 1 equiv.) in HCl / EtOAc (1.0 mL) was stirred at 20 °C for 1 hour. LCMS showed that the starting material was completely consumed, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. Compound methyl 2-[[6-chloro-3-(4-piperidylamino)-4-quinolyl]amino]benzoate (10 mg, 24.34 umol, 82.91% yield) was obtained as a yellow solid. MS (M + H) + =411.4
[0610] Step 3. Synthesis of 2-[[6-chloro-3-(4-piperidylamino)-4-quinolyl]amino]benzoic acid (186A): To a solution of methyl 2-[[6-chloro-3-(4-piperidylamino)-4-quinolyl]amino]benzoate (10 mg, 24.34 μmol, 1 equiv.) in THF (0.5 mL), LiOH (582.83 μg, 24.34 μmol, 1 equiv.) was added and the mixture was stirred at 60 °C for 2 hours. LCMS showed complete consumption of the starting material and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 5%-40%, 8 min) to give the compound 2-[[6-chloro-3-(4-piperidylamino)-4-quinolyl]amino]benzoic acid (2.05 mg, 16.15 umol, yield 66.38%, purity 100%, HCl) as a yellow solid. 1H NMR (400 MHz, DMSO-d6+D2O) δ ppm 8.87 (s, 1 H), 7.91 - 8.02 (m, 2 H), 7.49 - 7.56 (m, 2 H), 7.25 - 7.34 (m, 1 H), 6.86 (t, J = 7.50 Hz, 1 H), 1.56 - 1.66 (m, 2 H). MS (M + H) + =397.2.
[0611] Example 39-Synthesis of Compound 188A
change
[0612] Step 2. Synthesis of 2-[[6-chloro-3-[(1,1-dioxothian-4-yl)amino]-4-quinolyl]amino]benzoic acid (188A): To a solution of methyl 2-[[6-chloro-3-[(1,1-dioxothian-4-yl)amino]-4-quinolyl]amino]benzoate (10 mg, 21.74 μmol, 1 equiv.) in THF (0.5 mL), LiOH (2 M, 10.87 μL, 1 equiv.) was added and stirred at 60 °C for 2 h. LCMS showed complete consumption of the starting material and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 5%-35%, 8 min) to give compound 2-[[6-chloro-3-[(1,1-dioxothian-4-yl)amino]-4-quinolyl]amino]benzoic acid (1.43 mg, 2.96 umol, yield 13.63%, purity 100%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 8.84 (s, 1 H), 7.90 - 8.06 (m, 2 H), 7.53 - 7.64 (m, 2 H), 7.28 - 7.36 (m, 1 H), 6.91 (t, J =7.50 Hz, 1 H), 6.84 - 6.99 (m, 1 H), 6.30 (d, J =8.38 Hz, 1 H), 3.18 - 3.32 (m, 2 H), 3.08 (br d, J =12.51 Hz, 2 H), 2.09 - 2.19 (m, 2 H), 2.02 (br s, 2 H). MS (M + H) + =446.1
[0613] Example 40 - Synthesis of Compound 191A [ka] Step 1. Synthesis of methyl 2-[[6-chloro-3-(pyrimidin-5-ylamino)-4-quinolyl]amino]benzoate (2): To a solution of methyl 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoate (100 mg, 255.33 umol, 1 equiv.) in 2-methylbutan-2-ol (1.5 mL), sodium 2-methylpropan-2-olate (49.08 mg, 510.67 umol, 2 equiv.), tBuXPhos Pd G3 (20.28 mg, 25.53 umol, 0.1 equiv.) and t-Bu Xphos (10.84 mg, 25.53 umol, 0.1 equiv.) and pyrimidin-5-amine (24.28 mg, 255.33 umol, 1 equiv.) were added, N2 was bubbled through for 1 minute, and the mixture was stirred at 100 °C for 12 hours. LCMS showed that the starting material was completely consumed, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25 mm*3 um; mobile phase: [water (0.04% HCl)-ACN]; B%: 10%-30%, 8 min) to give the compound methyl 2-[[6-chloro-3-(pyrimidin-5-ylamino)-4-quinolyl]amino]benzoate (15 mg, 33.91 umol, 13.28% yield, HCl) as a yellow solid. MS (M + H) + =406.2
[0614] Step 2. Synthesis of 2-[[6-chloro-3-(pyrimidin-5-ylamino)-4-quinolyl]amino]benzoic acid (191A): To a solution of methyl 2-[[6-chloro-3-(pyrimidin-5-ylamino)-4-quinolyl]amino]benzoate (5 mg, 12.32 μmol, 1 equiv.) in THF (0.3 mL), LiOH (2 M, 12.32 μL, 2 equiv.) was added, and the mixture was stirred at 50 °C for 2 h. LCMS showed complete consumption of the starting material, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Welch Xtimate C18 100*25 mm*3 μm; mobile phase: [water (0.04% HCl)-ACN]; B%: 10%-40%, 8 min). The compound 2-[[6-chloro-3-(pyrimidin-5-ylamino)-4-quinolyl]amino]benzoic acid (0.82 mg, 1.75 umol, 14.19% yield, 91.32% purity, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 10.27 (s, 1 H), 8.82 (s, 1 H), 8.61 (s, 1 H), 8.45 (s, 1 H), 8.22 (s, 1 H), 8.08 (d, J =8.92 Hz, 1 H), 7.92 (s, 2 H), 7.88 (br d, J = 9.17 Hz, 1 H), 7.72 (d, J =7.58 Hz, 1 H), 7.34 (t, J = 7.52 Hz, 1 H), 6.98 (t, J =7.58 Hz, 1 H), 6.66 (d, J =8.31 Hz, 1 H). MS (M + H) + =392.1.
[0615] Synthesis of Example 41-204A [ka] Step 1. Synthesis of methyl 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoate (2): A solution of 3-bromo-4,6-dichloroquinoline (350 mg, 1.26 mmol, 1 equiv.), methyl 2-aminobenzoate (191.04 mg, 1.26 mmol, 163.28 uL, 1 equiv.), and HCl (12 M, 10.53 uL, 0.1 equiv.) in EtOH (5 mL) and CHCl (1 mL) was stirred at 80 °C for 12 hours. LCMS showed complete consumption of the starting material and the desired MS was detected. The reaction mixture was concentrated in vacuo. The compound methyl 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoate (450 mg, 1.15 mmol, 90.92% yield) was obtained as a yellow solid. MS (M + H) + = 393.2.
[0616] Step 2. Synthesis of methyl 2-[[6-chloro-3-(3,6-dihydro-2H-pyran-4-yl)-4-quinolyl]amino]benzoate (3): To a stirred solution of methyl 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoate (250 mg, 638.33 umol, 1 equiv.) in DMF (2 mL) and HO (0.4 mL) was added 2-(3,6-dihydro (2H-pyran-4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (134.10 mg, 638.33 μmol, 1 equiv.), Pd(PPh3)4 (73.76 mg, 63.83 μmol, 0.1 equiv.), and K3PO4 (406.49 mg, 1.91 mmol, 3 equiv.) were added, and the mixture was bubbled with N2 for 1 minute and stirred at 100 °C for 2 hours. LCMS showed complete consumption of the starting material and the desired MS was detected. The reaction mixture was poured into water (50 mL). The aqueous phase was extracted with ethyl acetate (50 mL * 2). The combined organic phase was dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The residue was purified by flash column (ISCO 10 g silica, 25-30% ethyl acetate in petroleum ether, gradient 15 min). TLC (petroleum ether:ethyl acetate = 1 / 1, R f=0.37). The compound methyl 2-[[6-chloro-3-(3,6-dihydro-2H-pyran-4-yl)-4-quinolyl]amino]benzoate (160 mg, 405.22 μmol, 63.48% yield) was obtained as a yellow solid. MS (M + H) + = 395.2.
[0617] Step 3. Synthesis of methyl 2-[(6-chloro-3-tetrahydropyran-4-yl-4-quinolyl)amino]benzoate (4): A solution of methyl 2-[[6-chloro-3-(3,6-dihydro-2H-pyran-4-yl)-4-quinolyl]amino]benzoate (60 mg, 151.96 μmol, 1 equiv.) and PtO (30 mg, 132.11 μmol, 8.69 e-1 equiv.) in EtOAc (1 mL) was stirred at 20 °C under N. The mixture was bubbled with H three times and stirred under H (15 psi) at 20 °C for 2 h. LCMS indicated complete consumption of the starting material and the desired MS was detected. The reaction mixture was filtered, and the filtrate was concentrated in vacuo. The compound methyl 2-[(6-chloro-3-tetrahydropyran-4-yl-4-quinolyl)amino]benzoate (40 mg, 100.79 μmol, yield 66.33%) was obtained as a yellow oil. MS (M + H) + = 395.2.
[0618] Step 4. Synthesis of 2-[(6-chloro-3-tetrahydropyran-4-yl-4-quinolyl)amino]benzoic acid (204A): To a solution of methyl 2-[(6-chloro-3-tetrahydropyran-4-yl-4-quinolyl)amino]benzoate (30.00 mg, 75.59 μmol, 1 equiv.) in THF (2 mL), LiOH.HO (6.34 mg, 151.18 μmol, 2 equiv.) was added, and the mixture was stirred at 50 °C for 2 h. LCMS showed that the starting material was completely consumed, and MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Phenomenex Gemini-NX 80*30 mm*3 μm; mobile phase: [water (0.04% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[(6-chloro-3-tetrahydropyran-4-yl-4-quinolyl)amino]benzoic acid (2.40 mg, 35.17 umol, 46.52% yield, 98.30% purity, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d 6+ D2O) δ = 8.90 (s, 1H), 8.02 (d, J = 9.0 Hz, 1H), 7.92 (dd, J= 1.2, 7.8 Hz, 1H), 7.71 (dd, J = 2.3, 8.9 Hz, 1H), 7.66 (d, J = 2.2 Hz, 1H), 7.19 - 7.11 (m, 1H), 6.77 (t, J = 7.5 Hz, 1H), 6.06 (d, J= 8.3 Hz, 1H), 3.96 - 3.85 (m, 2H), 3.43 - 3.31 (m, 1H), 3.28 - 3.17 (m, 1H), 3.16 - 3.04 (m, 1H), 2.04 - 1.88 (m, 1H), 1.85 - 1.71 (m, 1H), 1.70 - 1.63 (m, 1H), 1.59 - 1.49 (m, 1H). MS (M + H) + = 383.2.
[0619] Example 42 - Synthesis of Compound 204A-BP [ka] A solution of 2-[[6-chloro-3-(3,6-dihydro-2H-pyran-4-yl)-4-quinolyl]amino]benzoic acid (80 mg, 210.07 umol, 1 equiv.) and PtO2 (47.70 mg, 210.07 umol, 1 equiv.) in EtOAc (1 mL) was stirred under N2 at 20 °C, purged with H2 three times, and stirred under H2 (15 psi) at 20 °C for 15 min. LCMS showed that the product was detected. The reaction mixture was filtered, and the filtrate was concentrated in vacuo. The residue was purified by preparative HPLC (column: Phenomenex luna C18 80*40 mm*3 um; mobile phase: [water (0.04% HCl)-ACN]; B%: 30%-37%, 5.5 min). 10 mg of crude product was obtained. The crude product was purified by preparative HPLC (column: Phenomenex Luna C18 100*30mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 10%-30%, 8 min). The compound 2-[(3-tetrahydropyran-4-yl-5,6,7,8-tetrahydroquinolin-4-yl)amino]benzoic acid (3.03 mg, 7.57 umol, yield 3.60%, purity 97.19%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ = 9.75 (s, 1H), 8.39 (s, 1H), 7.98 - 7.90 (m, 1H), 7.55 - 7.43 (m, 1H), 7.11 (t, J = 7.6 Hz, 1H), 6.71 (d, J = MS (M + H) + = 353.2.
[0620] Example 43 - Synthesis of Compound 204A-INT [ka] To a solution of 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoic acid (100 mg, 264.82 μmol, 1 equiv.) in DMF (2.5 mL) and HO (0.5 mL) was added CsCO (258.85 mg, 794.45 μmol, 3 equiv.), Pd(dppf)Cl (19.38 mg, 26.48 μmol, 0.1 equiv.), and 2-(3,6-dihydro-2H-pyran-4-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (50.07 mg, 238.34 μmol, 0.9 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Phenomenex Luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 35%-55%, 7 min) to give the crude product (28 mg). The crude product was purified by preparative HPLC (column: Phenomenex Luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 15%-45%, 7 min) to give the compound 2-[[6-chloro-3-(3,6-dihydro-2H-pyran-4-yl)-4-quinolyl]amino]benzoic acid (20 mg, 46.93 umol, yield 17.72%, purity 97.91%, HCl) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm = 8.71 (br s, 1 H), 8.59 - 8.65 (m, 1 H), 8.06 - 8.13 (m, 1 H), 8.00 - 8.05 (m, 1 H), 7.97 (d, J=8.00 Hz, 1 H), 7.51 - 7.61 (m, 1 H), 7.28 - 7.38 (m, 1 H), 7.35 (t, J=7.57 Hz, 1 H), 7.12 (br d, J=7.75 Hz, 1 H), 5.77 (br s, 1 H), 3.82 (br s, 2 H), 3.02 - 3.18 (m, 2H), 2.03 (br s, 2H). MS (M + H) + = 381.1
[0621] Example 44 - Synthesis of Compound 205A [ka] Step 1: Synthesis of 2-[[6-chloro-3-(4,4-difluorocyclohexen-1-yl)-4-quinolyl]amino]benzoic acid (205A_INT): To a solution of 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoic acid (100 mg, 264.82 μmol, 1 equiv.) in DMF (2.5 mL) and HO (0.5 mL) was added CsCO (258.85 mg, (794.45 μmol, 3 equiv.), Pd(dppf)Cl (19.38 mg, 26.48 μmol, 0.1 equiv.), and 2-(4,4-difluorocyclohexen-1-yl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (58.17 mg, 238.34 μmol, 0.9 equiv.) were added, N was bubbled through for 1 min, and the mixture was stirred at 100° C. for 2 h. LCMS indicated complete consumption of the starting material and the MS of the desired product was detected. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Phenomenex luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 25%-55%, 7 min) to give the compound 2-[[6-chloro-3-(4,4-difluorocyclohexen-1-yl)-4-quinolyl]amino]benzoic acid (29.5 mg, 63.45 umol, yield 23.96%, purity 97.07%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.35 (br s, 1 H), 8.60 - 8.74 (m, 2 H), 8.10 - 8.19 (m, 1 H), 7.92 - 8.05 (m, 2 H), 7.55 (t, J=7.63 Hz, 1 H), 7.31 (br t, J=7.44 Hz, 1 H), 7.10 (br d, J=6.50 Hz, 1 H), 5.64 (br s, 1 H), 2.20 - 2.41 (m, 4 H), 1.46 (br s, 2 H). MS (M + H )+= 415.1
[0622] Step 2: Synthesis of 2-[[6-chloro-3-(4,4-difluorocyclohexyl)-4-quinolyl]amino]benzoic acid (205A): A solution of 2-[[6-chloro-3-(4,4-difluorocyclohexen-1-yl)-4-quinolyl]amino]benzoic acid (80 mg, 192.85 μmol, 1 equiv) and PtO (20 mg, 88.08 μmol, 4.57 e-1 equiv) in EtOAc (1 mL) was purged with H three times and stirred under H (15 psi) at 20 °C for 15 min. LCMS indicated complete consumption of the starting material and the desired MS was detected. The reaction mixture was filtered, and the filtrate was concentrated in vacuo. The residue was purified by preparative HPLC (column: Welch Xtimate C18 100*25mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 10%-40%, 8 min). Compound 2-[[6-chloro-3-(4,4-difluorocyclohexyl)-4-quinolyl]amino]benzoic acid (0.23 mg, 5.07e-1 umol, yield 2.63e-1%, purity 100%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6+D2O) δ = 8.88 (s, 1H), 8.05 (d, J = 8.6 Hz, 1H), 7.99 - 7.92 (m, 1H), 7.82 - 7.74 (m, 1H), 7.69 (s, 1H), 7.36 - MS (M + H) + = 417.1.
[0623] Example 45 - Synthesis of Compound 206A-INT [ka] To a solution of 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoic acid (100 mg, 264.82 μmol, 1 equiv.) in HO (0.5 mL) and DMF (2.5 mL) was added CsCO (258.85 mg, 794.45 μmol, 3 equiv.), Pd(dppf)Cl (19.38 mg, 26.48 μmol, 0.1 equiv.), and 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6-tetrahydropyridine (49.83 mg, 238.34 μmol, 0.9 equiv.), N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Phenomenex luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 12%-42%, 7 min) to give compound 2-[[6-chloro-3-(1,2,3,6-tetrahydropyridin-4-yl)-4-quinolyl]amino]benzoic acid (25 mg, 58.98 umol, yield 22.27%, purity 98.22%, HCl) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm 10.29 (br s, 1 H), 9.14 (br s, 2 H), 8.56 (s, 1 H), 8.49 (br s, 1 H), 8.17 (d, J=9.01 Hz, 1 H), 7.89 - 8.05 (m, MS (M+H )+ = 380.0
[0624] Example 46 - Synthesis of Compound 206A [ka] Step 1. Synthesis of 2-[[3-(1-tert-butoxycarbonyl-4-piperidyl)-6-chloro-4-quinolyl]amino]benzoic acid (2): 2-[[3-(1-tert-butoxycarbonyl-3,6-dihydro-2H-pyridin-4-yl)-6-chloro-4-quinolyl]amino]benzoic acid (80 mg, 166.68 µmol, 1 equiv.) and PtO2 (37.85 mg, 166.68 µmol, 1 equiv.) in EtOAc (2 mL) were bubbled with H2 three times and stirred under H2 (15 psi) at 15 °C for 15 min. LCMS showed starting material remaining and 20% of the desired product was detected. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Phenomenex Luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 32%-50%, 7 min). The compound 2-[[3-(1-tert-butoxycarbonyl-4-piperidyl)-6-chloro-4-quinolyl]amino]benzoic acid (10 mg, 19.29 umol, 11.57% yield, HCl) was obtained as a yellow solid. MS (M + H) + = 482.3.
[0625] Step 2. Synthesis of 2-[[6-chloro-3-(4-piperidyl)-4-quinolyl]amino]benzoic acid (206A): A solution of 2-[[3-(1-tert-butoxycarbonyl-4-piperidyl)-6-chloro-4-quinolyl]amino]benzoic acid (10 mg, 20.75 μmol, 1 equiv) in HCl / EtOAc (4 M, 2 mL, 385.58 equiv) was stirred at 20 °C for 1 h. LCMS showed complete consumption of the starting material and the desired MS was detected. The reaction mixture was concentrated in vacuo. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 80*40 mm*3 μm; mobile phase: [water (0.04% HCl)-ACN]; B%: 5%-45%, 7 min). The compound 2-[[6-chloro-3-(4-piperidyl)-4-quinolyl]amino]benzoic acid (0.83 mg, 1.98 umol, 9.56% yield, 100% purity, HCl) was obtained as a yellow oil. 1H NMR (400 MHz, DMSO-d6+D2O) δ = 8.83 (s, 1H), 8.07 (d, J = 9.0 Hz, 1H), 7.98 (dd, J= 1.6, 7.9 Hz, 1H), 7.83 (dd, J = 2.3, 9.0 Hz, 1H), 7.66 (d, J = 2.3 Hz, 1H), 7.38 (dt, J = 1.6, 7.8 Hz, 1H), 7.05 (t, J = 7.6 Hz, 1H), 6.52 (d, J = 8.4 Hz, 1H), 3.36 (br d, J = 12.6 Hz, 2H), 3.21 - 3.11 (m, 1H), 2.99 - 2.78 (m, 2H), 2.17 - 1.81 (m, 4H). MS (M + H) + = 382.1.
[0626] Example 47-Synthesis of Compound 207A
change
[0627] Step 2. Synthesis of 2-[[6-chloro-3-(1-methyl-4-piperidyl)-4-quinolyl]amino]benzoic acid (207A): A solution of 2-[[6-chloro-3-(1-methyl-3,6-dihydro-2H-pyridin-4-yl)-4-quinolyl]amino]benzoic acid (10 mg, 25.39 μmol, 1 equiv.) and PtO (2 mg, 8.81 μmol, 3.47 e-1 equiv.) in EtOAc (1 mL) was stirred at 15 °C under N. The mixture was purged with H three times and stirred under H (15 psi) at 15 °C for 15 min. LCMS indicated complete consumption of the starting material and the desired MS was detected. The reaction mixture was filtered, and the filtrate was directly purified. The filtrate was purified by preparative HPLC (column: Phenomenex Gemini NX-C18 (75*30mm*3um); mobile phase: [water (0.04% HCl)-ACN]; B%: 3%-30%, 8 min). The compound 2-[[6-chloro-3-(1-methyl-4-piperidyl)-4-quinolyl]amino]benzoic acid (1.54 mg, 3.56 umol, yield 14.03%, purity 100%, HCl) was obtained as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ = 10.38 - 10.27 (m, 1H), 9.95 (br s, 1H), 8.87 (s, 1H), 8.15 (d, J = 8.9 Hz, 1H), 7.99 (d, J = 7.9 Hz, 1H), 7.86 (dd, J = 2.3, 8.9 Hz, 1H), 7.73 (d, J = 2.2 Hz, 1H), 7.37 (br t, J = 7.4 Hz, 1H), 7.05 - 6.98 (m, 1H), 6.58 - 6.44 (m, 1H), 3.51 - 3.47 (m, 2H), 3.18 - 3.13 (m, 1H), 3.02 - 2.93 (m, 2H), 2.74 (br d, J = 4.5 Hz, 3H), 2.14 - 1.90 (m, 4H). MS (M + H) + = 396.1.
[0628] Example 48-Synthesis of Compound 208A_INT
change
[0629] Synthesis of Example 49-208A [ka] Step 1. Synthesis of methyl 2-[[6-chloro-3-(1,1-dioxothian-4-yl)-4-quinolyl]amino]benzoate (2): To a stirred solution of methyl 2-[(6-chloro-3-tetrahydrothiopyran-4-yl-4-quinolyl)amino]benzoate (15 mg, 36.33 μmol, 1 equiv.) in MeOH (0.2 mL) and HO (0.2 mL) was added NaIO (31.08 mg, 145.30 μmol, 8.05 μL, 4 equiv.) at 0 °C, and the mixture was then stirred at 70 °C for 12 h. LCMS showed that the starting material was completely consumed and the desired MS was detected. The reaction mixture was poured into water (5 mL). The aqueous phase was extracted with ethyl acetate (5 mL * 2). The combined organic phase was dried over anhydrous NaSO, filtered, and concentrated in vacuo. The compound methyl 2-[[6-chloro-3-(1,1-dioxothian-4-yl)-4-quinolyl]amino]benzoate (15 mg, 33.71 μmol, 92.81% yield) was obtained as a yellow solid. MS (M + H) + = 445.2.
[0630] Step 2. Synthesis of 2-[[6-chloro-3-(1,1-dioxothian-4-yl)-4-quinolyl]amino]benzoic acid (208A): To a stirred solution of methyl 2-[[6-chloro-3-(1,1-dioxothian-4-yl)-4-quinolyl]amino]benzoate (15 mg, 33.71 μmol, 1 equiv.) in THF (0.5 mL) and MeOH (0.5 mL), LiOH.HO (2 M, 33.71 μL, 2 equiv.) was added at 25 °C, and the mixture was then stirred at 60 °C for 1 h. LCMS showed that the starting material was completely consumed and the desired MS was detected. The reaction mixture was adjusted to pH 4 by adding 2 N HCl. The mixture was then concentrated in vacuo. The residue was purified by preparative HPLC (column: Phenomenex luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 16%-41%, 7 min). Compound 2-[[6-chloro-3-(1,1-dioxothian-4-yl)-4-quinolyl]amino]benzoic acid (8.50 mg, 17.88 umol, yield 53.04%, purity 98.32%, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6+D2O) δ = 8.80 (s, 1H), 8.05 - 7.95 (m, 2H), 7.85 (dd, J = 2.3, 9.0 Hz, 1H), 7.63 (d, J = 2.3 Hz, 1H), 7.50 - 7.43 (m, 1H), 7.26 - 7.17 (m, 1H), 6.81 (d, J = 7.8 Hz, 1H), 3.26 - 3.06 (m, 5H), 2.54 (s, 1H), 2.16 (br d, J = 1.6 Hz, 3H). + = 431.0.
[0631] Example 50 - Synthesis of Compound 209A [ka] Synthesis of 2-[[6-chloro-3-(4-pyridyl)-4-quinolyl]amino]benzoic acid (209A): To a solution of 4-pyridylboronic acid (22.19 mg, 180.54 μmol, 1 equiv.) in HO (0.2 mL) and DMF (1 mL), CsCO (176.47 mg, 541.62 μmol, 3 equiv.), Pd(dppf)Cl (13.21 mg, 18.05 μmol, 0.1 equiv.), and 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoic acid (68.18 mg, 180.54 μmol, 1 equiv.) were added. N was bubbled through for 1 min, and the mixture was stirred at 100 °C for 2 h. LCMS indicated complete consumption of the starting material and the MS of the desired product. The reaction mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (column: Phenomenex luna C18 80*40mm*3um; mobile phase: [water (0.04% HCl)-ACN]; B%: 15%-35%, 7 min). The crude product (20 mg) was obtained. The crude product was purified by preparative HPLC (column: Waters Xbridge BEH C18 100*30mm*10um; mobile phase: [water (0.04% HCl)-ACN]; B%: 4%-34%, 8 min) to give the compound 2-[[6-chloro-3-(4-pyridyl)-4-quinolyl]amino]benzoic acid (4.32 mg, 11.11 umol, yield 6.15%, purity 96.64%) as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ ppm = 10.10 (br s, 1 H), 8.92 (s, 1 H), 8.51 (d, J=5.99 Hz, 2 H), 8.14 (d, J=8.92 Hz, 1 H), 8.07 (d, J=2.32 Hz, 1 H), 7.86 (dd, J=9.05, 2.32 Hz, 1 H), 7.82 (dd, J=7.89, 1.53 Hz, 1 H), 7.45 - 7.51 (m, 2 H), 7.01 - 7.11 (m, 1 H), 6.71 (t, J=7.52 Hz, 1 H), 6.30 (d, J=8.31 Hz, 1 H). MS (M + H) + = 376.1
[0632] Example 51 - Synthesis of Compound 211A [ka] Step 1: Synthesis of methyl 2-[(6-chloro-3-thiazol-2-yl-4-quinolyl)amino]benzoate (2): To a stirred solution of methyl 2-[(3-bromo-6-chloro-4-quinolyl)amino]benzoate (100 mg, 255.33 μmol, 1 equiv.) in dioxane (5 mL), tributyl(thiazol-2-yl)stannane (95.54 mg, 255.33 μmol, 1 equiv.), [2-(2-aminophenyl)phenyl]chloropalladium; and bis(1-adamantyl)-butyl-phosphane (17.07 mg, 25.53 μmol, 0.1 equiv.) were added. N was bubbled through the mixture for 1 minute and stirred at 110 °C for 12 hours. LCMS indicated complete consumption of the starting material and the desired product was detected. The reaction mixture was concentrated in vacuo. The residue was purified by preparative HPLC (column: Phenomenex Gemini-NX 80*40mm*3um; mobile phase: [water (10mM NH4HCO3)-ACN]; B%: 40%-70%, 8 min). Compound methyl 2-[(6-chloro-3-thiazol-2-yl-4-quinolyl)amino]benzoate (25mg, 57.83umol, yield 22.65%, HCl) was obtained as a yellow solid. MS (M + H) + = 396.1.
[0633] Synthesis of 2-[(6-chloro-3-thiazol-2-yl-4-quinolyl)amino]benzoic acid (211A) A solution of methyl 2-[(6-chloro-3-thiazol-2-yl-4-quinolyl)amino]benzoate (20 mg, 50.52 μmol, 1 equiv.) and LiOH (2 M, 50.52 μL, 2 equiv.) in THF (0.5 mL) was stirred at 25° C. for 2 hours. LCMS showed complete consumption of the starting material and the desired MS was detected. The reaction mixture was concentrated in vacuo. The residue was purified by preparative HPLC (column: Welch Xtimate C18 100*25 mm*3 μm; mobile phase: [water (0.05% HCl)-ACN]; B%: 15%-45%, 8 min). The compound 2-[(6-chloro-3-thiazol-2-yl-4-quinolyl)amino]benzoic acid (9.15 mg, 20.87 μmol, 41.31% yield, 95.41% purity, HCl) was obtained as a yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ = 11.79 (br s, 1H), 9.48 (s, 1H), 8.26 - 8.18 (m, 1H), 8.03 - 7.97 (m, 2H), 7.97 ...
Claims
1. Compound of formula (VIII): 【Chemistry 1】 wherein: X 1 is O, S, CF 2 , C=O, CHCl, CHF, CCl 2 , C=N-OH, NH, NCH 3 , Si(OH) 2 , S.O. 2 and cyclopropylidene; each 【Chemistry 2】 are independently a single bond or a double bond, with the proviso that 【Transformation 3】 provided that no more than two of the R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 Haloalkoxy, halo, CN and NO 2 selected from the group consisting of: W is C(O)OR 8 and carboxylic acid bioisosteres (bioisosteres); R 8 is H and C 1-6 selected from the group consisting of alkyl; R 3 is a halo; and Each R 7 Ha, Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, C 1-3 Haloalkoxy and C 1-3 a compound independently selected from the group consisting of alkoxy, or a pharmaceutically acceptable salt thereof.
2. X 1 But O, S, CF 2 , CHCl, CCl 2 , N.H., N.C.H. 3 , Si(OH) 2 , S.O. 2 and cyclopropylidene, or a pharmaceutically acceptable salt thereof.
3. R 1 , R 2 , R 4 and R 5 are each independently H, C 1-3 Alkyl, C 1-3 Alkoxy, C 1-4 Haloalkyl, C 1-4 3. The compound of claim 1 or 2, selected from the group consisting of haloalkoxy and halo. or a pharmaceutically acceptable salt thereof.
4. R 1 , R 2 , R 4 and R 5 are each independently H and C 1-3 The compound according to claim 1 or 2, wherein the compound is selected from the group consisting of alkyl, or a pharmaceutically acceptable salt thereof.
5. C(O)OR 8 3. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof.
6. 3. The compound of claim 1 or 2, wherein W is a carboxylic acid bioisostere. or a pharmaceutically acceptable salt thereof.
7. W is the following part: 【Chemistry 4】 The compound according to claim 6, selected from any one of or a pharmaceutically acceptable salt thereof.
8. The compound of formula (VIII) has the formula: 【Transformation 5】 The compound of claim 1 having the formula: or a pharmaceutically acceptable salt thereof.
9. The compound of formula (VIII) has the formula: 【Transformation 6】 The compound of claim 1 having the formula: or a pharmaceutically acceptable salt thereof.
10. formula: 【Transformation 7】 10. The compound of claim 1 having the formula: R 3 is selected from the group consisting of Cl, Br and F; and R 7 But, Halo, C 1-3 Alkyl, and C 1-3 a compound selected from the group consisting of alkoxy, or a pharmaceutically acceptable salt thereof.
11. The following formula: 【Chemistry 8-1】 【Chemistry 8-2】 【Chemistry 8-3】 10. The compound of claim 1, having any one of: R 3 is selected from the group consisting of Cl, Br and F; and R 7 But, Halo, C 1-3 Alkyl, and C 1-3 a compound selected from the group consisting of alkoxy, or a pharmaceutically acceptable salt thereof.
12. The compound of claim 1 selected from any one of the following compounds: 【Chemistry 9-1】 【Chemistry 9-2】 【Chemistry 9-3】 【Chemistry 9-4】 【Chemistry 9-5】 【Chemistry 9-6】 【Chemistry 9-7】 【Chemistry 9-8】 【Chemistry 9-9】 or a pharmaceutically acceptable salt thereof.
13. 3. A pharmaceutical composition comprising the compound of claim 1 or 2 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
14. 14. The pharmaceutical composition of claim 13 for treating or preventing a disease or condition selected from the group consisting of disorders associated with telomere or telomerase dysfunction, age-related disorders, pre-leukemia or pre-cancerous conditions, HBV infection, HAV infection, CMV infection, neurodevelopmental disorders, and acquired or inherited diseases or conditions associated with RNA alterations.
15. 15. The pharmaceutical composition of claim 14, wherein the disorder associated with telomere or telomerase dysfunction is dyskeratosis congenita, aplastic anemia, myelodysplastic syndrome, pulmonary fibrosis, interstitial lung disease, hematological disorder, liver disease or liver fibrosis.
16. 15. The pharmaceutical composition of claim 14, wherein the age-related disorder is macular degeneration, diabetes mellitus, osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular disease, hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, or age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, or hearing.
17. 15. The pharmaceutical composition of claim 14, wherein the neurodevelopmental disorder is pontocerebellar hypoplasia.
18. A method for growing cells, comprising culturing cells in the presence of an effective amount of the compound of claim 1 or 2 or a pharmaceutically acceptable salt thereof.
19. 19. The method of claim 18, wherein the cells are selected from the group consisting of stem cells, pluripotent stem cells, hematopoietic stem cells, and embryonic stem cells.
20. 19. The method of claim 18, wherein the cell is derived from a subject having a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction, an age-related disorder, a pre-leukemia or pre-cancerous condition, and a neurodevelopmental disorder.
21. 19. The method of claim 18, wherein the cell is a chimeric antigen receptor (CAR) T cell.
22. 19. The method of claim 18, wherein the cell is a T cell, a genetically modified T cell, or a natural killer cell (NK).