Antibody to bradykinin b1 receptor ligand

Abstract

To provide a novel pharmaceutical to be used in treating a bradykinin B1 receptor-mediated pathology, and inhibits binding of kallidin and des-Arg10- kallidin to a bradykinin B1 receptor.SOLUTION: Provided is an isolated monoclonal antibody that a) specifically binds to kallidin or des-Arg10- kallidin, but does not specifically bind to bradykinin or des-Arg9- bradykinin, and b) specifically binds to kallidin or des-Arg10- kallidin, and inhibits binding to a bradykinin B1 receptor, or an antigen-binding fragment thereof.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 61 / 616,845, filed March 28, 2012, and French Patent Application No. 1350953, filed February 4, 2013, the contents of which are each incorporated herein by reference in their entirety. [Background technology]

[0002] Bradykinin B1 receptors have been implicated in the pathogenesis of inflammatory diseases and chronic pain. By modulating tissue inflammation and renal fibrosis, B1 receptors are also involved in the pathogenesis of acute kidney injury and chronic kidney disease, the leading cause of end-stage renal failure.

[0003] In humans, the primary agonists of the bradykinin B1 receptor are kinins. Kinins are bioactive peptides generated from the proteolytic cleavage of kininogen proteins. The primary kinin agonists of the bradykinin B1 receptor are the decapeptide kallidin and the nonapeptide des-Arg 10 -kallidin (formed from kallidin by proteolytic cleavage of the C-terminal arginine). 10 Agents that can inhibit the binding of -kallidin to the bradykinin B1 receptor have the potential to treat or prevent bradykinin B1 receptor-mediated pathologies. Summary of the Invention [Problem to be solved by the invention]

[0004] Thus, the art provides compounds such as kallidin and des-Arg for use in the treatment of bradykinin B1 receptor-mediated human conditions. 10 There is a need for new agents that inhibit the binding of kallidin to the bradykinin B1 receptor. [Means for solving the problem]

[0005] The present invention relates to kallidin and des-Arg 10 -An antibody or antigen-binding fragment thereof that specifically binds to kallidin and prevents binding to the bradykinin B1 receptor. Such an antibody specifically binds to kallidin and des-Arg 10 The present invention is particularly useful for treating kallidin-associated diseases or disorders (e.g., pain or fibrosis). The present invention also provides pharmaceutical compositions and methods for treating antikallidin and des-Arg 10 Nucleic acids encoding Kallidin antibodies, recombinant expression vectors, and host cells for producing such antibodies or fragments thereof are also provided. 10 - for detecting kallidin, or kallidin and des-Arg 10 The present invention also encompasses methods of using the antibodies or fragments thereof of the present invention to modulate des-Arg9-bradykinin and des-Arg9-kallidin activity. 10 Also provided are methods for producing antibodies that specifically bind to kallidin-like peptides.

[0006] Thus, in one aspect, the present invention provides a method for producing a composition comprising: a) Kallidin or des-Arg 10 -specifically binds kallidin but not bradykinin or des-Arg9-bradykinin; b) Kallidin or des-Arg 10 -Kallidin, 1 x 10 -10 Specific binding with a KD of less than M; c) Kallidin or des-Arg 10 -Kallidin, 1 x 10 4 s -1 Less than K off specifically binds at; or d) Kallidin or des-Arg 10 -specifically binds to kallidin and bradykinin Inhibits binding to B1 receptors An isolated monoclonal antibody or antigen-binding fragment thereof is provided.

[0007] In one embodiment, the antibody or antigen-binding fragment thereof is selected from the group consisting of kallidin and des-Arg 10 -Binds to the N-terminal lysine residue of kallidin.

[0008] In another embodiment, the antibody or antigen-binding fragment thereof is kallidin or des-Arg 10 -Inhibits the binding of kallidin to bradykinin-1 receptors.

[0009] In another embodiment, the antibody or antigen-binding fragment thereof specifically binds to mouse kallidin-like peptide (KLP).

[0010] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 7 [X1YX2X3DX4HAMX5Y], During the ceremony, X1 is Y, F, or H; X2 is R, D, A, V, L, I, M, F, Y, or W; X3 is Y, F, W, or H; X4 is D, E, or Y; X5 is D or E, b) SEQ ID NO: 63 [XEYDGXYX4LDX]; During the ceremony, X1 is W or F; X2 is N or no amino acid; X3 is Y or S; X4 is D or P; X5 is F or Y; c) SEQ ID NO: 13, d) SEQ ID NO: 32; e) SEQ ID NO: 40; f) SEQ ID NO: 47, and g) SEQ ID NO: 55 The heavy chain variable domain comprises an HCDR3 amino acid sequence selected from the group consisting of:

[0011] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 8 [YFX1PX2NGNTGYNQKFRG], During the ceremony, X1 is D, R, A, V, L, I, M, F, Y, or W; X2 is Y, D, E, N, or Q; b) SEQ ID NO: 64 [WX1DPENGDX2X3YAPKFQG], During the ceremony, X1 is I or V; X2 is T or S; X3 is G or D; c) SEQ ID NO: 14, d) SEQ ID NO: 33; e) SEQ ID NO: 41, f) SEQ ID NO: 48, and g) SEQ ID NO: 56 The HCDR2 amino acid sequence is selected from the group consisting of:

[0012] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 9 [GYSFTDYX1IY], During the ceremony, X1 is N, W, or Y; b) SEQ ID NO: 65 [GFNIKDYYX1H], During the ceremony, X1 is L or M; c) SEQ ID NO: 15; d) SEQ ID NO: 34; e) SEQ ID NO: 42, f) SEQ ID NO: 49, and g) SEQ ID NO: 57 The HCDR1 amino acid sequence is selected from the group consisting of:

[0013] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 10 [QQX1X2SX3PX4T], During the ceremony, X1 is Y, F, or H; X2 is Y, F, H, or W; X3 is Y, F, T, or H; X4 is W, Y, F, H, or L; b) SEQ ID NO: 66 [QX1X2X3SX4PX5T], During the ceremony, X1 is Q or N; X2 is Y, F, D, or H; X3 is Y, F, H, or W; X4 is Y, F, T, or H; X5 is W, Y, F, H, or L; c) SEQ ID NO: 69 [X1QGTHFPYT], During the ceremony, X1 is L or M; d) SEQ ID NO: 16; e) SEQ ID NO: 35, f) SEQ ID NO: 43, g) SEQ ID NO: 50, and h) SEQ ID NO: 58 The LCDR3 comprises a light chain variable domain comprising an LCDR3 amino acid sequence selected from the group consisting of:

[0014] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 11 [WASTRX1], During the ceremony, X1 is E, D, Q or N; b) SEQ ID NO: 67 [X2ASTRX2], During the ceremony, X1 is W or G; X2 is E, D, Q, or N; c) SEQ ID NO: 17, d) SEQ ID NO: 36; e) SEQ ID NO: 51, and f) SEQ ID NO: 59 The LCDR2 comprises an LCDR2 amino acid sequence selected from the group consisting of:

[0015] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 12 [KSSQSLLX1SSNQKNX2LA], During the ceremony, X1 is W, H, Y, or F; X2 is H or Y; b) SEQ ID NO: 68 [KSSQSLLX1X2SX3QX4NX5LA], During the ceremony, X1 is W, H, Y, or F; X2 is S or G; X3 is N or D; X4 is K or R; X5 is H or Y; c) SEQ ID NO: 70 [KSSQSLLYSNGX1TYLN], During the ceremony, X1 is K or E; b) SEQ ID NO: 18, c) SEQ ID NO: 37, d) SEQ ID NO: 44; e) SEQ ID NO: 52, and f) SEQ ID NO: 60 The LCDR1 comprises an LCDR1 amino acid sequence selected from the group consisting of:

[0016] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 10 [QQX1X2SX3PX4T], During the ceremony, X1 is Y, F, or H; X2 is Y, F, H, or W; X3 is Y, F, T, or H; X4 is W, Y, F, H, or L; b) SEQ ID NO: 66 [QX1X2X3SX4PX5T], During the ceremony, X1 is Q or N; X2 is Y, F, D, or H; X3 is Y, F, H, or W; X4 is Y, F, T, or H; X5 is W, Y, F, H, or L; c) SEQ ID NO: 69 [X1QGTHFPYT], During the ceremony, X1 is L or M; d) SEQ ID NO: 16; e) SEQ ID NO: 35, f) SEQ ID NO: 43, g) SEQ ID NO: 50, and h) SEQ ID NO: 58 The LCDR3 comprises a light chain variable domain comprising an LCDR3 amino acid sequence selected from the group consisting of:

[0017] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 11 [WASTRX1], During the ceremony, X1 is E, D, Q, or N; b) SEQ ID NO: 67 [X2ASTRX2], During the ceremony, X1 is W or G; X2 is E, D, Q, or N; c) SEQ ID NO: 17, d) SEQ ID NO: 36; e) SEQ ID NO: 51, and f) SEQ ID NO: 59 The LCDR2 comprises an LCDR2 amino acid sequence selected from the group consisting of:

[0018] In another embodiment, the antibody or antigen-binding fragment thereof a) SEQ ID NO: 12 [KSSQSLLX1SSNQKNX2LA], During the ceremony, X1 is W, H, Y, or F; X2 is H or Y; b) SEQ ID NO: 68 [KSSQSLLX1X2SX3QX4NX5LA], During the ceremony, X1 is W, H, Y, or F; X2 is S or G; X3 is N or D; X4 is K or R; X5 is H or Y; c) SEQ ID NO: 70 [KSSQSLLYSNGX1TYLN], During the ceremony, X1 is K or E; b) SEQ ID NO: 18, c) SEQ ID NO: 37, d) SEQ ID NO: 44; e) SEQ ID NO: 52, and f) SEQ ID NO: 60 The LCDR1 comprises an LCDR1 amino acid sequence selected from the group consisting of:

[0019] In another embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino sequences of the HCDR3, HCDR2, and HCDR1 regions set forth in SEQ ID NOs: 13, 14, and 15, respectively, and one or more amino acid substitutions at positions selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108 according to Kabat.

[0020] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising the amino sequences of the LCDR3, LCDR2, and LCDR1 regions set forth in SEQ ID NOs: 16, 17, and 18, respectively, and one or more amino acid substitutions at positions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100, and L104 according to Kabat.

[0021] In another embodiment, the antibody or antigen-binding fragment thereof has the sequence of SEQ ID NO: 19, The heavy chain variable region amino acid sequence has at least 90% identity to an amino acid sequence selected from the group consisting of 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0022] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable domain amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0023] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable region amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0024] In another embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

[0025] In another embodiment, the antibody or antigen-binding fragment thereof comprises a light chain variable domain amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0026] In another embodiment, the antibody or antigen-binding fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

[0027] In another embodiment, the antibody or antigen-binding fragment thereof comprises the heavy and light chain variable region amino acids set forth in SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27, SEQ ID NOs: 21 and 28, SEQ ID NOs: 22 and 28, SEQ ID NOs: 23 and 29, SEQ ID NOs: 24 and 30, SEQ ID NOs: 25 and 31, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0028] In another aspect, the present invention provides a method for the preparation of a compound comprising kallidin and des-Arg 10 - a combination of kallidin and des-Arg that competes for binding to kallidin with an antibody comprising the heavy and light chain variable region amino acid sequences set forth in SEQ ID NOs: 19 and 26, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively; 10 -An antibody or antigen-binding fragment thereof that specifically binds to kallidin is provided.

[0029] In another aspect, the present invention provides kallidin or des-Arg 10 and an isolated monoclonal antibody or antigen-binding fragment thereof that competes with the antibody of any one of claims 1 to 4 for binding to -kallidin and does not bind to bradykinin or desArg9-bradykinin.

[0030] In another aspect, the present invention provides an isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds to a conformational epitope of kallidin (KD) or desArg10-kallidin (DAKD), which adopts a Pro4 kink conformation that includes a type II sharp bend at proline 4 of KD or DAKD. In one embodiment, the Pro4 kink conformation of KD or DAKD further comprises an S-shaped amino acid repeat that is spatially stacked and aligned with the hydrophobic side chains of the amino acids. In another embodiment, the antibody or antigen-binding fragment thereof specifically binds to (a) kallidin or des-Arg 10 -kallidin specifically binds to bradykinin or des -Arg9-bradykinin, and b) kallidin or des-Arg 10 -1x10 to Kalidin -10 specifically binds to kallidin or des-Arg with a KD of less than M 10 -1x10 to Kalidin 4 s -1 Less than K off or d) kallidin or des-Arg10 -Specifically binds to kallidin and inhibits its binding to bradykinin B1 receptors.

[0031] In another embodiment, the antibody or antigen-binding fragment of the invention is conjugated to a diagnostic or therapeutic agent.

[0032] In another aspect, the present invention provides an isolated nucleic acid encoding the amino acid sequence of an antibody or antigen-binding fragment thereof of the present invention.

[0033] In another aspect, the invention provides a recombinant expression vector comprising a nucleic acid of the invention.

[0034] In another aspect, the present invention provides a host cell comprising a recombinant expression vector of the present invention.

[0035] In another aspect, the present invention provides a method for producing a host cell of the present invention comprising: 10 - culturing the host cells under conditions in which an antibody that specifically binds to kallidin is produced by the host cells; 10 -A method for producing an antibody that specifically binds to kallidin is provided.

[0036] In another aspect, the present invention provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof of the present invention and one or more pharmaceutically acceptable carriers.

[0037] In another aspect, the present invention provides a method for treating a disease or disorder characterized by kallidin or des-Arg, comprising administering a pharmaceutical composition of the present invention to a subject in need thereof. 10 -Methods for treating kallidin-associated diseases or disorders are provided.

[0038] In one embodiment, the disease or disorder is chronic pain.

[0039] In another embodiment, the present invention relates to a peptide comprising the amino acid sequence set forth in SEQ ID NO: 11, and 10 -Kallidin, and des-Arg 10 and immunizing an animal with an immunogen comprising a peptide, wherein the amino-terminal arginine of the peptide is indirectly coupled to a carrier moiety via a linker moiety, such that antibodies that specifically bind to the kallidin-like peptide are produced by the animal's immune system. 10 -Methods for producing antibodies that specifically bind to kallidin-like peptides are provided.

[0040] In another embodiment, the method comprises isolating the antibody, a nuclear isolating encoding the antibody, or an immune cell expressing the antibody from the animal.

[0041] In one embodiment, the carrier moiety is a protein. In another embodiment, the protein is keyhole limpet hemocyanin (KLH). In another embodiment, the linker moiety comprises [Gly-Gly-Gly]n, where n is at least 1. [Brief explanation of the drawings]

[0042] [Figure 1] FIG. 1 shows the results of an ELISA assay demonstrating binding of the EE1 antibody to kinin peptides. [Figure 2] FIG. 1 shows the results of differential scanning calorimetry of antibody F151. [Figure 3] 1 shows an amino acid sequence alignment of the variable regions of the murine and humanized F151 antibodies. All identical residues are listed in the alignment, homologous residues are identified by the symbol "+", and non-homologous residues are left blank. [Figure 4] FIG. 1 shows an electron density map of the antigen-binding site of the F151 antibody / kallidin complex. [Figure 5]FIG. 1 shows an electron density map of the antigen-binding site of the F151 antibody / des-Arg10-Kallidin complex. [Figure 6] Ribbon and stick diagram showing the Fv subunit of F151 bound to kallidin. [Figure 7] 1 shows an amino acid sequence alignment of the light chain variable regions of exemplary murine anti-Kallidin antibodies of the invention, with amino acid residues that interact with Kallidin marked with an asterisk. [Figure 8] 1 shows an amino acid sequence alignment of the heavy chain variable regions of exemplary murine anti-Kallidin antibodies of the invention, with amino acid residues that interact with Kallidin marked with an asterisk. [Figure 9] FIG. 1 shows the results of an in vivo experiment determining the effect of EE1 antibody on formalin-induced acute inflammatory pain. [Figure 10] FIG. 1 shows the results of an in vivo experiment determining the effect of EE1 antibody on CFA-induced mechanical hypersensitivity. [Figure 11] FIG. 1 shows the results of an in vivo experiment determining the effect of EE1 antibody on CFA-induced thermal hypersensitivity. [Figure 12] FIG. 1 shows the results of an in vivo experiment determining the effect of EE1 antibody on CCI-induced mechanical hypersensitivity. [Figure 13] FIG. 1 shows the results of an in vivo experiment determining the effect of EE1 antibody on CCI-induced thermal hypersensitivity. [Figure 14] Schematic maps of the VL and VH expression constructs for producing humanized F151 variant HC3a / LC3a, with predicted restriction DNA endonuclease sites shown in bold and underlined. Panel A represents the light chain, and panel B represents the heavy chain. [Figure 15] FIG. 1 shows alignment of the heavy chain (A) and light chain (B) amino acid sequences of F151 with the closest human germline amino acid sequences. [Figure 16]Alignment of the heavy chain (A) and light chain (B) of F151 with the heavy chain loci (1-08 and 1-18) and light chain (V IV-B3) loci of the VH1 subfamily. CDRs and Vernier regions are shown in bold, and humanizing mutations are underlined. [Figure 17] (C) (A) Secondary structure and (B) quaternary structure of the main polypeptide backbone conformation of kallidin (KD) bound to the F151 antibody, which contains a type II tight turn at proline 4. DETAILED DESCRIPTION OF THE INVENTION

[0043] The present invention relates to kallidin and des-Arg 10 -An antibody that specifically binds to kallidin and prevents its binding to the bradykinin B1 receptor. Such an antibody is capable of binding to kallidin and des-Arg 10 The present invention is particularly useful for treating kallidin-associated diseases or disorders (e.g., pain). The present invention also provides pharmaceutical compositions and methods for treating antikallidin and des-Arg 10 Nucleic acids encoding des-Arg-Kallidin antibodies, recombinant expression vectors, and host cells for producing such antibodies or fragments thereof are also provided. Antibodies of the invention can be used to detect Kallidin and des-Arg-Kallidin either in vitro or in vivo. 10 -Methods for detecting kallidin, or kallidin and des-Arg 10 Methods for modulating kallidin activity are also encompassed by the present invention.

[0044] I. Definition In order that the present invention may be more readily understood, certain terms are first defined.

[0045] As used herein, the term "kallidin" refers to a peptide comprising or consisting of the amino acid sequence KRPPGFSPFR (SEQ ID NO: 1).

[0046] As used herein, "des-Arg 10The term "-kallidin" refers to a peptide comprising or consisting of the amino acid sequence KRPPGFSPF (SEQ ID NO: 2).

[0047] As used herein, the term "mouse kallidin" or "kallidin-like peptide" refers to a peptide comprising or consisting of the amino acid sequence RRPPGFSPFR (SEQ ID NO:3).

[0048] As used herein, "mouse des-Arg 10 -Kallidin" or "des-Arg 10 The term "kallidin-like peptide" means a peptide comprising or consisting of the amino acid sequence RRPPGFSPF (SEQ ID NO: 4).

[0049] As used herein, the term "bradykinin" refers to a peptide comprising or consisting of the amino acid sequence RPPGFSPFR (SEQ ID NO: 5).

[0050] As used herein, the term "des-Arg9-bradykinin" refers to a peptide comprising or consisting of the amino acid sequence RPPGFSPF (SEQ ID NO: 6).

[0051] As used herein, the term "antibody" refers to an immunoglobulin molecule comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and multimers thereof (e.g., IgM). Each heavy chain contains a heavy chain variable region (abbreviated V H or VH) and heavy chain constant region (C H or CH). The heavy chain constant region contains C H 1. C H 2, and C H Each light chain contains three domains: a light chain variable region (abbreviated as V L ) and the light chain constant region (C L The light chain constant region contains one domain (C L 1) V H and V LThe regions can be further subdivided into regions of hypervariability, called complementarity-determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs). H and V L Each of these is composed of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0052] As used herein, the term "antigen-binding fragment" of an antibody includes any naturally occurring, enzymatically obtained, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Antigen-binding fragments of antibodies can be derived from intact antibody molecules or the like using any suitable standard technique, such as proteolytic digestion or recombinant genetic engineering techniques, involving manipulation and expression of DNA encoding antibody variable domains and, optionally, constant domains. Non-limiting examples of antigen-binding portions include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units consisting of amino acid residues mimicking the hypervariable regions of an antibody (e.g., isolated complementarity-determining regions (CDRs)). Other engineered molecules, such as diabodies, triabodies, tetrabodies, and minibodies, are also encompassed within the term "antigen-binding fragment."

[0053] As used herein, the term "CDR" or "complementarity-determining region" refers to the noncontiguous antigen-binding sites found within the variable regions of both heavy and light chain polypeptides. These specific regions are described by Kabat et al., J. Biol. Chem., 252:6609-6616 (1977), and Kabat et al., Sequences of proteins of immunological interest, (1991), and Chothia et al., J. Mol. Biol., 196:901-917 (1987), and MacCallum et al., J. Mol. Biol., 262:732-745 (1996), and overlapping or subsets of amino acid residues are included in the definitions when compared against each other. The amino acid residues encompassing the CDRs defined by each of the above-cited references are listed for comparison purposes. In one embodiment of the present invention, the term "CDR" refers to the CDRs defined by Kabat, based on sequence comparison.

[0054] As used herein, the term "framework (FR) amino acid residues" refers to amino acids in the framework region of an Ig chain. As used herein, the term "framework region" or "FR region" includes amino acid residues that are part of the variable region but are not part of the CDRs (e.g., using the Kabat definition of CDRs). Thus, the variable region framework is between about 100-120 amino acids in length, but includes only amino acids outside the CDRs.

[0055] As used herein, the term "specifically binds to" means that an antibody or antigen-binding fragment thereof specifically binds to an antigen with a binding affinity of at least about 1 x 10 -6 M, 1 x 10 -7 M, 1 x 10 -8 M, 1 x 10 -9 M, 1 x 10 -10 M, 1 x 10 -11 M, 1 x 10 -12The term "antibody" refers to the ability to bind to an antigen with a Kd of at least 2-fold greater than its affinity for a nonspecific antigen. However, it should be understood that an antibody or antigen-binding fragment thereof can specifically bind to two or more antigens that are related in sequence (e.g., kallidin or des-Arg10-kallidin and mouse kallidin or des-Arg10-kallidin).

[0056] As used herein, the term "antigen" refers to the binding site or epitope recognized by an antibody or antigen-binding fragment thereof.

[0057] As used herein, the term "vector" is intended to mean a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, into which additional DNA segments can be ligated into the viral genome. Some vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors have a bacterial origin of replication and mammalian episomal vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, some vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids. The terms "plasmid" and "vector" can be used interchangeably. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

[0058] As used herein, the term "host cell" is intended to mean a cell into which a recombinant expression vector has been introduced. It should be understood that this term refers not only to the particular subject cell but also to the progeny of such a cell. Because certain modifications may occur in successive generations, either due to mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein.

[0059] As used herein, the terms "treat," "treatment," and "treatment" refer to therapeutic or preventative measures as described herein. Methods of "treatment" employ administration of an antibody or antigen-binding fragment of the invention to a subject, e.g., a subject with or predisposed to having a kallidin- and des-Arg10-kallidin-associated disease or disorder (e.g., an inflammatory disease), to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of a disease or disorder, or of a recurrent disease or disorder, or to prolong the survival of the subject beyond that expected in the absence of such treatment.

[0060] As used herein, "kallidin or des-Arg 10 - The term "kallidin-associated disease or disorder" includes disorders of altered levels or activity of kallidin or des-Arg 10 -Includes disease states and / or symptoms associated with disease states in which kallidin is found. Exemplary kallidin or des-Arg 10 -Kallidin-related diseases or disorders include, but are not limited to, pain and fibrosis.

[0061] As used herein, the term "effective amount" refers to an amount of a compound of formula (I) or (II) described herein that, when administered to a subject, produces an effective amount of a compound of formula (I) or (II) that ... 10 - a kallidin or des-Arg sufficient to provide treatment, prognosis, or diagnosis of a kallidin-associated disease or disorder 10The term "effective amount" refers to the amount of an antibody or antigen-binding fragment thereof that binds to kallidin. A therapeutically effective amount varies depending on the subject and disease state being treated, the subject's weight and age, the severity of the disease state, the mode of administration, etc., and can be easily determined by one skilled in the art. The dosage to be administered may range, for example, from about 1 ng to about 10,000 mg, from about 1 ug to about 5,000 mg, from about 1 mg to about 1,000 mg, or from about 10 mg to about 100 mg of an antibody or antigen-binding fragment thereof according to the present invention. The dosage regimen can be adjusted to provide the optimal therapeutic response. An effective amount is also an amount in which any toxic or adverse effects (i.e., side effects) of the antibody or antigen-binding fragment thereof are minimized or are outweighed by the beneficial effects.

[0062] As used herein, the term "subject" includes any human or non-human animal.

[0063] As used herein, the term "epitope" refers to an antigenic determinant that interacts with a specific antigen-binding site in the variable region of an antibody molecule, known as the paratope. A single antigen can have more than one epitope. Thus, different antibodies may bind to different regions on the antigen and have different biological effects. Epitopes can be either conformational or linear. Conformational epitopes are generated by spatially juxtaposed amino acids from different segments of a linear polypeptide chain. Linear epitopes are those generated by adjacent amino acid residues in a polypeptide chain.

[0064] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0065] II. Anti-kallidin or anti-des-Arg 10 -Kallidin antibody In one aspect, the present invention provides kallidin or des-Arg10 The present invention provides an antibody or antigen-binding fragment thereof that specifically binds to kallidin. The amino acid sequences of exemplary VH, VL, and CDRs of the antibodies of the present invention are set forth in Table 1.

[0066] [Table 1]

[0067] [Table 2]

[0068] [Table 3]

[0069] [Table 4]

[0070] [Table 5]

[0071] In one embodiment, the antibody or antigen-binding fragment thereof comprises one or more CDR region amino acid sequences selected from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51 52, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, and 70.

[0072] In other embodiments, the antibody or antigen-binding fragment thereof comprises, respectively: a) SEQ ID NOs: 7, 8, and 9; b) SEQ ID NOs: 13, 14, and 15; c) SEQ ID NOs: 32, 33, and 34; d) SEQ ID NOs: 40, 41, and 42; e) SEQ ID NOs: 47, 48, and 49; f) SEQ ID NOs: 55, 56, and 57, and g) SEQ ID NOs: 63, 64, and 65 The amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions are selected from the group consisting of:

[0073] In other embodiments, the antibody or antigen-binding fragment thereof comprises, respectively: a) SEQ ID NOs: 10, 11, and 12; b) SEQ ID NOs: 16, 17, and 18; c) SEQ ID NOs: 35, 36, and 37; d) SEQ ID NOs: 43, 17, and 44; e) SEQ ID NOs: 50, 51, and 52; f) SEQ ID NOs: 58, 59, and 60; g) SEQ ID NOs: 66, 67, and 68, and h) comprising amino acid sequences of LCDR3, LCDR2, and LCDR1 regions selected from the group consisting of SEQ ID NOs: 69, 25, and 70.

[0074] In other embodiments, the antibody or antigen-binding fragment thereof comprises, respectively: a) SEQ ID NOs: 7, 8, 9, 10, 11, and 12; b) SEQ ID NOs: 13, 14, 15, 16, 17, and 18; c) SEQ ID NOs: 32, 33, 34, 35, 36, and 37; d) SEQ ID NOs: 40, 41, 42, 43, 17, and 44; e) SEQ ID NOs: 47, 48, 49, 50, 51, and 52, and f) SEQ ID NOs: 55, 56, 57, 58, 59, and 60 The amino acid sequences of the HCDR3, HCDR2, HCDR1, LCDR3, LCDR2, and LCDR1 regions are selected from the group consisting of:

[0075] In other embodiments, the present invention provides humanized antibodies or antigen-binding fragments thereof comprising one or more CDR regions (or conservatively modified variants thereof) from a murine antibody disclosed herein. Any method of humanization can be used to produce the humanized antibodies of the present invention. Suitable methods are disclosed herein and specifically exemplified in Example 4.

[0076] In one particular embodiment, the humanized antibody or antigen-binding fragment thereof comprises: 13, 14, and 15, respectively, and a heavy chain variable region comprising one or more amino acid substitutions at positions selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108; and / or 16, 17, and 18, respectively, and a light chain variable region comprising one or more amino acid substitutions at positions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100, and L104 (according to the Kabat numbering convention). Includes.

[0077] In other embodiments, the antibody or antigen-binding fragment thereof comprises a VH region amino acid sequence set forth in SEQ ID NO: 19, 20, 21, 22, 24, 25, 38, 45, 53, and / or 61.

[0078] In other embodiments, the antibody or antigen-binding fragment thereof comprises a VL region amino acid sequence set forth in SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and / or 62.

[0079] In other embodiments, the antibody or antigen-binding fragment thereof comprises VH and VL region amino acid sequences selected from the group consisting of SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27, SEQ ID NOs: 21 and 28, SEQ ID NOs: 22 and 28, SEQ ID NOs: 23 and 29, SEQ ID NOs: 24 and 30, SEQ ID NOs: 25 and 31, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

[0080] In one embodiment, the antibody or antigen-binding fragment thereof comprises one or more CDR region amino acid sequences selected from the group consisting of SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59 and 60, wherein the one or more CDR region amino acid sequences comprise at least one or more conservative amino acid substitutions.

[0081] The present invention also encompasses "conservative amino acid substitutions" in the CDR amino acid sequences of the antibodies of the invention (e.g., SEQ ID NOS: 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 32, 33, 34, 35, 36, 37, 40, 41, 42, 43, 44, 47, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, and 60), i.e., modifications to the amino acid sequence that do not abrogate binding of the antibody to an antigen, such as kallidin or des-Arg10-kallidin. Conservative amino acid substitutions include those that involve the same amino acid sequence within a class of amino acids. Conservative substitutions include substitutions with amino acids from the same class, where classes are defined by the common physicochemical properties and frequent substitutions of amino acid side chains in homologous proteins found in nature, as determined by, for example, standard Dayhoff frequency exchange matrices or BLOUSUM matrices. Six general classes of amino acid side chains have been categorized, including class I (Cys), class II (Ser, Thr, Pro, Ala, Gly), class III (Asn, Asp, Gln, Glu), class IV (His, Arg, Lys), class V (Ile, Leu, Val, Met), and class VI (Phe, Tyr, Trp). For example, substitution of Asp for another residue from class III, such as Asn, Gln, or Glu, is a conservative substitution. Thus, predicted non-essential amino acid residues in an anti-Kallidin or des-Arg10-Kallidin antibody are preferably substituted with another amino acid residue from the same class. Methods for identifying conservative amino acid substitutions that do not eliminate antigen binding are well known in the art (see, e.g., Brummell et al., Biochem., 32:1180-1187 (1993); Kobayashi et al., Protein Eng., 12(10):879-884 (1999); and Burks et al., Proc. Natl. Acad. Sci. USA, 94:412-417 (1997)).

[0082] In another embodiment, the present invention provides an anti-Kallidin or des-Arg10-Kallidin antibody or antigen-binding fragment thereof comprising a VH and / or VL region amino acid sequence with approximately 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the VH region amino acid sequence set forth in SEQ ID NO: 19, 20, 21, 22, 24, 25, 38, 45, 53, or 61, or the VL region amino acid sequence set forth in SEQ ID NO: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, or 62, respectively.

[0083] In another embodiment, the present invention provides anti-Kallidin or des-Arg10-Kallidin antibodies that bind to the same epitope and / or cross-compete with an antibody or antigen-binding fragment thereof comprising the amino acid sequences of the VH and VL regions set forth, respectively, in SEQ ID NOs: 19 and 25, 38 and 39, 45 and 46, 53 and 54, or 61 and 62. Such antibodies can be identified using routine competitive binding assays, including, for example, surface plasmon resonance (SPR)-based competition assays.

[0084] In one embodiment, an antibody of the present invention binds to a conformational epitope of kallidin (KD) or desArg10-kallidin (DAKD) in a "Pro4 kink" conformation. As shown in Figure 17, the "Pro4 kink" conformation is characterized by a type II tight turn at proline 4 in the main polypeptide backbone of KD or DAKD. As known to those skilled in the art, the type II tight turn conformation involves three residues (X1-X2-X3), in which the carbonyl of residue X1 forms a hydrogen bond with the amide N of residue X3 (typically a glycine) (see Richardson JS. "The anatomy and taxonomy of protein structure." Adv. Protein Chem., 1981, 34, 167-339, incorporated herein by reference). Thus, in one embodiment, the type II tight turn conformation is formed by the Pro3-Pro4-Gly5 motif of KD or DADK. In more specific embodiments, the "Pro4 kink" conformation is further defined by all or substantially all of the remaining amino acids of KD (1-2 and 6-9) or DAKD adopting S-shaped repeats that are spatially stacked and align with hydrophobic side chains.

[0085] III. Modified anti-Kallidin or des-Arg10-Kallidin antibodies In certain embodiments, anti-Kallidin or des-Arg10-Kallidin antibodies of the invention may contain one or more modifications. Modified forms of anti-Kallidin or des-Arg10-Kallidin antibodies of the invention can be made using any technique known in the art.

[0086] i) Reduced immunogenicity In certain embodiments, anti-Kallidin or des-Arg10-Kallidin antibodies of the invention, or antigen-binding fragments thereof, are modified to reduce their immunogenicity using art-recognized techniques, e.g., antibodies or fragments thereof can be chimerized, humanized, and / or deimmunized.

[0087] In one embodiment, the antibody or antigen-binding fragment thereof of the present invention may be chimeric. A chimeric antibody is an antibody in which different portions of the antibody are derived from different animal species, such as an antibody having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies or fragments thereof are known in the art. See, for example, Morrison, Science, 229, 1202 (1985); Oi et al., BioTechniques, 4, 214 (1986); Gillies et al., J. Immunol. Methods, 125, 191-202 (1989); U.S. Patent Nos. 5,807,715, 4,816,567, and 4,816,397, the entire contents of which are incorporated herein by reference. Techniques developed to produce "chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci., 81:851-855 (1984); Neuberger et al., Nature, 312:604-608 (1984); Takeda et al., Nature, 314:452-454 (1985)) may be used to synthesize such molecules. For example, the genetic sequence encoding the binding specificity of a murine anti-Kallidin or des-Arg10-Kallidin antibody molecule may be fused together with sequences from an appropriate biologically active human antibody molecule. As used herein, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as molecules having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region, e.g., humanized antibodies.

[0088] In another embodiment, the antibody or antigen-binding fragment thereof of the present invention is humanized. A humanized antibody has a binding specificity comprising one or more complementarity-determining regions (CDRs) from a non-human antibody and framework regions from a human antibody molecule. Often, framework residues in the human framework regions are replaced with corresponding residues from the CDR donor antibody to alter, and preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions between CDRs and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at specific positions (see, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature, 332:323 (1988)), the entire contents of which are incorporated herein by reference). Antibodies can be modified by, for example, CDR grafting (EP 239,400; PCT Publication WO 91 / 09967; U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology, 28(4 / 5), 489-498 (1991); Studnicka et al., Protein Engineering, 7(6), 805-814 (1994); Roguska et al., PNAS, 91, 969-973 (1994)), and Humanization can be achieved using a variety of techniques known in the art, including chain shuffling (US Pat. No. 5,565,332).

[0089] In a specific embodiment, a humanization method is used that is based on the effect of flexibility of antibody molecules during and upon immune recognition (see WO2009 / 032661, the entire text of which is incorporated herein by reference). Protein flexibility is related to the molecular motion of protein molecules. Protein flexibility is the ability of the entire protein, a portion of a protein, or a single amino acid residue to adopt an ensemble of conformations that are significantly different from each other. Information about protein flexibility can be obtained by performing protein X-ray crystallography experiments (see, for example, Kundu et al., 2002, Biophys J, 83, 723-732), nuclear magnetic resonance experiments (see, for example, Freedberg et al., J Am Chem Soc, 1998, 120(31), 7916-7923), or by running molecular dynamics (MD) simulations. MD simulations of proteins are performed on a computer to determine the motion of all protein atoms over a period of time by calculating the physical interactions of the atoms with each other. The output of an MD simulation is a trajectory of the protein being tested over the period of the simulation. The trajectory is an ensemble of conformations of the protein, also called snapshots, sampled periodically, e.g., every 1 picosecond (ps), over the period of the simulation. It is by analyzing the ensemble of snapshots that the flexibility of amino acid residues in a protein can be quantified. Thus, a flexible residue is one that adopts an ensemble of different conformations in relation to the polypeptide in which it resides. MD methods are known in the art and are described, for example, in Brooks et al., "Proteins: See "A Theoretical Perspective of Dynamics, Structure and Thermodynamics" (Wiley, New York, 1988). Several software programs allow MD simulations, such as Amber (see Case et al. (2005) J Comp Chem, 26, 1668-1688), Charmm (see Brooks et al. (1983) J Comp Chem, 4, 187-217; and MacKerell et al. (1998) The Encyclopedia of Computational Chemistry, 1, 271-177, Schleyer et al. (eds.), Chichester: John Wiley & Sons), or Impact (see Rizzo et al., J Am Chem Soc, 2000, 122(51), 12898-12900).

[0090] It has been shown that most protein complexes share relatively large, planar, buried surfaces, and that the flexibility of binding partners contributes to the plasticity of protein complexes, allowing them to conformationally accommodate one another (Structure (2000) 8, R137-R142). Thus, examples of "induced fit" have been shown to play a dominant role at protein-protein interfaces. Furthermore, there is a steadily growing body of data showing that proteins do indeed bind to ligands that are diverse in shape, size, and composition (Protein Science (2002) 11, 184-187) and that conformational diversity appears to be an essential component of their ability to recognize different partners (Science (2003) 299, 1362-1367). Flexible residues are involved in the binding of protein-protein partners (Structure (2006) 14, 683-693).

[0091] Flexible residues can take on various conformations providing an ensemble of interaction areas that may be recognized by memory B cells and elicit an immunogenic response. Thus, antibodies can be humanized by modifying a number of residues from the framework so that the ensemble of conformations and recognition areas exhibited by the modified antibody resembles as closely as possible the ensemble of conformations and recognition areas exhibited by their human counterparts. This can be achieved by (1) constructing a homology model of the parent mAb and running MD simulations; (2) analyzing the identity of flexible residues and the most flexible residues in the non-human antibody molecule and identifying residues or motifs that may be the source of heterogeneity or degradation; (3) identifying the human antibody that exhibits the most similar ensemble of recognition areas to the parent antibody; (4) determining which flexible residues to mutate, and also mutating residues or motifs that may be the source of heterogeneity and degradation; and (5) modifying a limited number of residues by examining the presence of known T-cell or B-cell epitopes. Flexible residues can be found using MD calculations taught herein using an implicit solvent model, which accounts for the interaction of the aqueous solvent with protein atoms over the duration of the simulation.

[0092] After identifying a set of flexible residues within the variable light and variable heavy chains, a set of human heavy and light chain variable region frameworks that closely resemble the antibody of interest is identified. This can be done using BLAST or similar methods to match the set of flexible residues against a database of antibody human germline sequences. This can also be done by comparing the dynamics of the parent mAb with the dynamics of a library of germline reference sequences. CDR residues and adjacent residues are excluded from the search to ensure high affinity for the antigen is preserved. The flexible residues are then replaced.

[0093] Where several human residues show similar homology, selection is also driven by the nature of the residues that may affect the solution behavior of the humanized antibody. For example, polar residues are preferred in flexible loops exposed across hydrophobic residues. Residues that are potential sources of instability and heterogeneity are also mutated, even if they are found in CDRs. These residues include exposed methionines, because sulfoxide formation can result from oxygen radicals, proteolytic cleavage of acid-labile bonds (e.g., Asp-Pro dipeptide cleavage) (Drug Dev Res (2004) 61:137-154), deamination sites found in exposed asparagine residues followed by small amino acids (e.g., Gly, Ser, Ala, His, Asn, or Cys) (J Chromatog (2006) 837:35-43), and N-glycosylation sites (e.g., Asn-X-ser / Thr sites). Typically, exposed methionines are substituted with Leu, exposed asparagines are replaced with glutamine or aspartate, or the subsequent residue is altered. For glycosylation sites (Asn-X-Ser / Thr), either the Asn or Ser / Thr residue is altered.

[0094] The resulting composite antibody sequence is inspected for the presence of known B-cell or linear T-cell epitopes. For example, a search is performed in the publicly available Immune Epitope Database (IEDP) (PLos Biol (2005) vol. 3(3), e91). If a known epitope is found within the composite sequence, another set of human sequences is retrieved and substituted. Thus, unlike the resurfaced method of U.S. Pat. No. 5,639,641, both B-cell- and T-cell-mediated immunogenic responses are addressed by this method. This method also avoids the loss of activity sometimes observed with CDR grafting (U.S. Pat. No. 5,530,101). Furthermore, stability and solubility issues are also considered in the engineering and selection process, resulting in antibodies optimized for low immunogenicity, high antigen affinity, and improved biophysical properties.

[0095] In some embodiments, deimmunization can be used to reduce the immunogenicity of an antibody or its antigen-binding fragment. As used herein, the term "deimmunization" includes modifications of an antibody or its antigen-binding fragment that modify its T cell epitopes (see, e.g., WO9852976A1, WO0034317A2). For example, the VH and VL sequences from the starting antibody can be analyzed, and a human T cell epitope "map" can be generated from each V region that indicates the location of the epitope in relation to the complementarity-determining regions (CDRs) and other key residues within the sequence. Individual T cell epitopes from the T cell epitope map are analyzed to identify alternative amino acid substitutions that are less likely to alter the activity of the final antibody. A range of alternative VH and VL sequences containing combinations of amino acid substitutions can be designed, and these sequences are subsequently incorporated into a range of kallidin- or des-Arg10-kallidin-specific antibodies or fragments thereof, which are then tested for function for use in the diagnostic and treatment methods disclosed herein. Typically, between 12 and 24 variant antibodies are produced and tested. The complete heavy and light chain genes, including modified V regions and human C regions, are then cloned into expression vectors, and the subsequent plasmids are introduced into cell lines to produce whole antibodies. The antibodies are then compared in appropriate biochemical and biological assays to identify the optimal variant.

[0096] ii) Effector Function and Fc Modification Anti-Kallidin or des-Arg10-Kallidin antibodies of the present invention can comprise an antibody constant region (e.g., an IgG constant region, e.g., a human IgG constant region, e.g., a human IgG1 or IgG4 constant region) that mediates one or more effector functions. For example, binding of the C1 component of complement to an antibody constant region can activate the complement system. Complement activation is important in opsonization and lysis of cellular pathogens. Complement activation also stimulates inflammatory responses and may be involved in autoimmune hypersensitivity. Furthermore, antibodies bind to receptors on various cells via their Fc region, and the Fc receptor binding site on the Fc region of an antibody binds to an Fc receptor (FcR) on the cell. There are numerous Fc receptors specific for different classes of antibodies, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors), and IgM (mu receptors). Binding of antibodies to Fc receptors on cell surfaces elicits a number of important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity or ADCC), release of inflammatory mediators, placental passage, and control of immunoglobulin production. In preferred embodiments, antibodies or fragments thereof of the invention bind to Fc-gamma receptors. In alternative embodiments, anti-Kallidin or des-Arg10-Kallidin antibodies of the invention may contain a constant region that lacks one or more effector functions (e.g., ADCC activity) and / or is incapable of binding to Fc receptors.

[0097] Certain embodiments of the present invention include anti-Kallidin or des-Arg10-Kallidin antibodies in which at least one amino acid in one or more constant region domains has been deleted or otherwise modified to confer desirable biochemical characteristics, such as reduced or enhanced effector function, the ability to noncovalently dimerize, an increased ability to localize to tumor sites, a reduced serum half-life, or an increased serum half-life, when compared to an unmodified whole antibody with approximately the same immunogenicity. For example, certain antibodies or fragments thereof for use in the diagnostic and treatment methods described herein are domain-deleted antibodies, which comprise a polypeptide chain similar to an immunoglobulin heavy chain but lack at least a portion of one or more heavy chain domains. For example, in some antibodies, an entire domain of the constant region of the modified antibody is deleted, e.g., all or part of the CH2 domain is deleted.

[0098] In certain other embodiments, an anti-Kallidin or des-Arg10-Kallidin antibody comprises constant regions derived from different antibody isotypes (e.g., constant regions from two or more of human IgG1, IgG2, IgG3, or IgG4). In other embodiments, an anti-Kallidin or des-Arg10-Kallidin antibody comprises a chimeric hinge (i.e., a hinge comprising hinge portions derived from hinge domains of different antibody isotypes, e.g., an upper hinge domain from an IgG4 molecule and an IgG1 middle hinge domain). In one embodiment, an anti-Kallidin or des-Arg10-Kallidin antibody comprises an Fc region or portion thereof from a human IgG4 molecule and a Ser228Pro mutation (EU numbering) in the core hinge region of the molecule.

[0099] In certain anti-Kallidin or des-Arg10-Kallidin antibodies, the Fc portion may be mutated to increase or decrease effector function using techniques known in the art. For example, deletion or inactivation (by point mutation or other means) of the constant region domain may reduce Fc receptor binding of the circulating modified antibody, thereby increasing tumor localization. In other cases, constant region modifications consistent with the present invention may moderate complement binding, thereby reducing serum half-life and nonspecific association of conjugated cytotoxins. Still other modifications of the constant region may be used to modify disulfide linkages or oligosaccharide moieties, which enhance localization through increased antigen specificity or flexibility. The resulting physical profile, bioavailability, and other biochemical effects of the modifications, such as tumor localization, biodistribution, and serum half-life, can be readily measured and quantified using well-known immunological techniques without undue experimentation.

[0100] In one embodiment, the Fc domain used in the antibody of the present invention is an Fc variant. As used herein, the term "Fc variant" refers to an Fc domain that has at least one amino acid substitution relative to the wild-type Fc domain from which the Fc domain is derived. For example, if the Fc domain is derived from a human IgG antibody, an Fc variant of the human IgG1 Fc domain contains at least one amino acid substitution relative to the Fc domain.

[0101] The amino acid substitutions in the Fc variants may be located at any position within the Fc domain (i.e., any amino acid position according to the EU regulations). In one embodiment, the Fc variant comprises a substitution at an amino acid position located in the hinge domain or a portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in the CH2 domain or a portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in the CH3 domain or a portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in the CH4 domain or a portion thereof.

[0102] The antibodies of the invention can use any art-recognized Fc variant known to provide improved (e.g., reduced or enhanced) effector function and / or FcR binding, such as those described in International PCT Publications WO88 / 07089A1, WO96 / 14339A1, WO98 / 05787A1, WO98 / 23289A1, WO99 / 51642A1, WO99 / 58572A1, WO00 / 09560A2, WO00 / 32767A1, WO00 / 42072A2, WO02 / 44215A2, WO02 / 060919A2, WO03 / 074569A2, and WO04 / 0167, each of which is incorporated herein by reference. 50A2, WO04 / 029207A2, WO04 / 035752A2, WO04 / 063351A2, WO04 / 074455A2, WO04 / 099249A2, WO05 / 040217A2, WO05 / 070963A1, WO05 / 077981A2, WO05 / 092925A2, WO05 / 123780A2, WO06 / 019447A1, WO06 / 047350A2, and WO06 / 085967A2, or U.S. Pat. No. 5,648,260,5 739,277, 5,834,250, 5,869,046, 6,096,871, 6,121,022, 6,194,551, 6,242,195, 6,277,375, 6,528,624, 6,538,124, 6,737,056, 6,821,505, 6,998,253, and 7,083,784. In an exemplary embodiment, an antibody of the invention can comprise an Fc variant comprising an amino acid substitution at EU268 (e.g., H268D or H268E). In another exemplary embodiment, an antibody of the invention may comprise an Fc variant comprising an amino acid substitution at EU position 239 (e.g., S239D or S239E) and / or EU position 332 (e.g., I332D or I332Q).

[0103] In certain embodiments, antibodies of the present invention can comprise Fc variants containing amino acid substitutions that alter the antigen-independent effector function of the antibody, particularly its circulating half-life. Compared to antibodies without these substitutions, such antibodies exhibit either increased or decreased binding to FcRn and therefore have increased or decreased serum half-lives, respectively. Fc variants with improved affinity for FcRn are expected to have longer serum half-lives, making such molecules useful in methods of treating mammals where a long half-life of the administered antibody is desirable, such as treating chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have shorter half-lives, making such molecules useful for administration to mammals where a shortened circulation time may be advantageous, for example, in in vivo imaging diagnostics or when the starting antibody has toxic side effects if present in the circulation for an extended period of time. Fc variants with reduced FcRn binding affinity are also less likely to cross the placenta and are therefore useful for treating diseases or disorders in pregnant women. Additionally, other applications in which reduced FcRn-binding affinity may be desirable include applications in which brain, kidney, and / or liver localization is desirable. In one exemplary embodiment, modified antibodies of the invention exhibit reduced transport across the epithelium of the renal glomerulus from the vasculature. In another embodiment, modified antibodies of the invention exhibit reduced transport across the blood-brain barrier (BBB) ​​from the brain into the interstitial space of the blood. In one embodiment, modified FcRn-binding antibodies comprise an Fc domain with one or more amino acid substitutions within the "FcRn-binding loop" of the Fc domain. The FcRn-binding loop consists of amino acid residues 280-299 (according to EU numbering). Exemplary amino acid substitutions that alter FcRn-binding activity are disclosed in International PCT Publication No. WO 05 / 047327, incorporated herein by reference. In certain exemplary embodiments, an antibody or fragment thereof of the invention comprises an Fc domain with one or more of the following substitutions: V284E, H285E, N286D, K290E, and S304D (EU numbering).

[0104] In other embodiments, antibodies for use in the diagnostic and treatment methods described herein have constant regions, such as IgG1 or IgG4 heavy chain constant regions, that have been modified to reduce or eliminate glycosylation. For example, antibodies of the present invention can also include Fc variants containing amino acid substitutions that alter the glycosylation of the antibody. For example, the Fc variants can have reduced glycosylation (e.g., N-linked or O-linked glycosylation). In an exemplary embodiment, the Fc variant contains reduced glycosylation of the N-linked glycan normally found at amino acid position 297 (EU numbering). In another embodiment, the antibody contains an amino acid substitution near or within a glycosylation motif, e.g., within an N-linked glycosylation motif containing the amino acid sequence NXT or NXS. In a specific embodiment, the antibody contains an Fc variant containing an amino acid substitution at amino acid position 228 or 299 (EU numbering). In more particular embodiments, the antibody comprises an IgG1 or IgG4 constant region comprising S228P and T299A mutations (EU numbering).

[0105] Exemplary amino acid substitutions that confer reduced or altered glycosylation are disclosed in International PCT Publication No. WO 05 / 018572, incorporated herein by reference. In a preferred embodiment, an antibody or fragment thereof of the present invention is modified to eliminate glycosylation. Such an antibody or fragment thereof may be referred to as an "agly" antibody or fragment thereof (e.g., an "agly" antibody). Without wishing to be bound by theory, an "agly" antibody or fragment thereof may have an improved in vivo safety and stability profile. An exemplary agly antibody or fragment thereof comprises an aglycosylated Fc region of an IgG4 antibody lacking Fc effector function, thereby eliminating the potential for Fc-mediated toxicity to normal vital organs expressing kallidin or des-Arg10-kallidin. In yet another embodiment, an antibody or fragment thereof of the present invention comprises an engineered glycan. For example, the antibody can have a small number of fucose residues on the N-glycan at Asn297 of the Fc region, i.e., is afucosylated. In another embodiment, the antibody can have an altered number of sialic acid residues on the N-glycan at Asn297 of the Fc region.

[0106] iii) Covalent attachment Anti-Kallidin or des-Arg10-Kallidin antibodies of the invention may be modified, such as by the covalent attachment of a molecule to the antibody, so that the covalent attachment does not prevent the antibody from specifically binding to its cognate epitope. For example, without limitation, antibodies of the invention or fragments thereof may be modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linkage to cellular ligands or other proteins, etc. Any of a number of chemical modifications may be made by known techniques, including, but not limited to, specific chemical cleavage, acetylation, formylation, etc. Additionally, derivatives may contain one or more non-classical amino acids.

[0107] The antibodies or fragments thereof of the present invention may further be recombinantly fused to heterologous polypeptides at the N- or C-terminus, or chemically conjugated to polypeptides or other compositions (including covalent and non-covalent conjugates). For example, anti-Kallidin or des-Arg10-Kallidin antibodies may be recombinantly fused or conjugated to molecules useful as labels in detection assays, and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, for example, PCT Publications WO92 / 08495, WO91 / 14438, WO89 / 12624, U.S. Patent No. 5,314,995, and EP396,387.

[0108] Anti-Kallidin or des-Arg10-Kallidin antibodies may be fused to heterologous polypeptides to increase their in vivo half-life or for use in immunoassays using methods known in the art. For example, in one embodiment, PEG can be conjugated to an anti-Kallidin or des-Arg10-Kallidin antibody of the invention to increase its in vivo half-life. Leong, SR et al., Cytokine, 16:106 (2001); Adv. in Drug Deliv. Rev., 54:531 (2002); or Weir et al., Biochem. Soc. Transactions, 30:512 (2002).

[0109] Additionally, the anti-Kallidin or des-Arg10-Kallidin antibodies of the present invention may be fused to a marker sequence, such as a peptide, to facilitate purification or detection. In a preferred embodiment, the marker amino acid sequence is expressed in a pQE vector ( ), among others, many of which are commercially available. A suitable peptide tag is a hexa-histidine peptide, such as the tag provided by QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311. For example, as described in Gentz ​​et al., Proc. Natl. Acad. Sci. USA, 86:821-824 (1989), hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell, 37:767 (1984)), and the "flag" tag.

[0110] The anti-Kallidin or des-Arg10-Kallidin antibodies of the present invention may be used in unconjugated form or may be conjugated to at least one of a variety of molecules, e.g., to improve the therapeutic properties of the molecule, to facilitate target detection, or for patient imaging or treatment. The anti-Kallidin or des-Arg10-Kallidin antibodies of the present invention can be labeled or conjugated either before or after purification, if performed. In particular, the anti-Kallidin or des-Arg10-Kallidin antibodies of the present invention may be conjugated to a therapeutic agent, prodrug, peptide, protein, enzyme, virus, lipid, biological response modifier, pharmaceutical, or PEG.

[0111] The present invention further encompasses anti-Kallidin or des-Arg10-Kallidin antibodies of the invention conjugated to a diagnostic or therapeutic agent. Anti-Kallidin or des-Arg10-Kallidin antibodies can be used diagnostically, for example, to monitor the onset or progression of an immune cell disorder (e.g., CLL) as part of a clinical testing procedure, to determine the effectiveness of a given treatment and / or prevention regimen, and the like. Detection can be facilitated by coupling the anti-Kallidin or des-Arg10-Kallidin antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, various positron-emitting metals using positron emission tomography, and non-radioactive paramagnetic metal ions. See, e.g., U.S. Patent No. 4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive materials include 125I, 131I, 111In, or 99Tc.

[0112] Anti-Kallidin or des-Arg10-Kallidin antibodies for use in the diagnostic and treatment methods disclosed herein may be conjugated to a cytotoxin (e.g., a radioisotope, cytotoxic drug, or toxin), a therapeutic agent, a cytostatic agent, a biological toxin, a prodrug, a peptide, a protein, an enzyme, a virus, a lipid, a biological response modifier, a pharmaceutical agent, an immunologically active ligand (e.g., a lymphokine or other antibody, such that the resulting molecule binds to both neoplastic cells and effector cells such as T cells), or PEG.

[0113] In another embodiment, anti-Kallidin or des-Arg10-Kallidin antibodies for use in the diagnostic and treatment methods disclosed herein may be conjugated to a molecule that reduces tumor cell proliferation. In other embodiments, the disclosed compositions may comprise an antibody or fragment thereof coupled to a drug or prodrug. Still other embodiments of the present invention are directed to antibodies against ricin, gelonin, Pseudomonas excreta, This includes the use of antibodies or fragments thereof conjugated to specific biological toxins or cytotoxic fragments thereof, such as toxins or diphtheria toxin. The choice of which conjugated or unconjugated antibody to use depends on the type and stage of the cancer, the use of adjuvant treatments (e.g., chemotherapy or external radiation), and the condition of the patient. Those skilled in the art will understand that such a choice can be readily made in light of the teachings herein.

[0114] It will be appreciated that in previous studies, isotope-labeled antitumor antibodies have been successfully used to destroy tumor cells in animal models and, in some cases, in humans. Exemplary radioisotopes include 90Y, 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re, and 188Re. Radionuclides act by producing ionizing radiation that causes multiple strand breaks in nuclear DNA, resulting in cell death. Isotopes used to produce therapeutic conjugates typically produce short-path, high-energy alpha or beta particles. Such radionuclides kill cells in close proximity to them, such as neoplastic cells to which the conjugate attaches or penetrates. They have little or no effect on non-localized cells. Radionuclides are inherently non-immunogenic.

[0115] IV. Expression of anti-Kallidin or des-Arg10-Kallidin antibodies, or antigen-binding fragments thereof After the isolated genetic material has been manipulated to provide the anti-Kallidin or des-Arg10-Kallidin antibodies of the present invention described above, the genes are typically inserted into an expression vector for introduction into a host cell that can be used to produce desired quantities of the claimed antibody or fragment thereof.

[0116] The term "vector" or "expression vector" is used herein for purposes of the specification and claims to refer to a vector used in accordance with the present invention as a vehicle for introducing into and expressing a desired gene in a cell. As known to those skilled in the art, such vectors can be easily selected from the group consisting of plasmids, phages, viruses, and retroviruses. Generally, vectors compatible with the present invention contain a selectable marker, appropriate restriction sites to facilitate cloning of the desired gene, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0117] Numerous expression vector systems can be used for the purposes of the present invention. For example, one class of vectors utilizes DNA elements derived from animal viruses such as bovine papillomavirus, polyomavirus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV, or MOMLV), or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites. Additionally, cells that have integrated the DNA into their chromosomes can be selected by introducing one or more markers that allow for selection of transfected host cells. Markers can provide prototrophy, resistance to biocides (e.g., antibiotics) for auxotrophic hosts, or resistance to heavy metals such as copper. The selectable marker gene can either be directly linked to the DNA sequence to be expressed or introduced into the same cell by cotransformation. Additional elements may also be required for optimal synthesis of mRNA. These elements can include signal sequences, splice signals, and transcriptional promoters, enhancers, and termination signals. In a particularly preferred embodiment, the cloned variable region genes are inserted into an expression vector along with synthetic heavy and light chain constant region genes (preferably human), as discussed above. do.

[0118] In another preferred embodiment, the anti-Kallidin or des-Arg10-Kallidin antibodies or fragments thereof of the present invention can be expressed using a polycistronic construct. In such expression systems, multiple gene products of interest, such as antibody heavy and light chains, can be produced from a single polycistronic construct. These systems advantageously use an internal ribosome entry site (IRES) to provide relatively high levels of the polypeptides of the present invention in eukaryotic host cells. Compatible IRES sequences are disclosed in U.S. Patent No. 6,193,980, incorporated herein by reference. Those skilled in the art will be able to use such expression systems to effectively produce the full range of polypeptides disclosed in this application.

[0119] More generally, after preparing a vector or DNA sequence encoding an antibody or fragment thereof, the expression vector may be introduced into a suitable host cell; i.e., the host cell may be transformed. Introduction of the plasmid into the host cell can be accomplished by a variety of techniques well known to those skilled in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with coated DNA, microinjection, and infection with intact virus. See Ridgway, AAG, "Mammalian Expression Vectors," Chapter 24.2, pp. 470-472, in Vectors, edited by Rodriguez and Denhardt (Butterworths, Boston, Mass., 1988). Introduction of the plasmid into the host is most preferably by electroporation. Transformed cells are grown under conditions appropriate for the production of light and heavy chains and assayed for heavy and / or light chain protein synthesis. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence activated cell sorter analysis (FACS), immunohistochemistry, and the like.

[0120] As used herein, the term "transformation" is used in a broad sense to refer to the introduction of DNA into a recipient host cell, altering the genotype and subsequent changes in the recipient cell.

[0121] Along these same lines, "host cells" refer to cells that have been transformed with a vector constructed using recombinant DNA techniques and encoding at least one heterologous gene. In describing processes for isolating polypeptides from recombinant hosts, the terms "cells" and "cell culture" are used interchangeably and refer to the source of the antibody, unless clearly specified otherwise. In other words, recovery of polypeptides from "cells" can mean either from spun down whole cells or from the cell culture, including both the medium and suspended cells.

[0122] In one embodiment, the host cell line used to express the antibody is of mammalian origin, and one of skill in the art can determine the particular host cell line that is most suitable for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblast), BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), and 293 (human kidney). In one embodiment, the cell line provides for altered glycosylation, such as afucosylation, of the antibody expressed therefrom (e.g., PER.C6.RTM. (Cruc ell) or a FUT8-knockout CHO cell line (Potelligent.RTM. cells) (Biowa, Princeton, NJ). In one embodiment, NS0 cells can be used. CHO cells are particularly preferred. Host cell lines are typically available from commercial services, the American Tissue Culture Collection, or published literature.

[0123] In vitro production allows for scale-up to produce large amounts of the desired polypeptide. Techniques for culturing mammalian cells under tissue culture conditions are known in the art and include homogeneous suspension culture (e.g., in airlift reactors or continuous stirrer reactors), or immobilized or entrapped cell culture (e.g., in hollow fibers, in microcapsules, on agarose microbeads, or on ceramic cartridges). If necessary and / or desired, the solution of the polypeptide can be purified by conventional chromatographic methods, such as gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose, and / or (immuno)affinity chromatography.

[0124] Genes encoding the anti-Kallidin or des-Arg10-Kallidin antibodies or fragments thereof of the present invention can also be expressed in non-mammalian cells, such as bacteria, yeast, or plant cells. In this regard, it will be understood that various non-mammalian unicellular microorganisms (e.g., bacteria), i.e., those that can be grown in culture or fermentation, can also be transformed. Bacteria are susceptible to transformation and include members of the Enterobacteriaceae family, such as Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus; and Haemophilus influenzae strains. It will further be understood that when expressed in bacteria, the polypeptide may become part of inclusion bodies. The polypeptide must be isolated, purified, and then assembled into a functional molecule.

[0125] In addition to prokaryotes, eukaryotic microorganisms can also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used eukaryotic microorganism, although numerous other strains are commonly available. For expression in Saccharomyces cerevisiae, for example, the plasmid YRp7 (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)) is commonly used. This plasmid already contains the TRP1 gene, which provides a selection marker for yeast mutants lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)). The presence of the trpI lesion, which is characteristic of the genome of the yeast host cell, then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0126] V. Pharmaceutical Formulations and Methods of Administering Anti-Kallidin or des-Arg10-Kallidin Antibodies In another aspect, the present invention provides pharmaceutical compositions comprising anti-Kallidin or des-Arg10-Kallidin antibodies or fragments thereof.

[0127] Methods of preparing and administering the antibodies or fragments thereof of the present invention to a subject are well known or readily determined by one of ordinary skill in the art. The route of administration of the antibodies or fragments thereof of the present invention may be oral, parenteral, by inhalation, or topical. As used herein, the term "antibody" refers to a molecule or molecule that is capable of acting as a target for the administration of an antibody or fragment thereof. The term parenteral, as used herein, includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal, or vaginal administration. Intravenous, intraarterial, subcutaneous, and intramuscular forms of parenteral administration are generally preferred. While all of these forms of administration are expressly contemplated within the scope of the present invention, the form for administration is a solution for injection, particularly for intravenous or intraarterial injection or infusion. Typically, pharmaceutical compositions suitable for injection can include buffers (e.g., acetate buffer, phosphate buffer, or citrate buffer), surfactants (e.g., polysorbates), and optionally stabilizers (e.g., human albumin). However, in other methods compatible with the teachings herein, polypeptides can be derivatized directly at the site of the harmful cell population, thereby increasing the exposure of the affected tissue to the therapeutic agent.

[0128] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. In the present invention, pharmaceutically acceptable carriers include, but are not limited to, 0.01M to 0.1M, preferably 0.05M, phosphate buffer, or 0.8% saline. Other common parenteral vehicles include sodium phosphate solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose, and the like. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents, and inert gases, may also be present. More specifically, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble), or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the compositions must be sterile and fluid to the extent that easy syringability exists. The compositions must be stable under the conditions of manufacture and storage and preferably preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0129] In any case, sterile injectable solutions can be prepared by incorporating the required amount of active compound (e.g., antibody alone or in combination with other active agents) into a suitable solvent, optionally with one or a combination of the ingredients listed herein, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and other required ingredients from those listed above. For sterile powders for preparing sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze-drying, which produces a powder of the active ingredient plus any additional desired ingredients from the previously sterile-filtered solution. Injectable preparations are processed under aseptic conditions according to methods known in the art, filled into containers such as ampoules, bags, bottles, syringes, or vials, and sealed. Furthermore, the preparations can be packaged and processed in accordance with the methods described in co-pending U.S. Application No. 09 / 259,337 and U.S. Application No. 09 / 259,337, each of which is incorporated herein by reference. The compositions may also be sold in the form of kits, such as those described in US Pat. No. 9,338. Such products preferably have a label or package insert indicating that the associated compositions are useful for treating subjects suffering from or susceptible to an autoimmune or neoplastic disorder.

[0130] The effective dosage of the stabilized antibody or fragment thereof of the present invention for treating the above-described conditions will vary depending on many factors, including the means of administration, the target site, the physiological condition of the patient, whether the patient is human or animal, other medications administered, and whether the treatment is prophylactic or therapeutic. Typically, the patient is human, but non-human mammals, including transgenic mammals, can also be treated. Treatment dosages can be titrated using routine methods known to those skilled in the art to optimize safety and efficacy.

[0131] For passive immunization with an antibody of the invention, dosages can range, for example, from about 0.0001 mg / kg to 100 mg / kg body weight of the host, more usually 0.01 mg / kg to 5 mg / kg body weight (e.g., 0.02 mg / kg, 0.25 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, etc.). For example, dosages can be 1 mg / kg or 10 mg / kg body weight, or within the range of 1-10 mg / kg body weight, preferably at least 1 mg / kg body weight. Dosages intermediate in the above ranges are also contemplated as being within the scope of the invention.

[0132] Such dosages can be administered to subjects daily, every other day, weekly, or according to any other schedule determined by empirical analysis. Exemplary treatments involve administration of multiple dosages over an extended period of time, e.g., at least six months. Further exemplary treatment regimens involve administration once every two weeks, once a month, or once every three to six months. Exemplary dosage schedules include 1-10 mg / kg or 15 mg / kg daily, 30 mg / kg every other day, or 60 mg / kg weekly. In some embodiments, two or more monoclonal antibodies with different binding specificities are administered simultaneously, in which case the dosage of each antibody administered can be within the indicated ranges.

[0133] The antibodies or fragments thereof of the present invention can be administered on multiple occasions. The interval between single doses can be, for example, daily, weekly, monthly, or yearly. The intervals can also be irregular, as indicated by measuring the blood levels of the polypeptide or target molecule in the patient. In some methods, the dosage is adjusted to achieve a plasma concentration of the antibody or toxin, such as 1-1000 μg / ml or 25-300 μg / ml. Alternatively, the antibodies or fragments thereof can be administered as sustained-release formulations, requiring less frequent administration. The dosage and frequency will vary depending on the half-life of the antibody in the patient. Generally, humanized antibodies exhibit the longest half-life, followed by chimeric antibodies and nonhuman antibodies. In one embodiment, the antibodies or fragments thereof of the present invention can be administered in unconjugated form. In another embodiment, the antibodies of the present invention can be administered multiple times in conjugated form. In yet another embodiment, the antibodies or fragments thereof of the present invention can be administered in unconjugated form, then in conjugated form, or vice versa.

[0134] The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a composition containing the antibody of the present invention or a cocktail thereof is administered to a patient who is not yet in a disease state to enhance the patient's resistance. Such an amount is defined as a "prophylactically effective dose." In this use, the exact amount further depends on the patient's health status and general immunity, but generally ranges from 0.1 mg to 25 mg per dose, particularly 0.5 mg to 2.5 mg per dose. Relatively low dosages can be administered over a long period of time. The doses are administered at relatively infrequent intervals, and some patients continue to receive treatment for the rest of their lives.

[0135] In therapeutic applications, relatively high dosages (e.g., about 1 mg / kg to 400 mg / kg of antibody per dosage, 5 mg to 25 mg for radioimmunoconjugates, higher dosages more usually used for cytotoxin-drug conjugate molecules) at relatively short intervals are sometimes required until disease progression is reduced or terminated, preferably until the patient shows partial or complete recovery from disease symptoms. Thereafter, the patient may be administered a prophylactic regimen.

[0136] In one embodiment, a subject may be treated with a nucleic acid molecule (e.g., in a vector) encoding a polypeptide of the invention. Dosages for nucleic acids encoding the polypeptide range from about 10 ng to 1 g, 100 ng to 100 mg, 1 μg to 10 mg, or 30-300 μg of DNA per patient. Dosages for infectious viral vectors vary from 10-100 or more virions per dose.

[0137] Therapeutic agents can be administered parenterally, topically, intravenously, orally, subcutaneously, intraarterially, intracranially, intraperitoneally, intranasally, or intramuscularly for prophylactic and / or therapeutic treatment. Intramuscular injection or intravenous infusion is preferred for administration of the antibodies of the invention. In some methods, the therapeutic antibody or fragment thereof is injected directly into the skull. In some methods, the antibody or fragment thereof is administered as a sustained release composition or device, for example, a Medipat™ device.

[0138] The agents of the invention can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (e.g., prophylactic or therapeutic). Preferred additional agents are art-recognized and normally administered agents for the particular disorder.

[0139] Effective single treatment doses (i.e., therapeutically effective amounts) of 90Y-labeled antibodies of the present invention range between about 5 mCi and about 75 mCi, more preferably between about 10 mCi and about 40 mCi. Effective single treatment non-marrow ablative doses of 131I-labeled antibodies range between about 5 mCi and about 70 mCi, more preferably between about 5 mCi and about 40 mCi. Effective single treatment ablative doses (i.e., that may require bone marrow autotransplantation) of 131I-labeled antibodies range between about 30 mCi and about 600 mCi, more preferably between about 50 mCi and less than 500 mCi. In combination with chimeric modified antibodies, due to their longer circulating half-lives relative to murine antibodies, effective single-treatment non-marrow ablative doses of iodine-131 labeled chimeric antibodies range between about 5 mCi and about 40 mCi, more preferably less than about 30 mCi. The imaging threshold for labels such as 111In is typically less than about 5 mCi.

[0140] Although 131I and 90Y have achieved a large amount of clinical experience, other radiolabels are known in the art and are used for similar purposes. Still other radioisotopes have been used in imaging. For example, additional radioisotopes that are compatible with the scope of the present invention include, but are not limited to, 123I, 125I, 32P, 57Co, 64Cu, 67Cu, 77Br, 81Rb, 81Kr, 87Sr, 113In, 127Cs, 129Cs, 132I, 197Hg, 203Pb, 206Bi, 177Lu, 186Re, 212Pb, 212Bi, 47Sc, 105Rh, 109Pd, 153Sm, 188Re, 199Au, 225Ac, 211A 213Bi. In this regard, alpha, gamma, and beta emitters are all compatible within the scope of the present invention. Furthermore, in view of this disclosure, one of ordinary skill in the art It is proposed that, if the above information is available, it will be possible to easily determine which radionuclide is suitable for the selected course of treatment without undue experimentation. For this purpose, additional radionuclides already used in clinical diagnosis include 125I, 123I, 99Tc, 43K, 52Fe, 67Ga, 68Ga, and 111In. Antibodies have also been labeled with various radionuclides for potential use in targeted immunotherapy (Peirersz et al., Immunol. Cell Biol., vol. 65, pp. 111-125 (1987)). These radionuclides include 188Re and 186Re, and to a lesser extent 199Au and 67Cu. U.S. Patent No. 5,460,785 provides further information regarding such radioisotopes and is incorporated herein by reference.

[0141] As discussed above, the antibodies or fragments thereof of the present invention can be administered in a pharmaceutically effective amount for in vivo treatment of mammalian disorders. In this regard, it will be understood that the antibodies or fragments thereof of the present disclosure are formulated to facilitate administration and promote stability of the active agent. Pharmaceutical compositions according to the present invention preferably include a pharmaceutically acceptable, non-toxic, sterile carrier, such as saline, non-toxic buffers, preservatives, and the like. For purposes of this application, a pharmaceutically effective amount of an antibody of the present invention, conjugated or unconjugated to a therapeutic agent, is taken to mean an amount sufficient to achieve effective binding to a target and achieve a benefit, e.g., ameliorate symptoms of a disease or disorder, or detect a substance or cell. In the case of tumor cells, the polypeptide preferably can interact with a selected immunoreactive antigen on neoplastic or immunoreactive cells, resulting in increased killing of these cells. Of course, the pharmaceutical compositions of the present invention can be administered in a single dose or multiple doses to provide a pharmaceutically effective amount of the polypeptide.

[0142] In accordance with the scope of the present disclosure, the antibodies of the present invention can be administered to humans or other animals in the aforementioned treatment methods in an amount sufficient to produce a therapeutic or prophylactic effect. The polypeptides of the present invention can be administered to such humans or other animals in conventional dosage forms prepared by combining the antibodies of the present invention with conventional pharmaceutically acceptable carriers or diluents in accordance with known techniques. Those skilled in the art will recognize that the form and characteristics of the pharmaceutically acceptable carrier or diluent will be dictated by the amount of active ingredient to be combined therewith, the route of administration, and other well-known variables. Those skilled in the art will further appreciate that cocktails containing one or more species of polypeptides according to the present invention may prove particularly effective.

[0143] VI. Methods of Treating Kallidin or des-Arg10-Kallidin-Associated Diseases or Disorders The anti-Kallidin or des-Arg10-Kallidin antibodies of the invention, or fragments thereof, are useful for antagonizing the activity of Kallidin or des-Arg10-Kallidin. Accordingly, in another aspect, the invention provides methods for treating a Kallidin or des-Arg10-Kallidin-associated disease or disorder by administering to a subject in need thereof a pharmaceutical composition comprising one or more anti-Kallidin or des-Arg10-Kallidin antibodies of the invention, or antigen-binding fragments thereof.

[0144] Kallidin or des-Arg10-Kallidin-associated diseases or disorders amenable to treatment include, without limitation, pathophysiological conditions such as inflammation, trauma, burns, shock, allergy, acute or chronic pain, and fibrosis, such as renal fibrosis. In certain exemplary embodiments, the antibodies of the invention can be administered to treat renal fibrosis and associated acute kidney injury, which is a major cause of end-stage renal failure, as well as chronic kidney disease.

[0145] Those skilled in the art will be able to determine, through routine experimentation, what is an effective, non-toxic amount of antibody (or additional therapeutic agent) for treating a kallidin or des-Arg10-kallidin-associated disease or disorder. For example, a therapeutically effective amount of a polypeptide may vary according to factors such as the stage of the disease (e.g., stage I vs. stage IV), age, sex, medical complications (e.g., immunosuppressive conditions or diseases), and weight of the subject, as well as the ability of the antibody to elicit a desired response in the subject. Dosage regimens can be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, or the dosage may be proportionally reduced as indicated by the exigencies of the therapeutic situation. However, in general, an effective dosage is expected to be in the range of about 0.05 to 100 milligrams per kilogram of body weight per day, more preferably about 0.5 to 10 milligrams per kilogram of body weight per day.

[0146] VII. Working Examples The present invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of the sequence listing, figures, and all references, patents and published patent applications cited throughout this application are hereby expressly incorporated by reference.

[0147] Furthermore, in accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art, such techniques being fully explained in the literature. See, e.g., Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed. (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein referred to as "Sambrook et al., 1989"); DNA Cloning: A Practical Approach, Vols. I and II (D.N. Glover, eds., 1985); Oligonucleotide Synthesis (M.J. Gait, eds., 1984); Nucleic Acid Hybridization (B.D. Hames and S.J. Higgins, eds., 1985); Transcription and Translation (B.D. Hames and S.J. Higgins, eds., 1984); Animal Cell Culture (R.I. Freshney, ed., 1986); Immobilized Cells and Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M.Ausubel et al. (eds.), Current Protocols in Molecular See Biology, John Wiley & Sons, Inc. (1994).

[0148] Example 1 Generation of hybridomas: Immunization of mice with kallidin peptide conjugates to KLH and antibody production against human BKR1 ligands The goal was to develop cross-reactive antibodies against kallidin (KD; SEQ ID NO: 1) and des-arg-kallidin (DAKD; SEQ ID NO: 2) that would inhibit the binding of these ligands (kallidin and des-arg-kallidin) to human BKR1. Generally, immunization of mice with KLH conjugated to KD by an additional cysteine ​​on either the C- or N-terminus of the peptide was used to obtain mouse splenocytes for fusion with mouse myeloma cell lines as fusion partners to generate hybridomas.

[0149] Briefly, the immunization protocol was as follows: BALB / c mice ( Naive female mice (8-20 weeks old) were immunized intraperitoneally (day 0) with an equal mixture of KLH-KD and KD-KLH in phosphate-buffered saline (PBS) as antigen, mixed at a 1:1 ratio with Sigma adjuvant system (Sigma catalog no. 6322) in a total volume of 200 μl per mouse, totaling 100 μg per mouse. On day 21, the mice were boosted with an equal mixture of KLH-KD and KD-KLH in PBS as antigen, mixed at a 1:1 ratio with Sigma adjuvant system (Sigma catalog no. 6322) in a total volume of 200 μl per mouse, totaling 50 μg per mouse. On day 30, blood samples were collected to assess KD-specific antibody titers. On day 51, mice were boosted for fusion with a mixture of equal parts KLH-KD and KD-KLH in PBS as antigen, totaling 50 μg per mouse, mixed with Sigma adjuvant system (Sigma catalog no. 6322) at a 1:1 ratio in a total volume of 200 μl per mouse. On day 55, mice were sacrificed by CO chamber, blood was collected by cardiac puncture, and spleens were harvested for hybridoma generation.

[0150] Hybridomas were generated by fusing mouse myeloma cells deficient in adenosine phosphoribosyltransferase (APRT) with spleen cells from mice immunized with a specific antigen. A selection system using HAT (hypoxanthine, azaserine, and thymidine) medium eliminates all but the APRT+ fused cells. Successful hybridomas must also retain one immunoglobulin (Igh) heavy chain and one immunoglobulin light chain locus and secrete functional antibody.

[0151] Hybridoma generation medium (IMDM) was made by combining the following: 500 ml of Iscove's Dulbecco's Modified Eagle's Medium (HyClone SH30259.01), 50 ml of fetal bovine serum (HyClone SH30070.03), 5 ml of L-glutamine (Gibco Invitrogen Catalog No. 25030), 5 ml of non-essential amino acids (Gibco Invitrogen Catalog No. 11140050), 5 ml of sodium pyruvate (Gibco Invitrogen Catalog No. 11360070), and 5 ml of 0.1% penicillin-streptomycin (Gibco Invitrogen Catalog No. 15140148). The medium was filtered before use. Growth medium was made by combining the following: serum-free medium (Gibco Hybridoma The freezing medium was 45 ml of filter-sterilized, heat-inactivated FBS (HyClone SH30070.03) and 5 ml of DMSO. Other materials included were as follows: HAT (50x) was obtained from Sigma-Aldrich (#HO262); Hybridoma Fusion and Cloning Supplement (50x) (Roche Diagnostics 11 363 735 001), Trypan Blue Stain 0.4% (Invitrogen catalog number 15250-061 or T10282); PEG 1500 in 75 mM Hepes 50% w / v (Roche catalog number 783641 (10783641001)). All reagents except HAT and Hybridoma Fusion and Cloning Supplement were used at 37°C.

[0152] [Table 6]

[0153] Briefly, three or four days before fusion, mice were boosted with the antigen of interest either intraperitoneally or intravenously. On the day of fusion, mice were sacrificed in a CO2 chamber, blood was collected by cardiac puncture, and spleens were removed and placed in 10 ml of serum-free IMDM in a Petri dish. Fusion partner myeloma cells: FO (ATCC ref CRL-1646) / x63Ag8.653 (ATCC ref CRL1580) were grown to logarithmic phase and then split (1:2 and 1:5) one day before fusion, collected in a 20 ml centrifuge tube, spun, and the pellet resuspended in 10 ml of IMDM. The pellet was washed twice with serum-free IMDM medium. All centrifugations were performed at 1570 rpm for 5 minutes. The final resuspension was in 10 ml of serum-free IMDM. The connective tissue was dissected from the spleen. The spleen was injected with 1 ml of serum-free IMDM pre-warmed to 37°C using a 1 ml syringe and a 25-gauge needle. The splenocytes were squeezed out of the elastic fibrous outer membrane with forceps, washed twice (including the first spin) with 10 ml of serum-free IMDM, and resuspended in 10 ml of serum-free IMDM. The cells were counted using a Countess automated cell counter.

[0154] Fusion partner cells and splenocytes were combined in a 50 ml tube at a ratio of 1:2 to 1:10 (depending on cell number) and spun at 970 rpm for 10 minutes (slow spin) to form a loose pellet. After the "slow" spin, the supernatant was removed, taking care not to disturb the pellet but minimizing the amount of liquid above the cells to avoid diluting the PEG 1500. The remaining medium was saved and added back after the addition of PEG (see below). Pre-warmed PEG 1500 (37°C, 1 ml total volume) was added dropwise to the cell pellet over a 1-minute period, and the cells were mixed after the PEG was added dropwise. The pellet was incubated with PEG for an additional 1 minute, after which 10 ml of serum-free IMDM medium was added over 1 minute, with the first 1 ml added over 30 seconds. The cells were spun at 970 rpm for 10 minutes and the supernatant was decanted. The following was added to a 100 ml trough (2): 70 ml of IMDM containing 10% FBS, 2 ml of HAT, and 2 ml of Hybridoma and Fusion Cloning Supplement. The cells were resuspended in 10 ml of IMDM containing 10% FBS and divided into two 50 ml tubes (5 ml cells per tube), and 25 ml of IMDM containing 10% FBS was added. The resulting 30 ml was transferred to a trough containing 70 ml of HBSS / HAT / cloning supplement, and 200 μl of cells / well were pipetted into a 96-well plate (10). After approximately 10 to 14 days, or when the medium in the wells turned yellow, the fusions were ready for screening by ELISA (50 μl). After the first screening, positive clones were selected, numbered, and transferred to a 24-well plate in 500 μl per well of IMDM containing 10% FBS. Hybridoma supernatants were screened by ELISA on streptavidin plates coated with N- and C-terminally biotinylated peptides (see below).

[0155] Example 2 Characterization and selection of hybridomas expressing antibodies against human BKR1 ligands Hybridoma supernatants were screened by ELISA on streptavidin plates coated with N- and C-terminal biotinylated peptides (see, for example, those listed in Table 2), and antibody binding kinetics were then determined for confirmed positive hybridoma clones.

[0156] The ability of antibodies in hybridoma supernatants to bind to BKR1 ligand peptides was assessed by ELISA assay. DAKD-biotin or KD-biotin peptides were coated onto 96-well SA plates in phosphate-buffered saline (PBS) buffer for 1 hour at room temperature, and nonspecific binding sites were blocked with 1% bovine serum albumin (BSA) in PBS buffer. Primary and secondary screening of crude hybridoma supernatants was performed using this plate. Hybridoma supernatants were added to the plate for binding to the coated KD or DAKD peptides. After 1 hour of incubation, the plates were washed, and bound antibodies were detected using a horseradish peroxidase (HRP)-conjugated secondary antibody (HRP-goat anti-mouse IgG (H+L): Jackson ImmunoResearch Labs #115-035-166) and developed with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) substrate (Roche diagnostics #11 204 521 001). Data were analyzed using Excel. A positive signal (1:10,000 serum dilution ELISA) was obtained. Antibodies showing a signal higher than 2-fold were selected and rescreened twice for confirmation. Confirmed positive hybridoma clones were selected and subjected to binding off-rate ranking by Biacore.

[0157] For antibody binding kinetics, the instrument used was a BIACORE2000 or BIACORE3000 (GE Healthcare), designed for real-time biomolecular interaction analysis (BIA). The sensor chip used was an SA chip (GE Healthcare) with streptavidin covalently immobilized on a carboxymethylated dextran matrix. Each sensor chip has four parallel flow cells (Fc). Biotinylated BKR1 or BKR2 ligand peptides were immobilized on one of flow cells 2 to 4 (Fc2 to Fc4) of the SA chip for binding / dissociation rate screening and selectivity screening. Flow cell 1 (Fc1) was reserved and immobilized with a random peptide (biotinylated at one end) of equal or similar length to the ligand peptide to be tested as a negative control. In the screening assay, cell culture supernatant of hybridoma clones selected by primary screening of transiently expressed humanized variants was injected over the immobilized peptides. Hybridoma cell culture medium was also injected onto the surface of the chip as a blank to establish a baseline. After subtracting the signals from Fc1 and blank buffer, the dissociation rate of the antibody from the supernatant for each peptide was analyzed and ranked using BIAevaluation software. The top (Kd<10 -4 Only antibody clones that demonstrated binding dissociation rates of 1 / s were selected for subcloning and further characterization. In kinetic analysis, the corresponding biotin-peptides identified in screening for the test antibodies were immobilized on Fc2 to Fc4, and Fc1 with a random peptide was used as a reference cell. Each purified antibody selected from screening was made into a two-fold serial dilution in running buffer (1x HBS-EP buffer, GE Healthcare) between 0.1 nM and 10 nM. The binding association rate, dissociation rate, and overall affinity were calculated in BIA evaluation. Antibody binding kinetics for each antibody was always confirmed in triplicate assays using Biacore.

[0158] A total of eight mice were immunized with a mixture of KLH-KD / KD-KLH and KLH-DAKD / DAKD-KLH, and spleens were fused using the protocol described above. After primary screening of approximately 7680 hybridoma clones in ELISA with DAKD-biotin and KD-biotin, only 76 clones were confirmed as positive and selected for binding / dissociation rate ranking in Biacore 3000 / 2000 across DAKD-biotin and KD-biotin immobilized on a streptavidin (SA) chip. Of these, only 76 clones with binding / dissociation rates <=10 -4 Eight hybridoma clones representing the nucleotide sequences were subcloned, sequenced, purified, and further characterized (see Table 3).

[0159] [Table 7]

[0160] [Table 8]

[0161] Based on the results seen in Table 3, five clones with unique sequences were selected for kinetic studies. These antibodies were highly selective for binding DAKD-biotin, KD-biotin, DAKLP-biotin, and KLP-biotin (see Table 4). They do not bind to other kinin peptides or to peptides that are N-terminally biotinylated.

[0162] [Table 9]

[0163] Further immunizations were performed with an array of immunogens (see list of peptides, Table 2) to generate antibodies that block rodent BKR1 ligands, DABK and DAKD, as well as antibodies with other binding specificities for different members of the kinin family of peptides. Table 5 lists the heavy and light chain sequences of the antibodies generated.

[0164] [Table 10]

[0165] [Table 11]

[0166] Example 3 Production of surrogate antibodies for mouse animal testing The surrogate antibody used in the mouse animal test is a rodent BKR1 ligand, DA The antibodies were required to be able to bind to and neutralize DABK, DAKLP, and DAKD (the murine equivalent of DAKD). To generate the required surrogate antibodies, mice were first immunized with DABK and / or DAKD, and KLH was directly conjugated to the N-terminus of the peptide. Hybridoma clones that were positive for biotin-DABK / biotin-DAKD (direct biotinylation on the N-terminus of the peptide) from ELISA screening were selected for scale-up and purification. Antibodies listed in Family 7 (see Table 12), which demonstrated high binding affinity to biotin-DABK, biotin-DAKLP, and biotin-DAKD, were selected based on Biacore direct binding assays (Table 10). However, these Family 7 antibodies did not show binding to the native, unmodified DABK and DAKD peptides in competitive ELISA and lacked neutralizing function in calcium influx assays using a functional drug screening system (FDSS) (Hamamatsu Photonics KK, Japan). Furthermore, biotin-DABK and biotin-DAKD completely lost bioactivity in the FDSS assay compared to the native, unmodified DABK and DAKD peptides (data not shown).

[0167] We hypothesized that direct N-terminal conjugation of KLH and biotin would prevent the formation of the native conformation of DABK and DAKD. Aiming to restore the native conformation of the KLH- and biotin-conjugated peptides, linkers were designed and added to the N-terminus of DABK and / or DAKD to "cushion" the effect of the KLH / biotin conjugate on the conformation of the peptides. Based on modeling results, a polyglycine linker was first attempted and tested due to its simple, nonpolar, and neutral nature. The results of the FDSS assay indicated that the gly-gly-gly (3G) linker was the best in terms of its ability to restore the bioactivity of the KLH- and biotin-conjugated DABK and DAKD peptides (data not shown). Therefore, KLH-3G-DABK was selected for immunization of mice. Biotin-3G-DABK and biotin-3G-KD were also used in binding-based screening assays (ELISA and Biacore). Several DABK / DAKD-specific antibodies (Family 3, see Table 13) were identified in this new round of surrogate antibody hybridoma selection. EE1 was selected as the lead surrogate antibody based on its top binding affinity and neutralizing activity against native DABK / DAKD, as well as its lack of cross-reactivity to other peptides (see Tables 6-12).

[0168] Antibodies with different specificities were produced using different immunogens listed in Table 13. Family 4 antibodies were specific for the BKR2 receptor ligands, BK and KD. Family 5 antibodies specifically bind to the C-terminus of BK and DABK. Family 6 antibodies bind to BK, DABK, and DAKD, but not KD.

[0169] Additional linkers, including longer polyglycine linkers, polyalanine linkers, and existing linkers such as polyethylene glycol (PEG) and aminohexanoic acid (Ahx) linkers (6-carbon inert linkers), were evaluated for their ability to fit into the DABK / DAKD binding pocket in EE1 for binding to the surrogate EE1 antibody. All linker peptides were custom synthesized by Abgent (San Diego, CA). All biotinylated peptides with linkers tested (biotin-linker-DABK / DAKD) bound well to EE1, indicating that all inert N-terminal linkers help the DABK and DAKD peptides retain their native, bioactive conformation when conjugated with biotin and other molecules. In contrast, no or poor binding to EE1 was observed for the biotin-DABK and biotin-DAKD peptides, which have a direct biotin conjugate at the N-terminus (see Figure 1).

[0170] The binding kinetics of the antibodies produced are summarized in Tables 5-11. All of the antibodies produced were then sorted into families, and their binding specificities are summarized below in Table 12. Table 13 provides the heavy and light chain sequences of the antibodies, which were placed into Family 1 and Family 2 based on their binding specificity (see Table 12).

[0171] [Table 12]

[0172] [Table 13]

[0173] [Table 14]

[0174] [Table 15]

[0175] [Table 16]

[0176] [Table 17]

[0177] [Table 18]

[0178] [Table 19]

[0179] Example 4 Characterization of des-arg-kinin ligand depletion using calcium mobilization Seven families of antibodies were further characterized using functional assays. Bradykinin B1 receptor signaling is Gq-coupled, so receptor activation can be monitored using IP3 activation of Gq and downstream calcium mobilization. Calcium mobilization was measured using HEK mBKR1 (recombinant mouse bradykinin B1 receptor) cells or MRC5 (endogenously expressing the bradykinin B2 receptor (ATCC CCL-171)) cells.

[0180] Briefly, the mouse Bdkrb1 gene (sequence provided below) was amplified from mouse lung cDNA (Biochain, catalog number C1334152) using PCR primers 804_cGWY_F: 5'-AAAAGCAGGCTTAGGAGCGGCCGCCATGGCGTCCCAGGCCTCGCTG-3' (SEQ ID NO: 107) and 804_cGWY_R: 5'-CAAGAAAGCTGGGTCGGATCCTTATAAAGTTCCCAGAACCCTGGTC-3' (SEQ ID NO: 108) and Pfu polymerase (Agilent Technologies, catalog number 600264) and cloned into pDONR201 using BP clonase enzyme mix (Invitrogen, catalog number 11789-020). In parallel, the pEAK8 expression vector (EDGE Biosystems) was modified by inserting an N-terminal HA tag (GCATACCCATACGACGTCCCAGACTACGCT, GenBank SEQ ID NO: 109CY100443) into pEAK8 linearized with EcoRI and HindIII (vector pEAK8-nHA). Subsequently, Gateway Cassette B (Invitrogen, catalog no. 11828-029) was inserted into pEAK8_nHA digested with EcoRI and NotI and blunt-ended with Klenow polymerase (NEB, catalog no. M0210S), resulting in vector pEAK8_nHA_DEST. Mouse Bdkrb1 was then subcloned into pEAK8_nHA_DEST using LR clonase (Invitrogen, catalog no. 11791-100). 293-PSC cells were then transfected with the pEAK8-Bdkrb1 plasmid using Fugene6 transfection reagent. Cells were placed under antibiotic (puromycin) selection 24 hours after transfection and maintained under this selection to generate stable cell lines. The presence of the Bdkrb1 gene in the resulting stable cell lines was confirmed by real-time RT-PCR and agarose gel electrophoresis. Cell surface expression of the bradykinin B1 receptor was measured using an antibody against the N-terminal HA tag on the bradykinin B1R (Covance, catalog number MMS-101P) on a FACS instrument. Functional activity of the bradykinin B1 receptor was demonstrated in a calcium mobilization assay with selective agonists.

[0181] The Bdkrb1 gene subcloned into cells:

[0182] HEK mBKR1 or MRC5 cells were plated in growth medium in 384-well clear-bottom plates and allowed to attach overnight. Growth medium was removed, and cells were washed in assay buffer (HBSS, 20 mM HEPES, 2.5 mM probenecid) and then loaded with 0.5 μM Fluo-4 AM cell-permeable calcium-sensing dye containing 0.04% pluronic acid for 1 hour at 37°C. The AM ester was cleaved, retaining the calcium dye in the cytoplasm. After 1 hour, cells were washed to remove excess dye, leaving 20 μl of residual buffer on the cells. Treatments were added as 2x solutions on a Hamamatsu Functional Drug Screening System (FDSS), and calcium mobilization was monitored kinetically for at least 4 minutes. Activation of B1R or B2R receptors leads to Galpha q-mediated activation of phospholipase C and IP3-mediated calcium mobilization. Fluo-4 dye chelates the released calcium, and robust changes in fluorescence are observed. Results were exported as max-min relative fluorescence units to normalize for differences between cell densities or dye loading across plates.

[0183] Ligand potency was determined each day by running a ligand concentration-response curve, and the approximate EC70-EC80 concentration of ligand was selected for antibody incubation. An EC80 concentration was selected because it was within the linear range of the detection curve and provided a sufficient window to observe antagonist or ligand-depleting antibody reduction. Antibody dose-response curves allowed binding to an EC80 concentration of ligand, and the degree of ligand depletion was monitored using changes in fluorescence. Results were normalized to buffer and EC80 ligand response, and the EC50 for ligand depletion was calculated. Results were then reported as a molar ratio, which corresponds to the antibody concentration that reduces 50% depletion of the ligand response (i.e., the EC50 of the Ab) divided by the ligand concentration used. Because one unit of antibody should be able to deplete two units of ligand, the theoretical maximum should be 0.5, but we have observed values ​​lower than this in practice. This may reflect insensitivity of the detection method to low ligand concentrations rather than stoichiometric constraints on the antibody. The results of these experiments are shown in Tables 14-16.

[0184] Family 1 and Family 2 antibodies (see Table 13) demonstrate superior binding kinetics by Biacore (Table 13) and neutralizing activity as measured by calcium mobilization against the DAKD and KD peptides (Tables 14 and 15). The antibodies were further analyzed for their thermal stability and sequence suitability for humanization. F151 was a step forward for humanization because it was thermostable, free of problematic residues in the CDR regions, and cross-reactive with the murine ligands KLP and DAKLP.

[0185] [Table 20]

[0186] [Table 21]

[0187] Example 5 Engineering F151: Humanization, stabilization, and mutation of unnecessary sequence motifs 1. Humanization The humanization protocol used is described in PCT International Publication No. PCT / US99 / 01999, which is incorporated herein by reference in its entirety. The homology models of anti-DAKD / KD F151 LC and HC were constructed in the Molecular Operating Environment (MOE; v.2009.10; Chemical Computing Group) using the variable light chain (VL) and variable heavy chain (VH) sequences of mouse F151. The following templates were used: light chain framework-1SBS (93% identity in the framework region), heavy chain framework-2VXT (84% identity in the framework region), L1-1LVE (93% identity), L2-1EEU (100% identity), L3-2R56 (93% identity), H1-1NJ9 (95% identity), H2-2VXU (76% identity), and H3-1HIL (49% identity). Templates are available in the RCSB Protein Data Bank, found on the World Wide Web at rcsb.org, a website maintained by Rutgers and the University of California, San Diego (Berman, HM, Westbrook, J., Feng, Z., Gilliland, G., Bhat, TN, Weissig, H., Shindyalov, IN, Bourne, PE, The Protein Data Bank, Nucleic Acids Research, 2000, 28, 235-242). The homology model was subsequently energy-minimized using standard procedures implemented in MOE. Molecular dynamics (MD) simulations of the minimized 3D homology model of mouse F151 were subsequently performed in Generalized Born in implicit solvent for 1.1 nanoseconds (ns) at a temperature of 500 K with constraints on the protein backbone. Ten diverse conformations were sampled every 100 picoseconds (ps) from this initial MD run for the last 1 ns. These various conformations were then each subjected to MD simulations, with no restraints on the protein backbone, for 2.3 ns at a temperature of 300 K.For each of the 10 MD runs, the final 2,000 snapshots, one per 1 ps, from the MD trajectory were then used to calculate the root mean square deviation (rmsd) for each mouse F151 amino acid compared to a reference medoid position. By comparing the average rmsd for 10 separate MD runs for a given amino acid to the overall average rmsd for all F151 mouse amino acids, it was determined that if an amino acid was sufficiently flexible, as seen during MD, it could potentially interact with T cell receptors and be considered reactive in activating the immune response. 62 amino acids were identified as flexible in the mouse F151 antibody, excluding the CDRs and their immediate vicinity within 5 Å.

[0188] The movements of the 28 most flexible mouse F151 amino acids were then compared with the movements of the corresponding flexible amino acids in 49 human germline phasic models over a 20-ns (10 × 2 ns) time period, and 10 × 2 ns MD simulations were run on each. The 49 human germline models were constructed by systematically matching the seven most common human germline light chains (vk1, vk2, vk3, vk4, vlambda1, vlambda2, and vlambda3) and the seven most common human germline heavy chains (vh1a, vh1b, vh2, vh3, vh4, vh5, and vh6). The flexible amino acids in the vk1-vh1b human germline antibody showed a 4D similarity of 0.80 compared to those in the mouse F151 antibody. Therefore, we focused on the flexible amino acids and humanized the F151 amino acids using the vk1-vh1b germline antibody. The two sequences were aligned based on the best-fit 3D superposition of the alpha carbons of the two corresponding homology models for pairwise amino acid associations between the vk1-vh1b amino acids of mouse F151 (see Figure 15 for the alignment of F151 LC and F151 HC with vk1 and vh1b, respectively).

[0189] 2. Stabilization Two approaches were used to improve antibody stability.

[0190] a) Knowledge-based approach Low-frequency light and heavy chain amino acids versus their respective canonical sequences were proposed to be mutated to the most frequently occurring amino acids, excluding the CDRs (ΔΔGth > 0.5 kcal / mol; E. Monsellier, H. Bedouelle. J. Mol. Biol., 362, 2006, 580-593). This initial list of consensus mutations for the light chain (LC) and heavy chain (HC) was restricted to amino acids found in the closest human germline (vk1-vh1b). Suggested changes in the closest vicinity of the CDRs (5 angstrom "Vernier" zone, J. Mol. Biol., 224, 1992, 487-499) were excluded from consideration. This resulted in five stabilizing mutations in the LC (see Table 19) and four stabilizing mutations in the HC (see Table 20). These mutations were considered for potential stabilization of the anti-DAKD / KD F151 antibody, taking into account other criteria. These criteria were favorable changes in surface hydropathy or predicted stabilization of variants based on molecular mechanics. Additional stabilizing mutations reported to be successful in the literature (E. Monsellier and H. Bedouelle, J. Mol. Biol., 362, 2006, 580-593; BJ Steipe et al., J. Mol. Biol., 240, 1994, 188-192) were also considered (see Tables 16-22). One of these changes was incorporated as a stabilizing mutation (D89E) in the following HC2a, HC2b, and HC2c sequences. Another suggested change (Q62E) was incorporated into variant HC2b.

[0191] b) 3D and MD-based approaches 3D and MD-based approaches have been previously reported (Seco J, Luque FJ, Barril X., J Med Chem., April 23, 2009, Vol. 52(8), pp. 2363-71; Malin Jonsson et al., J. Phys. Chem. B, 2003, Vol. 107, pp. 5511-5518). Analysis of molecular dynamics simulations of the Fab in a binary solvent (20% isopropanol in water, 20 ns generation simulation) clearly identified hydrophobic regions of the antibody. Lysine mutations were then introduced near these regions to prevent aggregation. Further analysis was completed using a hydrophobic surface map within Schrödinger's Maestro software (v. 8.5.207). Using a combination of these two techniques, two Lys mutations were suggested: one in the heavy chain and one in the light chain.

[0192] 3. Humanization by grafting Humanization using grafting techniques has been previously reported (Peter T. Jones, Paul H. Dear, Jefferson Foote, Michael S. Neuberger, and Greg Winter, Nature, 1986, 321, 522-525). The humanization process used began by identifying the closest human germline sequences to the anti-DAKD / KD light and heavy chains. This was done by performing a BLAST search against all systematically enumerated human germline sequences (all possible combinations of V and J domains for kappa and lambda chains; V, D, and J domains for the heavy chain).

[0193] The closest human germlines were identified with 83% and 62% sequence identity to the anti-DAKD / KD F151 light chain (LC) and heavy chain (HC), respectively (see Figure 16). Using the internal VBASE germlines, the light chain is found to be close to the VIV-B3 locus (approximately 83% identity), and the heavy chain is found to be close to the 1-08 and 1-18 loci of the VH1 subfamily (approximately 62% identity). The CDR regions (as defined by MOE) and Vernier regions (as defined in Foote and Winter, J. Mol. Biol., 1992, 224, 487-499) are shown in bold. The underlined humanized variants are shown. Differences were obtained by performing a pairwise comparison of the two aligned sequences, excluding residues in the CDRs and Vernier zones as defined above. In another humanized variant, only the CDRs were excluded in the comparison.

[0194] 4. Mutation of unwanted sequence motifs The following sequence motifs were considered: Asp-Pro (acid-labile bond), Asn-X-Ser / Thr (glycosylation, X = any amino acid except Pro), Asp-Gly / Ser / Thr (succinimide / iso-asp formation in flexible regions), Asn-Gly / His / Ser / Ala / Cys (exposed deamidation sites), and Met (oxidation in exposed regions). Among other criteria, the VL and VH domains of mouse F151 were selected from other mouse antibodies because mouse F151 lacks exposed unwanted sequence motifs, which are introduced in some humanized variants.

[0195] LC3a, LC3b, HC3a, and HC3b each have identified potentially problematic succinimide sites. These sites were not modified in the proposed sequences because the residues involved are potentially involved in H-bond networks (visual inspection of the homology model). These positions are also found in numerous other antibody structures. Furthermore, in both HC3a and HC3b, rigorous humanization by grafting involves substituting Ser115 with Met, exposing this methionine. Because leucine is a common residue among many close human germline sequences, substituting leucine at this position is suggested as a humanizing mutation.

[0196] The resulting humanized sequences were BLAST searched for sequence similarity against the International Epitope Database (IEDB) database (found on the World Wide Web at immuneepitope.com; version June 2009; Vita R, Zarebski L, Greenbaum JA, Emami H, Hoof I, Salimi N, Damle R, Sette A, Peters B. The immune epitope database 2.0. Nucleic Acids Res. 2010 January;38(Database Issue):D854-62. Epub 2009 November 11) to ensure that none of the sequences contained any known human B-cell or T-cell epitopes (70% sequence identity was used as the cutoff for results obtained by BLAST search, considering only results from the human species).

[0197] 5. Original sequence of mouse F151 variable domain The CDRs are highlighted in bold and the Vernier region (Foote and Winter, J. Mol. Biol., 1992, 224, 487-499) is underlined.

[0198] Light chain (SEQ ID NO: 26) [ka] Germinality index = Z46615_1_V_X67858_1_J[V IV-B3] and 83%

[0199] Heavy chain (SEQ ID NO: 19): [ka] Germlinality index = Z12316_1_VX97051_4_D_X97051_5_J[VH1 1-18] and 62%

[0200] 6. Manipulated array a) Background Five versions have been proposed for the light chain (LC1, LC2a, LC2b, LC3a, and LC3b) and five versions for the heavy chain (HC1, HC2a, HC2b, HC3a, and HC3b).

[0201] LC1 contains five humanized mutations identified using the 4D humanization protocol. LC2a introduced five additional stabilizing mutations. LC2b added one lysine mutation to help prevent aggregation. LC3a contained 15 mutations derived from grafting to the closest human germline sequence and retained mouse CDR and Vernier zone residues. LC3c contained 16 mutations derived from CDR grafting along with one additional humanized mutation.

[0202] HC1 has six humanized mutations identified by our in-house protocol. HC2a introduces five additional stabilizing mutations, and HC2b contains six additional stabilizing mutations compared to HC1. HC2c contains one Lys mutation in addition to the stabilizing mutations of HC2a to help prevent aggregation. HC3a contains 19 mutations derived from grafting to the closest human germline sequence and retains mouse CDR and Vernier zone residues. HC3b contains 25 mutations derived from CDR grafting.

[0203] A total of six combinations were proposed (summarized in Table 16): LC1×HC1 (mutations that address humanization only) LC2a x HC2a (mutations addressing humanization and stabilization) LC2a x HC2b (mutations addressing humanization and stabilization) LC2b x HC2c (mutations addressing humanization, stabilization, and "anti-aggregation") LC3a x HC3a (mutations that almost completely address humanization through grafting + vernier) LC3b × HC3b (mutations that address humanization by grafting)

[0204] [Table 22]

[0205] [Table 23]

[0206] [Table 24]

[0207] a) Engineered light chain sequence No known potentially problematic T-cell or B-cell epitopes were found in any of the proposed variants.

[0208] LC1 (SEQ ID NO: 27), humanizing mutations are underlined, CDRs and Vernier zones are in bold: [ka]

[0209] LC2a (SEQ ID NO: 28), humanizing mutations are underlined, CDRs and Vernier zones are in bold, stabilizing mutations are in italics (T at position 5, S at position 12, I at position 21, S at position 69, T at position 91, as shown below): [ka]

[0210] LC2b (SEQ ID NO: 29), humanizing mutations are underlined, CDRs and Vernier zones are in bold, stabilizing mutations are in italics (shown below: T at position 5, S at position 12, I at position 21, S at position 69, T at position 91), anti-aggregation mutation is K at position 89: [ka]

[0211] LC3a (SEQ ID NO: 30), grafted mutations are shown underlined, CDRs and Vernier zones are shown in bold: [ka]

[0212] LC3b (SEQ ID NO: 31), grafted mutations are shown underlined, CDRs and Vernier zones are shown in bold: [ka] Note that L at position 52 is the Vernier residue that is mutated in humans.

[0213] c) Engineered Heavy Chain Sequence HC1 (SEQ ID NO: 20), humanizing mutations are underlined, CDRs and Vernier zones are in bold: [ka]

[0214] HC2a (SEQ ID NO: 21), humanizing mutations are underlined, CDRs and Vernier zones are in bold, and stabilizing mutations are in italics (Q at position 1, A at position 9, G at position 44, Y at position 80, and E at position 90, as shown below): [ka]

[0215] HC2b (SEQ ID NO: 22), humanizing mutations are underlined, CDRs and Vernier zones are in bold, and stabilizing mutations are in italics (Q at position 1, A at position 9, G at position 44, E at position 62, Y at position 80, and E at position 90, as shown below): [ka]

[0216] In the IEDB database, no human epitopes were identified for the sequence HC2b.

[0217] HC2c (SEQ ID NO: 23), humanizing mutations are underlined, CDRs and Vernier zones are in bold, stabilizing mutations are in italics (shown below: Q at position 1, A at position 9, G at position 44, Y at position 80, and E at position 90), anti-aggregation mutation is K at position 86: [ka]

[0218] HC3a (SEQ ID NO: 24), grafted mutations are underlined and CDRs and Vernier zones are in bold: [ka]

[0219] LC3b (SEQ ID NO: 25), grafted mutations are shown underlined, CDRs and Vernier zones are shown in bold: [ka]

[0220] Note that the following Vernier residues are mutated in humans: V at position 2, M at position 48, V at position 68, M at position 70, and T at position 74. In the IED8 database, no human epitopes were identified for the sequence HC3b. HC3b Germinality Index = Z12316_1_V_J00235_1_D_U42590_1_J[1-18 / DP-14] and 83%

[0221] [Table 25]

[0222] [Table 26]

[0223] [Table 27]

[0224] [Table 28]

[0225] Example 6 Characterization of humanized variants Based on the in silico modeling shown in Table 16, DNA for the variable regions of the light chain (VL) and heavy chain (VH) of humanized F151 was codon-optimized for HEK293 expression and gene-synthesized by GeneArt (a subsidiary of Life Technologies). The synthesized DNA fragments were cloned into the constant region of pFF0362 (A. human kappa LC vector), a vector encoding the light chain (CL), at the ApaLI / BsiWI sites, and into the constant region of pFF0363 (B. human IgG1 HC vector), a vector encoding the heavy chain (CH1, CH2, and CH3), at the ApaLI / ApaI sites. The resulting plasmid, pFF0640, containing the full-length LC, and the humanized F151 were cloned into the constant region of pFF0362 (A. human kappa LC vector), a vector encoding the light chain (CL), at the ApaLI / ApaI sites. pFF0466, containing the full-length HC of the 151 variant, was co-transfected and transiently expressed in the FreeStyle™ 293 Expression System (Invitrogen / Life Technologies, Cat. No. K9000-01).

[0226] The six humanized variants shown in Table 16 were characterized by various parameters such as binding kinetics (discussed above), as well as chemical and physical properties, e.g., thermal stability, which are routinely used in the art.

[0227] Characterization was performed in two stages. Stage I included differential scanning calorimetry (DSC), as shown in Table 24 and Figure 2. Briefly, for DSC experiments, the antibody was dialyzed against phosphate-buffered saline solution. Antibody concentration was measured by UV absorption. The antibody was diluted to 1 mg / mL with PBS. Scans were performed with a Calorimetry Sciences Corporation N-DSC II instrument using a 0.3268 mL capillary cell with PBS in the reference cell. The scan rate was 2°C / min, and samples were scanned from 20°C to 100°C.

[0228] All variants, except for HC3b / LC3b, showed comparable binding affinity to the parent antibody. Variant HC3a / LC3a was selected over other variants based on other physicochemical properties, such as SEC data, stability, and lack of aggregation (see Tables 23-25).

[0229] [Table 29]

[0230] [Table 30]

[0231] [Table 31]

[0232] [Table 32]

[0233] See Figure 3 for alignment of the parental F151 light and heavy chains to the humanized F151 variant (HC3a / LC3a).

[0234] Example 7 BRK1 ligands kallidin and des-Arg 10 -Humanized antibody F1 against kallidin 51 crystal structures Kallidin or des-Arg 10 We determined the crystal structure of humanized F151(HC3a / LC3a) Fab binding to -kallidin and analyzed the molecular interactions.

[0235] Kallidin powder was purchased from Phoenix Pharmaceuticals (catalog number 009-37). For Fab protein production, DNA of the heavy chain (HC) VH region from humanized F151 HC3a was cloned into the 6xHis-tagged CH1 vector pFF0366. The light chain (LC) plasmid used here was the same as the original F151 LC3a plasmid used in F151 humanization (see Example 5). The two plasmids were cotransfected into freestyle HEK293 cells for Fab expression. The Fab protein was purified using cobalt resin and concentrated to approximately 9 mg / mL after buffer exchange into 50 mM MES pH 6.0, 50 mM NaCl. The purified F151 Fab protein was mixed with Kallidin at a molar ratio of 1:2 and set up for crystallization screening. Crystallization screening was performed under a wide range of conditions using the Hampton Research screening kit PEG / ION. The best crystals were observed under HT conditions B10, B12, and G10. Crystals were cryoprotected with 20% glycerol in well buffer and frozen for diffraction data collection. X-ray diffraction data for both complexes were collected at the Canadian Light Source, beamline CMCF-08ID. The Rmerge for the F151-KD complex was 8.9%, with I / s(I) = 20.2, compared with 7.7% and 18.5 for F151-DAKD, respectively. The F151-KD structure was determined by molecular replacement in Phaser to yield a V L -V H and C L -C H Each domain was treated as an independent unit and solved using the Fab coordinates from PDB entry 3QOS. The structure was refined with autoBuster at 2.07 Å resolution in space group P212121 with an R factor of 0.205 and an R free of 0.228. The F151-DAKD structure was solved using the F151-KD coordinates. The structure was refined with autoBuster at 1.86 Å resolution in space group P212121 with an R factor of 0.232 and an R free of 0.238.

[0236] The electron density maps shown in Figures 4 and 5 show the structure of kallidin (KD) and Des-Arg 10 The binding of Kallidin (DAKD) to F151 Fab is shown, and the position of each amino acid is clearly determined. 10 There is no electron density for Phe in KD. This is consistent with the observation that DAKD (shown in Table 27 below), which lacks the C-terminal arginine residue, binds equally well to F151 as KD. The IC50 values ​​of F151 in the neutralization FDSS cell assay for KD and DAKD are 0.12 nM and 0.09 nM, respectively. In both cases, the electron density weakens towards the C-terminus of the peptide. 9 is Phe in DAKD 9Since KD has slightly better electron density than DAKD, the presence of an additional arginine at the C-terminus of KD may stabilize the C-terminus of this peptide when bound to F151, but this arginine is not stable enough by itself to be observed by X-ray. Since the two structures are essentially identical (rms between KD and DAKD is 0.139 for C atoms and 0.328 for all atoms), all of the following discussion is based on the F151-KD structure.

[0237] [Table 33]

[0238] The KD binds with its N-terminus buried in the interface between the light and heavy chain Fv subunits, as shown in Figure 6. The interface between the light and heavy chains is filled with aromatic amino acids, including Tyr-L42, Tyr-L93, Tyr-L100, Trp-L102, Phe-L104, and Tyr-H35, Trp-H47, Tyr-H50, Tyr-H99, and Trp-H110, which mutually stabilize the interface through stacking and hydrophobic interactions. Residues from the CDRs of the light and heavy chains contribute to binding. Residues along the light and heavy chains involved in interactions with the KD, mapped onto the CDRs, are shown in Figures 7 and 8. The heavy chain CDR H3 is the longest loop and is most frequently used in interactions with the KD, forming a side cover for the KD. The loop was primarily stabilized by interactions with the other two CDRs, H1 and H2 of the heavy chain: a salt bridge between Asp-H101 and Arg-H52 (stabilizing H1 and H3), an arene-H interaction between Tyr-H102 and Tyr-H54 (stabilizing H2 and H3), an H-bond between Asp-H108 and Tyr-H35, and an H-bond between His-H105 and Tyr-L55 (stabilizing H3 and L2).

[0239] Comparison of the KD-interacting residues between the antibodies produced reveals similarities between the antibodies, with some more involved in the use of specific amino acids for KD interactions than others. For example, in the light chain, F151, C63, and I22 bind to the KD using more similar amino acids in their CDRs, while B21 and I54 are even more similar. In the heavy chain, F151 and C63 are surprisingly unique from each other and from B21, I22, and I54. The latter three appear to form a similarity cluster. C63 is particularly interesting in its heavy chain, as the loop lengths in H2 and H3 are even more distinct from all others. Considering the Fab as a whole, B21 and I54 are most closely related.

[0240] In the crystal structure, we found that KD is involved in systematic hydrogen bonding and hydrophobic interactions with Fab. The N-terminus of KD is buried in the Fab and has more intensive interactions, while the C-terminus is essentially solvent-exposed. Except for the first four residues (Lys-Arg-Pro-Pro), the other residues of KD gradually extend into the bulk solvent. The amidinium group of the Lys1 side chain is tethered by a salt bridge with Glu-L61 (L: light chain), and the amino-terminal amino group of Lys1 forms a salt bridge with Asp-H108 (H: heavy chain). The amidinium group of the Lys1 side chain also dangles from the aromatic ring of Tyr-L55 and participates in cationic interactions. These strong interactions involving Lys1 tightly tether the amino terminus of KD in Fab. This is due to the F1 of KD. This also explains the importance of Lys1 in binding to hF151 (i.e., bradykinin). Without it (i.e., bradykinin), no detectable binding to hF151 or F151 could be measured. Like Lys1, Arg2 interacts with Fab through a salt bridge. The guanidium group of Arg2 interacts with the side chain of Asp-H104. The side chain of Arg2 also H-bonds to the main-chain carbonyl oxygen of Arg-H101. The main-chain oxygen of Pro8 also H-bonds to the side chain of Arg-H101. Tyr-H102 is semi-intercalated with Phe8 and Pro9 and participates in hydrophobic interactions with the KD. In addition to direct interactions, numerous water-mediated H-bonds are also observed between the KD and Fab. It is interesting to note that tyrosine residues are most frequently used in interactions compared to other amino acids; 9 of the 16 residues marked with asterisks in Figures 7 and 8 are tyrosines. All residues in F151 surrounding the KD appear to play a role in ligand binding, except for Asn-H33, which is close to the Phe6 side chain but is polarly incompatible and lacks other important interactions. Substitution of aromatic / hydrophobic residues, such as Trp or Tyr, for interactions with Phe8 appears to be a straightforward choice when affinity maturation is considered. These two aromatic amino acids are indeed found in other antibodies (Trp at C63 and Tyr at B21, I22, and I54). Table 28 below provides a detailed analysis of the 16 KD-interacting amino acid residues marked in Figures 7 and 8 and lists functional substitutions that can be made in the CDR regions that must not disrupt antigen binding.

[0241] [Table 34]

[0242] [Table 35]

[0243] Conformational epitope analysis of kallidin (KD) or desArg10-kallidin (DAKD) revealed that it adopts a "Pro4 kink" conformation. As shown in Figure 17, the "Pro4 kink" conformation is characterized by a type II tight turn in the main polypeptide backbone of KD or DAKD at proline 4 (see Richardson J.S., "The anatomy and taxonomy of protein structure." Adv. Protein Chem., 1981, 34, 167-339, incorporated herein by reference). The "Pro4 kink" conformation can be further defined by the fact that all or substantially all of the remaining amino acids of KD (positions 1-2 and 6-9) or DAKD adopt S-shaped repeats that spatially stack and align with hydrophobic side chains.

[0244] Example 8 In vivo pharmacology of anti-BKR1-ligand antibodies in pain models This example of the present invention describes the in vivo efficacy of anti-BKR1 receptor-ligand antibodies in various preclinical models of acute and chronic pain using modified procedures described in (a) Saddi GM and Abbott FV., Pain, 2000, 89:53-63; (b) Chen et al., Molecular Pain, 2010, 2:6-13; and (c) Bennett GJ and Xie YK., Pain, 1988, 33:87-107.

[0245] animal Adult male OF1 mice (20-30 g) were used for formalin experiments, and adult male C57BI / 6J mice (25-30 g) were used for both the CFA and CCI tests. Mice were maintained in a temperature-controlled room under a 12-h light / dark cycle. Food and water were available ad libitum. For all experiments, mice were allowed to acclimate to the laboratory for at least 2 h before testing. No randomization was performed. Experimenters performing behavioral tests were not blinded to treatment but were unaware of the test hypotheses. All procedures were approved by the Animal Care and Use Committee of Sanofi-Aventis Research and Development and were performed in accordance with French legislation implementing European directive 86 / 609 / EEC (Ministerial Order No. 87-848 of October 19, 1987, Decision No. 87-848 of April 19, 1988).

[0246] A. Formalin-induced acute inflammatory pain The formalin test was used to measure nociceptive and inflammatory pain. Indeed, intraplantar injection of formalin elicits an initial acute nociceptive behavioral response (0-12 min), followed by a secondary inflammation-mediated response (15-45 min) due to spinal cord excitability.

[0247] Formaldehyde (37%, Sigma) was diluted (v / v) with saline to obtain a formaldehyde concentration of 2.5% (i.e., a formalin concentration of approximately 6.25%). Mice were gently restrained, and 20 μL of this solution was injected subcutaneously into the dorsum of one hind paw. Behavioral responses were scored immediately after formalin injection and then at 3-minute intervals for 45 minutes as follows: (0) normal weight bearing of the injected paw, (1) lightly resting the injected paw on the floor, (2) lifting-elevation of the injected paw, and (3) licking or biting of the injected paw. Group sizes were 11–12 male OF1 mice.

[0248] Scores were plotted against time, and the area under the curve (AUC) was calculated from the mean scores (±SEM) for both the early phase (0-12 min) and the late phase (15-45 min). Reversal of pain-like behavior was expressed as the % change in AUC.

[0249] The EE1 antibody inhibited pain-like behaviors in the late phase of the formalin test in male OF1 mice. When administered intravenously 48 hours before intraplantar injection of formalin, the EE1 antibody demonstrated a dose-dependent reversal of pain-like behaviors in only the late phase, with a minimum effective dose (MED) of 2.5 mg / kg, as shown in Figure 9. Indeed, when administered at 2.5, 10, and 30 mg / kg, EE1 reversed the late phase by 35±5%, 33±5%, and 45±7%, respectively, as shown in Table 29.

[0250] In contrast, F151 weakly inhibited pain-like behaviors in the late phase of the formalin test when administered 48 hours before intraplantar injection of formalin. Indeed, as shown in Table 29, F151 reversed the late phase by 15±7% and 21±5% when administered at 2.5 and 10 mg / kg, respectively.

[0251] [Table 36]

[0252] B. CFA (Complete Freund's Adjuvant)-induced chronic inflammatory pain Chronic inflammation was induced by intraplantar administration of 25 μL of complete Freund's adjuvant (CFA) containing 1 μg / μL heat-killed Mycobacterium tuberculosis in mineral oil and mannide monooleate (Sigma) under brief anesthesia (isoflurane, 3%). Group size was 8 male C57B / 6 mice.

[0253] EE1 antibody was administered intravenously 22 hours after intraplantar injection of 2.5 mg / kg and 30 mg / kg CFA, and mechanical and thermal hypersensitivity were assessed on days 1 (D1), 4 (D4), and 7 (D7) after intraplantar CFA administration.

[0254] B1. Mechanical hypersensitivity Mechanical hypersensitivity was assessed by measuring the frequency of withdrawal response (FR, in %) after 10 applications of 0.6 g of Von Frey filaments (Bioseb, France) onto the plantar surface of the injected paw. To investigate the efficacy of EE1 antibody on pain-like behavior, we calculated the reversal of mechanical hypersensitivity (in %) as follows: Percent reversal was calculated for each mouse as (mean FR-isotype-control 投与後 -FR-Ipsi 投与後 ) / (mean FR-isotype-control 投与後 -Average FR-sham 投与後 ) was calculated as

[0255] After intraplantar CFA injection, a significant increase in FR to Von Frey filaments was observed in the isotype-control 1B7.11-treated group compared with the untreated group on D1, D4, and D7, demonstrating the development of mechanical hypersensitivity. When the EE1 antibody was administered intravenously 22 hours after intraplantar CFA, it was able to significantly reduce this FR compared with that obtained in the isotype-control 1B7.11-treated group at the various times examined (Figure 10).

[0256] Reversal of mechanical hypersensitivity was 41±8% and 22±8% on D1, 36±9% and 32±9% on D4, and 27±10% and 50±9% on D7 for intravenous administration of 2.5 mg / kg and 30 mg / kg of EE1 antibody, respectively (Table 30).

[0257] [Table 37]

[0258] B2. Thermal hypersensitivity Thermal hypersensitivity was assessed by measuring paw withdrawal latencies (PWL, in seconds) in response to radiant heat using a footpad apparatus (IITC, Woodland Hills, USA).

[0259] To investigate the efficacy of EE1 antibody on pain-like behavior, we calculated the reversal of thermal hypersensitivity (in %) as follows: Percent reversal was calculated for each mouse (PWL 投与後 -Average Isotype-Control 投与後 ) / (mean isotype-control 投与前 -Average Isotype-Control 投与後 ) was calculated as

[0260] Thermal hypersensitivity did not differ among all groups at baseline, before intraplantar injection of CFA (data not shown).

[0261] After intraplantar CFA injection, a significant reduction in the paw withdrawal latency of the injected paw was observed in the isotype-control 1B7.11-treated mice on D1, D4, and D7, demonstrating that CFA induced thermal hypersensitivity (data not shown). EE1 antibody was intravenously administered 22 hours after intraplantar CFA injection (i.e., on day 1 after intraplantar CFA injection), and the EE1 antibody failed to increase the paw withdrawal latency on D1, regardless of the dose tested (Figure 11). However, EE1 significantly increased the paw withdrawal latency on D4, and this effect was also present on D7 (Figure 11).

[0262] Reversal of thermal hypersensitivity was 41±15% and 58±21% on D4 and 46±10% and 52±17% on D7 for 2.5 mg / kg and 30 mg / kg intravenous administration of EE1, respectively (Table 31).

[0263] [Table 38]

[0264] C. CCI (chronic constriction injury)-induced neuropathic-like pain (Bennett's model) The CCI model was used as a model of peripheral nerve injury. Briefly, mice were anesthetized with isoflurane (3%), and the right sciatic nerve was exposed at mid-thigh level through a small incision. Three loose ligatures of 6.0 chromic gut (Ethicon) with 1 mm spacing were placed around the sciatic nerve. The surgical procedure was completed by closing the muscles and skin. The day of CCI surgery was designated as day 0. Group sizes were 6–10 male C57BI / 6 mice.

[0265] On day 11 after surgery, EE1 antibody was administered intravenously at 2.5 and 30 mg / kg, and mechanical and thermal hypersensitivity were assessed on days 12 (D12), 14 (D14), and 18 (D18) after surgery, which corresponded to days 1 (D1), 3 (D3), and 7 (D7) after treatment.

[0266] C1. Mechanical hypersensitivity Mechanical hypersensitivity was assessed by measuring the hind paw withdrawal threshold (for both the injured [i.e., Ipsi] and uninjured [i.e., Contra] paws) to increasing pressure (in g) stimuli using a Dynamic Plantar Aesthesiometer (Ugo-Basile, Italy), in which a steel rod was applied to the mouse hind paw with increasing force (5 g for 10 s).

[0267] To investigate the effect of EE1 antibody on pain-like behavior, we determined the reversal of mechanical hypersensitivity as follows: the percentage of reversal was calculated for each mouse (Ipsi 投与後 -Ipsi 投与前 ) / (Contra 投与前 -Ipsi 投与前 ) was calculated as

[0268] After surgery, operated mice developed robust sensitization to mechanical stimuli in the injured paw, but not in the uninjured paw. By day 11, mechanical sensitization to the injured paw reached a plateau (data not shown).

[0269] Intravenous administration of EE1 antibody on day 11 demonstrated a slight trend towards reversal of CCI-induced mechanical hypersensitivity on D12, D14, and D18: 15.2±4.9% and 15.2±5.7% on D12, 26.8±5.7% and 25.7±4.5% on D14, and 30.3±7.1% and 20.8±5.9% on D18 at 2.5 and 30 mg / kg, respectively (Figure 12 and Table 32).

[0270] [Table 39]

[0271] C2. Thermal hypersensitivity Thermal hypersensitivity was assessed for the injected hind paw by measuring paw withdrawal latency (in seconds) in response to radiant heat using a footpad apparatus (IITC, Woodland Hills, USA).

[0272] To investigate the efficacy of EE1 antibody on pain-like behavior, we calculated the reversal of thermal hypersensitivity (in %) as follows: The percent reversal was calculated for each mouse (Ipsi 投与後 -Average Isotype-Control 投与後 ) / (mean untreated 投与後 -Average Isotype-Control 投与後 ) was calculated as

[0273] After surgery, operated mice developed robust sensitization to thermal stimuli in the injured paw, but not in the uninjured paw. By day 11, thermal sensitization to the injured paw reached a plateau (data not shown).

[0274] When EE1 antibody was administered intravenously on day 11, it did not significantly increase the paw withdrawal latency of the injured paw on D12, although a trend was observed. However, from D14 onwards, EE1 antibody significantly increased hind paw withdrawal (Figure 13). The reversal of thermal hypersensitivity was 41±16% and 56±24% on D12, 51±16% and 98±48% on D14, and 78±19% and 84±22% on D18 for 2.5 mg / kg and 30 mg / kg intravenous administration of EE1 antibody, respectively (Table 33).

[0275] [Table 40]

Claims

1. a) Kallidin or des-Arg １０ -specifically binds to kallidin but not to bradykinin or des-Arg ９ - does not specifically bind to bradykinin; b) Kallidin or des-Arg １０ - Kalidin, 1 x 10 －１０ specifically binds with a KD of less than M; c) Kallidin or des-Arg １０ - Kalidin, 1 x 10 ４ s －１ Less than K ｏｆｆ specifically binds at; and / or d) Kallidin or des-Arg １０ -Specifically binds to kallidin and inhibits its binding to bradykinin B1 receptors An isolated monoclonal antibody or antigen-binding fragment thereof.

2. Kallidin or des-Arg １０ The antibody or antigen-binding fragment thereof according to claim 1, which binds to the N-terminal lysine residue of kallidin.

3. Kallidin or des-Arg １０ -An antibody or antigen-binding fragment thereof according to claim 1 or 2, which inhibits the binding of kallidin to the bradykinin-1 receptor.

4. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, which specifically binds to mouse kallidin-like peptide (KLP).

5. a) SEQ ID NO: 7 [X １ YX ２ X ３ DX ４ HAMX ５ Y], During the ceremony, X １ is Y, F, or H; X ２ is R, D, A, V, L, I, M, F, Y, or W; X ３ is Y, F, W, or H; X ４ is D, E, or Y; X ５ is D or E; b) SEQ ID NO: 63 [X １ EYDGX ２ YX ３ X ４ LDX ５ ], During the ceremony, X １ is W or F, X ２ is N or no amino acid, X ３ is Y or S, X ４ is D or P, X ５ is F or Y; c) SEQ ID NO: 13, d) SEQ ID NO: 32, e) SEQ ID NO: 40, f) SEQ ID NO: 47, and g) SEQ ID NO: 55 The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising a heavy chain variable domain comprising an HCDR3 amino acid sequence selected from the group consisting of:

6. a) SEQ ID NO: 8 [YFX １ PX ２ NGNTGYNQKFRG], During the ceremony, X １ is D, R, A, V, L, I, M, F, Y, or W; X ２ is Y, D, E, N, or Q; b) SEQ ID NO: 64 [WX １ DPENGDX ２ X ３ YAPKFQG], During the ceremony, X １ is I or V, X ２ is T or S, X ３ is G or D, c) SEQ ID NO: 14, d) SEQ ID NO: 33, e) SEQ ID NO: 41, f) SEQ ID NO: 48, and g) SEQ ID NO: 56 The antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, further comprising an HCDR2 amino acid sequence selected from the group consisting of:

7. a) SEQ ID NO: 9 [GYSFTDYX １ IY], During the ceremony, X １ is N, W, or Y; b) SEQ ID NO: 65 [GFNIKDYYX １ H], During the ceremony, X １ is L or M; c) SEQ ID NO: 15, d) SEQ ID NO: 34, e) SEQ ID NO: 42, f) SEQ ID NO: 49, and g) SEQ ID NO: 57 The antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, further comprising an HCDR1 amino acid sequence selected from the group consisting of:

8. a) Allocation number 10 [QQX １ X ２ SX ３ PX ４ T]、 During the ceremony, X １ is Y, F, or H; X ２ is Y, F, H, or W; X ３ is Y, F, T, or H; X ４ is W, Y, F, H, or L; b) Allocation number 66 [QX １ X ２ X ３ SX ４ PX ５ T]、 During the ceremony, X １ is Q or N, X ２ is Y, F, D, or H; X ３ is Y, F, H, or W; X ４ is Y, F, T, or H; X ５ is W, Y, F, H, or L; c) SEQ ID NO: 69 [X １ QGTHFPYT], During the ceremony, X １ is L or M; d) SEQ ID NO: 16, e) SEQ ID NO: 35, f) SEQ ID NO: 43, g) SEQ ID NO: 50, and h) SEQ ID NO: 58, The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, further comprising a light chain variable domain comprising an LCDR3 amino acid sequence selected from the group consisting of:

9. a) SEQ ID NO: 11 [WASTRX １ ], During the ceremony, X １ is E, D, Q, or N; b) SEQ ID NO: 67 [X ２ ASTRX ２ ], During the ceremony, X １ is W or G, X ２ is E, D, Q, or N; c) SEQ ID NO: 17, d) SEQ ID NO: 36, e) SEQ ID NO: 51, f) SEQ ID NO: 59 The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, further comprising an LCDR2 amino acid sequence selected from the group consisting of:

10. a) SEQ ID NO: 12 [KSSQSLLX １ SSNQKNX ２ L.A.], During the ceremony, X １ is W, H, Y, or F; X ２ is H or Y; b) SEQ ID NO: 68 [KSSQSLLX １ X ２ SX ３ QX ４ NX ５ L.A.], During the ceremony, X １ is W, H, Y, or F; X ２ is S or G, X ３ is N or D, X ４ is K or R, X ５ is H or Y; c) SEQ ID NO: 70 [KSSQSLLYSNGX １ TYLN], During the ceremony, X １ is K or E, b) SEQ ID NO: 18, c) SEQ ID NO: 37, d) SEQ ID NO: 44, e) SEQ ID NO: 52, and f) SEQ ID NO: 60 The antibody or antigen-binding fragment thereof according to any one of claims 1 to 9, further comprising an LCDR1 amino acid sequence selected from the group consisting of:

11. a) Allocation number 10 [QQX １ X ２ SX ３ PX ４ T]、 During the ceremony, X １ is Y, F, or H; X ２ is Y, F, H, or W; X ３ is Y, F, T, or H; X ４ is W, Y, F, H, or L; b) Allocation number 66 [QX １ X ２ X ３ SX ４ PX ５ T]、 During the ceremony, X １ is Q or N, X ２ is Y, F, D, or H; X ３ is Y, F, H, or W; X ４ is Y, F, T, or H; X ５ is W, Y, F, H, or L; c) SEQ ID NO: 69 [X １ QGTHFPYT], During the ceremony, X １ is L or M; d) SEQ ID NO: 16, e) SEQ ID NO: 35, f) SEQ ID NO: 43, g) SEQ ID NO: 50, and h) SEQ ID NO: 58 The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising a light chain variable domain comprising an LCDR3 amino acid sequence selected from the group consisting of:

12. a) SEQ ID NO: 11 [WASTRX １ ], During the ceremony, X １ is E, D, Q, or N; b) SEQ ID NO: 67 [X ２ ASTRX ２ ], During the ceremony, X １ is W or G, X ２ is E, D, Q, or N; c) SEQ ID NO: 17, d) SEQ ID NO: 36, e) SEQ ID NO: 51, and f) SEQ ID NO: 59 The antibody or antigen-binding fragment thereof of claim 11, further comprising an LCDR2 amino acid sequence selected from the group consisting of:

13. a) SEQ ID NO: 12 [KSSQSLLX １ SSNQKNX ２ L.A.], During the ceremony, X １ is W, H, Y, or F; X ２ is H or Y; b) SEQ ID NO: 68 [KSSQSLLX １ X ２ SX ３ QX ４ NX ５ L.A.], During the ceremony, X １ is W, H, Y, or F; X ２ is S or G, X ３ is N or D, X ４ is K or R, X ５ is H or Y; c) SEQ ID NO: 70 [KSSQSLLYSNGX １ TYLN], During the ceremony, X １ is K or E, b) SEQ ID NO: 18, c) SEQ ID NO: 37, d) SEQ ID NO: 44, e) SEQ ID NO: 52, and f) SEQ ID NO: 60 The antibody or antigen-binding fragment thereof of claim 12, further comprising an LCDR1 amino acid sequence selected from the group consisting of:

14. 5. The method of claim 1, comprising a heavy chain variable region comprising the amino acid sequences of the HCDR3, HCDR2, and HCDR1 regions set forth in SEQ ID NOs: 13, 14, and 15, respectively, and one or more amino acid substitutions at positions selected from the group consisting of H1, H5, H9, H11, H12, H16, H38, H40, H41, H43, H44, H66, H75, H79, H81, H82A, H83, H87, and H108 according to Kabat. The antibody or antigen-binding fragment thereof described herein.

15. The antibody or antigen-binding fragment thereof of claim 14, further comprising a light chain variable region comprising the amino acid sequences of LCDR3, LCDR2, and LCDR1 regions set forth in SEQ ID NOs: 16, 17, and 18, respectively, and one or more amino acid substitutions at positions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100, and L104 according to Kabat.

16. 5. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising a light chain variable region comprising the amino acid sequences of LCDR3, LCDR2, and LCDR1 regions set forth in SEQ ID NOs: 16, 17, and 18, respectively, and one or more amino acid substitutions at positions selected from the group consisting of L5, L9, L15, L18, L19, L21, L22, L43, L63, L78, L79, L83, L85, L100, and L104 according to Kabat.

17. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising a heavy chain variable region amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

18. The antibody or antigen-binding fragment thereof of claim 17, further comprising a light chain variable domain amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

19. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising a light chain variable region amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

20. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 20, 21, 22, 24, 25, 38, 45, 53, and 61.

21. 21. The antibody or antigen-binding fragment thereof of claim 20, further comprising a light chain variable domain amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

22. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 27, 28, 29, 29, 30, 31, 39, 46, 54, and 62.

23. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, comprising the heavy and light chain variable region amino acid sequences set forth in SEQ ID NOs: 19 and 26, SEQ ID NOs: 20 and 27, SEQ ID NOs: 21 and 28, SEQ ID NOs: 22 and 28, SEQ ID NOs: 23 and 29, SEQ ID NOs: 24 and 30, SEQ ID NOs: 25 and 31, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively.

24. Kallidin and des-Arg １０ - kallidin and des-Arg that compete for binding to kallidin with antibodies comprising the heavy and light chain variable region amino acid sequences set forth in SEQ ID NOs: 19 and 26, SEQ ID NOs: 38 and 39, SEQ ID NOs: 45 and 46, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 61 and 62, respectively. １０ -An antibody or antigen-binding fragment thereof that specifically binds to kallidin.

25. Kallidin or des-Arg １０ - competes for binding to kallidin with an antibody according to any one of claims 1 to 24, and ９ - An isolated monoclonal antibody or antigen-binding fragment thereof that does not bind to bradykinin.

26. An isolated monoclonal antibody or antigen-binding fragment thereof that specifically binds to a conformational epitope of kallidin (KD) or desArg10-kallidin (DAKD), which adopts a Pro4 kink conformation that includes a type II tight turn at proline 4 of KD or DAKD.

27. The antibody or antigen-binding fragment thereof of claim 26, wherein the KD or DAKD Pro4 kink conformation further comprises S-shaped amino acid repeats that are spatially stacked and aligned with the hydrophobic side chains of the amino acids.

28. (a) Kallidin or des-Arg １０ -specifically binds kallidin but not bradykinin or des-Arg9-bradykinin; b) Kallidin or des-Arg １０ - 1 x 10 to Kalidin －１０ specifically binds with a KD of less than M; c) Kallidin or des-Arg １０ - 1 x 10 to Kalidin ４ s －１ Less than K ｏｆｆ specifically binds at; and / or d) Kallidin or des-Arg １０ -specifically binds to kallidin and inhibits its binding to bradykinin B1 receptors; An antibody or antigen-binding fragment thereof according to claim 26 or 27.

29. The antibody of any one of claims 1 to 28, conjugated to a diagnostic or therapeutic agent.

30. An isolated nucleic acid encoding the amino acid sequence of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 29.

31. A recombinant expression vector comprising the nucleic acid of claim 30.

32. 32. A host cell comprising the recombinant expression vector of claim 31.

33. The host cell of claim 32 is subjected to a step of converting kallidin and des-Arg １０ - culturing the host cells under conditions in which antibodies that specifically bind to kallidin are produced by the host cells; １０ - A method for producing antibodies that specifically bind to kallidin.

34. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 28, and one or more pharmaceutically acceptable carriers.

35. A method for administering kallidin or des-Arg to a subject in need thereof, comprising administering the pharmaceutical composition of claim 34 to a subject in need thereof. １０ - A method for treating a kallidin-associated disease or disorder.

36. 36. The method of claim 35, wherein the disease or disorder is chronic pain.

37. The peptide consists of the amino acid sequence set forth in SEQ ID NO: 11, and is des-Arg ９ - Bradykinin, des-Arg １０ -Kallidin, and des-Arg １０ - immunizing an animal with an immunogen comprising a peptide, wherein the amino-terminal arginine of the peptide is indirectly coupled to a carrier moiety via a linker moiety, such that antibodies that specifically bind to the kallidin-like peptide are produced by the animal's immune system; ９ -bradykinin and des-Arg １０ - A method for producing antibodies that specifically bind to kallidin-like peptides.

38. 38. The method of claim 37, further comprising isolating the antibody, a nuclear isolating encoding the antibody, or an immune cell expressing the antibody from the animal.

39. 38. The method of claim 37, wherein the carrier moiety is a protein.

40. 40. The method of claim 39, wherein the protein is keyhole limpet hemocyanin (KLH).

41. 41. The method of claim 40, wherein the linker moiety comprises [Gly-Gly-Gly]n, where n is at least 1.

Images