Immunoprivileged bioactive renal cells for treatment of kidney disease

Genetically modified renal cells with reduced immunogenicity address the challenges of autologous therapies by enabling allogeneic treatments for kidney disease, offering consistent efficacy and safety without the need for patient-specific facilities or personnel.

JP2025143321APending Publication Date: 2025-10-01PROKIDNEY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2025106886
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2017-06-21
Filing Date
2025-06-25
Publication Date
2025-10-01

AI Technical Summary

Technical Problem

Current autologous cell transplantation therapies for kidney disease face significant technical and logistical challenges, requiring expensive facilities and specialized personnel, and can have variability in efficacy and safety due to the patient's cells being barely functional and in low numbers.

Method used

Genetically modify bioactive renal cells (BRCs) to reduce immunogenicity by targeting and reducing MHC class I and II molecules using RNA interference, allowing for the development of allogeneic cell populations that can be administered without immunosuppression, using CRISPR/Cas9 gene editing to create immune-privileged cells.

Benefits of technology

The modified BRCs reduce the likelihood of immune rejection and can be used as off-the-shelf therapies for kidney disease, providing consistent and effective treatment across different patient haplotypes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025143321000001_ABST
    Figure 2025143321000001_ABST
Patent Text Reader

Abstract

To provide cells having reduced immunogenicity and methods for producing such cells, compositions, and methods for treating kidney disease, to provide regenerative effects to a native kidney for the treatment of chronic kidney disease.SOLUTION: Provided herein are: bioactive renal cells (BRCs) in which a gene encoding a protein within a major histocompatibility complex (MHC) class I molecule or a MHC class II molecule is modified; and methods for producing the same. The genetically modified BRC comprises a heterologous polynucleotide (for example, a plasmid or a viral vector) that expresses an RNA interference (RNAi) molecule that reduces expression of the gene in the BRC.SELECTED DRAWING: Figure 10
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 62 / 523,241, filed June 21, 2017; The entire contents of which are incorporated herein by reference.

[0002] Citation by reference to sequence listing The sequence listing text file with the file name “050400-516001WO_SEQUENCE_LISTING.txt” was created on June 21, 2018, and is 88,654 bytes in size. All of which are incorporated herein by reference.

[0003] FIELD OF THE INVENTION The present invention relates to cells, compositions, and methods for treating kidney disease. Some aspects relate to compositions and methods for developing genetically engineered, bioactive kidney cell populations, preferably non-alloreactive, for treating subjects with kidney disease, as well as methods for using selected kidney cell populations to provide a regenerative effect to the native kidney. [Background technology]

[0004] background Renal cell therapy has recently attracted interest, as tissue and organ regeneration is now technologically within the reach of modern medicine (Ludlow et al. The Future of Regenerative Medicine: Urinary System. Tissue Engineering. 2012; 18:218-24). New therapeutic paradigms involving tissue engineering and cell-based applications have been reported to result in substantial and durable enhancement of renal function, slowing disease progression, and improving quality of life in this patient population. These next-generation regenerative medicine technologies offer isolated renal cells as a therapeutic option for chronic kidney disease (CKD). Presnell et al. WO / 2010 / 056328 and Ilagan et al. PCT / US2011 / 036347 describe isolated, bioactive renal cells, as well as methods for isolating and culturing the cells and for therapeutic use with these cell populations. Infusion of these bioactive kidney cells into recipient kidneys resulted in significant improvements in animal survival and renal function in non-clinical studies, as evidenced, for example, by urine concentrating and filtering functions.

[0005] Current protocols for the treatment of patients using selected kidney cells are based on autologous cell transplantation. In this approach, bioactive kidney cells are harvested from the patient and explanted. They are selected in vivo and, if necessary, cultured in vitro to expand the cell numbers, and finally The cells are then infused into the patient. Each patient receives a personalized treatment using the patient's own kidney cells (i.e., autologous therapy). Autologous therapy faces significant technical and logistical challenges in its practical application; it requires expensive, dedicated facilities and specialized personnel to produce, and must be produced within a short time after the patient's diagnosis; in some cases, depending on the stage of the disease, the patient's cells may be barely functional and / or present in very low numbers. Because of these obstacles, autologous cell preparations are , can have considerable variability in efficacy and safety. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] WO / 2010 / 056328 [Patent Document 2] PCT / US2011 / 036347 [Non-patent literature]

[0007] [Non-Patent Document 1] Ludlow et al. The Future of Regenerative Medicine: Urinary System. Tissue Engineering. 2012; 18:218-24 Summary of the Invention

[0008] Provided herein are cells with reduced immunogenicity, particularly for use in treating subjects with kidney disease. In some embodiments, cells from a donor that would not normally be administered to a patient (e.g., due to potential inflammation and immune system rejection) are genetically modified to be useful to the patient (e.g., so that the cells persist and promote improved kidney function). Methods for producing such cells are also included herein.

[0009] In some embodiments, a method for producing genetically modified bioactive kidney cells (BRCs) is described herein. In one embodiment, the genetically modified BRC is a genomically modified BRC (i.e., a BRC with a genetic modification in its genome). In one embodiment, the genetically modified BRC contains an exogenous polynucleotide (e.g., a plasmid or viral vector) that expresses an RNA interference (RNAi) molecule that reduces the expression of a genomic immunogenic gene in the BRC. In one embodiment, the RNAi molecule is a small interfering RNA molecule or a small hairpin RNA molecule. In one embodiment, the method involves reducing the expression of a genomic immunogenic gene in the BRC by a genetic modification. This includes gene modification.

[0010] In some embodiments, the gene encodes a protein within a major histocompatibility complex (MHC) class I molecule or an MHC class II molecule. beta2 microglobulin (B2M, also known as beta2M), human leukocyte antigen (HLA)-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, or HLA-DQB1 gene.

[0011] In one embodiment, the gene encodes a minor histocompatibility antigen (MiHA or mHA). In certain embodiments, the gene is an HA-1, HA-2, HA-8, HB-1, HY-A1, HY-A2, HY-B7, HY-B8, HY-B60, or HY-DQ5 gene.

[0012] In one embodiment, any allelic variant of a gene referred to herein (e.g., an HLA gene, a B2M gene, or an mHA gene) is modified (e.g., deleted), or can be targeted by RNA interference.

[0013] In some embodiments, genetically modifying a gene comprises mutating the gene, hi some embodiments, mutating the gene comprises deleting the gene or a portion thereof.

[0014] In one embodiment, genetically modifying the cells comprises genetically modifying the cells with HLA-B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, and The method involves mutating any combination of two or more of the HLA-DQB1 and / or HLA-DQB2 genes.

[0015] In one embodiment, the genetically modified BRCs are genetically modified primary kidney cells. In some embodiments, the genetically modified primary kidney cells have been passaged at least approximately once, twice, three times, four times, five times, or six times or more before or after genetic modification. In some embodiments, the method further comprises obtaining SRCs from the genetically modified BRCs. In some embodiments, the SRCs obtained and then genetically modified.

[0016] In some embodiments, the BRC is in a BRC population. In one embodiment, the SRCs are selected renal cells (SRCs). In one embodiment, the SRCs are in an SRC population. Various non-limiting examples of RCs are disclosed herein. In some embodiments, the SRCs are renal tubule cells. In some embodiments, the renal tubule cells are proximal tubule cells. In certain embodiments, the SRC is an endocrine cell, a vascular cell, or a glomerular cell. In embodiments, the SRC population comprises hypoxia-resistant and iodixanol-resistant cells. In one embodiment, the SRC population comprises cells expressing hyaluronan synthase 2. In one embodiment, the SRC population comprises cells capable of receptor-mediated albumin transport. In one embodiment, the SRC is characterized by expressing CK18 and GGT1. In some embodiments, the metabolism of PrestoBlue and the expression of VEGF and KIM-1 are Production is used as a marker for the presence of viable and functional progeny. In one embodiment, BRCs are obtained by kidney biopsy.

[0017] In one embodiment, the BRC is genetically modified within a BRC population, and In some embodiments, fewer than all of the cells in a population of BRCs will be genetically modified. In some embodiments, the method further comprises isolating or enriching genetically modified BRCs from the BRC population. In some embodiments, the method further comprises isolating or enriching genetically modified SRCs from the SRC population. In some embodiments, a population of BRCs (e.g., SRCs) is subjected to genetic manipulation to produce a BRC population in which some cells are genetically modified and some cells are not modified. In some embodiments, the method further comprises isolating or enriching genetically modified BRCs from the BRC population. In some embodiments, the method further comprises isolating or enriching genetically modified SRCs from the SRC population. In some embodiments, the population of BRCs (e.g., SRCs) is genetically manipulated to produce a BRC population in which some cells are genetically modified and some cells are not modified. In some embodiments, a portion of the genetically modified cells are homozygous for the modification. In some embodiments, a portion of the genetically modified cells are heterozygous for the modification. In some embodiments, cells in which the modification is homozygous are enriched or selected. In some embodiments, cells in which the modification is heterozygous are enriched or selected. In some embodiments, cells in which the modification is homozygous or heterozygous are enriched or selected. In some embodiments, the modification is a mutation that reduces expression of the protein encoded by the gene. In some embodiments, the mutation reduces the level of the protein on the surface of the modified cells. In some embodiments, cells expressing the protein are depleted (depleted) or eliminated. In some embodiments, the mutation reduces the level of MHC class I and / or MHC class II molecules on the surface of the cells. In some embodiments, cells with the mutation lack MHC class I and / or MHC class II molecules on their surface. In some embodiments, cells expressing MHC class I molecules on their surface are depleted or eliminated. In some embodiments, cells expressing MHC class II molecules on their surface are depleted or eliminated. In some embodiments, cell sorting methods are used to remove cells from a population that express MHC class I and / or MHC class II molecules that are proteins. In some embodiments, the cell sorting method includes an agent (such as an antibody) that binds to MHC class I and / or MHC class II molecules that are proteins. In some embodiments, cell depletion or selection includes bead / antibody conjugation, which can remove cells that have a particular protein on their cell surface. In some embodiments, cell sorting The methods are magnetically activated cell sorting (MACS) or fluorescently activated cell sorting (FACS). In one embodiment, the gene selected for genetic modification is a gene whose protein is expressed on the cell surface, and FACS and / or MACS techniques are used to detect the surface expression of the gene. In embodiments, MACS can be used to separate cells that express MHC molecules (e.g., MHC class I or MHC class II molecules) from cells that do not. In certain embodiments, integrating or non-integrating vectors are used to express additional HLA component polypeptides to further stimulate the adaptive or innate immune system, such as by preventing targeting and lysis by natural killer (NK) cells. can be changed or adjusted.

[0018] In some embodiments, genetically modifying (e.g., mutating) a gene involves (i) expressing a gene-editing protein in the BRC; or (ii) transfecting the BRC across the cell membrane of the BRC. In one embodiment, the gene editing protein is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TAN), or a transcription factor-like effector nuclease (TFN). The term TALEN, megaTAL, or RNA-guided endonuclease is a In some embodiments, the RNA-guided endonuclease is a Cas protein. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the gene is The gene modification may further comprise (i) expressing a guide single guide RNA (gRNA) in the BRC; or (ii) transducing the guide single guide RNA (gRNA) across the plasma membrane of the BRC. In one embodiment, the Cas9 protein and gRNA are part of a ribonucleoprotein complex.

[0019] In some embodiments, the method for producing genetically modified BRCs comprises genetically modifying a genomic immunogenic gene in a BRC to produce a genetically modified BRC, and then culturing the modified BRC to produce progeny with a genetic modification in the gene. In some embodiments, the progeny have a reduced likelihood of immune rejection compared to corresponding cells that do not contain the genetic modification in the gene. In some embodiments, the method comprises propagating the progeny. In some embodiments, propagating the progeny comprises passage the progeny at least once, twice, three times, four times, or five times. In one embodiment, the cell proliferation rate and / or viability is increased per cell passage. In some embodiments, the viability of the expanded progeny is assayed. In some embodiments, the number of expanded cells is measured. In some embodiments, the number and viability of the progeny are monitored by trypan blue dye exclusion and PrestoBlue metabolism. In some embodiments, BRC or SRC functionality is assessed by gene expression profiling or enzyme activity measurement. In some embodiments, enzyme activity is measured for LAP and / or GGT.

[0020] In some embodiments, the gene editing protein is expressed from the transfected mRNA. In some embodiments, the Cas protein is expressed from the transfected mRNA. In one embodiment, the transfectant is expressed from a plasmid DNA, and the gRNA is expressed from a plasmid DNA. The transfected mRNA is stabilized by the inclusion of modified nucleobases or polyadenylation sequences. In certain embodiments, the transfected mRNA comprises at least one In some embodiments, the Cas protein is linked to a cell-penetrating peptide of the present invention. In some embodiments, the Cas protein is expressed from a DNA vector. In some embodiments, expression of the Cas protein is induced during at least a portion of the time period during which the gRNA is expressed in the cell. In some embodiments, the DNA vector does not integrate into the genome. In some embodiments, the DNA vector is linked to an epitope. In one embodiment, the DNA vector is a transposon. In embodiments, the gRNA is a transcript from a DNA vector. The gene editing protein is a recombination protein that forms a complex with the gRNA ex vivo. In some embodiments, the gene-editing protein is a recombinant protein that forms a complex with a gRNA ex vivo, and the protein / gRNA complex is delivered to cells by transfection, lipofection, electroporation, microinjection, or other methods known to those skilled in the art. In some embodiments, additional nucleic acid elements encoding selectable markers and / or specific mutations to the target gene are introduced into the cells along with the Cas9 protein / gRNA complex.

[0021] In some embodiments, genetically modifying the gene reduces the amount of MHC class I at the cell surface. In some embodiments, genetically modifying the gene reduces the amount of MHC class II at the cell surface. In some embodiments, the method includes genetically modifying two or more genes, at least one of which encodes an MHC class I molecule. In one embodiment, at least one of the genes encodes a protein within an MHC class II molecule. are HLA genes.

[0022] In some embodiments, provided herein are methods for treating psoriasis, including the use of psoriasis-causing agents, such as steroids, anti-inflammatory drugs ... In one embodiment, the BRC population is an engineered (e.g., genetically modified) BRC population. The genetically modified BRC population is a genomically modified BRC population. In some embodiments, the population includes both non-genetically modified cells and genetically modified cells. In some embodiments, the population is enriched for engineered BRCs. In some embodiments, Thus, the engineered BRCs are homozygous for the gene modification.

[0023] In one embodiment, provided herein are major histocompatibility complex (MHC) clones. In one embodiment, the BRC is an engineered (e.g., genetically modified) BRC that contains a mutation in a gene that encodes a protein contained in an MHC class I molecule or an MHC class II molecule. In this case, at least part of the gene is deleted, and the gene is B2M, HLA-A, HLA-B , HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, or HLA-DQB1 genes. In one embodiment, engineered BRCs are included in a population of BRCs. In one embodiment, a genetically modified BRC population is a population of BRCs that has been genetically modified. In one embodiment, the population is a genetically modified BRC population. In one embodiment, the population includes both engineered BRCs and genetically modified cells. In one embodiment, the engineered BRCs are homozygous for the genetic modification. It is a conjugated type.

[0024] In one embodiment, provided herein is a method for treating kidney disease in a patient, the method comprising administering to the patient a population of BRCs, the population of BRCs comprising engineered BRCs, the engineered BRCs comprising major histocompatibility complex (MHC) class II (MHC) class III (MHC class II)-specific BRCs. These include mutations in genes that code for proteins contained in MHC class I or class II molecules.

[0025] In certain embodiments, the kidney disease is chronic kidney disease.

[0026] In one embodiment, the BRC population is an SRC population. In certain embodiments, the SRC population is derived from a patient. In certain embodiments, the SRC population originates from one or more donors. In certain embodiments, the SRC population is obtained after exposure to hypoxic culture conditions. In one embodiment, the SRC population is obtained after density gradient separation of expanded kidney cells. In certain embodiments, the SRC population has a buoyant density greater than about 1.04, 1.0419, or 1.045 g / mL. In certain embodiments, the SRC population contains a higher proportion of one or more cell types and is devoid of or lacks one or more other cell types compared to the starting renal cell population. There is a shortage of them.

[0027] In some aspects, provided herein are injectable formulations. In some embodiments, the formulations comprise a) a temperature-sensitive cell-stabilized biomaterial, and b) a BRC population. However, this BRC population contains engineered BRCs, which are major histocompatibility genes. Encodes proteins contained within the MHC class I or II molecules In one embodiment, the temperature-sensitive cell-stabilizing biomaterial is a hydrogel, which (i) is substantially solid at about 8°C or below. (ii) maintain a body temperature above about ambient temperature; and (iii) maintain a substantially liquid state at temperatures between about 8°C and about ambient temperature or At higher temperatures, it undergoes a transition from solid to liquid.

[0028] In some embodiments, the hydrogel comprises extracellular matrix proteins of recombinant origin, derived from extracellular matrix obtained from the kidney or another tissue or organ, or comprises gelatin. In some embodiments, the hydrogel comprises gelatin. In some embodiments, the gelatin is derived from type I alpha I collagen. In some embodiments, the gelatin is derived from porcine type I alpha I collagen or recombinant human type I alpha I collagen. In one embodiment, the BRC population is a selected renal cell (SRC) population and the engineered BRCs are engineered SRCs.

[0029] In some embodiments, provided herein are methods of treating kidney disease in a patient, the methods comprising infusing a formulation containing an engineered BRC described herein into the patient. In certain embodiments, the formulation is injected through an 18-30 gauge needle. In certain embodiments, the needle is about 27 gauge, about 26 gauge, about 25 gauge, about 24 gauge, about 23 gauge, about 22 gauge, about 21 gauge, or the like. The diameter of the tube is about 20 gauge.

[0030] The present invention genetically engineered BRCs to produce BRCs from donors whose presence is not recognized as an immunogenic source. We disclose a method for obtaining homogeneous BRCs, which involves the use of RNA-guided endonucleases such as Cas9 / CRISPR (clustered regularly interspaced short palindromic repeats). The use of the BRC makes it suitable for therapeutic purposes. Specifically, the uptake of these cells as an allograft without immunological recognition of immune clearance BRC. Inactivating and / or replacing genes involved in renal tissue regeneration (e.g., MHC recognition and / or immune checkpoint proteins) to allow for the uptake of This allows for precise modification of the genome of suitable BRCs.

[0031] In one aspect, provided herein is a method for preparing a genetically modified, immunoprivileged, bioactive kidney cell population, the method comprising: (a) administering an RNA-guided endonuclease In one embodiment, the method comprises (a) genetically modifying a BRC or SRC, the genetic modification comprising introducing and / or expressing an endonuclease and a specific guide RNA into the cells, the guide RNA directing the endonuclease to at least one target immunogenic gene in the BRC or SRC genome; and (b) expanding the resulting immune-privileged cells, which have a low or reduced likelihood of immune rejection. The endonuclease is Cas9. The RNA-guided endonuclease is can be expressed from mRNA, i.e., RNA-guided endonuclease is expressed from transfected mRNA, and the gRNA is expressed from plasmid DNA. In some embodiments, the transfected mRNA is stabilized by including modified nucleic acid bases or a polyadenylation sequence. In some embodiments, the transfected mRNA is linked to at least one cell-penetrating peptide. In certain embodiments of the method, the endonuclease is expressed from a DNA vector. Expression of the nuclease can be induced once the guide RNA is produced in the cell. In some embodiments, the DNA vector is not integrated into the genome. The DNA vector can be an episomal vector, an artificial chromosome, or a transposon. In some embodiments, the guide RNA is a transcript from the DNA vector. In some embodiments, the Cas protein is a purified recombinant protein complexed ex vivo with a guide RNA and / or DNA targeting construct containing a specified mutation. In one embodiment, the Cas / gRNA complex or plasmid is introduced into cells by electroporation.

[0032] In one embodiment, the at least one target immunogenic gene is a gene that regulates MHC class I. In one embodiment, the at least one target immunogenic gene encodes one or more genes that regulate MHC class II. In one embodiment, the at least one target immunogenic gene encodes one or more genes that regulate MHC class I and MHC class II. In one embodiment, the at least one target immunogenic gene encodes one or more genes that regulate MHC class I and MHC class II. Another target locus may encode an HLA gene. In one embodiment, the HLA gene is selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DRB3 / 4 / 5, HLA-DQ family genes (e.g., HLA-DQA1 and / or HLA-DQB1), and HLA-DP family genes (e.g., HLA-DQA1, HLA-DQB1 ... For example, HLA-DPA1 and / or HLA-DPA2).

[0033] In one embodiment, suppression of MHC in BRCs (e.g., SRCs) is associated with chronic kidney disease (RD). In one embodiment, this enables the development of off-the-shelf allogeneic tissue engineered / regenerative medicine products for A modified BRC (e.g., a modified SRC, such as a universal donor SRC) is generated by knocking down MHC class I on the surface of the SRC. In one embodiment, gene editing (e.g., CRISPR / Cas-9 gene editing) is used to target (e.g., mutate by deleting all or part of, or by editing base pairs, or by introducing exogenous DNA elements such as selectable markers and / or modified genomic fragments) the B2M or HLA-A (α subunit) components of the MHC class I complex.

[0034] In certain embodiments of the method, the genetically modified BRCs are propagated in vitro. In some embodiments, the method is used to prepare a BRC or SRC for use as a medicament. In some embodiments, the method is used to prepare a BRC or SRC for treating chronic kidney disease in a patient in need thereof.

[0035] In some embodiments, an engineered BRC or SRC population obtained by the methods described herein is provided.

[0036] In some embodiments, included herein are methods for treating a patient, the methods comprising: (a) preparing a genetically modified BRC or SRC population according to the methods described above; and (b) administering the genetically modified BRC or SRC to the patient. In some embodiments, the patient has been diagnosed with chronic kidney disease. In some embodiments, the BRC or SRC originates from the patient being treated. In some embodiments, the BRC or SRC originates from one or more individuals. Originated from multiple donors.

[0037] In some embodiments, the bioactive renal cell population is obtained by isolating and expanding renal cells from renal tissue under culture conditions that enrich for cells capable of renal regeneration. In some embodiments, the bioactive renal cell population is obtained after exposure to hypoxic culture conditions. In some embodiments, the BRC population is an SRC population obtained after density gradient separation of expanded renal cells. In some embodiments, the SRC exhibit a buoyant density greater than about 1.04, 1.0419, or 1.045 g / mL. In one embodiment, the BRC or SRC population has one or more changes compared to the starting kidney cell population. or contain a higher proportion of one or more cell populations and lack one or more other cell populations. In some embodiments, the cell proliferation rate of a BRC or SRC population can be monitored at each cell passage. For example, BRC or SRC cell number and viability can be monitored by trypan blue dye exclusion and PrestoBlue metabolism. In some embodiments, BRCs or SRCs can be characterized by the phenotypic expression of specific viability and functionality markers, such as CK18 and GGT1. In some embodiments, the production of VEGF and KIM-1 can be used as markers for the presence of live, functional BRCs or SRCs. In some embodiments, viability and viability can be monitored by trypan blue dye exclusion and PrestoBlue metabolism. The functionality can be established by measuring gene expression profiles or enzymatic activity. In one embodiment, the BRC or SRC inhibits the enzymatic activity of LAP and / or GGT. It is characterized by the measurement of

[0038] The present invention encompasses, but is not limited to, isolated cells or cell populations containing the genetic modifications described herein (e.g., in the Summary, Detailed Description, Examples, and Figures), as well as any proteins, polypeptides, or vectors useful for genomic modification of kidney cells to render them less immunogenic (e.g., immune privileged). The modified kidney cells provided herein can be used as a therapeutic product, ideally as an "off-the-shelf" product (useful for use by many, if not most or all, patients), in methods for treating or preventing chronic kidney disease. [Brief explanation of the drawings]

[0039] [Figure 1] Flowchart representation of a manufacturing plan for producing engineered human allogeneic kidney cells for use in treating chronic kidney disease. [Figure 2] 1 is a flowchart of a non-limiting example of the overall NKA manufacturing process. [Figure 3A] 3 is a flowchart illustrating in further detail a non-limiting example of the steps shown in FIG. 2. [Figure 3B] 3 is a flowchart illustrating in further detail a non-limiting example of the steps shown in FIG. 2. [Figure 3C] 3 is a flowchart illustrating in further detail a non-limiting example of the steps shown in FIG. 2. [Figure 3D] 3 is a flowchart illustrating in further detail a non-limiting example of the steps shown in FIG. 2. [Figure 4] Schematic diagram of the MHC class I complex. [Figure 5-1] Genomic scaffold in the B2M gene showing the binding site for guide RNA [Figure 5-2] Continued from Figure 5-1. [Figure 6] FACS showing CRISPR / Cas9-mediated knockdown of B2M (an invariant subunit of MHC-I) in human primary kidney cells. [Figure 7] FACS showing CRISPR / Cas9-mediated knockdown of B2M (an invariant subunit of MHC-I) in human primary kidney cells. [Figure 8] Image from genome cutting assay showing successful gene editing at B2M locus. Below is an ethidium bromide stained DNA gel, inverted for clarity. In a non-limiting example, genome cutting assay or direct sequencing of the target locus can be used to confirm targeted genome modification. [Figure 9] FACS output showing CRISPR-mediated B2M locus editing in SRC. Note the difference in donor ABO haplotypes, indicating that the ability to perform MHC-I gene editing is independent of ABO haplotype. Donor Blood Type TCHK006 O(+) TCHK011 AB(-) TCHK004 O(-) [Figure 10] Graph from a lymphocyte proliferation assay showing that B2M CRISPR-modified SRC reduces lymphocyte proliferation compared to unmodified control SRC, providing evidence that CRISPR targeting of B2M reduces the immunogenicity of CRISPR-modified SRC. [Figure 11] Graphs from a potency assay of B2M CRISPR-modified SRC showing no significant difference in VEGF and KIM1 secretion between modified and unmodified SRC. CRISPR modification does not affect SRC functionality. [Figure 12] Schematic diagram showing the HLA MHC complex on human chromosome 6. [Figure 13] Image showing typical human kidney cell morphology in culture. [Figure 14] Image showing typical SRC band formation upon centrifugation across a density boundary. [Figure 15] 1 is a graph showing the temperature characteristics of a typical gelatin solution with respect to gelation. [Figure 16] Graph showing typical cell distribution as a function of rotation time during NKA gelation. DETAILED DESCRIPTION OF THE INVENTION

[0040] Detailed Description of the Invention Provided herein are preparations and methods for obtaining renal cell populations, which can be used for a large number of patients.In some embodiments, this population is less immunogenic than the original population from which it originates.In some embodiments, gene editing is used to create an allogeneic renal cell population that can be administered to patients without immunosuppression.Included herein are suitable donor cells from different tissue types or donors that can be successfully transplanted into recipient subjects, regardless of differences in immunogenic gene haplotypes.

[0041] Ideally, one would like to use a standardized therapy in which allogeneic therapeutic cells are pre-manufactured, thoroughly characterized, and available for immediate administration to patients. Unfortunately, there are many cases where alleles match at one or more immunogenic loci. The availability of suitable donor cells with HLA-containing genes is limited due to the diversity of haplotypes in the human population. For example, HLA genes are immunogenic genes that were first identified during early bone marrow hematopoietic stem / progenitor cell transplantation (HSCT) clinical treatments. HLA mismatches between donor and recipient can result in an immune response in which recipient T cells recognize HLA proteins or donor-specific antigens expressed or presented on the surface of allogeneic donor cells. This causes the body to recognize the donor's allogeneic tissue as a foreign body, ultimately leading to graft rejection (Bhatia S. Expert Rev Hematol. 2011; 4(4):437-452; Garnett C, Despite advances in the medical field that suppress immune responses to allogeneic donor cells, there remains a need for additional methods that can reduce donor cell rejection and / or increase the immunocompatibility of donor cells. There remains a need for methods and compositions, most notably to improve the availability of suitable donor cells that can be successfully transplanted into recipient subjects, regardless of differences in immunogenic gene haplotypes.

[0042] One approach to overcome the immunological barriers to cell transplantation is genetic manipulation of HLA molecules. By using zinc finger nucleases, Torikai et al. Human leukocyte antigen (HLA) class I was removed from ESCs, and HLA-A cells were identified as HLA-restricted cells. It has been demonstrated that the cytotoxic T lymphocyte-mediated lysis of leukocytes can be avoided (Oberg L et al., Eur J Immunol., 2004, 34(6): 1646-1653). In another study, Riolobos et al. disrupted B2M, which encodes the accessory chain of MHC class I molecules and is required for their surface expression (Laura Riolobos et al., 2013, 21(6): 1232-1241). Homozygous deletion of the B2M gene prevented surface translocation of class I human leukocyte antigen (HLA) molecules, reducing immunogenicity. More recently, the discovery and application of the CRISPR / Cas9 system in mammalian cells has led to the development of novel immunotherapies, e.g., non-specific antibodies against MHC class I molecules. It has been shown that homogeneous end joining (NHEJ), homology-directed repair (HDR), or other DNA repair pathways can result in efficient and precise editing of targeted genes (Gasiunas, Barrangou et al. (Jinek, Chylinski et al. 2012; Jinek, Chylinski et al. 2012). The simultaneous delivery of Cas9 molecules and target-specific guide RNA (gRNA) molecules facilitates gene editing of target sequences within the genome. Therefore, using the CRISPR / Cas9 system to modify genes in cells is a promising approach. It is also a promising strategy to enhance the immune compatibility of donor cells for transplantation into recipients (WO2016201047 A1).

[0043] Experiments on the immunogenicity of one cell type (e.g., embryonic stem cells) cannot be predictably extrapolated or transposed to another cell type (e.g., kidney cells). Surprisingly, knocking out some B2M expression also knocks down the immunogenicity of kidney cell populations. Furthermore, although some B2M expression remained in the engineered cell population, However, reduced immunogenicity was observed. The present invention involves gene editing techniques to modify the adaptive immune system of BRCs (e.g., SRCs) to create universal donor cells for the treatment of kidney disease. In one embodiment, immunogenicity is measured by eliciting an adaptive (T cell-mediated) immune response. It is the ability to make it happen.

[0044] An embodiment of the present invention is directed, at least in part, to SRCs derived from donors with certain haplotypes. The present invention relates to the discovery that SRCs can be genetically modified to reduce their immunogenicity in subjects with different haplotypes. Included herein are genetically modified SRCs that can be successfully transplanted into recipient subjects regardless of differences in immunogenic gene haplotypes. and methods and formulations for treating kidney disease with such modified SRCs.

[0045] Specific embodiments of the invention will now be described in detail. While the invention will be described in conjunction with example illustrative embodiments, it is understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to encompass all alternatives, modifications, and equivalents that may be included within the scope of the invention as defined by the claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described.

[0046] All references cited throughout this specification are expressly incorporated herein by reference in their entirety. If any one or more of the incorporated publications, patents, and similar materials In the event that anything differs or conflicts with this application, including but not limited to defined terms, terminology, described techniques, etc., this application will control.

[0047] definition Unless otherwise defined, scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Principles of Tissue Engineering, 3rd Ed. (Edited by R Lanza, R Langer, & J Vacanti), 2007, provides those skilled in the art with the principles and methods used in this application. This document provides general guidance for many of the terms used. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein, and could use them in the practice of the present invention. Indeed, the present invention is not limited in any way to the methods and materials described.

[0048] As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise. As used herein, "and / or" includes any and all combinations of the listed items.

[0049] "comprise," "comprising," "include," "including," and "includes" The term ")" as used in the specification and claims specifies the presence of a stated feature, integer, component, or step, but may be used in conjunction with one or more other features. This does not preclude the presence or addition of any integer, component, step, or group thereof.

[0050] As used herein, the term "about" in the context of a numerical value or range means the stated or claimed numerical value or range ±10%, unless the context dictates a more limited range. This shall be the case.

[0051] As used herein, the term "cell population" refers to a large number of cells obtained by direct isolation from an appropriate tissue source, usually a mammal. For example, the cell population may include a population of kidney cells and mixtures thereof. The isolated cell population can then be cultured in vitro. Those skilled in the art will recognize various methods for isolating and culturing cell populations for use herein, as well as various cell numbers in cell populations suitable for use herein. The cell population can be an unfractionated heterogeneous cell population or an enriched homogeneous cell population derived from an organ or tissue, such as the kidney. For example, a heterogeneous cell population can be isolated from a tissue biopsy or whole organ tissue. Alternatively, a heterogeneous cell population can be obtained from an in vitro culture of mammalian cells established from a tissue biopsy or whole organ tissue. An unfractionated heterogeneous cell population can also be referred to as a non-enriched cell population. In certain embodiments, the cell population contains biologically active cells. A homogeneous cell population contains a greater proportion of cells of the same cell type that share a common phenotype or have similar physical properties than an unfractionated heterogeneous cell population. For example, a homogeneous cell population can be isolated, removed, or enriched from a heterogeneous renal cell population. In some embodiments, a homogeneous cell population is obtained as a cell fraction by centrifugal separation across a density boundary, barrier, or interface of a heterogeneous cell suspension. In some embodiments, a homogeneous cell population is obtained as a cell fraction by continuous or discontinuous (single-step or multi-step) density gradient separation of a heterogeneous cell suspension. In some embodiments, a homogeneous or heterogeneous cell population of kidney origin is mixed with a homogeneous or heterogeneous cell population originating from a tissue or organ other than the kidney, including, but not limited to, the kidney.

[0052] As used herein, the term "biologically active" means "having biological activity," such as pharmacological or therapeutic activity. In one embodiment, the biological activity is an enhancement of renal function and / or an effect on renal homeostasis. In one embodiment, Biological activities include, but are not limited to, analgesic; antiviral; anti-inflammatory; anti-tumor; immunostimulatory; immunomodulatory; enhancing cell viability, antioxidant, oxygen carrier, cell recruitment, cell adhesion, immunosuppression, angiogenesis, wound healing activity, recruitment of host stem or progenitor cells, cell proliferation, stimulation of cell migration to the site of injury, amelioration of cell and tissue fibrosis, disruption of epithelial-mesenchymal signaling cascades, secretion of cytokines, growth factors, proteins, nucleic acids, exosomes, microvesicles, or any combination thereof.

[0053] As used herein, the term "bioactive renal cells" or "BRCs" refers to cells derived from the kidney of a subject. and the ability to reduce (e.g., slow or stop) the progression or deterioration of chronic kidney disease or its symptoms, enhance kidney function, affect (improve) renal homeostasis, and promote healing, repair, and / or renal tissue or kidney function when administered to refers to kidney cells that have one or more of the following abilities to promote regeneration. In this study, BRC appeared to be less immunogenic in patients than without genetic modification. In certain embodiments, the BRC is a gene that is genetically modified (e.g., genomically modified and / or modified via RNAi), regardless of the patient's haplotype. In certain embodiments, the BRC can be administered to a patient to inhibit renal function without immunological rejection. BRCs are genetically modified (e.g., genomically modified and / or modified via RNAi) immune privileged cells that can enhance renal function, affect (improve) renal homeostasis, and / or promote healing, repair, and / or regeneration of renal tissue or the kidney. In certain embodiments, such cells may include functional tubular cells (e.g., based on improved creatinine excretion and protein retention), glomerular cells (e.g., based on improved protein retention), vascular cells, and other cells of the corticomedullary junction. In certain embodiments, BRCs are obtained from the isolation and expansion of renal cells from renal tissue. In certain embodiments, Therefore, BRC uses a method to select bioactive cells (e.g., cells with regenerative potential) BRCs are obtained by isolating and expanding renal cells from renal tissue. In certain embodiments, BRCs are obtained by isolating and expanding renal cells from renal tissue. In certain embodiments, the BRCs comprise, consist essentially of, or consist of selected renal cells (SRCs). In certain embodiments, the BRCs are SRCs. Methods for obtaining bioactive renal cells (BRCs) are disclosed, for example, in Presnell et al., WO / 2010 / 056328, Ilagan et al., PCT / US2011 / 036347, and Jain et al., PCT / US2016 / 044866.

[0054] In certain embodiments, SRCs are prepared by isolating and expanding renal cells derived from a suitable renal tissue source. The SRCs are derived from the renal cell population, and contain a higher proportion of one or more cell types and are devoid of one or more other cell types, or In certain embodiments, the SRCs contain a smaller proportion of In certain embodiments, the SRC population is an isolated renal cell population for use in treating kidney disease, the renal cell population being enriched for particular bioactive components and / or cell types and / or depleted for particular inactive and / or undesirable components or cell types, i.e., renal In certain embodiments, the SRCs are renal cell populations that result in stabilization and / or improvement and / or regeneration of function. In certain embodiments, the SRCs are less immunogenic in patients than they would be without genetic modification. In certain embodiments, the SRC is genetically modified (e.g., genomically modified and / or modified via RNAi) to reduce the risk of developing a rare disease regardless of the patient's haplotype. In certain embodiments, the SRC may be administered to a patient without modification. SRCs are engineered (through genomic modification and / or RNAi) to be immune privileged or incapable of rejection and have the ability to stabilize and / or improve and / or regenerate kidney function. SRCs offer superior therapeutic and regenerative outcomes compared to the starting population. In certain embodiments, SRC is obtained from the renal cortical tissue of a patient by renal biopsy. In certain embodiments, SRCs are selected (e.g., by MACS or FACS) based on the expression of one or more markers. One or more cell types are depleted (e.g., by MACS or FACS) based on the expression of one or more markers in the cell types. In certain embodiments, cell depletion or selection involves bead / antibody coupling to extract cells that have specific proteins on their cell surface. In certain embodiments, SRCs are isolated from a population of bioactive kidney cells. In certain embodiments, SRCs are selected from the group consisting of: SRCs obtained by density gradient separation of expanded kidney cells; In certain embodiments, the SRC is selected from a density boundary, barrier, or interface. In certain embodiments, SRCs are selected by separating the expanded kidney cells by centrifugation over 1000 kJ / h or by single-stage discontinuous step gradient separation. In certain embodiments, SRCs are selected by continuous or discontinuous density gradient separation of proliferated renal cells cultured under hypoxic conditions for at least about 8, 12, 16, 20, or 24 hours. In certain embodiments, SRCs are selected by density gradient separation of proliferated renal cells cultured under hypoxic conditions for at least about 8, 12, 16, 20, or 24 hours. In certain embodiments, SRCs are selected by density gradient separation of proliferated renal cells cultured under hypoxic conditions at a density boundary, barrier, or boundary. In certain embodiments, the SRC is selected by centrifugal separation over a surface. The density boundary of proliferating kidney cells cultured under normal conditions for at least about 8, 12, 16, 20, or 24 hours. In certain embodiments, SRCs are selected by centrifugal separation across a boundary, barrier, or interface (e.g., single-step discontinuous density gradient separation). In certain embodiments, SRCs are primarily isolated from tubular kidney cells. In certain embodiments, other parenchymal (e.g., vascular) and interstitial (e.g., collecting duct) cells may be included in the SRCs. In certain embodiments, less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the cells in the SRC population are vascular cells. In embodiments, less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the cells in the SRC population are collecting duct cells. In certain embodiments, less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the cells in the SRC population are vascular cells or collecting duct cells. Methods for obtaining SRCs are disclosed in, for example, Example 1 herein, Presnell et al., WO / 2010 / 056328, Ilagan et al., PCT / US2011 / 036347, and Jain et al., PCT / US2016 / 044866. do.

[0055] The term "native organ" refers to an organ of a living subject. The subject may be healthy or non-healthy. A non-healthy subject may have a disease involving that particular organ.

[0056] The term "native kidney" refers to a kidney of a living subject. The subject may be healthy or non-healthy. A non-healthy subject may have renal disease.

[0057] The term "regenerative effect" refers to an effect that benefits a native organ, such as the kidney. The effect can include, but is not limited to, reducing the extent of native organ damage, or improving, restoring, or stabilizing the function or structure of the native organ. Renal damage can take the form of fibrosis, inflammation, glomerular hypertrophy, atrophy, etc., and can be associated with diseases associated with the native organ in a subject.

[0058] As used herein, in the context of cell populations, the term "mixture" refers to a combination of two or more isolated, enriched cell population phenotypes derived from an unfractionated heterogeneous cell population. According to a particular embodiment, The cell population of the present invention is a renal cell population.

[0059] An "enriched" cell population or preparation is a cell population obtained from a starting organ cell population (e.g., an unfractionated heterogeneous cell population) that identifies a particular cell type relative to that cell type in the starting population. For example, a starting kidney cell population can be enriched for a first, second, third, fourth, fifth, etc. cell population of interest. As used herein, the terms "cell population," "cell preparation," and "cell phenotype" are used interchangeably.

[0060] As used herein, the term "hypoxic" culture conditions refers to conditions in which cells are cultured at reduced levels of available oxygen in the culture system compared to standard culture conditions in which cells are cultured at atmospheric oxygen levels (approximately 21%). Non-hypoxic conditions are referred to herein as normal or normoxic conditions.

[0061] Provided herein are "genetically modified" or "genetically engineered" or "genetically altered" BRCs (e.g., SRCs). In some embodiments, such cells can be engineered using gene editing techniques to modify one or more specific cell surface antigens, such as For example, it can be obtained by removing major histocompatibility antigens from a SRC / BRC donor population. Various techniques can be used to engineer such cells, for example: a) Genome editing methods using artificial nucleases, such as CRISPR / Cas systems; b) transcription activator-like effector nucleases (TALENs); c) zinc finger nucleases (ZFNs); and d) engineered meganucleases and homing nucleases, allow the modification of cloned or synthesized DNA. Synthetic artificial DNA can be inserted, substituted, or deleted to generate genetically engineered SRC / BRCs. Various other polynucleotide delivery methods known in the art can be used, including transfection, electroporation, transduction, lipofection, nanoengineered materials such as organically modified silica or organically modified silicates (e.g., Ormosil), adenovirus, and the like. Viral delivery methods such as genomic DNA, retrovirus, lentivirus, adeno-associated virus, or another suitable method may be suitable for genetic manipulation of SRC / BRC.

[0062] "RNA-guided endonuclease" refers to a polypeptide whose endonuclease activity and specificity are determined by association with an RNA molecule, the entire sequence of which is Or more generally, fragments of the RNA molecule, preferably sequences longer than 8 nucleobases, more preferably longer than 10 nucleobases, and even more preferably longer than 12 nucleobases, have the ability to identify target sequences in a genome. The RNA-guided endonuclease hybridizes with the sequence and has the ability to mediate the endonuclease activity of the above-mentioned endonuclease.An example of RNA-guided endonuclease is Cas9 (CRISPR-associated protein 9) as part of Cas9 / CRISPR system.For more details, see, for example, Sanders and Joung, Nature Biotechnology 32, 347-355 (2014).

[0063] As used herein, "immunogenicity" refers to the ability of a substance to induce a detectable immune response (humoral or cellular) when introduced into a subject (e.g., a human subject).

[0064] The term "immunogenic gene" includes genes encoding major histocompatibility complex proteins or minor histocompatibility antigens. In certain embodiments, the immunogenic gene is any one of the B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, and / or HLA-DQB1 genes, or a combination thereof. In one embodiment, the immunogenic genes are B2M, HLA-A, HLA-B, HLA-C, HLA-DR family genes (e.g., HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4 , and / or HLA-DRB5), HLA-DP family genes (e.g., HLA-DPA1 and / or HLA-DPA2), and HLA-DQ family genes (e.g., HLA-DQA1 and / or HLA-DQB1).

[0065] The term "immunocompatible renal cells" or "immunocompatible renal cell population" refers to cells that are immunologically compatible. Major histocompatibility complex proteins and / or minor histocompatibility complex proteins that allow recognition by A kidney cell or population lacking one or more alleles of a gene encoding a matching antigen. In one embodiment, the immunocompatible renal cells or immunocompatible renal cell population comprises B2M. A kidney cell or population lacking one or more alleles of a gene encoding a In embodiments, the immunocompatible renal cells or population of immunocompatible renal cells are renal cells or populations that lack one or more alleles of any one, or any combination, of the B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, and / or HLA-DQB1 genes. In certain embodiments, administration of the immunocompatible renal cells to a recipient subject is immunologically privileged and does not induce an immune response in the recipient subject.

[0066] As used herein, the term "biomaterial" refers to a natural or synthetic biocompatible material that maintains selected bioactive cells in a viable state and is suitable for introduction into living tissue. Natural biomaterials are materials that are produced by or originate from a living system. Synthetic biomaterials are materials that are not produced by or do not originate directly from a living system, but instead are synthesized or constructed by specific chemical methods and protocols well known to those skilled in the art. The biomaterials described herein may be a combination of natural and synthetic biocompatible materials. Biomaterials as used herein include, for example, polymer matrices and scaffolds. As will be appreciated by those skilled in the art, biomaterials may be configured in a variety of forms, such as porous foams, gels, liquids, beads, solids, etc., and may be composed of one or more natural or synthetic materials. In some embodiments, the biomaterial is in a liquid state in a solution that can become a hydrogel.

[0067] As used herein, the term "hydrogel" refers to a material formed when organic polymers (natural or synthetic) are cross-linked via covalent, ionic, or hydrogen bonds to produce a three-dimensional open lattice structure that traps water molecules to form a gel. Examples of materials that can be used to form hydrogels include polysaccharides such as alginate, polyphosphazines, and polyacrylates, which are ionically crosslinked, or block copolymers such as Pluronics™ or Tetronics™, polyethylene oxide-polypropylene glycols, which are crosslinked by temperature or pH, respectively. The hydrogels used herein are preferably biodegradable gelatin-based hydrogels.

[0068] As used herein, biomaterial includes, for example, extracellular matrix obtained from a pre-existing kidney of human or animal origin, but whose native cell population has been removed by application of detergents and / or other chemicals known to those skilled in the art. In an embodiment, the biomaterial is in a liquid state, in a solution that can become a hydrogel, and can be printed onto specific tissues by applying three-dimensional bioprinting techniques known to those skilled in the art. In one embodiment, the biomaterial is configured to mimic the three-dimensional fractal tissue architecture of a decellularized kidney. .

[0069] The term "modified release," or equivalent terms "controlled release," "delayed release," or "sustained release," refers to a formulation that releases an active agent, such as bioactive cells, over an extended period of time or for a longer period of time after administration to an individual. Depending on the formulation, the modified release of the active agent can occur over a desired time range, e.g., minutes, hours, days, weeks, or longer, as opposed to standard formulations in which nearly the entire dosage unit is available immediately after administration. For tissue engineering and regenerative medicine applications, preferred modified release formulations provide many release periods after local administration (e.g., direct administration of the active agent to a solid organ). For example, a modified release formulation of bioactive cells provides an initial release of cells immediately upon administration, followed by a second release at a later time point. The delay time for the second release of the active substance may be minutes, hours, or days after the first dose. Generally, the release delay corresponds to the time it takes for the biomaterial carrier of the active agent to lose its structural integrity. The delayed release of the active agent begins as soon as such integrity begins to deteriorate and ends by the time that integrity is completely lost. Those skilled in the art can envision other suitable release mechanisms.

[0070] The term "ambient temperature" refers to the temperature at which the formulations herein are administered to a subject. Generally, ambient temperature is the temperature of a temperature-controlled environment. Ambient temperature ranges from about 18°C ​​to about 30°C. In certain embodiments, the ambient temperature is about 18°C, about 19°C, about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

[0071] As used herein, the term "kidney disease" refers to any stage or degree of acute or chronic renal failure that results in the loss of the kidney's ability to perform its function of filtering blood and removing excess fluid, electrolytes, and waste products from the blood. Kidney disease also includes endocrine dysfunction, such as anemia (erythropoietin deficiency), and mineral imbalance (vitamin D deficiency). Kidney disease can originate in the kidneys or can be secondary to a variety of conditions, including (but not limited to) heart failure, hypertension, diabetes, autoimmune disease, or liver disease. Kidney disease can also be a state of chronic kidney failure that develops after acute kidney injury. For example, kidney injury due to ischemia and / or exposure to toxic substances can lead to acute kidney failure. incomplete recovery after acute kidney injury can lead to the development of chronic renal failure.

[0072] The term "treatment" refers to both therapeutic and preventative measures for kidney disease, anemia, tubular transport failure, or glomerular filtration failure, the purpose of which is to reverse, prevent, or slow (halt) the progression of the targeted disease. Those in need of treatment include those who already have kidney disease, anemia, tubular transport failure, or glomerular filtration failure, as well as those who are susceptible to kidney disease, anemia, tubular transport failure, or glomerular filtration failure, or those in whom kidney disease, anemia, tubular transport failure, or glomerular filtration failure is to be prevented. As used herein, the term "treatment" includes stabilizing and / or improving kidney function.

[0073] As used herein, the term "in vivo contact" refers to secretion by an enriched cell population. Direct contact of a product with the native organ. For example, secreted products by an enriched kidney cell population (or mixtures or constructs containing kidney cells / renal cell fractions) may come into contact with the native kidney in vivo. Direct in vivo contact may be paracrine, endocrine, or juxtocrine in nature. The secreted products can be a heterogeneous population of different products as described herein.

[0074] The term "construct" or "formulation" refers to one or more synthetic The term "cell population" refers to one or more cell populations disposed on or within a scaffold or matrix composed of one or more synthetic or naturally occurring biocompatible biomaterials, polymers, or naturally occurring biocompatible materials. The cells may be coated with, placed on, embedded in, attached to, seeded (embedded) in, or entrapped in a biomaterial composed of a protein or peptide. In one embodiment, the naturally derived biomaterial is a decellularized kidney of human or animal origin. In one embodiment, the biomaterial has been structurally fabricated by three-dimensional bioprinting. One or more cell populations may be implanted in vitro or in vivo within the biomaterial or scaffold or matrix. can be combined with other compounds used to make constructs or formulations. The biomaterial(s) used can be selected to direct, promote, or allow dispersion and / or integration of the cellular components of the construct with endogenous tissue, but may also be selected to direct, promote, or allow survival, engraftment, tolerance, or functional performance of the cellular components of the construct or formulation. In certain embodiments, the biocompatible material(s) used to form the scaffold / biomaterial are selected to direct, promote, or allow the formation of a multicellular three-dimensional tissue by at least one of the cell populations disposed thereon. In certain embodiments, the biomaterial directs the assembly of specific three-dimensional cell aggregates or organoids that recapitulate aspects of native kidney tissue, including, but not limited to, the directionality of organization. In certain embodiments, the biomaterial directs the assembly of specific tubular structures that recapitulate aspects of native kidney tissue, including the lumen. In certain embodiments, the biomaterial enhances or promotes the secretion of proteins, nucleic acids, and membrane-bound vesicles from the cell populations disposed thereon. Generally, the biomaterial(s) used to create the construct are selected to direct, promote, or allow the formation of a multicellular three-dimensional tissue by at least one of the cell populations disposed thereon. A specific three-dimensional representation of the native kidney or renal parenchyma, corresponding to the original biological environment from which the population originated Selections can also be made to mimic or replicate aspects of the tissue or environmental niche, and recreating the original biological niche from which these cell populations originated may further enhance or promote cell viability and efficacy.

[0075] The term "cell aggregate" or "spheroid" refers to an aggregate or collection of cells cultured to allow for 3D growth as opposed to monolayer growth. It is noted that the term "spheroid" does not imply that the aggregate is geometrically spherical. An aggregate can be highly organized with a well-defined morphology and orientation, or it can be an unorganized mass; it can contain a single cell type, or it can contain two or more cell types. Cells can be primary isolates, This definition includes: In some embodiments, spheroids (e.g., cell aggregates or organoids) are formed in spinner flasks. In some embodiments, spheroids (e.g., cell aggregates or organoids) are formed in three-dimensional matrices. It is formed in the coke.

[0076] The term "Neo-Kidney Augment (NKA)" refers to a gelatin-based Consists of selected renal cells (SRC) formulated in a hydrogel biomaterial. It refers to a bioactive cell preparation that is an injectable product. The term "Advance Cell Therapy (ACT)" is also used for treatment with NKA. In certain embodiments, NKA is immunocompatible renal cells formulated in a biomaterial consisting of a gelatin-based hydrogel. In certain embodiments, the NKA is an injectable product comprising a population (e.g., immunocompatible SRCs). In certain embodiments, the NKA is an injectable product comprised of genomically modified, immunoprivileged, homologous SRCs formulated in a biomaterial comprised of a gelatin-based hydrogel, incapable of immune rejection. do.

[0077] The term "subject" shall mean any human subject, including a patient, who is suitable to receive treatment, but who is suffering from one or more of the following conditions: renal disease; A subject is experiencing or has experienced a number of signs, symptoms, or other indicators of renal disease. Such subjects include, but are not limited to, newly diagnosed or previously diagnosed subjects currently experiencing a recurrence or flare-up, or subjects at risk for kidney disease for any reason. The subject may or may not have already been treated for kidney disease.

[0078] The term "patient" refers to any individual animal, more preferably a mammal (e.g., dog, cat, horse, rabbit, zoo animal, cow, pig, sheep, and non-human animals such as non-human primates). Most preferably, the patient herein is a human.

[0079] The terms "sample" or "patient sample" or "biological sample" collectively refer to any biological sample obtained from a subject or patient, body fluid, body tissue, cell line, tissue culture, or other source. This term includes, for example, tissue biopsies, such as kidney biopsies. This term includes, for example, cultured cells, such as cultured mammalian kidney cells. Methods for obtaining tissue biopsies and cultured cells from mammals are well known in the art. When the term "sample" is used alone, this also means that the "sample" is a "biological sample" or a "patient sample," i.e., these terms are used interchangeably.

[0080] The term "test sample" refers to a sample derived from a subject treated by the methods herein. Test samples may be derived from a variety of sources from a mammalian subject, including, but not limited to, blood, semen, serum, urine, bone marrow, mucosa, tissue, etc.

[0081] The term "control" or "control sample" refers to a negative or positive control, the negative or positive results of which are expected to be useful in correlating results with test samples. Suitable controls herein include, but are not limited to, samples known to exhibit characteristic indicators of normal renal function, samples obtained from subjects known to be free of renal disease, and samples obtained from subjects known to have renal disease. In addition, a control can be a sample obtained from a subject before being treated with the methods herein. Further suitable controls can be test samples obtained from subjects known to have any type or stage of renal disease, and samples obtained from subjects known not to have any type or stage of renal disease. A control can be a normal, healthy matched control. Those skilled in the art will appreciate other controls suitable for use herein.

[0082] "Regeneration prognosis," "regenerative prognosis," or "regenerative prognosis" collectively refer to a prediction or forecast of the likely regenerative course or outcome for administration or transplantation of a cell population, mixture, or construct described herein. For a regenerative prognosis, the prediction or forecast may be informed by one or more of: improvement of a functional organ (e.g., kidney) after transplantation or administration; development of a functional kidney after transplantation or administration; appearance of improved kidney function or capacity after transplantation or administration; and expression of specific markers by the native kidney after transplantation or administration.

[0083] A "regenerated organ" refers to a native organ following transplantation or administration of a cell population, mixture, or construct described herein. The regenerated organ may be characterized by various indicators, including, but not limited to, the appearance of function or capacity in the native organ, improvement in function or capacity in the native organ, improvement in specific markers and physiological indicators associated with disease, and / or expression of specific markers in the native organ. Those skilled in the art will appreciate that other indicators may be suitable for characterizing a regenerated organ.

[0084] "Regenerated kidney" refers to a native kidney after transplantation or administration of a cell population, mixture, or construct described herein. The regenerated kidney is characterized by various indicators, including, but not limited to, the appearance of function or capacity in the native kidney, improvement in function or capacity in the native kidney, improvement in specific markers and physiological indicators associated with renal disease, and expression of specific markers in the native kidney. Those skilled in the art will appreciate that other indicators may be suitable for characterizing the regenerated kidney.

[0085] Bioactive cell populations In certain embodiments, the therapeutic compositions or formulations provided in this section are enriched for particular bioactive components or cell types, and / or enriched for particular inert or The compositions and formulations contain isolated heterogeneous renal cell populations devoid of unwanted components or cell types. In certain embodiments, such compositions and formulations are used in the treatment of renal disease, e.g., to stabilize and / or improve and / or regenerate kidney function and / or structure. In certain embodiments, the compositions contain isolated renal cell fractions that lack cellular components compared to healthy individuals but retain therapeutic properties, e.g., resulting in stabilization and / or improvement and / or regeneration of renal function. In certain embodiments, the cell populations described in this section can be obtained from a healthy individual, an individual with renal disease, or a subject described in this section.

[0086] Included herein are therapeutic compositions of selected renal cell populations to be administered to a target organ or tissue of a subject. In certain embodiments, a bioactive selected renal cell population generally refers to a cell population that may have therapeutic properties upon administration to a subject. In certain embodiments, a bioactive renal cell population, upon administration to a subject in need thereof, results in stabilization and / or improvement and / or repair and / or regeneration of renal function in the subject. In certain embodiments, the therapeutic properties may include a repair or regenerative effect.

[0087] In certain embodiments, the renal cell population is an unfractionated heterogeneous cell population or an enriched homogeneous cell population derived from the kidney. In certain embodiments, the heterogeneous cell population is isolated from a tissue biopsy or from whole organ tissue. In certain embodiments, the renal cell population is obtained from an in vitro culture of mammalian cells established from a tissue biopsy or whole organ tissue. In certain embodiments, the renal cell population comprises a subfraction or subpopulation of a heterogeneous renal cell population enriched for bioactive components (e.g., bioactive renal cells) and depleted of inactive or unwanted components or cells.

[0088] In certain embodiments, the renal cell population expresses GGT and cytokeratin. In certain embodiments, GGT has an expression level greater than about 10%, about 15%, about 18%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60%. In certain embodiments, the GGT is GGT-1. In certain embodiments, the renal cell population expresses cytokeratin, VEGF, and KIM-1. In certain embodiments, more than 18% of the cells in the renal cell population express GGT-1. In certain embodiments, more than 80% of the cells in the renal cell population express cytokeratin. In certain embodiments, the cytokeratin is selected from CK8, CK18, CK19, and combinations thereof. In certain embodiments, the renal cell population expresses cytokeratin ... The cytokeratin is CK8, CK18, CK19, CK8 / CK18, CK8 / CK19, CK18 / CK19, or CK8 / CK18 / CK19, where " / " denotes the combination of adjacent cytokeratins. In certain embodiments, the cytokeratin has an expression level greater than about 80%, about 85%, about 90%, or about 95%. Greater than 80% of the cells in a renal cell population express the cytokeratin. In certain embodiments, the renal cell population expresses AQP2. In certain embodiments, at least 3% of the cells in a renal cell population express AQP2.

[0089] In certain embodiments, greater than 18% of the cells in the cell population express GGT-1 and greater than 80% of the cells in the cell population express cytokeratin. The keratin is CK 18. In certain embodiments, 4.5% to 81.2% of the cells in the cell population express GGT-1, 3.0% to 53.7% of the cells in the cell population express AQP2, and 81.1% to 99.7% of the cells in the cell population express CK 18.

[0090] In certain embodiments, the renal cell population is selected from the group consisting of AQP1, AQP2, AQP4, calbindin, calponin, CD117, CD133, CD146, CD24, CD31 (PECAM-1), CD54 (ICAM-1), CD73, CK18, CK19, CK7, CK8, CK8, CK18, CK19, a combination of CK8 and CK18 and CK19, connexin 43, cubilin, CXCR4 (fusin), DBA, E-cadherin (CD324), EPO (erythropoietin) , GGT1, GLEPP1 (glomerular epithelial protein 1), haptoglobin, Itgbl (integrin β1) , KIM-1 (Kidney injury molecule-1), T1M-1 (T cell immunoglobulin and mucin-containing molecule), MAP-2( Microtubule-associated protein 2), megalin, N-cadherin, nephrin, NKCC (Na-K-Cl-cotransporter), OAT-1 (organic anion transporter 1), osteopontin, Pan-cadherin, PCLP1 (podocalyxin-like 1 molecule), podocin, SMA (smooth muscle alpha actin), synaptonemal podin, THP (Tamm-Horsfall protein), vimentin, and αGST-1 (α-glucosidase inhibitor). any combination of biomarkers selected from the group consisting of thiourea, thiamin, thiamin S-transferase, The present invention relates to cells expressing one or several of the above.

[0091] In certain embodiments, the renal cell population is enriched for epithelial cells relative to a starting population, such as a population of cells in a renal tissue biopsy or a primary culture thereof (e.g., the renal cell population comprises at least about 5%, 10%, 15%, 20%, or 25% more epithelial cells than the starting population). In certain embodiments, the renal cell population is enriched for tubular cells relative to a starting population, such as a population of cells in a renal tissue biopsy or a primary culture thereof (e.g., the renal cell population comprises at least about 5%, 10%, 15%, 20%, or 25% more tubular cells than the starting population). In certain embodiments, the tubular cells comprise proximal tubule cells. In certain embodiments, the renal cell population contains a reduced proportion of distal tubule cells, collecting duct cells, endocrine cells, vascular cells, or progenitor-like cells relative to the starting population. In certain embodiments, the renal cell population contains a reduced proportion of distal tubule cells than the starting population. In certain embodiments, the renal cell population contains a lower proportion of collecting duct cells than the starting population. In certain embodiments, the renal cell population contains a lower proportion of endocrine cells than the starting population. In certain embodiments, the renal cell population contains a lower proportion of vascular cells than the starting population. In certain embodiments, the renal cell population contains a lower proportion of progenitor-like cells than the starting population. In certain embodiments, the renal cell population contains a higher proportion of tubular cells and a lower proportion of EPO-producing cells, glomerular cells, and blood cells compared to a non-enriched population (e.g., the starting renal cell population). Contains ductal cells. In certain embodiments, the renal cell population contains a higher proportion of tubular cells and a lower proportion of EPO-producing cells and vascular cells compared to a non-enriched population. In certain embodiments, the renal cell population contains a higher proportion of tubular cells and a lower proportion of glomerular and vascular cells compared to a non-enriched population.

[0092] In certain embodiments, the cells of the renal cell population express hyaluronic acid (HA). In certain embodiments, the molecular weight range of HA is from about 5 kDa to about 20,000 kDa. In certain embodiments, the HA has a molecular weight of 5 kDa, 60 kDa, 800 kDa, and / or 3,000 kDa. In certain embodiments, renal cell populations synthesize and / or stimulate the synthesis of high molecular weight HA through expression of hyaluronan synthase 2 (HAS-2), particularly after intrarenal transplantation. In certain embodiments, cells of the renal cell population express relatively high molecular weight HA in vitro and / or in vivo through the action of HAS-2. The cells of the cell population express relatively high molecular weight HA both in vitro and in vivo through the action of HAS-2. In certain embodiments, the relatively high molecular weight HA species is HA having a molecular weight of at least 100 kDa. In certain embodiments, the relatively high molecular weight HA species is In certain embodiments, the HA has a molecular weight of about 800 kDa to about 3500 kDa. Relatively high molecular weight HA species are those with molecular weights ranging from about 800 kDa to about 3000 kDa. In certain embodiments, the relatively high molecular weight HA species has a molecular weight of at least 800 kDa. In certain embodiments, the relatively high molecular weight HA species is HA having a molecular weight of at least 3000 kDa. is HA having a molecular weight of about 800 kDa. In certain embodiments, the relatively high molecular weight HA species is HA having a molecular weight of about 3000 kDa. In certain embodiments, HAS-2 synthesizes HA having a molecular weight of 2x105 to 2x106 Da. In certain embodiments, the relatively high molecular weight HA species is HA having a molecular weight of about 3000 kDa. In certain embodiments, HAS-2 synthesizes HA having a molecular weight of 2x105 to 2x106 Da. Smaller HA species are generated by the action of degradative hyaluronidases. In certain embodiments, relatively high molecular weight HA species have a molecular weight of about 200 kDa to about 2000 kDa. In a specific embodiment, the relatively high molecular weight HA species is a molecule of about 200 kDa. In a specific embodiment, the relatively high molecular weight HA species is HA having a molecular weight of about 20 In certain embodiments, the relatively high molecular weight HA species is HA having a molecular weight of at least 200 kDa. The relatively high molecular weight HA species is HA having a molecular weight of at least 2000 kDa. In a specific embodiment, the relatively high molecular weight HA species is HA having a molecular weight of at least 5000 kDa. In a specific embodiment, the relatively high molecular weight HA species is HA having a molecular weight of at least 10000 kDa. In certain embodiments, the relatively high molecular weight HA species is HA having a molecular weight of at least 15,000 kDa. The primary species is HA with a molecular weight of approximately 20,000 kDa.

[0093] In certain embodiments, the population contains cells capable of receptor-mediated albumin transport.

[0094] In certain embodiments, the cells of the renal cell population are hypoxia resistant.

[0095] In certain embodiments, the renal cell population expresses one or more of any combination of megalin, cubilin, N-cadherin, E-cadherin, aquaporin-1, and aquaporin-2. It contains one or more cell types that express some of the

[0096] In certain embodiments, the renal cell population is characterized by the expression of megalin, cubilin, hyaluronic acid synthase 2 (HAS2), vitamin D3 25-hydroxylase (CYP2D25), N-cadherin (Ncad), E-cadherin (E-cad), and the like. Adherin (Ecad), aquaporin-1 (Aqp1), aquaporin-2 (Aqp2), RAB17, RAS oncogenic genes Gene family member (Rab17), GATA binding protein 3 (Gata3), FXYD domain-containing ion transport regulator 4 (Fxyd4), solute transporter family 9 (sodium-hydrogen exchanger) member Slc9a4, aldehyde dehydrogenase 3 family member B1 (Aldh3b1), The cells contain one or more cell types that express any combination of aldehyde dehydrogenase 1 family member A3 (Aldh1a3), and calpain 8 (Capn8).

[0097] In certain embodiments, the renal cell population is characterized by the expression of megalin, cubilin, hyaluronic acid synthase 2 (HAS2), vitamin D3 25-hydroxylase (CYP2D25), N-cadherin (Ncad), E-cadherin (E-cad), and the like. Adherin (Ecad), aquaporin-1 (Aqp1), aquaporin-2 (Aqp2), RAB17, RAS oncogenic genes Gene family member (Rab17), GATA binding protein 3 (Gata3), FXYD domain-containing ion transport regulator 4 (Fxyd4), solute transporter family 9 (sodium-hydrogen exchanger) member Slc9a4, aldehyde dehydrogenase 3 family member B1 (Aldh3b1), The cells contain one or more cell types that express any combination of aldehyde dehydrogenase 1 family member A3 (Aldh1a3), calpain 8 (Capn8), and aquaporin-4 (Aqp4).

[0098] In certain embodiments, the renal cell population expresses aquaporin 7 (Aqp7), FXYD domain-containing ion transport regulator 2 (Fxyd2), solute carrier family 17 (sodium phosphate) member 3 (Slc17a3), solute carrier family 3 member 1 (Slc3a1), claudin 2 (Cldn2), napsin A aspartic peptidase (Napsa), solute carrier family 2 (glucose-facilitated transporter), and / or phospholipase A (PGAP). Facilitated glucose transporter member 2 (Slc2a2), alanine (membrane) amino The present invention relates to a method for treating pulmonary arterial disease (PAD) comprising administering to a patient a therapeutically effective amount of any of the following: one or more cell types expressing any combination of one or more of: peptidase (Anpep), transmembrane protein 27 (Tmem27), acyl-CoA synthetase medium-chain family member 2 (Acsm2), glutathione peroxidase 3 (Gpx3), fructose-1,6-bisphosphatase 1 (Fbp1), alanine-glyoxylate aminotransferase 2 (Agxt2), platelet endothelial cell adhesion molecule (Pecam), and podocin (Podn).

[0099] In certain embodiments, the renal cell population expresses PECAM, VEGF, KDR, HIF1a, CD31, CD146, podocin (Podn), and nephrin (Neph), chemokine (C-X-C motif) receptor 4 (Cxcr4), endothelin receptor type B (Ednrb), type V collagen alpha 2 (Col5a2), cadherin 5 (Cdh5), tissue expressing one or more of any combination of plasminogen activator (Plat), angiopoietin 2 (Angpt2), kinase insert domain protein receptor (Kdr), secreted cysteine-rich acidic protein (osteonectin) (Sparc), serglycin (Srgn), TIMP metallopeptidase inhibitor 3 (Timp3), Wilms' tumor 1 (Wt1), wingless-type MMTV integration site family member 4 (Wnt4), regulator of G-protein signaling 4 (Rgs4), and erythropoietin (EPO), contains multiple cell types.

[0100] In certain embodiments, the renal cell population is a population of renal cells expressing PECAM, vEGF, KDR, HIF1a, podocin, nephrin, expressing any combination of one or more of: phospholipase A (PTA), EPO, CK7, and CK8 / 18 / 19; Or it contains multiple cell types.

[0101] In certain embodiments, the renal cell population contains one or more cell types that express one or more of any combination of PECAM, vEGF, KDR, HIF1a, CD31, CD146.

[0102] In certain embodiments, the renal cell population contains one or more cell types that express one or some of any combination of podocin (Podn) and nephrin (Neph).

[0103] In certain embodiments, the renal cell population contains one or more cell types that express one or more of any combination of PECAM, vEGF, KDR, HIF1a, and EPO.

[0104] In certain embodiments, the presence (e.g., expression) and / or level / amount of various biomarkers in a sample or cell population can be analyzed by numerous methods, many of which are well known in the art and understood by those of skill in the art, including immunohistochemistry (“IHC”), Western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, fluorescence activated cell sorting (“FACS”), MassARRAY, protein analysis, and the like. Omics, biochemical enzyme activity assays, in situ hybridization, Southern analysis, Northern analysis, whole genome sequencing, quantitative real-time PCR (“qRT-PCR”) and other amplification Polymerase chain reaction (“PCR”), including broad-spectrum detection methods (e.g., branched DNA analysis, SISBA, TMA, etc.), RNA-Seq, FISH, microarray analysis, gene expression profiling, and / or These include any one of a variety of assays performed by gene expression profiling techniques (“SAGE”), and protein, gene, and / or tissue array analysis. Non-limiting examples of protocols for assessing the status of genes and gene products include Northern blotting, Southern blotting, immunoblotting, and PCR analysis. In certain embodiments, Rules Based Medicine or or multiplex immunoassays available from Meso Scale Discovery. In certain embodiments, the presence (e.g., expression) and / or level / amount of various biomarkers in a sample or cell population can be analyzed by a number of methods, many of which are well known in the art and will be understood by those of skill in the art, including genome-wide transcriptomics, proteomics, and the like. , secretomics, lipidomics, phospatomics These include, but are not limited to, "-omics" ("-omics") platforms such as exosomics, which, in conjunction with computational biology and bioinformatics techniques, provide a complete biological picture of the genes, miRNAs, proteins, secreted proteins, lipids, and other information expressed and not expressed by the cell population under study. Revealing the biological signature.

[0105] In certain embodiments, detecting the presence of two or more biomarkers in a renal cell population The method includes contacting the sample with an antibody to the biomarker under conditions that allow binding of the antibody to its associated ligand (i.e., biomarker), and detecting the presence of bound antibody, e.g., by determining whether a complex is formed between the antibody and the biomarker. In certain embodiments, one or more antibodies The presence of the biomarkers is detected by immunohistochemical methods. As used herein, the term "detect" includes quantitative detection and / or qualitative detection.

[0106] In certain embodiments, the renal cell population is treated with one or more reagents that allow for the detection of the biomarkers described herein, such as AQP1, AQP2, AQP4, calbindin, calcitonin, and the like. Ponin, CD117, CD133, CD146, CD24, CD31 (PECAM-1), CD54 (ICAM-1), CD73, CK18, CK19, CK7, CK8, CK8 / 18, CK8 / 18 / 19, connexin 43, cubilin, CXCR4 (fusin), DBA, E-cadherin (CD324), EPO (erythropoietin), GGT1, GLEPP1 (glomerular epithelial protein 1), haptoglobin, Itgbl (integrin p), KIM-1 (kidney injury molecule-1), T1M-1 (T cell immunoglobulin- and mucin-containing molecules), MAP-2 (microtubule-associated protein 2), megalin, N-cadherin, nephrin, NKCC (Na-K-Cl-cotransporter), OAT-1 (organic anion transporter 1), osteopontin, Pan-cadherin, PCLP1 (podocalyxin-like 1 molecule) , podocin, SMA (smooth muscle alpha actin), synaptopodin, THP (Tamm-Horsfall protein), vimentin, and αGST-1 (α-glutathione S-transferase). In certain embodiments, the biomarkers are detected by monoclonal or polyclonal antibodies.

[0107] In certain embodiments, the origin of the cells is the same as the intended target organ or tissue. In certain embodiments, BRCs and SRCs can be obtained from the kidney for use in formulations administered to the kidney. In certain embodiments, the cell population is obtained from kidney biopsy. In certain embodiments, the cell population is obtained from whole kidney tissue. In certain embodiments, the cell population is obtained from in vitro culture of mammalian kidney cells established from kidney biopsy or whole kidney tissue.

[0108] In certain embodiments, the BRCs and SRCs comprise a heterogeneous mixture or fraction of bioactive renal cells. In certain embodiments, the BRCs and SRCs can be obtained from a healthy individual, or are autologous renal cell fractions from a healthy individual. In certain embodiments, renal cell populations or fractions obtained from unhealthy individuals (e.g., in kidney or kidney biopsies) that may lack certain cell types compared to renal cell populations from healthy individuals are included herein. In certain embodiments, therapeutically active cell populations are provided that lack cell types compared to healthy individuals. In certain embodiments, the cell populations are isolated and expanded from an autologous cell population.

[0109] In certain embodiments, SRCs are obtained from renal cortical tissue of a patient by renal biopsy. In certain embodiments, renal cells are isolated from renal tissue by enzymatic digestion, expanded by standard cell culture techniques, and selected from the expanded renal cells by centrifugation across a density boundary, barrier, or interface. In certain embodiments, renal cells are isolated from renal tissue by enzymatic digestion, expanded by standard cell culture techniques, and selected from the expanded renal cells by centrifugation across a density boundary, barrier, or interface. In certain embodiments, SRCs are primarily derived from kidney cells, and then expanded by techniques and selected from the expanded kidney cells by continuous or discontinuous single-step or multi-step density gradient centrifugation. They consist of epithelial cells, which are known to have regenerative potential. In certain embodiments, other parenchymal (vascular) and stromal cells may also be included in the autologous SRC population.

[0110] As described above, BRCs are a type of regenerative kidney cell that is naturally involved in kidney repair and regeneration. In certain embodiments, BRCs are isolated from kidney tissue by enzymatic digestion. The BRCs are obtained from renal cells expanded by standard cell culture techniques. Cell culture media can be formulated to expand regenerative, bioactive renal cells. In certain embodiments, the BRCs are obtained from renal cells isolated from renal tissue by enzymatic digestion; these The renal cells are genetically modified (e.g., genomically and / or RNAi modified) to be immune privileged or incapable of transplant rejection, and expanded (amplified) using standard culture techniques. Cell culture media can be designed to expand (amplified) immune privileged, bioactive renal cells with regenerative potential. In certain embodiments, the cell culture media does not contain differentiation factors. In certain embodiments, the heterogeneous mixture of expanded renal cells is cultured under hypoxic conditions to further enrich the composition of cells with regenerative potential. Without wishing to be bound by theory, this may be due to one or more of the following phenomena: This may be due to: 1) selective survival or death of specific cellular components during hypoxic culture. 2) changes in cell granularity and / or size in response to hypoxic culture; 3) changes in cellular gene / protein expression in response to hypoxic culture, resulting in differential cellular properties in isolated, expanded populations.

[0111] In certain embodiments, the bioactive renal cell population is obtained from the isolation and expansion of renal cells from renal tissue (such as tissue obtained by biopsy) under culture conditions that enrich for cells with renal regenerative potential.

[0112] In certain embodiments, renal cells obtained from renal tissue (such as tissue obtained by biopsy) are passaged 1, 2, 3, 4, 5, or 6 or more times to generate expanded, bioactive renal cells (such as a cell population enriched for cells with kidney regenerative capacity). In certain embodiments, renal cells obtained from renal tissue (such as tissue obtained by biopsy) are passaged once to generate expanded, bioactive renal cells. In certain embodiments, renal tissue (such as tissue obtained by biopsy) The renal cells obtained from the method are passaged twice to produce expanded, bioactive renal cells. In certain embodiments, renal cells obtained from renal tissue (such as tissue obtained by biopsy) are passaged three times to generate expanded, bioactive renal cells. Renal cells obtained from tissue (such as tissue obtained by biopsy) are passaged four times to generate expanded, bioactive renal cells. In certain embodiments, renal tissue (such as tissue obtained by biopsy) is cultured four times. ) are passaged five times to yield expanded, bioactive kidney cells. In certain embodiments, passaging the cells depletes the cell population of biologically inactive kidney cells. In certain embodiments, passaging the cells depletes the cell population of at least one cell type. In certain embodiments, passaging the cells depletes the cell population of cells with a density greater than 1.095 g / ml. In certain embodiments, passaging the cells depletes the cell population of small, low-granularity cells. In certain embodiments, passaging the cells depletes the cell population of cells smaller than red blood cells. In certain embodiments, passaging the cells depletes the cell population of cells with a diameter of less than 6 μm. In certain embodiments, passaging the cells depletes the cell population of cells with a diameter of less than 2 μm. In certain embodiments, passaging the cells depletes the cell population of cells with a granularity less than red blood cells. In certain embodiments, the viability of the cell population increases after one or more passagings. In certain embodiments, the terms small cells and low-granularity are used when cells are analyzed by fluorescence-activated cell sorting (FACS), for example, using the XY axis of a scatter plot of cell occurrence.

[0113] In certain embodiments, expanded bioactive renal cells are cultured under hypoxic conditions for at least about 6, 9, 10, 12, or 24 hours but less than 48 hours, or between 6 and 9 hours, or between 6 and 48 hours, or between 12 and 15 hours, or about 8 hours, or about 12 hours, or about 24 hours, or about 36 hours, or about 48 hours. In certain embodiments, cells cultured under hypoxic conditions are selected based on density. In certain embodiments, bioactive renal cell populations are cultured (e.g., after passaging and / or culturing under hypoxic conditions) for at least about 6, 9, 10, 12, or 24 hours but less than 48 hours. A selected renal cell (SRC) population is obtained after continuous or discontinuous (single-step or multi-step) density gradient separation of expanded renal cells (e.g., erythrocytes). In certain embodiments, the biological The activated renal cell population may be expanded (e.g., after passage and / or culture under hypoxic conditions) The selected renal cell (SRC) population is obtained after separation of cultured renal cells by centrifugation across a density boundary, barrier, or interface. In certain embodiments, the hypoxic culture conditions are , cells are cultured at atmospheric oxygen levels (approximately 21%) compared to standard culture conditions. Hypoxic culture conditions are culture conditions in which the culture system is exposed to a decrease in the available oxygen level. In certain embodiments, cells cultured under hypoxic culture conditions are cultured at an oxygen level of about 5% to about 15%, or about 5% to about 10%, or about 2% to about 5%, or about 2% to about 7%, or about 2%, or about 3%, or about 4%, or about 5%. In certain embodiments, the SRC exhibits a buoyant density greater than about 1.0419 g / mL. In certain embodiments, the SRC exhibits a buoyant density greater than about 1.04 g / mL. In certain embodiments, the SRC exhibits a buoyant density greater than about 1.045 g / mL. In this embodiment, the BRCs or SRCs have one or more cellular modifications compared to the starting kidney cell population. contain a higher proportion of one cell population and lack one or more other cell populations, or There is a shortage of them.

[0114] In certain embodiments, the expanded kidney cells are subjected to density gradient separation to obtain SRCs. In certain embodiments, the SRC is then genetically modified. In some embodiments, genetically modified (e.g., genomically and / or RNAi-modified) BRCs are subjected to density gradient separation to obtain genetically modified SRCs. In certain embodiments, genetically modified (e.g., genomically and / or RNAi-modified) BRCs are subjected to both hypoxic culture conditions and density gradient separation to obtain genetically modified SRCs. In certain embodiments, continuous or discontinuous single-step or Multi-step density gradient centrifugation is used to separate the collected renal cell population based on cell buoyant density. In certain embodiments, the expanded bioactive renal cells are used to obtain SRCs. To separate the renal cell populations, the cells can be separated by centrifugation across a density boundary, barrier, or interface. In certain embodiments, centrifugation across a density boundary or interface is used to separate the collected renal cell populations based on cell buoyant density. In certain embodiments, SRCs are generated, in part, by using OPTIPREP (Axis-Shield) medium. This medium contains a 60% (w / v) aqueous solution of the non-ionic iodine compound iodixanol. However, it will be understood by those skilled in the art that other media, density gradients (continuous or discontinuous), density boundaries, barriers, interfaces, or other means, such as immunological separation using cell surface markers known in the art, that have the characteristics required for the isolation of cell populations described herein can be used to obtain bioactive kidney cells. In certain embodiments, a cell fraction exhibiting a buoyant density greater than about 1.04 g / mL is separated as a separate pellet after centrifugation. In certain embodiments, cells that maintain a buoyant density below 1.04 g / mL are collected. In certain embodiments, the buoyant density is greater than about 1.0419 g / mL. The cell fraction is collected as a separate pellet after centrifugation. In certain embodiments, cells that maintain a buoyant density below 1.0419 g / mL are excluded and discarded. In certain embodiments, the cell fraction exhibiting a buoyant density greater than about 1.045 g / mL is collected as a separate pellet after centrifugation. In certain embodiments, cells that maintain a buoyant density less than 1.045 g / mL are excluded and discarded.

[0115] In certain embodiments, cell buoyant density is used to obtain an SRC population and / or determine whether a renal cell population is bioactive renal cells. In certain embodiments, cell buoyant density is used to isolate bioactive renal cells. In certain embodiments, cell buoyant density is measured by centrifugation across a single-stage OptiPrep (7% iodixanol; 60% (w / v) in OptiMEM) density interface (single-stage discontinuous density gradient). OptiPrep is a 60% w / v aqueous solution of iodixanol. When used for gradients, OptiPrep is diluted with OptiMEM (basal cell culture medium) to a final concentration of 7% iodixanol (in water and OptiMEM). OptiMEM is prepared buffered with HEPES and sodium bicarbonate and contains hypoxanthine, thymidine, sodium pyruvate, and iodixanol. It is a modification of Eagle's minimum essential medium supplemented with glutamate, L-glutamine or GLUTAMAX, trace elements, and growth factors. Protein levels are minimal (15 μg / mL), and insulin and and transferrin are minor protein additives. Phenol red is included at low concentrations as a pH indicator. In certain embodiments, OptiMEM is diluted with 2-mercaptoethanol prior to use. Ethanol can be added.

[0116] In certain embodiments, an OptiPrep solution is prepared and the refractive index is measured prior to use to indicate the desired density (RI 1.3456 + / - 0.0004). In certain embodiments, kidney cells are layered on top of the solution. In certain embodiments, the density interface or single-step discontinuous density gradient is prepared in a centrifuge tube (50 ml conical tube) or cell processing device (e.g., COBE 2991). Centrifuge at 800 g (no brake) for 20 minutes at room temperature. Cell fractions exhibiting buoyant densities higher than 1000 μg / mL were collected as a separate pellet after centrifugation. In certain embodiments, cells that maintain a buoyant density below 1.04 g / mL are excluded, In certain embodiments, the cell fraction exhibiting a buoyant density greater than about 1.0419 g / mL is discarded. are collected as a separate pellet after centrifugation. In certain embodiments, cells that maintain a buoyant density below 1.0419 g / mL are excluded and discarded. The cell fraction exhibiting a buoyant density greater than about 1.045 g / mL is collected as a separate pellet after centrifugation. In certain embodiments, cells that maintain a buoyant density less than 1.045 g / mL are excluded and discarded. In certain embodiments, prior to cell density assessment or density-based selection, cells are cultured until they are at least 50% confluent and allowed to stand overnight (e.g., 12 hours). (e.g., at least about 8 to 12 hours) at 37°C in a 5% CO2 atmosphere and 2% oxygen. Incubated in an oxygen incubator.

[0117] In certain embodiments, cells obtained from a kidney sample are expanded and then treated (e.g., hypoxia and centrifugation) to generate an SRC population. In certain embodiments, the SRC population is generated using the reagents and methods described herein. In certain embodiments, the viability of a cell sample from an SRC population is tested prior to administering the cells of the population to a subject. In certain embodiments, prior to administering cells of the SRC population to a subject, the cells from the population are purified. A cell sample is examined for expression of one or more of the markers described herein. .

[0118] Non-limiting examples of compositions and methods for preparing SRC are found in U.S. Patent Application Publication No. 2017 / 0281684 A1, the entire contents of which are incorporated herein by reference.

[0119] In certain embodiments, BRCs or SRCs are obtained from natural autologous or allogeneic kidney samples. In certain embodiments, BRCs or SRCs are obtained from non-autologous kidney samples. In certain embodiments, the sample can be obtained by kidney biopsy.

[0120] In certain embodiments, the isolation and expansion of renal cells results in a mixture of renal cell types, including renal epithelial cells and stromal cells. In certain embodiments, SRCs are isolated from the expanded renal cells. In certain embodiments, the predominant cell type in the density gradient separated SRC population is a cell type of renal tubular epithelial phenotype. In some embodiments, SRCs are grown by centrifugation across a density boundary, barrier, or interface. In certain embodiments, the density boundary / barrier is obtained by isolating induced kidney cells. The predominant cell type in the SRC population that separates across the renal / interface is that of the tubular epithelial phenotype. In certain embodiments, the characteristics of SRCs obtained from expanded renal cells are multifaceted. In certain embodiments, cell morphology, proliferation rate, and cell viability are monitored during the renal cell proliferation process. Free density and viability are characterized by centrifugation on or through density gradient media and trypan blue dye exclusion. In certain embodiments, the SRC phenotype is SRC function is characterized by flow cytometry and demonstrated by expression of VEGF and KIM-1. In certain embodiments, the cellular function of preformulated SRC is , two specific enzymes present in the proximal tubule; GGT (γ-glutamyl transpeptidase) It can also be evaluated by measuring the activity of LAP (leucine aminopeptidase).

[0121] In certain embodiments, cell subpopulations can be separated by flow cytometry using cellular characteristics (size and granularity) that contribute to the separation of cell subpopulations via density media (forward scatter = reflective of size by flow cytometry, and side scatter = reflective of granularity). In certain embodiments, the density gradient or separation media should be low toxic to the specific cells of interest. While in certain embodiments, the density media should have low toxicity to the specific cells of interest, the present specification contemplates the use of media that play a role in the selection process for the cells of interest. In certain embodiments, without wishing to be bound by theory, the cell populations described herein recovered with iodixanol-containing media appear to be iodixanol-resistant, as there is a substantial loss of cells between the loading and recovery steps, suggesting that exposure to iodixanol under conditions of a density gradient, or density boundary, density barrier, or density interface, results in the elimination of certain cells. In certain embodiments, cells emerging after iodixanol density gradient or density interface separation may be due to the effects of iodixanol and / or density gradient or interface exposure. In certain embodiments, imaging agents containing mild to moderate nephrotoxins are used to isolate and / or select cell populations, such as SRC populations. In certain embodiments, SRCs are resistant to iodixanol. In this embodiment, the density medium should not bind to proteins in human plasma and should not adversely affect important functions of the cells of interest.

[0122] In certain embodiments, the cell population is enriched and / or depleted for one or more renal cell types using fluorescence-activated cell sorting (FACS). In certain embodiments, the renal cell types can be enriched and / or depleted using a BD FACSAria™ or equivalent product. In certain embodiments, the renal cell types can be enriched and / or depleted using a FACSAria III™ or equivalent product.

[0123] In certain embodiments, the cell population is isolated from one or more kidneys using magnetic cell separation. Cell types were enriched and / or depleted. In certain embodiments, one or more renal cell types can be enriched and / or depleted using a Miltenyi autoMACS® system or equivalent product.

[0124] In certain embodiments, the renal cell population is subjected to three-dimensional culture. In certain embodiments, the method for culturing the cell population is by continuous perfusion. Cell populations cultured by 3D culture and continuous perfusion exhibit increased cellularity and interconnectivity compared to statically cultured cell populations. In certain embodiments, 3D culture and continuous perfusion are used to culture cell populations. Cell populations cultured by flow have a higher concentration of EPO compared to static cultures of such cell populations. In certain embodiments, cell populations cultured by continuous perfusion exhibit higher levels of glucose and glutamine consumption than cell populations cultured in static culture.

[0125] In certain embodiments, hypoxic conditions can be used in the methods of preparing cell populations provided herein. In certain embodiments, the methods of preparing cell populations can be used without a step of conditioning with hypoxia. In certain embodiments, normoxic conditions can be used.

[0126] In certain embodiments, the renal cell population is isolated and / or cultured from renal tissue. Non-limiting examples of methods for separating and isolating cellular components, such as enriched cell populations for use in therapeutic formulations, are described herein, including methods for treating kidney disease, anemia, EPO deficiency, urinary In certain embodiments, the cell population is isolated from freshly digested, i.e., mechanically or enzymatically digested, kidney tissue or from a heterogeneous in vitro culture of mammalian kidney cells.

[0127] In certain embodiments, the renal cell population contains EPO-producing renal cells. In certain embodiments, the subject has anemia and / or EPO deficiency. The EPO-producing renal cell population was characterized for its expression and biological response to oxygen. A decrease in oxygen tension in the nutrient system results in the induction of EPO expression. In certain embodiments, the EPO-producing cell population is enriched for EPO-producing cells. Currently, cell populations are cultured at standard atmospheric levels of available oxygen (approximately 21%) compared to cell populations cultured at standard atmospheric levels of available oxygen (approximately 21%). In certain embodiments, EPO-producing cells cultured under hypoxic conditions are induced to undergo oxidative stress when exposed to a decrease in the available oxygen level in the culture system. The cells express higher levels of EPO than EPO-producing cells cultured under these conditions. Generally, culturing cells under reduced levels of available oxygen (also referred to as hypoxic culture conditions) means that the level of reduced oxygen is reduced compared to cell culture under standard atmospheric levels of available oxygen (also referred to as normal or normoxic culture conditions). In certain embodiments, hypoxic cell culture conditions include culturing cells under less than about 1% oxygen, less than about 2% oxygen, less than about 3% oxygen, less than about 4% oxygen, or less than about 5% oxygen. In certain embodiments, normal or normoxic culture conditions include culturing cells under about 10% oxygen, about 12% oxygen, about 13% oxygen, about 14% oxygen, about 15% oxygen, about 16% oxygen, about 17% oxygen, about 18% oxygen, about 19% oxygen, about 20% oxygen, or about 21% oxygen.

[0128] In certain embodiments, cells are cultured at less than about 5% available oxygen and EPO expression levels are measured at atmospheric pressure. By comparing cells cultured in medium (approximately 21%) oxygen, an increased induction or expression of EPO can be observed. In certain embodiments, the ability to express EPO can be observed. In cultures of cells with high oxygen content, the cell cultures are exposed to atmospheric oxygen (approximately 21%) for a period of time. In the first culture phase, the cells are cultured at a reduced available oxygen level, resulting in less than about 5% of the available oxygen. Induction of EPO is achieved by a method including a second culture period in which the cells are cultured in oxygen. In certain embodiments, EPO expression in response to hypoxic conditions is regulated by HIF1α. In some embodiments, other oxygen manipulation culture conditions known in the art can be used for the cells described herein.

[0129] In certain embodiments, the formulation may be formulated to enhance biological responsiveness (e.g., EPO expression) to perfusion conditions. In certain embodiments, the present invention comprises an enriched population of EPO-producing mammalian cells characterized by a Perfusion conditions include transient, intermittent, or continuous fluid flow (perfusion). In certain embodiments, EPO expression is mechanically induced when the medium in which the cells are cultured is circulated intermittently or continuously and agitated such that dynamic forces are transmitted to the cells via the flow. In certain embodiments, cells exposed to transient, intermittent, or continuous fluid flow are cultured such that the cells exist as three-dimensional structures within or on a material that provides a framework and / or space for such three-dimensional structures to form. In certain embodiments, cells are cultured on porous beads and exposed to intermittent or continuous fluid flow using a rocking platform, an orbiting platform, or a spinner flask. In certain embodiments, cells are cultured on a three-dimensional scaffold material and exposed to intermittent or continuous fluid flow. The scaffold is set into a vice, with the scaffold held in place by the device and fluid flowing through or across the scaffold. It will be appreciated by those skilled in the art that other perfusion culture conditions known in the art can be used for the cells described herein.

[0130] In certain embodiments, the cell population is obtained from a kidney biopsy. In certain embodiments, the cell population is obtained from whole kidney tissue. In certain embodiments, the cell population is obtained from an in vitro culture of mammalian kidney cells established from a kidney biopsy or whole kidney tissue. In certain embodiments, the kidney cell population is an SRC population. In certain embodiments, the cell population is unfractionated. The enriched cell population is also referred to herein as a non-enriched cell population.

[0131] Compositions containing a variety of active agents (e.g., other than kidney cells) are included herein. Non-limiting examples of suitable active agents include, but are not limited to, cell aggregates, acellular biomaterials, secretory products from bioactive cells, large and small molecule therapeutic agents, and combinations thereof. For example, one bioactive cell type can be combined with a biomaterial-based microcarrier with or without a therapeutic molecule or another bioactive cell type. In certain embodiments, non-adherent cells can be combined with acellular particles.

[0132] In certain embodiments, the cells of the renal cell population are present in spheroids. In certain embodiments, the renal cell population is in the form of a spheroid. In certain embodiments, the spheroids containing bioactive renal cells are administered to a subject. In certain embodiments, the spheroids contain at least one non-renal cell type or cell population. In this state, the spheroids (i) combine bioactive renal cell populations and non-renal cell populations; and (ii) culturing the bioactive renal cell population and the non-renal cell population in a three-dimensional culture system, including a spinner flask, until spheroids are formed. will be done.

[0133] In certain embodiments, the non-renal cell population comprises an endothelial cell population and an endothelial progenitor cell population. In certain embodiments, the bioactive cell population is an endothelial cell population. In certain embodiments, the endothelial cell population is a cell line. In certain embodiments, the endothelial cell population comprises human umbilical vein endothelial cells (HUVECs). In certain embodiments, the non-renal cell population is a mesenchymal cell population. In certain embodiments, the non-renal cell population is a stem cell population of hematopoietic, breast, intestinal, placental, lung, bone marrow, blood, umbilical cord, endothelial, dental pulp, adipose, neural, olfactory nerve, neural crest, or testicular origin. In certain embodiments, the non-renal cell population is an adipose-derived progenitor cell population. In certain embodiments, the cell population is a xenogeneic, syngeneic, allogeneic, autologous population, or combinations thereof. In certain embodiments, the bioactive renal cell population and the non-renal cell population are cultured at a ratio of 0.1:9.9 to 9.9:0.1. In certain embodiments, the bioactive renal cell population and the non-renal cell population are cultured at a ratio of about 1:1. In certain embodiments, The renal cell population and the bioactive cell population are suspended in growth medium.

[0134] The expanded bioactive kidney cells were further subjected to continuous or discontinuous density media separation to isolate SRCs. Specifically, continuous or discontinuous, single-step or multi-step density gradient centrifugation is used to separate the collected kidney cell population based on cell buoyant density. In some embodiments, the expanded bioactive kidney cells can be further subjected to separation by centrifugation across a density boundary, barrier, or interface to obtain SRCs. Centrifugation across a barrier, or interface, is used to separate the collected renal cell population based on cell buoyant density. In one embodiment, SRCs are prepared in part from non-ionic iodine compounds. The OPTIPREP (Axis-Shield) medium containing a 60% aqueous solution of iodixanol was used. However, one of skill in the art will recognize that any density gradient medium can be used in accordance with the present disclosure, without being limited to a particular medium or other means, such as, for example, immunological separation using cell surface markers known in the art that have the characteristics required for the separation of cell populations herein. For example, Percoll or sucrose can be used to separate cell populations. In one embodiment, a density gradient or density boundary can be formed. Cell fractions exhibiting buoyant densities higher than 1000 μg / mL were collected as a separate pellet after centrifugation. In one embodiment, cells that maintain a buoyant density below 1.04 g / mL are rejected and discarded. In one embodiment, a cell fraction exhibiting a buoyant density greater than about 1.0419 g / mL is centrifuged. It is collected as a separate pellet after centrifugation. In one embodiment, it is greater than 1.0419 g / mL. Cells that maintain a low buoyant density are rejected and discarded. In one embodiment, the cell fraction exhibiting a buoyant density greater than about 1.045 g / mL is collected as a separate pellet after centrifugation. In one embodiment, cells that maintain a buoyant density less than 1.045 g / mL are rejected and discarded.

[0135] The therapeutic compositions and formulations thereof herein are intended to be enriched for particular bioactive components or cell types and / or to eliminate particular inactive or unwanted components for use in treating renal disease. or reduced cell types, which have been genetically modified by removing genetic components encoding cell surface antigens that are responsible for immune rejection in the recipient, i.e., stabilizing and / or improving and / or regenerating kidney function and / or structure. and may contain heterogeneous populations and / or mixtures of isolated kidney cells. Non-limiting examples of cells that provide such stabilization and improvement have been previously described, for example, in Presnell et al. US 8,318,484, Ilagan et al. PCT / US2011 / 036347, and Jain et al. PCT / US2016 / 044866, which are incorporated herein by reference in their entireties. The compositions can contain isolated kidney cell fractions that lack cellular components compared to healthy individuals but retain therapeutic properties, i.e., provide stabilization and / or improvement and / or regeneration of kidney function. The cell populations, cell fractions, and / or cell mixtures described herein can be used to treat kidney disease. The product can be obtained from a healthy individual, an individual with kidney disease, or a subject as described herein.

[0136] The present specification contemplates therapeutic compositions of genetically modified (e.g., genomically and / or RNAi modified) immunoprivileged selected renal cell populations to be administered to a target organ or tissue of a subject in need. Bioactive selected renal cell populations generally refer to cell populations that may have therapeutic properties upon administration to a subject. For example, upon administration to a subject in need, the bioactive renal cell populations may result in stabilization and / or improvement and / or repair and / or regeneration of renal function in the subject. The therapeutic properties can include repair or regenerative effects.

[0137] In one embodiment, the cells are of the same origin as the intended target organ or tissue. For example, BRCs and / or SRCs may be obtained from the kidney and used in formulations administered to the kidney. In certain embodiments, the cell population is obtained from a kidney biopsy. In certain embodiments, the cell population is obtained from whole kidney tissue. In certain embodiments, the cell population is obtained from an in vitro culture of mammalian kidney cells established from a kidney biopsy or whole kidney tissue. In certain embodiments, the BRCs and / or SRCs are a heterogeneous mixture of bioactive kidney cells or BRCs and / or SRCs can be obtained from healthy individuals and contain a fraction of the BRCs and / or SRCs. i.e., a renal cell fraction obtained from a healthy individual. Provided herein are renal cell fractions obtained from unhealthy individuals that may lack certain cellular components compared to corresponding renal cell fractions from healthy individuals, yet still retain therapeutic properties. Also provided herein are therapeutically active cell populations that lack cellular components compared to healthy individuals, which cell populations can, in certain embodiments, be isolated and expanded from autologous sources at various stages of disease.

[0138] In one embodiment, SRCs are obtained by isolating renal cells from renal cortical tissue obtained by renal biopsy in a patient. Renal cells are isolated from kidney tissue by enzymatic digestion, expanded by standard cell culture techniques, and selected by centrifugation of proliferating kidney cells that cross a density boundary, barrier, or interface. In this embodiment, SRCs are primarily derived from renal tubular epithelial cells. The retina is made up of cells known for their regenerative capacity (Bonventre JV. Dedifferentiation and proliferation of surviving epithelial cells in acute renal failure. J Am Soc Nephrol. 2003;14(Suppl. 1):S55-61; Humphreys BD, Czerniak S, DiRocco DP, et al. Repair of injured proximal tubule does not involve specialized progenitors. PNAS. 2011;108:9226-31; Humphreys BD, Valerius MT, Kobayashi A, et al. Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell. 2008;2:284-91) Other parenchymal (vascular) and stromal cells may be present in the autologous SRC population. In the method, kidney cells are selected by centrifugation through continuous or discontinuous single-step or multi-step gradients.

[0139] A genetically modified (e.g., genomically modified and / or modified via RNAi) immunoprivileged antibody to be administered to a target organ or tissue of a subject in need thereof. Therapeutic compositions of selected renal cell populations that are bioactive are included herein. Bioactive selected renal cell populations generally refer to cell populations that may have therapeutic properties upon administration to a subject. For example, bioactive renal cell populations, when administered to a subject in need, may result in stabilization and / or improvement and / or repair and / or regeneration of renal function in the subject. The therapeutic properties may include a repair or regenerative effect.

[0140] In certain embodiments, the source of the cells is the same as the intended target organ or tissue, either from the same or a different source. For example, BRCs and / or SRCs are administered to the kidney. In some embodiments, the cell population is obtained from a kidney for use in a formulation to be used in a renal biopsy. In some embodiments, the cell population is obtained from whole kidney tissue. In some embodiments, the cell population is obtained from an in vitro culture of mammalian kidney cells established from a kidney biopsy or whole kidney tissue. In some embodiments, BRC and / or SRC are genetically modified (e.g., genomically modified and / or modified via RNAi) BRCs and The SRCs and / or SRCs can be obtained from healthy individuals, or can be autologous kidney cell fractions from healthy individuals. Additionally, the present invention provides kidney cell fractions obtained from non-healthy individuals that may lack certain cellular components compared to corresponding kidney cell fractions from healthy individuals, while still retaining therapeutic properties. The present invention also provides therapeutically active cell populations that lack cellular components compared to healthy individuals, which cell populations can, in certain embodiments, be isolated and expanded from kidneys obtained from a variety of mammals.

[0141] In one embodiment, SRCs are obtained by renal biopsy from renal cortical tissue of different patients. In one embodiment, renal cells are isolated from kidney tissue by enzymatic digestion, genetically modified (e.g., genomic and / or via RNAi) to render the renal cells immune privileged or unable to be rejected, and then grown by standard cell culture techniques. In one embodiment, SRCs are primarily selected from renal epithelial cells by density gradient centrifugation. SRCs are composed of cells known to be immune privileged and have regenerative capacity. Other parenchymal (vascular) and stromal cells may also be present in small amounts in the SRC population.

[0142] As described in this section, the present invention is based, in part, on the surprising discovery that specific subfractions of heterogeneous populations of kidney cells, enriched for bioactive components and depleted of inactive or unwanted components, provide superior therapeutic and regenerative outcomes than the starting population.

[0143] Isolation and expansion of renal cells yields a mixture of renal cell types, including renal epithelial and stromal cells. As described above, SRCs are obtained by density gradient separation of expanded renal cells. The predominant cell type in the isolated SRC population is that of the renal tubular epithelial phenotype. The characteristics of SRC derived from kidney cells are evaluated using a multi-pronged approach. During the growth process, monitor cell morphology, growth rate, and cell viability. SRC phenotype was characterized by flow cytometry, and SRC function was determined by expression of VEGF and KIM-1. This is demonstrated by the reality.

[0144] Those skilled in the art will appreciate that other methods of isolation and culture known in the art can be used for the cells described herein. Those skilled in the art will also appreciate that biologically active cell populations can be obtained from sources other than those specifically listed above, for example, but not limited to, tissues and organs other than kidney, body fluids, and adipose.

[0145] SRC phenotype In one embodiment, cell phenotype is monitored by analyzing the expression of renal cell markers using flow cytometry. Cell phenotypic analysis is based on the use of antigen markers specific to the cell type being analyzed. Flow cytometric analysis provides a quantitative indication of cells in a sample population that express the antigen marker being analyzed.

[0146] Various markers useful for characterizing the phenotype of renal tubular epithelial cells have been reported in the literature: (i) cytokeratins; (ii) membrane proteins involved in transport (aquaporins and and cubilin; (iii) cell junction molecules (adherins and clusters of differentiation and and lectins); and (iv) metabolic enzymes (glutathione and gamma glutamyltransferase) (Table 1) The majority of cells in cultures obtained from whole kidney digests were Since the two groups are epithelial and endothelial cells, the markers examined are proteins specific to these two groups. Emphasis is placed on the expression of [Table 1]

[0147] Table 2 provides the selected markers, the phenotypic ranges and percent mean values ​​in the SRC population, and the rationale for their selection. [Table 2]

[0148] cell function SRC actively secretes proteins that can be detected by analysis of conditioned medium. Cell function is assessed by the ability of cells to metabolize PrestoBlue and to secrete VEGF (vascular endothelial growth factor) and KIM-1 (kidney injury molecule 1).

[0149] Table 3 shows the concentrations of VEGF and KIM-1 present in conditioned medium obtained from renal cell and SRC cultures. The amounts are shown. Renal cells were cultured until near confluence. Conditioned medium from overnight exposure to the renal cell cultures was assayed for VEGF and KIM-1. [Table 3]

[0150] SRC enzyme activity The cellular function of the preformulated SRC can also be evaluated by measuring the activity of two specific enzymes present in the renal proximal tubules: GGT (gamma glutamyl transpeptidase) and LAP (leucine aminopeptidase).

[0151] While selected renal cell compositions are described herein, the present invention contemplates compositions containing a variety of other active agents. Other suitable active agents include, but are not limited to, cell aggregates, acellular biomaterials, secretory products from bioactive cells, large and small molecule therapeutic agents, and combinations thereof. For example, one bioactive cell type can be combined with a biomaterial-based microcarrier with or without a therapeutic molecule or another bioactive cell type, and non-adherent cells can be combined with acellular particles.

[0152] Representative gene modification methods In one embodiment, genetically modifying a cell such as a BRC (e.g., an SRC) involves introducing a gene-editing protein and / or nucleic acid into the BRC (e.g., via expression or by delivery across the cell membrane).

[0153] In some embodiments, the gene editing protein is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a megaTAL, or a Cas protein. In some embodiments, the gene editing protein is a single-stranded rare-cutting nuclease construct ("megaTAL"). In some embodiments, a gene editing protein such as a ZFN, a megaTAL, or a Cas protein (e.g., Cas9) may be delivered as a protein, or alternatively, a polynucleotide (e.g., mRNA or a vector) encoding the protein is delivered to a cell.

[0154] In some embodiments, the Cas9 protein is delivered as a protein. In some embodiments, a polynucleotide (e.g., mRNA or vector) encoding the Cas9 protein is delivered to a cell. In some embodiments, a gene-editing polynucleotide, such as a gRNA, is delivered into a cell. In the context of the CRISPR / Cas9 system, a single guide RNA ("gRNA" or "guide RNA") contains both a targeting sequence (crRNA sequence) and a Cas9 nuclease recruiting sequence (tracrRNA). In some embodiments, the crRNA and / or tracrRNA is delivered into a cell. In some embodiments, the gene-editing polynucleotide is expressed in a cell, for example, from an mRNA or vector. In some embodiments, a gene-editing complex containing the Cas9 protein and a gRNA or crRNA and tracrRNA, CRISPR ribonucleoprotein complexes (RNPs) are delivered or expressed inside cells. .

[0155] In one embodiment, to genetically modify a cell, (e.g., as part of an RNP) In one embodiment, a Cas protein (expressed or delivered) is used. In one embodiment, the Cas protein is a Cas9 protein or a variant thereof. Non-limiting examples of Cas proteins (including non-limiting examples of Cas9 and Cas9 variants) are described herein.

[0156] In one embodiment, the first and second gRNA or first and second crRNA molecules are As a target sequence adjacent to a gene or part thereof (e.g., promoter and / or or one or more exons and / or introns thereof), wherein the gene or portion thereof is about 1, 2, 3, 4, 5, 6, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-100 kilobases in length, or at least about 1, 2, 3, 4, 5, 6, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-100 kilobases in length. In one embodiment, a pair of RNPs containing the first and second gRNA or first and second crRNA molecules are expressed or delivered in a cell. In one embodiment, one of the RNPs One component (e.g., a Cas protein or gRNA) is expressed intracellularly, and the other component (e.g., The target gene (e.g., a gRNA or a Cas protein) is delivered across the plasma membrane of the cell.

[0157] In one embodiment, the target sequence of the gRNA or crRNA is about 12 to about 25, i.e., about 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 17-23, or 18-22 nucleotides in length. In certain embodiments, the target sequence is 20 nucleotides in length or approximately 20 nucleotides in length.

[0158] In some embodiments, epigenetic modifications at a targeted genomic locus can alter the accessibility of the targeted DNA site to a Cas protein. In some embodiments, the gRNA is located near the transcription start site and / or nucleosome. In one embodiment, the target sequence is located within about 5000, 2500, 2000, 1500, 1250, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, or 25 nucleotides of the transcription start site (e.g., at either the 5' or 3' end) of the targeted gene. In some embodiments, the target sequence overlaps with or is complementary to at least a portion of the transcription start site of the gene. In some embodiments, CRISPR targeting constructs are generated using publicly available software (CHOPCHOP, WU-CRISPR). Constructs (gRNAs that bind to specified DNA sequences) can be designed. Non-limiting examples of potential gRNA target sites for genes are shown in Tables 4 and 5.

[0159] [Table 4] TIFF2025143321000006.tif233161TIFF2025143321000007.tif232155

[0160] [Table 5] TIFF2025143321000009.tif247162TIFF2025143321000010.tif247162TIFF2025143 321000011.tif247162TIFF2025143321000012.tif247162TIFF2025143321000013.t if247162TIFF2025143321000014.tif247162TIFF2025143321000015.tif247162TIF F2025143321000016.tif247162TIFF2025143321000017.tif247162TIFF2025143321 000018.tif247162TIFF2025143321000019.tif247162TIFF2025143321000020.tif2 47162TIFF2025143321000021.tif247162TIFF2025143321000022.tif247162TIFF20 25143321000023.tif247162TIFF2025143321000024.tif247162TIFF2025143321000 025.tif247162TIFF2025143321000026.tif247162TIFF2025143321000027.tif24674

[0161] In one embodiment, a cell (such as a BRC, e.g., an SRC) transmits a Cas protein, a gRNA molecule, an RNP, and / or a Cas protein and / or a gRNA molecule across the cell's plasma membrane. The vector or vectors expressing the gRNA molecules are introduced (e.g., by electroporation). After being subjected to a procedure for delivery (by immunoglobulin or other method), at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 1-99%, or more of the population of cells are viable.

[0162] Various embodiments of the CRISPR-Cas system are known in the art. Non-limiting embodiments of this system are described, for example, in U.S. Patent No. 9,023,649, issued May 5, 2015; U.S. Patent No. 9,074,199, issued July 7, 2015; U.S. Patent No. 8,697,359, issued April 15, 2014; U.S. Patent No. 8,932,814, issued January 13, 2015; U.S. Application Publication No. 2016 / 0298096, published October 13, 2016; Cho et al., (2013) Nature Biotechnology Vol 31 No 3 pp 230-232 (including supplementary information); and Jinek et al., (2012) Science Vol 337 No 6096 pp 816-821, the contents of each of which are incorporated herein by reference in their entirety. It can be seen.

[0163] In the CRISPR / Cas nuclease system, the CRISPR locus encodes the RNA component of the system. The CRISPR loci of the microbial host encode for the CRISPR gene, while the Cas (CRISPR-associated) loci encode for proteins. The locus contains CRISPR-associated (Cas) genes and the specificity of polynucleotide cleavage by CRISPR. They contain a combination of non-coding RNA elements that have the ability to program heterogeneity.

[0164] Type II CRISPR is the best-characterized system, targeting genes in a series of four steps. First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat region of the pre-crRNA and mediates processing of the pre-crRNA into mature crRNAs containing their respective spacer sequences. Third, the mature crRNA:tracrRNA complex targets Cas9 to the target DNA by Watson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA adjacent to the protospacer adjacent motif (PAM). In the engineered CRISPR / Cas9 system, the gRNA, also referred to as the single guide RNA ("gRNA"), places the crRNA and tracrRNA in a single RNA construct containing the protospacer element and linker-loop sequence. The use of gRNAs is a necessary step in the use of CRISPR / Cas9 for genome editing. This simplifies the process. Cas9 species from different organisms have different PAM sequences. For example, Streptococcus pyogenes (Sp) has a PAM sequence of 5′-NGG-3′, Staphylococcus aureus (Sa) has a PAM sequence of 5′-NGRRT-3′ or 5′-NGRRN-3′, Neisseria meningitidis (NM) has a PAM sequence of 5′-NNNNGATT-3′, Streptococcus thermophilus (St) has a PAM sequence of 5′-NNAGAAW-3′, and Treponema denticola (Treponema denticola (Td) has a PAM sequence of 5'-NAAAAC-3'. Cas9 mediates cleavage of the target DNA, resulting in a DSB within the protospacer. The activity of the CRISPR / Cas system essentially involves three steps: (i) the exogenous DNA is cleaved to prevent future attacks in a process called "adaptation." (ii) inserting the sequences into the CRISPR array; (iii) expression of the associated proteins; and (iv) generating the array. expression and processing, followed by (iii) RNA-mediated disruption of the foreign polynucleotide. The foreign polynucleotide comes from a virus that attacks bacterial cells. Therefore, in bacterial cells, some of the so-called "Cas" proteins perform the natural function of the CRISPR / Cas system. CRISPR is involved in the function of inserting foreign DNA. Two genes in the Cpf2 family encode RuvC-like enzymes. Cpf1 contains the endonuclease domain of Cas9 but lacks the second HNH endonuclease domain of Cas9. Cpf1 cleaves DNA in a staggered pattern and requires only one RNA (tracrRNA and crRNA) rather than the two RNAs required for cleavage by Cas9. The preferred PAM of Cpf1 is 5'-TTN, which differs from the PAM of Cas9 (3'-NGG) in both genomic location and GC content. The mature crRNA for cleavage by Cpf1 is 42-44 nucleotides long, approximately the same size as that of Cas9, but precedes the spacer instead of following it. The Cpf1 crRNA also has a much simpler structure than Cas9; only a short stem-loop structure in the direct repeat is required for target cleavage. Cpf1 also does not require an additional trancrRNA. While Cas9 generates a blunt end 3 nt upstream of the PAM site, Cpf1 cleaves in a staggered manner, generating a 5' end 18-23 nt away from the PAM. CRISPR-associated proteins other than Cas9 can be used in place of Cas9. For example, CRISPR-associated protein 1 (Cas1) mediates CRISPR-mediated prokaryotic immune defense. Cas1 is one of two universally conserved proteins found in the mitochondrial system. Cas1 is a metal-dependent, DNA-specific endonuclease that generates double-stranded DNA fragments. It forms a stable complex with another universally conserved CRISPR-associated protein, Cas2, as part of the spacer acquisition for the CRISPR system.

[0165] There are also CRISPR / Cas9 variants that do not use PAM sequences, such as NgAgo, which works with a 24-nucleotide ssDNA guide and cuts 8–11 nucleotides from the start of this sequence. The ssDNA is loaded with proteins and is non-thermal. The guides are not exchanged for different guides unless the temperature is raised to a normal temperature of 55°C. A nucleotide is removed near the cut site. The technique using NgAgo is described in Gao, F. et al., DNA-guided Genome Editing Using the Natronobacterium Gregoryi Argonaute, 34 Nature Biotechnology 768 (2016), the entire contents of which are incorporated herein by reference. A DSB can be formed by making two single-strand breaks at different positions to create a cut DNA molecule with sticky ends. A single-strand break or "nick" is This can be formed by a modified version of the Cas9 enzyme that contains only one active catalytic domain (termed the "Cas9 nickase"). The Cas9 nickase still binds to DNA based on the specificity of the gRNA, but the nickase only has the ability to cleave one of the DNA strands. To create a DSB in the target DNA, two nickases targeting opposite strands are required (often referred to as a "double nick" or "dual nickase" CRISPR system). This requirement dramatically increases target specificity, but it also requires that nearby sites be in close enough proximity to cause a DSB. This is because the likelihood of two off-target nicks occurring within the same site is low. Techniques for using the dual nickase CRISPR system to generate DSBs are described in Ran, et al., Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity, 154 Cell 6:1380 (2013), the entire contents of which are incorporated herein by reference. can be.

[0166] Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Csel, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and homologous and modified forms thereof. These enzymes Known; for example, the amino acid sequence of the S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2 (SEQ ID NO: 1) and in the NCBI database under accession number Q99ZW2.1. Database accession numbers A0A0G4DEU5 and CDJ55032 provide another example of a Cas9 protein amino acid sequence (SEQ ID NO: 2). Another non-limiting example is the Cas9 protein of Streptococcus The Streptococcus thermophilus Cas9 protein, the amino acid sequence of which can be found in the UniProt database under accession number Q03JI6.1. (SEQ ID NO: 3). In one embodiment, the unmodified CRISPR enzyme can be In one embodiment, the CRISPR enzyme is Cas9, which may be Cas9 derived from S. pyogenes or S. pneumoniae. In embodiments, the CRISPR enzyme directs a single- or double-stranded cut at the location of the target sequence, e.g., within the target sequence and / or within the complementary strand of the target sequence. In some embodiments, the CRISPR enzyme is located at the first or last nucleotide of the target sequence. The vector directs single- or double-stranded cleavage within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the nucleotide of interest. In some embodiments, the vector encodes a CRISPR enzyme that is mutated relative to the corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave single or double strands of a target polynucleotide containing the target sequence. For example, the RuvC I catalyzes the RuvC I catalyzed cleavage of S. pyogenes Cas9. An aspartate to alanine substitution (D10A, the amino acid numbering of which is as shown in SEQ ID NO: 1) in the mediator domain transforms Cas9 from a double-strand cleaving nuclease. , converting it into a nickase (which makes single-strand cleavages). Other examples of mutations that make Cas9 a nickase include, but are not limited to, H840A, N854A, and N863A (these amino acid numbering (The sequence is shown in SEQ ID NO: 1.) In one embodiment, the genome is transformed by homologous recombination. Nickase can be used for editing.

[0167] In one embodiment, the Cas9 nickase is linked to one or more guide sequences, e.g., This can be used in combination with two guide sequences that target the sense and antisense strands of a DNA target, respectively, to create a nick in the duplex and then use it to induce NHEJ.

[0168] In some embodiments, genetic engineering is achieved using a base editing protein. In some embodiments, the base editing protein creates a double-stranded DNA break (initially or otherwise). engineered proteins (Cas proteins) that catalyze transitions and transversions of one base to another (e.g., A to T, C to G, etc.) without the need for induction CRISPR / Cas systems comprising base editor Cas proteins represent the next generation of CRISPR systems. Non-limiting examples of such systems include: Remarkable examples are shown in Gaudelli et al. (2017) Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage, Nature volume 551, pages 464-471; and Gehrke et al. (2018) High-precision CRISPR-Cas9 base editors with minimized bystander and off-target mutations, bioRxiv 273938; doi: https: / / doi.org / 10.1101 / 273938. In one embodiment, the base editing protein mediates the conversion of A·T to G·C in genomic DNA. In one embodiment, the base editing protein is an adenine base editor (ABE). The protein is fused to a catalytically impaired CRISPR-Cas mutant (e.g., a CRISPR-Cas9 mutant). In some embodiments, the base editing protein comprises an adenosine deaminase engineered to act on genomic DNA (e.g., an RNA adenosine deaminase engineered to act on DNA). It is a cytidine base editor (ABE) that mediates the conversion of C·G to T·A in some cases. In some embodiments, the base editing protein comprises a Cas9 nuclease having a mutation that converts the Cas9 nuclease into a nickase, fused to an Apolipoprotein B Editing Complex (APOBEC) (e.g., rat APOBEC1 or human APOBEC3A (A3A) cytidine deaminase) and a uracil glycosylase inhibitor (UGI). In some embodiments, the RNA or DNA base editor is a Cas variant other than a Cas9 variant. Various gene editing proteins and Cas variants can be used for base editing, including, for example, Cas13 variants.

[0169] In one embodiment, the gene editing protein (ZFN, MegaTAL, or Cas) being delivered A fusion protein (e.g., a Cas9 protein) may contain or be fused with a subcellular localization signal, constituting a gene editing fusion protein. Depending on the context, for example, a fusion protein containing Cas9 and a nuclear localization signal may be referred to herein as "Cas9" without specifying that it contains a nuclear localization signal. In some embodiments, the fusion protein may contain a nuclear localization signal. In some embodiments, the Cas9 protein may contain a nuclear localization signal. A protein may contain more than one localization signal, for example, 2, 3, 4, 5, or 6 or more nuclear localization signals. In some embodiments, the localization signal is a Cas protein. In other embodiments, the localization signal is at the N-terminus of the Cas protein. .

[0170] Non-limiting examples of nuclear localization signals include GGSGPPKKKRKV (SEQ ID NO: 4), PKKKRKV (SEQ ID NO: No. 5), KR[PAATKKAGQA]KKKK (SEQ ID NO: 6), KR[XXXXXXXXXX]KKKK (SEQ ID NO: 7), KKXK (SEQ ID NO: 8), KRXK (SEQ ID NO: 9), KKXR (SEQ ID NO: 10), KRXR (SEQ ID NO: 11), AVKRPAATKKAGQAKKKKLD (SEQ ID NO: 12), MSRRRKANPTKLSENAKKLAKEVEN (SEQ ID NO: 13), PAAKRVKLD (SEQ ID NO: 14), PPKKKRKV (SEQ ID NO: 15), and KLKIKRPVK (SEQ ID NO: 16).

[0171] In certain embodiments, the enzyme coding sequence encoding the CRISPR enzyme is optimized for expression in a particular cell, e.g., a mammalian cell, e.g., a human cell.

[0172] Generally, a guide sequence is any polynucleotide sequence that has sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In certain embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence is about 90%, 95%, 97.5%, 98%, 99%, or more when optimally aligned using a suitable alignment algorithm. and greater. In some embodiments, the degree of complementarity is 100%. Optimal alignment can be determined using any algorithm suitable for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.)), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, the guide sequence is about 15, 16, 17, 18, 19, 20, or more nucleotides in length. The length of the guide sequence is less than about 30, 25, 20, 15, or fewer nucleotides. The ability of a guide sequence to direct the sequence-specific binding of a CRISPR complex to a target sequence can be evaluated by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, can be provided to a host cell having a corresponding target sequence, for example, by transfection with a vector encoding the components of the CRISPR sequence, and then selective cleavage within the target sequence can be evaluated. Similarly, cleavage of a target polynucleotide sequence can be evaluated in vitro by providing the target sequence, the components of the CRISPR complex, including the test guide sequence and a control guide sequence different from the test guide sequence, and comparing the binding or cleavage rate at the target sequence between the reaction of the test guide sequence and the reaction of the control guide sequence.

[0173] The guide sequence can be selected to target any target sequence. In some embodiments, the target sequence is a sequence within the genome of a cell. In some embodiments, the target sequence is unique in the target genome.

[0174] In one embodiment, ZFNs are used to genetically modify cells. ZFNs are artificial restriction enzymes created by fusing a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain is designed to target specific desired DNA sequences. This allows zinc finger nucleases to target unique sequences within complex genomes. These reagents can be used to precisely alter the genomes of higher animals. Along with Cas9 and TALEN proteins, ZFNs are becoming prominent tools in the field of genome editing. Zinc finger nucleases bind and cleave DNA at specific locations. It is a site-specific endonuclease designed to The first domain is a DNA binding domain, which contains a eukaryotic transcription factor and a zinc finger. The second domain is a nuclease domain, This includes restriction enzymes (such as FokI) that cause catalytic DNA cleavage. The DNA binding domain of each ZFN typically contains 3 to 6 individual zinc finger repeats, each capable of recognizing 9 to 18 base pairs. If the zinc finger domains are perfectly specific for the intended target site, a pair of three-finger ZFNs recognizing the entire 18 base pairs can target a single locus in the mammalian (e.g., human) genome. In some embodiments, small zinc finger "modules" with known specificities are combined. In some embodiments, the module assembly process involves combining three distinct zinc finger domains, each capable of recognizing a three-base pair DNA sequence. The method involves combining fingers to create a three-finger array capable of recognizing a nine-base pair target site. In one embodiment, a non-specific cleavage domain derived from the type II restriction endonuclease FokI is used as the cleavage domain in ZFNs. This cleavage The domains must dimerize in order to cleave DNA. In one embodiment, a pair of ZFNs is used to target a non-palindromic DNA site. The cleavage domain is fused to the C-terminus of each zinc finger domain. In this mode, two individual ZFNs bind to opposite strands of DNA with their C-termini spaced a fixed distance apart.

[0175] TALENs are restriction enzymes that can be engineered to cleave specific sequences in DNA. TALENs are engineered by combining a TAL effector DNA-binding domain with a DNA-cleavage domain (i.e., a domain that cleaves DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind virtually any desired DNA sequence. When combined with a nuclease, it can cut DNA at specific positions. Restriction enzymes can be introduced into cells for gene editing or for in situ genome editing. The DNA binding domain can be a highly cleavable domain with diverse amino acids at positions 12 and 13. These two positions, called repeat variable dinucleotides (RVDs), are highly variable and show a strong correlation with specific nucleotide recognition. The direct relationship between amino acid sequence and DNA recognition has made it possible to engineer specific DNA-binding domains by selecting combinations of repeat segments containing appropriate RVDs. In particular, subtle changes in the RVD and the incorporation of "non-conventional" RVD sequences can improve targeting specificity. Those skilled in the art will know how to design and use TALENs to generate DSBs in dsDNA at desired target sites. Hermann, M. et al., Mouse Genome Engineering Using Designer Nucleases, 86 J. Vis. Exp. 50930 (2014) and Sakuma, T. et al., Efficient TALEN Construction and Evaluation Methods for Human Cell and Animal Applications, 18(4) Genes Cells 315 (2013) , suitable protocols are available.

[0176] Mega-TALs are derived from the combination of two different enzymes that target DNA. Homing endonucleases (also called homing endonucleases) contain DNA recognition domains within the same domain. Meganucleases are single peptide chains that combine the advantages of both DNA double-strand cleavage and nuclease function. However, the target recognition of meganucleases is difficult to modify, and they often exhibit low specificity and lower on-target cleavage efficiency than other genome-targeting endonucleases. Transcription activator-like (TAL) effectors bind separate DNA endonucleases to achieve targeted DNA double-strand cleavage. In contrast to meganucleases, they are DNA recognition proteins linked to a nuclease domain. Conversely, TALs are easily engineered to target specific DNA sequences. MegaTALs combine a TAL effector with a meganuclease, where the DNA-binding domain of the TAL effector is used to "address" the site-specific meganuclease next to a single desired genomic target site. A non-limiting description of megaTALs is provided in Boissel et al. (2014) Nucleic Acids Research 42(4):2591-2601, the entire contents of which are incorporated herein by reference. No. 6,299,499, which is incorporated herein by reference.

[0177] Aspects herein relate to the modification of genomic immunogenic genes, for example, by mutation (e.g., insertion, deletion, or point mutation). In certain embodiments, the genes encode components of MHC-I. In one embodiment, the gene encodes a component of MHC-II. Non-limiting examples of genomic immunogenic genes include B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, and / or HLA-DQB1. Many variants of such genes naturally exist, for example, in humans.

[0178] In some embodiments, the genetic modification is not a genomic modification. In some embodiments, small interfering molecules and small hairpin RNAs are used to mediate gene silencing. In one embodiment, the native genome is not altered, but rather RNAi occurs at the RNA level. It may work to reduce or stop the expression of target genes such as B2M or HLA-A, thereby achieving a similar end result to gene editing.

[0179] Genetically engineered kidney cell populations One primary object of the present invention is to provide a non-alloreactive kidney protein for use in treating chronic kidney disease. The method for manipulating cells, particularly BRCs (e.g., SRC populations), employs previously described gene editing techniques (e.g., CRISPR / Cas9). The composition enhances the immunocompatibility (immune privilege) of donor cells (e.g., BRCs, such as SRCs) for transplantation into a recipient subject, and is therefore referred to as a "universal donor." This ensures the availability of "allogenic" kidney cell populations, allowing "allogeneic" kidney cells to be administered to patients without immunosuppression. This can be achieved by targeted inactivation or modification of one or more immunogenic genes (e.g., HLA genes) of the cells, resulting in donor cells suitable for transplantation into a recipient subject.

[0180] The discovery and application of the CRISPR / Cas9 system in mammalian cells has led to the development of, for example, non-homologous end-targeting. It has proven to be an effective and precise means for editing targeted genes by non-hepatic end-joining (NHEJ), homology-directed repair (HDR), or other DNA repair pathways. Co-delivery of Cas9 molecules and target-specific guide RNA (gRNA) molecules, along with donor DNA repair template molecules if necessary, facilitates gene editing of target sequences within the genome. Thus, the use of the CRISPR / Cas9 system to modify genes in cells has potential applications for treating multiple genetic disorders. For further details, see, for example, Sanders and Joung, Nature Biotechnology 32, 347-355 (2014).

[0181] In one embodiment, a particular HLA allele is identified by combining a Cas9 molecule and at least one target-specific guide RNA (gRNA) that targets an endogenous immunogenic gene with a cell described herein. The cells produced using the methods and compositions described herein are less likely to induce an immune response in a recipient subject upon transplantation and / or are less likely to induce an immune response in a recipient subject upon transplantation. The ability to improve the immune compatibility of donor cells, which can be customized to be transplanted into any donor subject, regardless of the donor's immunogenic gene haplotype, is particularly advantageous, as it dramatically increases the donor cell pool that can be used in the cell therapy field for numerous clinical applications.

[0182] Inactivating a gene means that the gene is not expressed in the form of a functional protein. In one embodiment, the genetic modification of the method relies on the expression of an RNA-guided endonuclease in the cell provided for manipulation, and the endonuclease The enzyme catalyzes cleavage in one target gene, thereby inactivating the target gene. Nucleic acid strand breaks caused by endonucleases are usually repaired by different mechanisms: homologous recombination or non-homologous end joining (NHEJ). However, NHEJ is an incomplete repair process that often results in changes in the DNA sequence at the break site. The mechanism is either direct religation (Critchlow and Jackson 1998) or so-called microhomology-mediated end joining (Betts, Brenchley et al. 2003; Ma, Kim et al. 2003). Repair by non-homologous end joining (NHEJ) often results in small insertions or deletions and can be used to generate knockouts of specific genes. The modification can be a substitution, deletion, or deletion of at least one nucleotide. Cells in which a mutagenesis event caused by a break, i.e., a mutagenesis event subsequent to an NHEJ event, has occurred can be identified and / or selected by methods well known to those skilled in the art. In some embodiments, a base-editing CRISPR protein is used that does not introduce DNA breaks (e.g., double-stranded DNA breaks). In some embodiments, In this study, base editing proteins introduce double-stranded DNA breaks (either initially or later). In one embodiment, the Cas protein catalyzes transitions and transversions of one base to another (e.g., A to T, C to G, etc.) without the need for a nucleotide sequence. In one embodiment, the base editing protein comprises an adenosine deaminase fused to a catalytically impaired CRISPR-Cas mutant (e.g., a CRISPR-Cas9 mutant). Base editing proteins include those from the Apolipoprotein B Editing Complex (APOBEC) (e.g., rat APOBEC1 or human APOBEC3A (A3A) cytidine Cas9 nuclease fused to a uracil deaminase (GC) and a uracil glycosylase inhibitor (UGI) The Cas9 nuclease contains a mutation that converts the nuclease into a nickase (nCas9). In embodiments, the RNA or DNA base editor is a Cas variant other than a Cas9 variant. In some embodiments, the base editing protein is , a Cas13 variant that acts specifically on RNA.

[0183] In one embodiment, the expression of one or more endogenous immunogenic genes of kidney cells is A method for reducing expression of a gene encoding a gene encoding a first allele is provided, the method comprising: the allele-specific gRNA molecule and Cas9 molecule bind to a first allele of the endogenous immunogenic gene, thereby activating the endogenous immunogenic gene. In one embodiment, the cell surface expression of the first allele of the virulence gene is reduced. by contacting the cell population with a modified gRNA molecule specific for the first allele and a Cas9 molecule. In accordance with the present invention, a method for providing an engineered immunocompatible renal cell population is provided. The allele-specific modified gRNA molecule and Cas9 molecule are directed to a first allele of the endogenous immunogenic gene. thereby modifying the first allele of the endogenous immunogenic gene to provide immune compatibility. Renal cell populations are provided. In some embodiments, the genetically modified renal cells have a reduced likelihood of rejection by the recipient subject based on increased matching between donor and recipient cells and reduced immunogenicity as measured by a mixed lymphocyte or leukocyte reaction assay. In some embodiments, the methods described herein involve the use of one or more alleles. The first, second, third, and fourth gene fragments are generated using one or more gRNA molecules and Cas9 molecules specific for the gene fragment. , to change the fifth, sixth, seventh, eighth, ninth, tenth allele, or multiple alleles, In some embodiments, altering an allele using the methods described herein can result in inactivation of the altered allele. In some embodiments, the method further includes contacting the cell or cell population with a second Cas9. That's fine.

[0184] In one embodiment, the cell population is treated with at least one target-specific gRNA molecule and a Cas9 molecule. In one embodiment, an ex vivo method is provided for producing a composition containing a cell population enriched for a particular genetic modification by contacting a cell with a target-specific gRNA molecule and a Cas9 molecule, wherein the target-specific gRNA molecule and the Cas9 molecule bind to a gene encoding an identifiable gene product; and enriching for cells lacking expression of the identifiable gene product. In the methods described herein, the step of enriching for cells expressing the gene product may include cell sorting using, for example, FACS or MACS. In certain embodiments, the ex vivo method includes enriching for a population of cells with an allele-specific genetic modification, wherein the allele-specific genetic modification is enriched for the cell. the allele-specific gRNA molecule and the Cas9 molecule bind to a single allele of a gene encoding an identifiable gene product; and In one embodiment, the step of enriching for cells that express the gene but do not express the first allele comprises enriching for cells that express the gene but do not express the first allele by enriching for cells that express the gene but do not express the first allele. In some embodiments, the method may involve contacting a gene encoding the gene with a first antibody that specifically binds to a first variant of an identifiable gene product encoded by a first allele of the gene, and a second antibody that binds to a second variant of the identifiable gene product. The step of enriching for cells that express the first allele but not the second allele comprises enriching for each of the plurality of cells. This may include detecting a substance or signal associated with a functional variant of the identifiable gene product in the cell. The cell population may be a population of bioactive kidney cells.

[0185] The methods described herein can optionally further comprise selecting cells expressing a particular allele of the gene by sorting the cell population with an allele-specific antibody. In some embodiments, the cell population can be sorted by fluorescence-activated cell sorting (FACS) or immunomagnetic microbead cell sorting. In some embodiments, the method further comprises obtaining a series of cells to confirm the alteration.

[0186] In some embodiments, the gene can be an immunogenic gene. In some embodiments, the identifiable gene product can be a cell surface marker. In some embodiments, the identifiable gene product can be a human leukocyte antigen (HLA). In embodiments, the identifiable gene product can be a major histocompatibility complex protein or major histocompatibility antigen (MiHA or mHA) (e.g., a chemokine receptor). Non-limiting examples of mHA include: TIFF2025143321000028.tif6843

[0187] Although genetic polymorphisms can give rise to minor histoincompatibilities, the number of genes encoding minor antigens is limited. Approximately 10 minor antigens on the autosomes have been identified out of the 100 or so that exist. The Y chromosome also carries a gene encoding mHA. Identification The first minor histocompatibility peptide identified was HA-2, a graft-versus-host disease-associated mHA. The most studied of all mHAs is the HY antigen. In certain embodiments, gRNA molecules can contain a targeting domain complementary to the target domain of an mHA gene. In certain embodiments, gRNA molecules can contain a targeting domain complementary to the target domain of an HA-1, HA-2, HA-8, HB-1, HY-A1, HY-A2, HY-B7, HY-B8, HY-B60, or HY-DQ5 gene.

[0188] In one embodiment, the gRNA molecule is a targeting gene complementary to a target domain of an HLA gene. HLA genes can contain a specific domain. HLA genes include HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DRB3 / 4 / 5, HLA-DQ family genes (e.g., HLA-DQA1 and / or HLA-DQB1), and HLA-DP family genes (e.g., HLA-DPA1 and / or HLA-DPA2). The compound can be selected from a group of compounds.

[0189] In certain embodiments, the cells or cell populations can be primary renal cells or selected renal cell populations. In certain embodiments, the cell populations can be heterogeneous or homogeneous cell populations.

[0190] In one embodiment, one or more targeted HLA genes are mutated by CRISPR / Cas9 activity. To verify that the donor cells were inactivated by the targeting agent, one or more The alteration of multiple allele sequences or the expression of one or more alleles can be detected by conventional methods (e.g., For example, PCR specific for one or more alleles, qRT-PCR, or flow cytometry can be used to assay for HLA expression. In one embodiment, donor cells with or without genome editing can be co-cultured with NK cells, and cytolytic activity directed against the donor cells can be used to determine downregulation of HLA expression. After validation, cells in which one or more mismatched donor HLA alleles have been inactivated and / or cells in which one or more matched recipient HLA alleles have been introduced are used. The modified cells can be enriched, isolated, or purified from unmodified cells by conventional selection methods.

[0191] cell aggregates In some aspects, the formulations herein contain cell aggregates or spheroids. In some embodiments, the cell aggregates comprise a bioactive cell population described herein. In some embodiments, the cell aggregates include bioactive renal cells, such as renal cell mixtures, enriched renal cell populations, and combinations of renal cell fractions and renal cell mixtures with mesenchymal stem cells, endothelial progenitor cells, cells derived from adipose stromal vascular cells, or any other non-renal cell population, without limitation.

[0192] In certain embodiments, the bioactive kidney cells herein can be cultured in a 3D format as further described in this section. In certain embodiments, the term "organoid" refers to a collection of cells with a phenotype and / or function that recapitulates aspects of a native kidney. In some embodiments, organoids contain a mixed population of cells of different lineages, which are typically found in vivo within a given tissue. In this embodiment, the organoid herein can be formed by any method in vitro, and the cells herein can form aggregates by this method, which can then form spheroids, organoids, or a combination thereof.In certain embodiments, such aggregates, spheroids, or organoids exhibit a structure that matches a specific organ.In some embodiments, such aggregates, spheroids, or organoids express surface markers that are typically expressed by cells of a specific organ.In certain embodiments, such aggregates, spheroids, or organoids produce compounds or materials that are typically expressed by cells of a specific organ.In some embodiments, the cells herein can be cultured on natural substrates, such as gelatin.In some embodiments, the cells herein can be cultured on synthetic substrates, such as PLGA.

[0193] Biomaterials Various biomaterials can be combined with active agents to form the therapeutic formulations herein. In certain embodiments, the biomaterial can take any suitable form (e.g., beads) or shape (e.g., liquid, gel, etc.). Suitable biomaterials in the form of polymer matrices are described in Bertram et al. US Published Application 20070276507, which is incorporated herein by reference in its entirety. In certain embodiments, the polymer matrix or scaffold can be fashioned into any number of desirable shapes to satisfy any number of overall system, shape, or space constraints. In some embodiments, the biomaterial is in the form of a liquid suspension. In certain embodiments, the matrix or scaffold herein is three-dimensional and can be attached to an organ. For example, in the use of polymeric scaffolds to treat kidney disease, tubular transport defects, or glomerular filtration defects, three-dimensional (3-D) matrices can be used that replicate aspects or the entirety of native kidney tissue structure and organization, as well as that of the renal parenchyma.

[0194] A variety of different shaped 3-D scaffolds can be used. Of course, the polymer matrix The polymer matrix can be shaped into a variety of sizes and shapes to accommodate different sized patients. The polymer matrix may also be shaped in other ways to meet the specific needs of the patient. In certain embodiments, the polymer matrix or scaffold can be a biocompatible material (e.g., a porous polymeric scaffold). Scaffolds can be formed from a variety of synthetic or naturally occurring materials, including open-cell polylactic acid (OPLA®), cellulose ethers, cellulose, cellulose esters, fluorinated polyethylene, phenolics, poly-4-methylpentene, polyacrylonitrile, polyamides, polyamide ions, and the like. Examples of suitable scaffolds include, but are not limited to, polyamides, polyacrylates, polybenzoxazoles, polycarbonates, polycyanoaryl ethers, polyesters, polyestercarbonates, polyethers, polyetheretherketones, polyetherimides, polyetherketones, polyethersulfones, polyethylenes, polyfluoroolefins, polyimides, polyolefins, polyoxadiazoles, polyphenylene oxides, polyphenylene sulfide, polypropylene, polystyrenes, polysulfides, polysulfones, polytetrafluoroethylenes, polythioethers, polytriazoles, polyurethanes, polyvinyls, polyvinylidene fluoride, regenerated cellulose, silicones, urea-formaldehyde, collagens, gelatin, alginates, laminins, fibronectin, silk, elastin, alginates, hyaluronic acid, agarose, or copolymers or physical blends thereof. Scaffold morphology can vary widely, from soft porous scaffolds to rigid, shape-retaining porous scaffolds. In some embodiments, the scaffold is configured as a liquid solution that can become a hydrogel, for example, a hydrogel that is above its melting point.

[0195] In one embodiment, the scaffold is derived from an existing kidney or other organ of human or animal origin, where the native cell population is present in a surfactant and / or a surfactant known to those skilled in the art. In this embodiment, the native three-dimensional structure of the source organ is maintained without any associated endothelial cells or tissues. In one embodiment, the scaffold is an extracellular matrix obtained from human or animal kidneys or other organs. In one embodiment, the configuration is a three-dimensional bioprinted structure. By applying a coating method, the configuration is constructed into a tissue-like structure. In some embodiments, the configuration is in the liquid form of a solution that can be a hydrogel.

[0196] In certain embodiments, the biomaterial is a hydrogel. Hydrogels are formed from a variety of polymeric materials and are useful in a variety of biomedical applications. Hydrogels can be physically described as a three-dimensional network of hydrophilic polymers. Depending on the type of hydrogel, they contain various percentages of water, but are completely insoluble in water. Despite their high water content, hydrogels are easily dissolved in water due to the presence of hydrophilic residues. Because of this, they can further bind large amounts of liquid. Hydrogels can swell significantly without changing their gelatinous structure. The basic physical properties of hydrogels can be individually modified depending on the nature of the polymers used and the device used to administer the hydrogel.

[0197] Preferably, the hydrogel material does not induce an inflammatory response. Examples of other materials that can be used to form hydrogels include (a) modified alginate, (b) monovalent cations, and (c) hydroxybenzoates. Examples of suitable hydrogel polymer precursors include polysaccharides that gel upon exposure to hydroxybenzoates (e.g., gellan gum and carrageenan), (c) polysaccharides that are highly viscous liquids or thixotropic, gradually forming gels by slow evolution of structure (e.g., hyaluronic acid), (d) gelatin or collagen, and (e) hydrogel polymer precursors (e.g., polyethylene oxide-polypropylene glycol block copolymers and proteins). U.S. Pat. No. 6,224,893 B1 discloses suitable hydrogel polymer precursors for making hydrogels according to the present invention. , provides a detailed description of various polymers and the chemical properties of such polymers.

[0198] In certain embodiments, the hydrogels used to prepare the biomaterials herein are gelatin-based. Gelatin is a non-toxic, biodegradable, water-soluble protein derived from collagen, a major component of the mesenchymal extracellular matrix (ECM). Collagen is the major structural protein in the extracellular space within various connective tissues in animals. As the main component of connective tissue, it is the most abundant protein in mammals, comprising 25% to 35% of the total body protein content. Depending on the degree of mineralization, collagen tissues can be stiff (bone), flexible (tendon), or varying degrees of stiffness and flexibility (cartilage). Collagen, in the form of elongated fibrils, is found primarily in fibrous tissues such as tendons, ligaments, and skin. Collagen is also abundant in the cornea, cartilage, bone, blood vessels, the digestive tract, intervertebral discs, and the dentin of teeth. In muscle tissue, collagen serves as the main component of the endomysium. Collagen constitutes 1-2% of muscle tissue. It accounts for 6% of the weight of strong, tendinous muscle. Collagen is found in many places throughout the body. However, more than 90% of the collagen in the human body is type I.

[0199] To date, 28 types of collagen have been identified and described. These collagens can be divided into several groups according to the structure they form: fibrillar (types I, II, III, V, XI), non-fibrillar FACIT (fibril-associated collagens with interrupted triple helices) (types IX, XII, XIV, XVI, XIX), short chain (types VIII, X), basement membrane (type IV), and multi-chain collagens. Rexin (multiple triple helical domains with multiple interruptions) (types XV and XVIII), MACIT (membrane-bound collagen with interrupted triple helices) (types XIII and XVII), others (types VI and VII) The five most common types are: Type I: skin, tendons, blood vessels, ligaments, organs, and bone (the main component of the organic part of bone); Type II: cartilage (the main collagen component of cartilage); and Type III: reticular (the main component of reticular fibers). ) and usually coexists with type I; type IV: basal layer, which forms a layer of basement membrane secreted by the epithelium Type V: cell surface, hair and placenta.

[0200] Gelatin contains information signals containing the arginine-glycine-aspartic acid (RGD) sequence. It has a high molecular weight, which promotes cell adhesion, proliferation, and stem cell differentiation. A distinctive property of gelatin is that it exhibits upper critical solution temperature behavior (UCST). Above a certain temperature threshold of 40°C, it can dissolve in water by forming a flexible random single coil. Upon cooling, hydrogen bonding and van der Waals interactions occur, resulting in the formation of triple helices. These collagen-like triple helices act as junction zones, thus inducing the sol-gel transition. Gelatin is widely used in pharmaceutical and medical applications. It is widely used.

[0201] In certain embodiments, the hydrogels used to formulate the injectable cell compositions herein are based on porcine gelatin, which can be sourced from pig skin and are available from, for example, Nitta Gelatin NA Inc. (NC, USA) or Gelita USA Inc. (IA, USA). Gelatin is commercially available from Biosciences, Inc. Gelatin can be dissolved, for example, in Dulbecco's phosphate-buffered saline (DPBS) to form a thermoresponsive hydrogel, which may gel and liquefy at various temperatures. In certain embodiments, the hydrogels used to formulate the injectable cell compositions herein are based on recombinant human or animal gelatin, expressed and purified by methods known to those skilled in the art. In certain embodiments, an expression vector containing all or part of the cDNA for human type I, alpha I collagen, is expressed in the yeast Pichia pastoris. Other expression vector systems and In certain embodiments, the gelatin-based hydrogels herein are liquid at or above room temperature (22-28°C) and gel upon cooling to refrigeration temperatures (2-8°C).

[0202] Those skilled in the art will appreciate that other types of synthetic or naturally occurring materials known in the art can be used to form the scaffolds described herein.

[0203] In one embodiment, the biomaterial used in accordance with the present invention comprises hyaluronic acid (HA) in the form of a hydrogel, which has a molecular weight of 5.1 kDa to >2 x 105 kDa. HA contains hyaluronan molecules that span the entire cell lineage. Hyaluronan is essential for the branching morphogenesis and three-dimensional autonomy of associated bioactive cell populations. In one embodiment, the biomaterial used in accordance with the present invention comprises hyaluronic acid in the form of a porous foam, also comprising HA molecules with molecular weights ranging from 5.1 kDa to >2 x 105 kDa. In one embodiment, the hydrogel is In yet another embodiment, the biomaterial used in accordance with the present invention is derived from or contains an extracellular matrix sourced from, but not limited to, the kidney or any other tissue or organ. The base foam has an open cell structure with pore sizes ranging from about 50 microns to about 300 microns.

[0204] Temperature-Sensitive Biomaterials The biomaterials described herein can be used to, for example, induce certain They can also be designed or configured to respond to external conditions. In some embodiments, the biomaterial is temperature sensitive (e.g., in vitro or in vivo). In embodiments, the biomaterial may be an enzyme-linked biomaterial (e.g., in vitro or in vivo). The biomaterial is configured to respond to exposure to a solution. The biomaterial's response to external conditions can be fine-tuned as described herein. The temperature sensitivity of the described formulations can be varied by adjusting the proportion of biomaterial in the formulation. For example, the proportion of gelatin in the solution can be adjusted to control the temperature sensitivity of the gelatin in the final formulation (e.g., liquid, gel, beads, etc.). Alternatively, the biomaterial can be chemically crosslinked to increase its resistance to enzymatic degradation. For example, gelatin beads can be chemically crosslinked using a carbodiimide crosslinker to reduce their susceptibility to endogenous enzymes.

[0205] In some aspects, the formulations described herein incorporate a biomaterial that has properties that create a favorable environment for administering an active agent, such as bioactive renal cells, to a subject. In some embodiments, the formulation incorporates a first biomaterial that provides a favorable environment from the time the active agent is formulated with the biomaterial until the time of administration to a subject. In certain embodiments, the preferred environment relates to the advantages of suspending the bioactive cells in a substantially solid state versus cells in a liquid (as described herein) prior to administration to a subject. In certain embodiments, the first biomaterial is a temperature-sensitive biomaterial. Temperature-sensitive biomaterials are those that (i) remain substantially solid at temperatures below 8°C, and (ii) may have a substantially liquid state at or above ambient temperature. The outside temperature is almost room temperature.

[0206] In certain embodiments, the biomaterial is in at least two different phases or states. The present invention relates to a temperature-sensitive biomaterial that can maintain a first state at a first temperature, a second state at a second temperature, and / or a third state at a third temperature. The first, second, or third state can be a substantially solid, a substantially liquid, or a substantially semi-solid or semi-liquid state. In certain embodiments, the biomaterial adopts the first state at a first temperature and the second state at a second temperature, where the first temperature is lower than the second temperature.

[0207] In certain embodiments, the state of the temperature-sensitive biomaterial is at a temperature of 8° C. or less. In one embodiment, the substantially solid state is at about 1° C. It is maintained at about 2°C, about 3°C, about 4°C, about 5°C, about 6°C, about 7°C, or about 8°C. In some embodiments, the substantially solid state is in the form of a gel. In some embodiments, the temperature-sensitive biomaterial is in a substantially liquid state at or above ambient temperature. In some embodiments, the substantially liquid state is maintained at about 25°C, about 25.5°C, about 26°C, about 26.5°C, about 27°C, about 27.5°C, about 28°C, about 28.5°C, about 29°C, about 29.5°C, about 30°C, about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, or about 37°C. In some embodiments, the ambient temperature is about room temperature.

[0208] In some embodiments, the temperature-sensitive biomaterial is in a substantially solid state at a temperature at or below about ambient temperature. In some embodiments, the ambient temperature is about room temperature. In some embodiments, the substantially solid state is maintained at about 17°C, about 16°C, about 15°C, about 14°C, about 13°C, about 12°C, about 11°C, about 10°C, about 9°C, about 8°C, about 7°C, about 6°C, about 5°C, about 4°C, about 3°C, about 2°C, or about 1°C ... In certain embodiments, the temperature-sensitive biomaterial is in a substantially liquid state at temperatures above about 37°C. In certain embodiments, the substantially solid state is maintained at about 37°C, about 38°C, about 39°C, or about 40°C.

[0209] The temperature sensitive biomaterial may be provided in solution form, in solid form, in bead form, or in any other suitable form as described herein and / or known to those of skill in the art. The cell populations and preparations described herein may be coated with, deposited on, embedded in, attached to, seeded (embedded), suspended in, or entrapped in a temperature-sensitive biomaterial. In certain embodiments, the cell populations described herein may be assembled as three-dimensional cell aggregates or organoids, or three-dimensional tubular structures, before forming a complex with the temperature-sensitive biomaterial, or may be assembled as described above when forming a complex with the temperature-sensitive biomaterial. Alternatively, the temperature-sensitive biomaterial may be provided without cells, for example, in the form of spacer beads. In this embodiment, the temperature-sensitive biomaterial functions in a purely passive role, creating space within the target organ for regenerative biological activity, such as angiogenesis, or the infiltration and migration of host cell populations.

[0210] In some embodiments, the temperature-sensitive biomaterial undergoes a transition state between a first state and a second state. In some embodiments, the transition state occurs when the temperature is between about 8° C. and about ambient temperature. In certain embodiments, the ambient temperature is about room temperature. In certain embodiments, the solid to liquid transition state is at any one of about 8°C, about 9°C, about 10°C, about 11°C, about 12°C, about 13°C, about 14°C, about 15°C, about 16°C, about 17°C, and about 18°C. or occurs at multiple temperatures.

[0211] A temperature-sensitive biomaterial has a constant viscosity, measured in centipoise (cP), at a given temperature. In certain embodiments, the biomaterial has a viscosity at 25° C. of about 1 cP to about 5 cP, about 1.1 cP to about 4.5 cP, about 1.2 cP to about 4 cP, about 1.3 cP to about 3.5 cP, about 1.4 cP to about 3.5 cP, about 1.5 cP to about 3 cP, about 1.55 cP to about 2.5 cP, or about 1.6 cP to about 2.5 cP. The biomaterial has a viscosity of about 1.0 cP to about 2 cP. In certain embodiments, the biomaterial has a viscosity of about 1.0 cP to about 1.15 cP at 37° C. The viscosity at 37° C. can be about 1.0 cP, about 1.01 cP, about 1.02 cP, about 1.03 cP, about 1.04 cP, about 1.05 cP, about 1.06 cP, about 1.07 cP, about 1.08 cP, about 1.09 cP, about 1.10 cP, about 1.11 cP, about 1.12 cP, about 1.13 cP, about 1.14 cP, or about 1.15 cP. In certain embodiments, the biomaterial is a gelatin solution. The gelatin is present in the solution at about 0.5%, about 0.55%, about 0.6%, about 0.65%, about 0.7%, about 0.75%, about 0.8%, about 0.85%, about 0.9%, about 0.95%, or about 1% (w / v). The gelatin solution is a 0.75% (w / v) gelatin solution in PBS. In one embodiment, this 0.75% (w / v) The solution has a viscosity of about 1.6 cP to about 2 cP at 25° C. In one embodiment, a 0.75% (w / v) solution thereof has a viscosity of about 1.07 cP to about 1.08 cP at 37° C. The solution may be provided in PBS, DMEM, or other suitable solvent.

[0212] In some embodiments, the formulation comprises bioactive cells in combination with a second biomaterial. However, the biomaterial provides a favorable environment for the combined cells from the time of formulation to the time after administration to a subject. The favorable environment provided by the biomaterial provides the advantage of administering cells in a biomaterial that retains its structural integrity up until the time of administration to the subject, as well as for some time after administration. In certain embodiments, the structural integrity of a second biomaterial after implantation is maintained. The structural integrity may be for minutes, hours, days, or weeks. In some embodiments, the structural integrity is less than one month, less than one week, less than one day, or less than one hour. Relatively short-term structural integrity results in a formulation that can deliver active agents and biomaterials to target sites within tissues or organs by controlled processing, placement, or dispersion without interfering with or impeding the interaction of the incorporated elements with the tissue or organ in which it is placed.

[0213] In one embodiment, the second biomaterial is a temperature-sensitive biomaterial that has a different sensitivity than the first biomaterial. The second biomaterial is: (i) at least (ii) a substantially solid state at or below ambient temperature, and (iii) a substantially liquid state at or above about 37°C. In some embodiments, the ambient temperature is about room temperature.

[0214] In one embodiment, the second biomaterial is a crosslinked bead. The formulations can be used to achieve finely tunable in vivo retention depending on the degree of cross-linking, as described herein. In certain embodiments, the crosslinked beads contain bioactive cells and are resistant to enzymatic degradation as described herein. The formulations herein may be used with or without a second biomaterial in combination with an active agent, e.g., bioactive cells. The first biomaterial can be combined with an active agent, e.g., bioactive cells, without the biomaterial. If the formulation contains a second biomaterial, it may These can be temperature sensitive beads and / or cross-linked beads.

[0215] In some embodiments, the present disclosure provides formulations containing biomaterials that degrade over a period of time, such as minutes, hours, or days. This contrasts with the numerous lines of research that focus on solid implants that degrade slowly over days, weeks, or months. In some embodiments, the biomaterials have one or more of the following characteristics: It has several features: biocompatible, biodegradable / bioabsorbable, and can be used before and during implantation into a subject. The biomaterial's ability to maintain a consistent spacing between implanted particles during implantation promotes natural tissue ingrowth. The biomaterial also facilitates the implantation of solid formulations. The insertion of solid units helps prevent the delivered material from dispersing within the tissue during implantation, so the biomaterial provides localization of the formulations described herein. For cellular formulations, solid biomaterials also improve the stability and viability of anchorage-dependent cells compared to cells suspended in a liquid. However, the short duration of structural integrity means that the biomaterial may not be able to maintain tissue ingrowth or the integration of the delivered cells / materials with the host tissue immediately after implantation. This means that it does not pose a significant obstacle to integration.

[0216] In some embodiments, the present invention is implanted in a substantially solid form and then liquefied / melted. The present invention provides formulations containing biomaterials that are injected as liquids and subsequently solidify within the body, or that otherwise lose their structural integrity after implantation in the body. This contrasts with a significant body of research that has focused on the use of materials that are injected as liquids and then solidify within the body.

[0217] Biocompatible beads In another aspect, the formulation contains a temperature-sensitive biomaterial described herein, as well as a population of biocompatible beads containing the biomaterial. In one embodiment, the beads are crosslinked. Crosslinking can be achieved using any suitable crosslinking agent known to those skilled in the art, including, for example, carbodiimides; aldehydes (e.g., furfural, acrolein, formaldehyde, glutaraldehyde, glyceraldehyde); succinimide crosslinkers (bis(sulfosuccinimidyl) suberate (BS3), disuccinimidyl glutarate (DSG), disuccinimidyl suberate (DSS), dithiobis(succinimidyl propionate)); bis(sulfosuccinimidyl) succinate, ethylene glycol bis(succinimidyl succinate) (EGS), bis(sulfosuccinimidyl) glutarate (BS2G), disuccinimidyl tartrate (DST); epoxides (ethylene glycol diglycidyl ether, 1,4-butanediol diglycidyl ether); sugars (glucose and aldose sugars); sulfonic and p-toluenesulfonic acids; carbonyldiimidazole; genipin; imines; ketones; diphenylphosphoryl azide (DDPA); chlorides terephthaloyl; cerium(III) nitrate hexahydrate; microbial transglutaminase; and hydrogen peroxide, etc. Those skilled in the art will appreciate other suitable cross-linking agents and cross-linking methods for use in accordance with the present disclosure.

[0218] In one embodiment, the beads are carbodiimide-crosslinked beads. Carbodiimide-crosslinked beads are prepared by crosslinking 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC), DCC - N,N'-dicyclohexylcarbodiimide (DCC), and N,N'-diisopropylcarbodiimide (N,N'-diisopropylcarbodiimide). It is cross-linked with a carbodiimide selected from the group consisting of diimides (DIPC). The EDC-treated beads were expected to have many free primary amines, but the high concentrations Samples treated with this crosslinker are expected to have the majority of primary amines involved in amide bonds. The intensity of the orange color produced by the covalent binding of primary amines to picrylsulfonic acid is detectable spectrophotometrically at 335 nm and is proportional to the number of primary amines present in the sample. When normalized to milligrams of protein present in the sample, an inverse correlation can be observed between the number of free amines present and the initial concentration of EDC used for crosslinking. The results show differences in bead cross-linking, which is determined by the amount of carbodiimide used in the reaction. Generally, cross-linked beads show a reduced number of free primary amines compared to non-cross-linked beads.

[0219] Crosslinked beads are less susceptible to enzymatic degradation than non-crosslinked biocompatible beads, thereby providing beads with finely tuneable residence times in vivo. For example, cross-linked beads are resistant to endogenous enzymes such as collagenase. The provision of cross-linked beads is part of a delivery system that facilitates one or more of the following: (a) (b) delivering the attached cells to the desired site and creating space for regeneration and ingrowth of native tissue and vascular supply; (b) long enough to allow the cells to establish, function, and remodel their microenvironment and secrete their own extracellular matrix (ECM); (c) the ability to persist at the site; (d) the ability to facilitate integration of the implanted cells with the surrounding tissue; (e) the ability to implant the cells in a substantially solid form; and (f) the ability to not cause significant impairment to tissue ingrowth, neovascularization, or integration of the delivered cells / material with the host tissue. (f) localized in vivo delivery in a substantially solid form, resulting in (g) preventing dispersion of cells within tissue during implantation; (g) improving stability and viability of anchorage-dependent cells compared to cells suspended in a liquid; and (h) ensuring that cells: 1) are substantially solid. 1) in a substantially liquid state (e.g., attached to beads); and 2) in a substantially liquid state (e.g., liquid (i) Biphasic release when delivered (suspended in the body); (ii) recapitulation and mimicry of the three-dimensional biological niche or renal parenchyma from which these bioactive cell populations originate.

[0220] In one embodiment, the present disclosure provides cross-linked beads containing gelatin. Non-cross-linked gelatin beads are not suitable for bioactive cell formulations because they quickly lose their integrity and cells disappear from the injection site. In contrast, highly cross-linked gelatin beads can persist at the injection site for too long, resulting in the formation of novel ECM. This may interfere with secretion, cell accumulation, angiogenesis, and tissue regeneration. This specification allows for fine-tuning of the in vivo residence time of crosslinked beads. The biodegradability of biomaterials can be controlled. To optimize the sensitivity, various cross-linker concentrations of carbodiimide are used while keeping all reaction conditions constant for all samples. For example, the enzyme sensitivity of carbodiimide-cross-linked beads can be fine-tuned by varying the cross-linker concentration from about 0 to about 1 M. In certain embodiments, the concentration is about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, or about 12 mM. mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 26 mM, about 27 mM, about 28 mM, about 29 mM, about 30 mM, about 31 mM, about 32 mM, about 33 mM, about 34 mM, about 35 mM, about 36 mM, About 37 mM, about 38 mM, about 39 mM, about 40 mM, about 41 mM, about 42 mM, about 43 mM, about 44 mM, about 45 mM , about 46 mM, about 47 mM, about 48 mM, about 49 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, or about 100 mM. The crosslinker concentration can also be about 0.15 M, about 0.2 M, about 0.25 M, about 0.3 M, about 0.35 M, about 0.4 M, about 0.45 M, about 0.5 M, about 0.55 M, about 0.6 M, about 0.65 M, about 0.7 M, about 0.75 M, about 0.8 M, about 0.85 M, about 0.9 M, about 0.95 M, or about 1 M. In certain embodiments, the crosslinker is 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC). In certain embodiments, the crosslinker is 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC). The EDC cross-linked beads are gelatin beads. The percentage of bead degradation depends on the concentration of the cross-linker. In certain embodiments, gelatin beads can be mixed with non-gelatin (e.g., but not limited to, alginate or HA) beads or microparticles to enhance efficacy in delivering bioactive cell populations.

[0221] Crosslinked beads may have certain properties that are advantageous for seeding, attachment, or encapsulation of bioactive cell populations. For example, the beads may have a porous surface and / or may have a substantially porous surface. The presence of pores provides an increased cell attachment surface, allowing for the attachment of a greater number of cells than a non-porous or smooth surface. In addition, the pore structure can support the integration of the porous beads with host tissue, supporting the formation of new tissue. The beads can be fitted to a Weibull plot, which corresponds to a general particle distribution pattern. In one embodiment, the crosslinked beads have a particle size distribution of about 120 μm, about 115 μm, and about 120 μm. The crosslinked bilayer has an average diameter of less than about 110 μm, about 109 μm, about 108 μm, about 107 μm, about 106 μm, about 105 μm, about 104 μm, about 103 μm, about 102 μm, about 101 μm, about 100 μm, about 99 μm, about 98 μm, about 97 μm, about 96 μm, about 95 μm, about 94 μm, about 93 μm, about 92 μm, about 91 μm, or about 90 μm. The properties of beads vary depending on the casting method. For example, beads with the above properties can be obtained by using an air stream to aerosolize a liquid gelatin solution and then spraying it into liquid nitrogen using a thin-layer chromatography reagent sprayer (ACE Glassware). Those skilled in the art will appreciate that adjusting the parameters of the casting method provides the opportunity to tailor different properties of the beads, such as different size distributions. In certain embodiments, the microrelief, surface and internal properties of the beads can be further modified to facilitate cell attachment.

[0222] The cytocompatibility of crosslinked beads is assessed in vitro prior to formulation using cell culture techniques in which beads are cultured with cells that represent the final bioactive cell product. For example, prior to preparation of a bioactive renal cell product, beads are cultured with primary renal cells to perform live / dead cell aggregation. Cell compatibility is confirmed using the ELISA. In addition to cell viability, the metabolic capacity of the cells, secretion of certain important cytokines and growth factors and exosomes, and expression of certain important protein and nucleic acid markers, such as miRNAs, associated with functional and bioactive kidney cell populations are also assessed. Specific functional tests that measure expression are well known to those skilled in the art and can be further used to confirm the efficacy of cells in formulations with crosslinked beads.

[0223] In one embodiment, the biocompatible crosslinked beads are combined with the temperature-sensitive biomaterial in a solution at about 5% (w / w) to about 15% (w / w) of the volume of the solution. The soluble fraction may be present at about 5% (w / w), about 5.5% (w / w), about 6% (w / w), about 6.5% (w / w), about 7% (w / w), about 7.5% (w / w), about 8% (w / w), about 8.5% (w / w), about 9% (w / w), about 9.5% (w / w), about 10% (w / w), about 10.5% (w / w), about 11% (w / w), about 11.5% (w / w), about 12% (w / w), about 12.5% ​​(w / w), about 13% (w / w), about 13.5% (w / w), about 14% (w / w), about 14.5% (w / w), or about 15% (w / w) of the soluble fraction.

[0224] In some embodiments, the present disclosure provides formulations containing biomaterials that degrade over a period of time on the order of minutes, hours, or days, in contrast to the numerous lines of research that have focused on solid implants that degrade slowly over days, weeks, or months.

[0225] In one aspect, the present disclosure provides a formulation comprising bioactive cells in biocompatible crosslinked beads with a delivery matrix. In one embodiment, the delivery matrix has one or more of the following properties: biocompatibility, biodegradability / bioabsorbability, a substantially solid state before and during implantation into a subject, loss of structural integrity (substantially solid state) after implantation, and a cytocompatible environment that supports cell viability. The ability of the delivery matrix to maintain spacing between implanted particles during implantation promotes natural tissue ingrowth. Without the delivery matrix, compression of cellularized beads during implantation may result in insufficient space for sufficient tissue ingrowth. The delivery matrix facilitates implantation of the solid formulation. Additionally, the short-term structural integrity of the matrix prevents the matrix from posing a significant obstacle to tissue ingrowth, neovascularization, or integration of the delivered cells / materials with host tissue immediately after implantation. This means that the delivery matrix will not disperse. The insertion of a solid unit helps prevent the delivered material from dispersing within the tissue during implantation, so the delivery matrix provides localization of the formulations described herein. In certain embodiments, application of the delivery matrix described herein helps prevent rapid loss of transplanted cells due to urination after delivery to the renal parenchyma. For cell formulations, a solid delivery matrix improves the stability and viability of anchorage-dependent cells compared to cells suspended in a liquid.

[0226] In some embodiments, the delivery matrix is ​​a population of biocompatible beads that do not contain cells. In some embodiments, the cell-free beads are dispersed throughout and among the individual cell-containing beads. The cell-free beads are dispersed throughout and among the individual cell-containing beads. The spacer beads function as "spacer beads" between the cell-filled beads before and immediately after the first temperature. The spacer beads contain a temperature-sensitive biomaterial that is substantially solid at a first temperature and substantially liquid at a second temperature, the first temperature being lower than the second temperature. For example, the spacer beads contain a biomaterial, as described herein, that is substantially solid at or below about ambient temperature and substantially liquid at about 37°C. In one embodiment, the ambient temperature is about room temperature. In one embodiment, the biomaterial is a gelatin solution. The gelatin solution may be about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, about 10%, about 10.5%, or about 11% (w / v) The gelatin solution is prepared in PBS, cell culture medium (DMEM), or another suitable solvent. In one embodiment, the biomaterial is hyaluronic acid. In one embodiment, the biomaterial is a decellularized extracellular matrix sourced from human or animal kidneys, which may be further reconstituted as a hydrogel.

[0227] In some embodiments, the present disclosure is implanted in a substantially solid form (e.g., spacer beads) and then liquefied / melted or otherwise loses structural integrity after implantation in the body. This contrasts with a significant body of research that has focused on the use of materials that are injected as liquids and then solidify within the body.

[0228] The temperature sensitivity of spacer beads can be evaluated in vitro prior to formulation. Spacer beads can be labeled and mixed with unlabeled, temperature-insensitive beads. The mixture is then incubated at 37°C and observed for changes in the physical transition. The disruption of the labeled, temperature-sensitive beads at elevated temperatures is observed over time. For example, temperature-sensitive gelatin beads can be formulated with Alcian blue dye to serve as a marker for the physical transition. Blue gelatin beads are mixed with crosslinked (white) beads, placed in a catheter, extruded, and incubated at 37°C in 1X PBS, pH 7.4. The loss of the blue gelatin beads is tracked microscopically at various time points. The change in the physical state of the blue gelatin beads becomes visible after 30 minutes and becomes more pronounced with extended incubation times. The beads do not completely dissipate due to the viscosity of the material.

[0229] Modified-release formulations In some embodiments, the formulations herein are provided as modified release formulations. Generally, modified release is characterized by an initial release of a first active agent immediately after administration, followed by the release of at least one additional, second active agent. The first and second active agents are In some embodiments, the formulation provides modified release through multiple components in the same formulation. In some embodiments, the modified release formulation contains the active agent as part of a first component that allows the active agent to move freely throughout the volume of the formulation, thereby allowing for immediate release at the target site immediately after administration. The first component is a substantially liquid phase and The first component can be a temperature-sensitive biomaterial that is substantially solid phase. is in a substantially liquid phase at the time of administration. In certain embodiments, the active agent is in a substantially liquid phase such that it is substantially free to move throughout the volume of the formulation, and therefore is readily released at the target site immediately after administration.

[0230] In certain embodiments, the modified release formulation has the active agent as part of a second component. However, the active agent is attached to and distributed on a second component that remains present at the target site before and after administration. The second component comprises a structural element capable of binding an active agent, and the second component is deposited, coated, embedded, seeded, or entrapped. This prevents immediate release of the active agent from the second component at the time of administration. For example, the second component may be provided in a substantially solid form, for example, as biocompatible beads. It can be cross-linked to prevent or slow enzymatic degradation in vivo. In certain embodiments, the active agent in a substantially solid state retains its structural integrity within the formulation before and after administration, and therefore does not immediately release the active agent to the target site upon administration. Suitable carriers for modified release formulations are described herein, although one of skill in the art will be able to appreciate other carriers suitable for use herein.

[0231] In certain embodiments, the formulations provide for an initial rapid delivery / release of the delivered element, including cells, nanoparticles, therapeutic molecules, etc., followed by a subsequent delayed release. In some embodiments, the formulations include exosomes, miRNA and other bioactive nucleic acids or targets. This results in the initial rapid delivery / release of protein molecules, which are soluble and reach the kidney cells. or secreted bioactive products provided by other cell populations. Other molecules or therapeutic agents with regenerative biological activity will be appreciated by those of skill in the art. The formulations herein can be designed to achieve a biphasic release profile, such that the agent to be delivered is provided in an unattached form (e.g., cells in solution) and an attached form (e.g., cells associated with beads or another suitable carrier). Immediately after initial administration, unhindered agent is immediately delivered to the delivery site, while release of the immobilized agent is delayed until the structural integrity of the carrier (e.g., beads) is disrupted, at which point the pre-attached agent is released. Other suitable release mechanisms will be apparent to those of skill in the art, as discussed below.

[0232] The release delay time can be adjusted based on the properties of the active agent. For example, the release delay time for a bioactive cell formulation can be approximately seconds, minutes, hours, or days. In some situations, a delay of approximately weeks is appropriate. For other active agents, such as small molecules or polymers, the release delay time for the formulation can be approximately seconds, minutes, hours, days, weeks, or months. The formulation can also contain different biomaterials that provide different time-delay release profiles. For example, a first biomaterial with a first active agent may have a first release time. and a second biomaterial having a second active agent exhibiting a second release time. The first and second active agents may be the same or different.

[0233] As described herein, the delayed release time will generally correspond to the time at which the biomaterial loses structural integrity. However, one skilled in the art will appreciate other delayed release mechanisms. For example, the active agent may be released continuously over time, independent of the degradation time of a particular biomaterial, such as diffusion of a drug from a polymer matrix. Furthermore, bioactive cells can migrate away from a formulation containing the biomaterial and migrate into native tissue. In some embodiments, bioactive cells migrate from the biomaterial, e.g., beads, into native tissue. In some embodiments, bioactive cells migrate from the biomaterial into native tissue and release growth factors, cytokines, exosomes, miRNA, and other nucleic acids and other molecules involved in regenerative bioactivity. In certain embodiments, exosomes and other extracellular vesicles, as well as miRNAs, other biologically active nucleic acids and proteins, are used as biomaterials. In yet another embodiment, the bioactive cells migrate from the biomaterial into the native tissue and then participate in the recruitment of host stem and progenitor cells that migrate or migrate toward the site of injury or disease.

[0234] Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Prolonged absorption of injectable formulations can be brought about by including in the formulation an agent that delays absorption, for example, monostearate salts and gelatin. Many methods for preparing such formulations are patented or generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. Other methods applicable to the controlled or sustained release of polypeptide drugs are described, e.g., in U.S. Pat. Nos. 6,306,406 and 6,346,274, and, e.g., U.S. Patent Application Nos. US20020182254 and US20020051808, all of which are incorporated herein by reference.

[0235] Bioactive Cell Preparations The bioactive cell formulations described herein contain implantable constructs made from the biomaterials described above with genetically modified bioactive kidney cells described herein for treating kidney disease in a subject in need thereof. In certain embodiments, the constructs are made from a biocompatible material or biomaterial, including one or more synthetic and a scaffold or matrix made of a biocompatible material of natural origin, and a substance disposed (deposited) on the surface of the scaffold or embedded therein by attachment and / or entrapment. The cell population or mixtures may be comprised of one or more of the cells described herein. In the form, the constructs are disposed on, attached to, entrapped in, embedded in, or within the biomaterial, as well as biomaterial component(s). , seeded (embedded), or combined with one or more of the compounds described herein. The bioactive cell preparation is composed of multiple cell populations or cell mixtures. Any of the cell populations described herein, including enriched cell populations or mixtures thereof, can be used in combination with a matrix to form a construct. In some embodiments, the bioactive cell preparation is composed of the biocompatible material or biomaterial described herein and a genetically modified SRC population.

[0236] In one embodiment, the bioactive cell preparation is an injectable preparation of SRCs that have been genetically modified to reduce immunogenicity and that are then injected into a biomaterial (e.g., a gelatin-based In some embodiments, the allogeneic SRCs are prepared in a hydrogel containing 100% urea, 100% urea, 100% urea-containing steroids (SRCs). In some embodiments, the allogeneic SRCs are prepared in a hydrogel containing ... Isolation and expansion of renal cells from the patient's renal cortical tissue, and transfection of the SRC gene using gene editing technology SRCs are obtained by selection by density gradient centrifugation from engineered and expanded renal cells. SRCs are primarily composed of renal epithelial cells, which are well known for their regenerative potential (Humphreys et al., 2004). (2008) Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell. 2(3):284-91). Other parenchymal (vascular) and interstitial (collecting duct) cells may be present in small amounts in the SRC population. Infusion of SRCs into recipient kidneys has been shown to be effective in nonclinical studies. In this study, SRC significantly improved animal survival, urine concentration, and filtration. However, SRC has limited shelf life and stability. The SRC formulation in biomaterials enhances cell stability and therefore extends the shelf life of the product. prolongation and improve stability during transport and delivery to the renal cortex for clinical utility.

[0237] In some embodiments, bioactive cell preparations are produced by first obtaining renal cortical tissue from donors using clinical standard renal biopsy. Renal cells are isolated from renal tissue by enzymatic digestion and then grown using standard cell culture techniques. Cell culture medium is designed to grow primary renal cells and does not contain any differentiation factors. The collected renal cells are subjected to density gradient separation to obtain SRCs. Gene editing technology can be used to modify the immunogenicity of SRCs before or after density gradient separation.

[0238] In certain embodiments, the formulated cell population is substantially free to move throughout the biomaterial at temperatures at or above ambient temperature. Suspending the cell population in a substantially solid phase at lower temperatures provides stability advantages for cells, such as anchorage-dependent cells, compared to cells in a liquid. Moreover, suspending cells in a substantially solid state provides one or more of the following advantages: i) preventing cell settling; ii) increasing cell viability; iii) the cells can remain suspended and fixed to the biomaterial; iv) allowing cells to remain more uniformly dispersed throughout the biomaterial; iv) preventing the formation of cell aggregates; and v) allowing cells to remain more uniformly dispersed during storage and transport of the formulation. A formulation that can maintain these characteristics up until administration to a subject is advantageous because, at a minimum, the overall health of the cells in the formulation is better and a consistent dose of cells can be administered.

[0239] In a preferred embodiment, the gelatin-based hydrogel used to formulate the SRC The rheological biomaterial is porcine gelatin dissolved in a buffer to form a thermoresponsive hydrogel. This hydrogel is liquid at room temperature but becomes viscous at refrigerated temperatures (2-8°C). When cooled to ℃, it becomes a gel. SRC is formulated with a hydrogel and becomes a gel when cooled. The product is then shipped to the clinic at refrigerated temperatures (2-8°C). The bioactive cell preparation is warmed to room temperature before injection into the kidney and is implanted into the renal cortex using a needle and syringe suitable for percutaneous or laparoscopic administration.

[0240] Description and Composition of Neo-Kidney Augment Composition In certain embodiments, the bioactive cell preparation is a Neo-Kidney Augment (NKA), It is an injectable preparation of autologous selected renal cells (SRCs) formulated in a biomaterial (gelatin-based hydrogel). In one embodiment, the autologous SRCs are obtained by isolating and expanding renal cells obtained from a patient's renal cortical tissue by renal biopsy, and selecting the expanded renal cells by centrifugation across a density boundary, barrier, or interface. In one embodiment, the autologous SRCs are obtained from a patient's renal cortical tissue by renal biopsy. SRCs are obtained by the isolation and expansion of expanded renal cells and selection of the expanded renal cells over continuous or discontinuous single- or multi-step density gradients. The SRC population is composed of epithelial cells, which are well known for their regenerative capacity (Humphreys et al. (2008) Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell. 2(3):284-91). Other parenchymal (vascular) and interstitial (collecting duct) cells are present in small amounts in the autologous SRC population. Injection of SRC into the recipient kidney has been shown to be effective in animal studies in preclinical trials. Significant improvements in survival, urine concentrating, and filtering function were observed. However, SRC could be preserved. The formulation of SRC in gelatin-based hydrogel biomaterials enhances cell stability, thereby extending the shelf life of the product and improving its clinical usefulness. This results in improved stability of NKA during transport and delivery to the renal cortex.

[0241] In some embodiments, NKA is produced by first obtaining renal cortical tissue from a donor / recipient using standard-of-care renal biopsy techniques. In certain embodiments, renal cells are isolated from the renal tissue by enzymatic digestion and expanded using standard cell culture techniques. In certain embodiments, cell culture media is designed to expand primary renal cells and does not contain differentiation factors. In certain embodiments, the collected renal cells are cultured at a density boundary to obtain SRCs. The SRCs are subjected to separation across a boundary or interface or density gradient. In certain embodiments, the SRCs are genetically modified in accordance with the present disclosure.

[0242] Further included (provided) herein are formulations comprised of biomaterials designed or adapted to respond to the external conditions described herein. As a result, the nature of the association of the bioactive cell population with the biomaterial in the construct can be varied depending on the external conditions. For example, the association of the cell population with a temperature-sensitive biomaterial varies with temperature. In one embodiment, the construct comprises a bioactive renal cell population and a biomaterial that is substantially solid at temperatures below about 8°C and substantially solid at temperatures above about ambient temperature. The cell population contains a liquid biomaterial at approximately 8°C or below. However, the cell population is substantially free to move throughout the volume of the biomaterial at temperatures above about ambient temperature. Suspension in a substantially solid phase at low temperatures provides stability advantages for cells, such as anchorage-dependent cells, compared to cells in a liquid. Furthermore, suspending cells in a substantially solid state provides one or more of the following advantages: i) preventing cell settling; ii) allowing cells to remain fixed to the biomaterial in suspension; iii) allowing cells to biocompatible materials; iv) prevent the formation of cell aggregates; and v) better protect the cells during storage and transportation of the formulation. A formulation that can retain these characteristics until administration to a subject is advantageous, at least because it provides for better overall health of the cells in the formulation and a more uniform and consistent dose of cells administered.

[0243] In certain embodiments, the gelatin-based hydrogel biomaterial used to formulate the SRC into an NKA is porcine gelatin dissolved in a buffer, which forms a thermoresponsive hydrogel. This hydrogel is liquid at room temperature but becomes viscous at refrigerated temperatures (2-8°C). The NKA gels upon cooling to 2°C (2-8°C). The SRC is formulated with the hydrogel to produce the NKA. The NKA gels upon cooling and is transported to the clinic under refrigerated temperature conditions (2-8°C). The NKA has a shelf life of 3 days. In clinical settings, the product is warmed to room temperature before being injected into the patient's kidney. The NKA is implanted into the renal cortex using a needle and syringe suitable for percutaneous or laparoscopic delivery of the NKA. In one embodiment, the hydrogel is derived from gelatin or other extracellular matrix proteins of recombinant origin. In one embodiment, the hydrogel is derived from extracellular matrix originating from the kidney or another tissue or organ. In one embodiment, the hydrogel is derived from recombinant extracellular matrix proteins. In one embodiment, the hydrogel comprises gelatin derived from recombinant collagen (i.e., recombinant gelatin).

[0244] cell survival agents In some aspects, the bioactive cell formulation also includes a cell survival agent, hi some embodiments, the cell survival agent is selected from the group consisting of antioxidants, oxygen carriers, immunomodulators, cell recruitment factors, cell attachment factors, anti-inflammatory drugs, angiogenic factors, matrix metalloproteinases, wound healing factors, and secretory products from bioactive cells.

[0245] Antioxidants are characterized by their ability to inhibit the oxidation of other molecules. Antioxidants include 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox®), carotenoids, flavonoids, isoflavones, ubiquinone, glutathione, lipoic acid, superoxide dismutase, ascorbic acid, vitamin E, vitamin A, mixed carotenoids (e.g., beta-carotene, alpha-carotene, gamma-carotene, lutein, lycopene, phytoene, phytofluene, and astaxanthin), selenium, coenzyme Q10, and niacin. 3-carbinol, proanthocyanidins, resveratrol, quercetin, catechin , salicylic acid, curcumin, bilirubin, oxalic acid, phytic acid, lipoic acid, vanillic acid, polyphenols, ferulic acid, theaflavin, and one or more of their derivatives. Some examples include, but are not limited to, antioxidants. Those skilled in the art will appreciate that other suitable antioxidants may be used in certain embodiments of the present invention.

[0246] Oxygen carriers are agents characterized by their ability to carry and release oxygen. They include, but are not limited to, perfluorocarbons and perfluorocarbon-containing pharmaceuticals. Suitable perfluorocarbon-based oxygen carriers include perfluorooctyl bromide (C8F17Br); perfluorodichorotane (C8F16C12); Perfluorodecyl bromide; Perflubron; Perfluorodecalin; Perfluorotripropylamine; Perfluoromethylcyclopiperidine; Fluosol® (perfluorodecalin and perfluorotripropylamine); Perftoran® (perfluorodecalin and perfluoromethylcyclopiperidine); O xygent® (perfluorodecyl bromide and perflubron); Ocycyte® Trade name) (perfluoro(tert-butylcyclohexane)), but not limited to Those skilled in the art will appreciate that other suitable perfluorocarbon-based oxygen carriers may be used in certain embodiments herein.

[0247] Immunomodulatory factors include osteopontin, FAS ligand factor, interleukins, and transactivators. Forming growth factor β, platelet-derived growth factor, clusterin, transferrin, RANTES (regulated upon activation, normal T cell expressed and secreted), plasma These include phosphoinositide activator inhibitor 1 (Pai-1), tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), α1-microglobulin, and β2-microglobulin. It will be appreciated by those skilled in the art that other suitable immunomodulatory factors may be used in certain embodiments of the present invention, including but not limited to:

[0248] Anti-inflammatory or immunosuppressant drugs (described below) may also be part of the formulation. Those skilled in the art will appreciate that other suitable antioxidants may be used in certain embodiments of the present invention.

[0249] Cell recruitment factors include, but are not limited to, monocyte chemoattractant protein 1 (MCP-1) and CXCL-1. Those skilled in the art will appreciate that other suitable cell recruitment factors can be used in certain embodiments of the present invention.

[0250] Cell adhesion factors include, but are not limited to, fibronectin, procollagen, collagen, ICAM-1, connective tissue growth factor, laminin, proteoglycans, specific cell adhesion peptides such as RGD and YSIGR, etc. Those skilled in the art will appreciate that other suitable cell adhesion factors can be used in certain embodiments herein.

[0251] Angiogenic factors include, but are not limited to, vascular endothelial growth factor F (VEGF) and angiopoietin-2 (ANG-2). Those skilled in the art will appreciate that other suitable angiogenic factors may be used in certain embodiments herein.

[0252] Matrix metalloproteinases include matrix metalloproteinase 1 (MMP1), matrix metalloproteinase 2 (MMP2), matrix metalloproteinase 9 (MMP-9), and tissue inhibitor of metalloproteinase 1 (TIMP-1).

[0253] Wound healing factors include keratinocyte growth factor (KGF-1), tissue plasminogen activator (TPA), and tPA, calbindin, clusterin, cystatin C, and trefoil factor 3. Those skilled in the art will appreciate that other suitable wound healing factors may be used in certain embodiments herein, including but not limited to:

[0254] Secreted products from the bioactive cells described herein can also be added to bioactive cell formulations as cell survival agents.

[0255] Compositions obtained from bodily fluids, tissues or organs of human or animal origin, such as, but not limited to, human plasma, human platelet lysate, fetal bovine plasma or bovine pituitary extract, may be added to the bioactive cell preparation as cell survival agents.

[0256] Those skilled in the art will appreciate that there are several suitable methods for disposing cell populations on or otherwise combining cell populations with biomaterials to form constructs.

[0257] How to use In some embodiments, the cells and preparations herein are suitable for use in the methods described herein. In certain embodiments, the preparations of the present invention can be administered to treat disease. For example, genetically modified bioactive cells can be administered to a natural organ as part of the preparations described herein. In some embodiments, the genetically modified bioactive cells can be sourced from the natural organ to which they are intended to be administered, but can also be obtained from a source other than the target natural organ.

[0258] In some embodiments, the present disclosure provides a method for treating kidney disease in a subject in need thereof using a formulation containing a bioactive kidney cell population described herein. In some embodiments, the therapeutic formulation contains a selected kidney cell population, or a mixture thereof, that has been modified by gene editing to reduce immunogenicity. In some embodiments, the formulation is suitable for administration to a subject in need of improved kidney function.

[0259] In some embodiments, effective treatment of a subject's kidney disease by the methods herein can be monitored by various indicators of kidney function. In some embodiments, indicators of kidney function include serum albumin, albumin / globulin ratio (A / G ratio), serum phosphorus, serum sodium, kidney size (measured by ultrasound), serum calcium, phosphorus:calcium ratio, serum potassium, proteinuria, urine creatinine, serum creatinine, blood urea nitrogen (BUN), cholesterol, and the like. These include, but are not limited to, sterol levels, triglyceride levels, and glomerular filtration rate (GFR). Additionally, important indicators of general health and well-being include, but are not limited to, weight gain or loss, survival rate, blood pressure (mean systemic blood pressure, diastolic blood pressure, or systolic blood pressure), and physical endurance exercise capacity.

[0260] In some embodiments, effective treatment with the bioactive renal cell population may involve one or more of the following: Stabilization of renal function is evidenced by stabilization of one or more indices. Stabilization of renal function is demonstrated by observing a change in an index in a subject treated by the methods herein compared to the same index in a subject not treated by the methods herein. Alternatively, stabilization of renal function can be demonstrated by observing a change in the same index in a subject treated by the methods herein compared to the index in the same subject before treatment. The change in a first index is In certain embodiments, the treatment provided herein results in a stable or decreased serum creatine and / or blood urea nitrogen (BUN) level in a subject. The BUN values ​​observed in this subject may include changes in blood glucose levels, and the BUN values ​​observed in this subject may be higher than those observed in the subject treated with the methods herein. In certain embodiments, treatment may include stabilization of serum creatinine levels in a subject, wherein the serum creatinine levels observed in the subject are lower than in subjects with a similar condition who are not treated with the methods herein. In certain embodiments, stabilization of one or more of the above indicators of renal function. is the result of treatment with a selected kidney cell preparation that has been modified by gene editing to reduce immunogenicity.

[0261] Those skilled in the art will appreciate that one or more of the methods described herein or known in the art may be used. One or more additional indicators can be measured to determine effective treatment of kidney disease in a subject.

[0262] In certain embodiments, effective treatment with genetically modified bioactive renal cell preparations is demonstrated by an improvement in one or more indicators of renal structure and / or function. In certain embodiments, the genetically modified bioactive kidney cell population results in improved serum creatine and / or blood urea nitrogen (BUN) levels. In certain embodiments, the genetically modified bioactive renal cell populations result in improved serum protein retention compared to non-enriched cell populations. In one embodiment, the genetically modified bioactive kidney cell population provides an improved A:G ratio compared to a non-enriched cell population. Genetically modified, bioactive kidney cell populations can improve serum cholesterol levels and / or triglyceride levels. In one embodiment, the genetically modified bioactive kidney cell population results in improved cholesterol levels. In one embodiment, the genetically modified bioactive kidney cell population results in improved vitamin D levels. The bioactive renal cell populations result in improved phosphorus:calcium ratios compared to non-enriched cell populations. In certain embodiments, the genetically modified bioactive renal cell populations result in improved hemoglobin levels compared to non-enriched cell populations. In certain embodiments, the genetically modified bioactive renal cell populations result in improved serum creatinine levels compared to non-enriched cell populations. In certain embodiments, the genetically modified bioactive renal cell populations result in improved hematocrit levels compared to non-enriched cell populations. In certain embodiments, improvement in one or more of the above indices of renal function is indicative of treatment with the selected renal cell preparation. In one embodiment, one of the above-mentioned indicators of renal function or Some of the improvements are the result of treatment with kidney cell preparations that have been modified by gene editing to reduce immunogenicity.

[0263] In another aspect, the present specification provides a formulation for use in a method for regenerating a native kidney in a subject in need thereof. In some embodiments, the method comprises administering or transplanting a genetically modified bioactive cell population, mixture, or construct described herein. The regenerated native kidney can be characterized by a number of indicators, including, but not limited to, the development of native kidney function or capacity, the improvement of native kidney function or capacity, and the expression of specific native kidney markers. In some embodiments, the development or improvement of function or capacity can be monitored based on various indicators of renal function, as described above. In some embodiments, the regenerated kidney can be characterized by one or more of the following: These stem cells are characterized by differential expression of several stem cell markers, which can be one or several of the following: sex determining region Y (SRY)-box 2 (Sox2); blastocyst transcription factor (UTF1); Nodal homolog from mouse (NODAL); promyelocytic stem cell (Promyelocytic stem cell) transcription factor ... nin1 (PROM1) or CD133 (CD133); CD24; and any combination thereof (see Ilagan et al. PCT / US2011 / 036347, which is incorporated by reference in its entirety herein, (See also Genheimer et al., 2012. Molecular characterization of the regenerative response induced by intrarenal transplantation of selected renal cells in a rodent model of chronic kidney disease. Cells Tissue Organs 196: 374-384, also incorporated herein by reference in its entirety.) In certain embodiments, expression of one or more stem cell markers is upregulated compared to a control.

[0264] In certain aspects, provided herein are methods of treating kidney disease in a subject, the methods comprising injecting a formulation, composition, or cell population described herein into the subject. In certain embodiments, the formulation, composition, or cell population is injected through an 18-30 gauge needle. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 20 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 21 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 22 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 23 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 24 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 25 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 26 gauge. In certain embodiments, the formulation, composition, or cell population is injected through a needle smaller than 27 gauge. In certain embodiments, the formulation, composition, or cell population is injected with a needle smaller than 28 gauge. In certain embodiments, the formulation, composition, or cell population is injected with a needle smaller than 29 gauge. In certain embodiments, the formulation, composition, or cell population is injected with a needle smaller than about 20 gauge. Injected with a needle. In one embodiment, the formulation, composition, or cell population is injected with a needle that is about 21 gauge.

[0265] In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 22 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 23 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 24 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 25 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 26 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 27 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 28 gauge. In some embodiments, the formulation, composition, or cell population is injected with a needle that is about 29 gauge.

[0266] In some embodiments, the inner diameter of the needle is less than 0.84 mm. In some embodiments, the needle has an inner diameter of less than 0.61 mm. In some embodiments, the needle has an inner diameter of less than 0.51 mm. In some embodiments, the needle has an inner diameter of less than 0.41 mm. In some embodiments, the needle has an inner diameter of less than 0.33 mm. In some embodiments, the needle has an inner diameter of less than 0.25 mm. In some embodiments, the inner diameter of the needle is less than 0.20 mm. In some embodiments, the inner diameter of the needle is less than 0.15 mm. In some embodiments, the outer diameter of the needle is less than 1.27 mm. ... In some embodiments, the outer diameter of the needle is less than 0.91 mm. In some embodiments, the outer diameter of the needle is less than 0.81 mm. In some embodiments, the outer diameter of the needle is less than 0.71 mm. In some embodiments, The outer diameter of the needle is less than 0.64 mm. In some embodiments, the outer diameter of the needle is less than 0.51 mm. In some embodiments, the outer diameter of the needle is less than 0.41 mm. In some embodiments, the outer diameter of the needle is less than 0.51 mm. The diameter is less than 0.30 mm. In some embodiments, the needle has one of the sizes in the following table: TIFF2025143321000029.tif10185

[0267] secretory products In some embodiments, the effect is due to the cell itself and / or to a secreted product from the cell. The regenerative effect is characterized by one or more of the following: Decreased epithelial-mesenchymal transition (possibly due to attenuation of TGFβ signaling) reduction in renal fibrosis; reduction in renal inflammation; differential expression of stem cell markers in the native kidney; targeting of transplanted and / or endogenous cells to sites of renal injury, e.g., tubular injury. migration of the transplanted cells, engraftment of the transplanted cells at the site of kidney damage, e.g., at the site of tubular damage; stabilization of one or more indicators of kidney function (as described herein); de novo formation of S-shaped bodies / comma-shaped bodies associated with kidney development, de novo formation of kidney tubules or nephrons, restoration of red blood cell homeostasis (as described herein); and any combination thereof (Basu et al., 2011. Functional evaluation of primary renal cell / biomaterial neo-kidney augment prototypes for renal tissue engineering. Cell Transplantation 20: 1771-90; Bruce et al., 2015. Selected renal cells modulate disease progression in rodent models of chronic kidney disease via NF-κB and TGF-β1 pathways. Regenerative Medicine 10: 815-839, each of which is incorporated by reference in its entirety.

[0268] As an alternative to tissue biopsies, the regenerative outcomes in treated subjects can be assessed by examining bodily fluids, such as urine. Microvesicles obtained from a subject's urine have been shown to contain certain components, including, but not limited to, specific proteins and miRNAs. These components ultimately derive from renal cell populations affected by treatment with the cell populations herein. These components include stem cell replication and differentiation, apoptosis, inflammation and immune modulation, fibrosis, epithelial-mesenchymal transition, TGF-β signaling, and PAI-1 signaling. The factors involved can include, but are not limited to, the time course analysis of microvesicle-associated miRNA / protein expression patterns allows for continuous monitoring of regenerative outcomes within the kidney of subjects receiving the cell populations, mixtures, or constructs herein.

[0269] In one embodiment, the present invention provides a method for assessing whether a patient with kidney disease (KD) will respond to treatment with a therapeutic formulation, which can include measuring or detecting the amount of vesicles or their luminal contents in a test sample from a KD patient treated with the therapeutic agent, compared to or contrasted with the amount of vesicles in a control sample (e.g., a sample from the same patient prior to treatment with the therapeutic agent), where an increase or decrease in the amount of vesicles or their luminal contents in the test sample relative to the amount of vesicles or their luminal contents in the control sample indicates that the treated patient will respond to treatment with the therapeutic agent.

[0270] These kidney-derived vesicles and / or the luminal contents of kidney-derived vesicles were also detected in the urine of subjects. and can be analyzed as a biomarker of regenerative outcome or therapeutic efficacy. Non-invasive prognostic methods include measuring the prognosis of a subject before and / or after administration or transplantation of a genetically modified bioactive kidney cell population, mixture, or construct described herein. The method can include obtaining a urine sample from the subject. Vesicles and other secretory products can be isolated from the urine sample using standard methods, including centrifugation to remove unwanted debris (Zhou et al. 2008. Kidney Int. 74(5):613-621; Skog et al. US Patent Application Publication No. 20110053157, each of which is incorporated by reference in its entirety). (incorporated herein by reference thereto), precipitation to isolate exosomes from urine, polymerase chain reaction and nucleic acid sequencing to identify specific nucleic acids, and mass spectrometry and / or 2D gel electrophoresis to identify specific proteins associated with regenerative outcomes. This is not limited to:

[0271] Administration method and route The bioactive cell preparations of the present invention can be administered alone or in combination with other bioactive components. The preparations are suitable for injection or implantation of integrated tissue engineering elements inside solid organs for tissue regeneration. In addition, the preparations It is used for injecting or implanting tissue engineering elements into the walls of hollow organs to regenerate tissue.

[0272] In one aspect, the present invention provides a method of providing a bioactive cell preparation described herein to a subject in need thereof. In some embodiments, the origin of the bioactive cells may be allogeneic, syngeneic, or any combination thereof. In some embodiments, the method may also include administration of an immunosuppressant (see, e.g., U.S. Patent No. 7,563,822).

[0273] Therapeutic methods of the subject invention involve the delivery of bioactive cell preparations described herein. In certain embodiments, direct administration of cells to the intended site of benefit is preferred. A subject in need can also be treated by in vivo contacting the native kidney with a bioactive cell preparation described herein, along with a product selected from one or more enriched renal cell populations and / or mixtures or constructs containing the same. The in vivo contacting step produces a regenerative effect on the native kidney.

[0274] Various means for administering a composition of selected kidney cells to a subject will be apparent to those skilled in the art in view of this specification, including injection of the cells into a target site in the subject.

[0275] Delivery Carriers The cells and / or secreted products can be contained within a delivery device or carrier. The delivery vehicle can be a natural material, which facilitates introduction by injection or implantation into a subject. In certain embodiments, the delivery vehicle can comprise a natural material. In other certain embodiments, the delivery vehicle can comprise a synthetic material. In certain embodiments, the delivery vehicle provides a structure that mimics or appropriately matches the structure of an organ. In certain embodiments, the delivery vehicle is fluid-like in nature. Such a delivery device can include a tube, e.g., a catheter, for injecting cells and fluids into the body of the recipient subject. In preferred embodiments, the tube further has a needle, e.g., a syringe, through which the cells of the present invention can be introduced into the subject at a desired location. In certain embodiments, the mammalian kidney-derived cell population is formulated for intravascular administration through a catheter (the term "catheter" is intended to include any of a variety of tube-like systems for delivery of substances to a blood vessel). Alternatively, the cells can be embedded in or on a biomaterial or scaffold, including, but not limited to, textiles, such as woven, knitted, braided, meshed, and nonwoven fabrics, perforated films, sponges and foams, and beads, such as solid or porous beads, microparticles, nanoparticles, and the like (e.g., Cultispher-S gelatin beads - Sigma). The cells can be prepared in a variety of forms for this purpose. For example, the cells can be suspended in a solution or gel. The cells can be mixed with a pharmaceutically acceptable vehicle or excipient in which the cells of the invention remain viable. Pharmaceutically acceptable vehicles and excipients include saline, aqueous buffer solutions, solvents, and / or dispersion media. The use of such vehicles and excipients is well known in the art. It is well known that the solution is preferably sterile, fluid, and often isotonic. Preferably, the solution is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. Those skilled in the art will appreciate that the delivery vehicle used to deliver the cell populations and mixtures thereof of the present invention can include combinations of the above properties.

[0276] Administration method Methods of administering the formulation include, but are not limited to, systemic, intrarenal (e.g., intraparenchymal), intravenous, or intraarterial injection, and direct injection into tissue at the intended site of action. Other administration methods used in accordance with the present invention include single or multiple injections via direct laparotomy, direct laparoscopy, transperitoneal, or percutaneous injection. Other administration methods used in accordance with the present invention include, for example, retrograde injection and ureteral pelvic injection. Surgical administration methods include, but are not limited to, one-stage methods such as partial nephrectomy and construct implantation, partial nephrectomy, partial pyelotomy, retinoperitoneal vascularization, multi-local biopsy puncture route, cone or cone-to-cylinder, and renal pole-like replacement, and two-stage methods such as, for example, organoid endo-bioreactor for transplantation. In some embodiments, the formulations containing the cell mixture are delivered simultaneously via the same route. In some embodiments, each of the cell compositions comprising the controlled mixture is one or more of the cell compositions described herein. In some embodiments, the selected renal cells are delivered percutaneously into the renal cortex of the kidney. In some embodiments, a guide cannula is inserted percutaneously and used to puncture the kidney capsule prior to injecting the composition into the kidney.

[0277] Laparoscopic or percutaneous techniques can be used to access the kidney for infusion of formulated BRC or SRC populations. Laparoscopic techniques allow direct visualization of the kidney, allowing any bleeding or other adverse events to be detected during infusion and addressed immediately. The use of percutaneous approaches to the kidney has been used for over a decade, primarily for the removal of intrarenal masses. These procedures involve inserting an electrode or cryogenic needle into a designated intrarenal mass and leaving it in contact for (typically) 10–20 minutes while the lesion is removed. Percutaneous instrumentation for the injection of therapeutic formulations is less extensive or complex, and this approach offers the safety advantages of no surgery (avoiding peritoneal puncture wounds and gas distension) and minimal immobilization time. Additionally, the access route can be lined with hemostatic biodegradable materials to further reduce the likelihood of significant bleeding.

[0278] According to one embodiment of delivery by injection, the therapeutic bioactive cell formulation is injected into the renal cortex. It is important to distribute the therapeutic formulation as widely as possible within the renal cortex, which can be achieved, for example, by entering the renal cortex at an angle that allows for placement of the therapeutic formulation within the renal cortex as widely distributed as possible. This may require imaging the kidney using a longitudinal or transverse approach, either ultrasound-guided or computerized axial tomography (CT) imaging, depending on the characteristics of the individual patient. Ideally, the injection is performed as the needle / cannula is gradually withdrawn. This will result in multiple implants. The entire therapeutic product should be delivered to one or more injection points. In some embodiments, up to two injection points may be used to administer the therapeutic formulation. The entire amount of the drug can be implanted into the kidney. In one embodiment, one or more injections can be administered. Multiple injection points, e.g., one or two injection points, can be used in one kidney. In one embodiment, the injections are given to both kidneys, one or two in each kidney. This is done using multiple injection points, for example one or two injection points.

[0279] The foregoing description is deemed sufficient to enable one skilled in the art to practice the invention. It will be appreciated that while the present invention has been specifically disclosed by preferred embodiments and optional features, those skilled in the art may resort to modifications and variations of the concepts described herein, and such modifications and variations are deemed to be within the scope of the present invention as defined by the appended claims. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Indeed, it will be apparent from the foregoing description that various modifications of the present invention in addition to those shown and described herein are possible. As will be apparent to those skilled in the art, it is within the scope of the appended claims.

[0280] All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety. (Example) [Example]

[0281] Example 1 - Non-limiting examples of methods and compositions for making SRC Example 1.1 - Solution Preparation The Examples in this section provide compositions of various media products and solutions used in the isolation and characterization of heterogeneous renal cell populations and for the manufacture of regenerative therapy products.

[0282] [Table 6] Dulbecco's phosphate-buffered saline (DPBS) was used for all cell washes.

[0283] Example 1.2 - Isolation of a heterogeneous unfractionated kidney cell population The Examples in this section demonstrate the isolation of an unfractionated (UNFX) heterogeneous renal cell population from humans. A heterogeneous cell suspension was generated from human renal tissue by initial tissue dissociation.

[0284] Renal tissue from kidney biopsies provided the source for heterogeneous renal cell populations. Renal tissue containing one or more of the following tissues can be used: cortex, corticomedullary junction, or medullary tissue. It is preferable to use medullary border tissue. Avoid scar tissue and take multiple biopsies from CKD kidneys. Cores (minimum 2) were required. The kidney tissue was collected approximately 4 weeks before the planned transplantation of the final NKA. The tissue was obtained by clinical investigators from patients in clinical settings. The cells were transported in tissue transport medium.

[0285] The tissue was then washed with the tissue wash solution of Example 1.1 to reduce the incoming bioburden before processing the tissue to remove cells.

[0286] The kidney tissue was minced, weighed, and dissociated in the digestion solution of Example 1.1. The resulting cell suspension The cells were neutralized in Dulbecco's modified Eagle's medium (D-MEM) plus 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, Calif.), washed, and resuspended in serum-free, additive-free keratinocyte medium (KSFM) (Invitrogen). The cell suspension was then centrifuged across a 15% (w / v) iodixanol (OptiPrep™, Sigma) density boundary and transferred to tissue-culture-treated polystyrene films. Cells were grown in a LASCO or dish at a cell density of 25,000 cells / cm2 in the kidney cell growth medium of Example 1.1. Red blood cells and debris were removed before initiating culture at 4°C. For example, cells can be cultured on the surface of a T500 Nunc flask at 25x106 cells / flask in 150 ml of 50:50 medium.

[0287] Example 1.3 - Cellular expansion of isolated renal cell populations Renal cell expansion depends on the amount of tissue received and the successful isolation of renal cells from the received tissue. Isolated cells can be cryopreserved if desired (see above). Renal cell expansion rates can vary from sample to sample due to the inherent variability of cells isolated from individual patients.

[0288] Cells that fit the range of cell recovery rates due to the diversity of tissue received, as described in Table 7. Renal cell proliferation was performed using the designated cell culture method according to the Renal Cell Proliferation Methods in Table 6. In a closed culture vessel (e.g., T-flask, Cell Factories, HyperStacks) in a growth medium, Requires serial passage within the NIH 47000-12000 trademark.

[0289] To eliminate the inherent risks associated with the use of BPE for human clinical trials, we developed a BPE-free medium. Cell proliferation, phenotype (K18), and cell function (GGT and LAP enzyme activity) were evaluated in the BPE-free medium and compared with the BPE-containing medium used in animal studies. Phenotype and function were comparable in the two media (data not shown). [Table 7]

[0290] Once cell growth was observed in the first T-flask (passage 0) and there were no visible signs of contamination, the medium was replaced and then changed every 2–4 days (Figure 3B). Cells were assessed to verify kidney cell morphology by visual observation of the cultures. Cultures characteristically exhibited a tight, cobblestone appearance due to cell aggregation. These morphological features change during growth and may not be present at every passage. Cell culture confluence was estimated at various confluence levels within the culture vessels used throughout cell growth.

[0291] Renal cells were trypsinized when the culture vessels were at least 50% confluent. The cells were passaged by the following method (Figure 3B). The detached cells were collected in a container containing kidney cell growth medium, counted, and cell viability was calculated. At each cell passage, the cells were cultured to the number required for NKA preparation. To expand the cell population, seed cells at 500-4000 cells / cm² into a sufficient number of culture vessels. ) (Figure 3B). Culture vessels were placed in a 37°C incubator with 5% CO2. Cell morphology and confluence were monitored as described above, and tissue culture medium was changed every 2–4 days. Table 8 describes the human kidney cell viability observed during cell isolation and expansion of six kidney biopsy specimens from human donors. [Table 8]

[0292] The inherent variability of tissues obtained from different patients resulted in differences in cell yield during culture. Therefore, it is not practical to strictly define the timing of cell passage or the number and type of culture vessels required per passage to achieve the target cell number. Typically, kidney cells undergo two or three passages; however, the culture period and cell yield may vary depending on the cell growth rate.

[0293] Cells were harvested or passaged using 0.25% trypsin with EDTA (Invitrogen). Viability was assessed by trypan blue exclusion and counts were performed manually using a hemocytometer or using an automated Cellometer® counting system (Nexcelom Bioscience, Lawrence Mass.).

[0294] Example 1.4 - Cryopreservation of cultured cells The expanded kidney cells were routinely cryopreserved to adjust for the inherent variability of cell proliferation from individual patients and to administer the product on a predetermined clinical dosing schedule. The cryopreserved cells provide a backup cell source in the unlikely event that another NKA is needed (e.g., due to a patient illness delay, an unanticipated event, etc.). The conditions used to cryopreserve the cells and recover viable, functional cells upon thawing were established.

[0295] For cryopreservation, cells were suspended in cryopreservation solution (see Example 1.1) to a final concentration of approximately 50x106 cells / mL and dispensed into vials. The 1 ml vials were placed in the freezer compartment of a controlled-rate freezer and frozen at a preprogrammed rate. After freezing, the cells were transferred to a liquid nitrogen freezer for intermediate storage.

[0296] Example 1.5 - Preparation of SRC cell populations Selected renal cells (SRCs) are expanded from cryopreserved cells according to schedule. They can be prepared either from the final culture vessel or directly from the expansion culture (Figure 3B).

[0297] If using cryopreserved cells, thaw the cells and perform one final expansion step. The cells were cultured on the surface of tissue culture vessels for 24 h. The final culture vessels were approximately 50-100% confluent. Once this occurs, the cells are ready to be processed for SRC isolation. A medium change and final wash of the NKA dilutes any remaining cryopreservation solution in the final product.

[0298] When the last cell culture vessel reached at least 50% confluence, the vessel was transferred to a hypoxic incubator set at 37°C in a 5% CO2 atmosphere with 2% oxygen (Figure 3C). The cells were cultured overnight. They could be maintained in an oxygen-controlled incubator set at 2% oxygen for as long as 48 hours. Exposure to a more physiologically appropriate hypoxic (2%) environment improved cell isolation efficiency and allowed for better detection of hypoxia-inducible markers such as VEGF.

[0299] After exposing the cells to hypoxic conditions for a sufficient period of time (e.g., overnight to 48 hours), the cells were detached using 0.25% trypsin containing EDTA (Invitrogen). Viability was assessed by trypan blue exclusion. Cells were assessed by ELISA and counted manually using a hemocytometer or using an automated Cellometer® counting system (Nexcelom Bioscience, Lawrence Mass.) Cells were washed once with DPBS and resuspended in DPBS to approximately 850 x 10 cells / mL.

[0300] Cell collection based on cell buoyant density using centrifugation across the density boundary / interface The renal cell suspension was separated by centrifugation over a 7% iodixanol solution (OptiPrep in OptiMEM; 60% (w / v); see Example 1.1).

[0301] A 7% OptiPrep density interface solution was prepared and the refractive index of the desired density was measured prior to use (RI 1.3456 + / - 0.0004). A layer of harvested kidney cells was placed on top of the solution. This density interface was centrifuged. Centrifuged at 800 g for 20 minutes at room temperature in a tube or cell processor (e.g., COBE 2991). Cell fractions exhibiting a buoyant density greater than approximately 1.045 g / mL were collected as a separate pellet after centrifugation. Cells maintaining a buoyant density less than 1.045 g / mL were discarded.

[0302] The SRC pellet was resuspended in DPBS (Figure 3C). Carryover of residual OptiPrep, FBS, medium, and supplemental materials was minimized by four DPBS washes and one gelatin solution step. [Example]

[0303] Preparation of selected kidney cells Briefly, renal biopsies were purified with 4.0 units / mL dispase (Stem Cell Technologies, Inc., Vancouver, BC, Canada) and 300 units / mL collagenase IV (Worthington The enzyme is released in a buffer containing PEG-100 (Biochemical, Lakewood, NJ, USA). Red blood cells and debris are removed by centrifugation using 15% iodixanol (Optiprep®, Axis Shield, Norton, MA, USA). Primary kidney cells are seeded onto tissue culture-treated polystyrene plates (NUNC, Rochester, NY, USA) and cultured in a 1:1 mixture of 50:50 medium, high glucose Dulbecco's Modified Eagle Medium (DMEM): 5% fetal bovine serum (FBS), 1X ITS (insulin / transferrin / sodium selenite medium supplement), and keratinocyte serum-free medium (KSFM) containing antibiotics / antimycotics (all from Invitrogen, Carlsbad, CA, USA). After culture, primary kidney cells were cultured prior to cell isolation. Cultures were transferred from atmospheric oxygen conditions (21%) to more physiological oxygen conditions to improve cell isolation efficiency. Transfer to a clinically appropriate hypoxic (2%) environment for 24 hours. 75 x 10 cells in 2 mL of unsupplemented KSFM (uKSFM)6 Primary kidney cell cultures were isolated using a four-step iodixanol (OptiPrep; 60% w / v in uKSFM) density gradient in 15 mL polypropylene conical tubes. (16%, 13%, 11%, and 7%) at 800 g for 20 min at room temperature. After centrifugation, all bands were diluted with sterile phosphate buffered saline (PBS) before use. ) and wash three times.

[0304] In one embodiment, the cells express SRCs to reduce rejection by the recipient. In order to render the cells immunoprivileged, the cells are genomically modified to remove genes encoding immunologically active cell surface antigens. In one embodiment, the cells are genomically modified to render the cells immunoprivileged by genetically modifying the SRCs to reduce rejection by the recipient. To achieve this, the cells are genetically modified (eg, using RNAi) to reduce the expression of genes encoding immunologically active cell surface antigens.

[0305] From the density gradient centrifugation step, a mixed biomass sample exhibiting a buoyant density above approximately 1.0419 g / mL was obtained. The bioactive kidney cells are used to generate therapeutically bioactive SRCs. Cell preparation is also described, for example, by Kelley et al. (Am J Physiol Renal Physiol 2010; 299: F1026-39), Kelley et al. (Cell Transplant 2013; 22:1023-39), Bruce et al. (Methods Mol Biol. 2013; 1001:53-64), and Basu et al. (Cell Transplant. 2011; 20:1171-901). The cell suspension (100 μL) was placed in a gelatin-based hydrogel biomatrix. Mix with terial and load into a 10 cc syringe to dispense the therapeutic product.

[0306] Cell viability is measured (trypan blue exclusion) at each culture passage and during formulation. Cell phenotype and cell potency assays are performed on the final product as previously described (Basu and Ludlow. Regen Med 2014; 9:497-512). All procedures are in accordance with FDA and and MPA QP guidance and is carried out in compliance with current Good Manufacturing Practices (cGMP). [Example]

[0307] A general method for engineering human allogeneic kidney cells for the treatment of chronic kidney disease Treatment of patients with selected renal cells of the present invention is based on the use of genomically modified, immunoprivileged cells that lack surface antigens that render the cells rejection-competent. In one embodiment, bioactive renal cells are harvested from a patient or donor and selected ex vivo. The cells are selected, cultured in vitro to expand the cell numbers if necessary, and finally infused into the patient. Each patient receives a treatment prepared with genomically modified, immunoprivileged, bioactive kidney cells that lack surface antigens that lead to kidney cell rejection (i.e., immunoprivileged bioactive kidney cell therapy). To better understand the present invention, immunoprivileged NKA cells are used in the treatment of kidney disease. A schematic diagram of the manufacturing process steps for the product is shown in Figure 1.

[0308] The matching level between the donor candidate and the recipient is inadequate. To increase the likelihood of transplantation into a potential recipient, gene editing specific to the targeted allele is performed using Cas9 and specifically identified gRNA molecules. As a result, the level of HLA matching between cells derived from mismatched donors is improved through gene disruption. This makes the donor more suitable for the recipient (by reducing HLA mismatches). Primary human kidney cells or enriched SRCs obtained from donor and recipient pairs Multiple HLA (MHC class I and class II) gene editing can be used to increase the match of donor SRCs to the recipient.

[0309] Potential rejection of transplanted HLA-mismatched allogeneic cells (e.g., bioactive kidney cells) To reduce the risk of HIV infection, six HLA alleles (2 each in HLA-A, HLA-B, and HLA-DRB1) were used. HLA typing of recipient subjects requiring transplantation ( (For example, determining HLA-A, HLA-B, and HLA-DRB1 polymorphisms). The recipient's genotype should be identical, as a 6 / 6 HLA allele match is associated with a reduced risk of immune rejection after transplantation. Ideally, the donor should be matched with a 6 / 6 HLA allele match. A 6 / 6 HLA allele match can be obtained from a bone marrow or cord blood HSC bank, or from a relative member. If a donor with a 5 / 6, 4 / 6, 3 / 6, or 2 / 6 HLA allele match is not available, but a partially matched donor with a 5 / 6, 4 / 6, 3 / 6, or 2 / 6 HLA allele match is available, the method described herein can be used to identify a partially matched donor. This can reduce mismatches between the recipient and the donor. If necessary, one or more alleles (2, 3, 4, 5, or 6 alleles) of the gene editing method described herein. to reduce the risk of developing immunosuppression and the severity of the disease in the transplant recipient.

[0310] The methods described herein can be used to modify donor kidney cells (e.g., BRCs and / or SRCs) to generate immune-privileged kidney cells. For example, specific populations In order to generate cells that match the most frequently occurring HLA genotype in Using methods to disrupt (e.g., knock out) one, two, or three HLA alleles in the donor SRC For example, the 10 most common traits of four ethnicities in North America can be identified. Haplotypes of the genotypes are listed, for example, at https: / / bioinformatics.bethematchclinical.org / hla-resources / haplotype-frequencies / ; Burdett et al., Hum. Immunol. 64 (10 Suppl): S6 (2003) and the National Marrow Donor Program HLA haplotype frequency data provided in the National Marrow Donor Program.

[0311] For each gRNA, one oligonucleotide is designed and obtained. a promoter and gRNA scaffold (e.g., including everything except the targeting domain, e.g., including sequences derived from the crRNA and tracrRNA, e.g., a first complementarity domain; a linker domain; a second complementarity domain; a proximal domain; and a tail domain) The gRNA-specific nucleotides (including the nucleotide sequence) are amplified separately by PCR and purified as dsDNA molecules. The U6 and gRNA scaffolds are joined using oligonucleotides, linked by a targeting domain specified within the oligonucleotide. The resulting dsRNA molecule is transfected. Purify the vector for in vivo transcription or for in vitro transcription. Alternative promoters can be used for transcription. Any gRNA scaffold can be used to generate gRNAs compatible with Cas9 from any bacterial species.

[0312] Each gRNA of interest is combined with a plasmid expressing Cas9 and a small amount of GFP-expressing plasmid. The antibody is transfected into human cells with the antibody. In preliminary experiments, these cells can be immortalized human cell lines such as 293T, K562, or U20S. Alternatively, primary human cells can be used. In this case, the cells may be related to the ultimate therapeutic cell target (e.g., erythroid cells). The use of primary cells similar to the intended therapeutic target cell population can provide important information about the rate of gene targeting in relation to the underlying chromatin and gene expression.

[0313] Transfection was performed using lipid-mediated transfection (Lipofectamine or Fugene). or by electroporation (Lonza Nucleofection™, etc.) After transfection, GFP expression can be monitored by fluorescence microscopy or These preliminary transfections can be used to confirm consistent, high levels of transfection, as determined by flow cytometry or by PCR. Different gRNAs and different targeting approaches (17-mer, 20-mer, nuclease, dual nickase, etc.) can be included to determine which combination gives the greatest activity.

[0314] The efficiency of cleavage by each gRNA can be assessed by T7EI assay or sequencing of indels (insertion deletions) caused by NHEJ at the target locus. Alternatively, other mismatch-sensitive enzymes, such as Cel1 / Surveyor nuclease, can be used.

[0315] For the T7EI assay, the PCR amplicon is approximately 500-700 bp, and the target cleavage site is asymmetrically located within the amplicon. After amplification, purification, and size confirmation of the PCR product, the DNA is transformed. The hybridized PCR products are then digested with T7 endonuclease I (or other mismatch-sensitive enzyme), which recognizes and cleaves non-perfectly matched DNA. If indels are present in the original template DNA, the amplicons are denatured and reannealed. When the DNA strands are hybridized, the hybridization of the DNA strands with different indels is suppressed. This results in double-stranded DNA that is not perfectly matched. The fraction of cleaved DNA (the optical density of the cleavage products divided by the optical density of the cleaved and uncleaved DNA) can be visualized by gel electrophoresis or by capillary electrophoresis. ) can be used to estimate percent NHEJ by the following equation: %NHEJ = (1-(1 - percent cleaved)'72). The T7EI assay is sensitive down to approximately 2-5% NHEJ.

[0316] Sequencing may be used instead of, or in addition to, the T7EI assay. For Sanger sequencing, purified PCR amplicons are cloned into the plasmid backbone. cloned, transformed, miniprepped, and sequenced with one primer. After determining the NHEJ rate by T7EI, Sanger sequencing can be used to determine the exact nature of the indels. Sequencing can also be performed using next-generation sequencing techniques. When using next-generation sequencing techniques, amplicons can be 300-500 bp in length with the desired cleavage sites asymmetrically positioned. After PCR, next-generation sequencing adapters and barcodes (e.g., Illumina multiplex adapters and indexes) can be added to the ends of the amplicons for use in, for example, high-throughput sequencing (e.g., Illumina MiSeq). This method allows for the detection of very low NHEJ rates.

[0317] The methods described herein are useful for identifying gRNAs for use with CRISPR / Cas9 molecules. While exemplified for this purpose, the gRNA identification methods described herein can be used to identify sequences that can be used with other nucleases (e.g., TALENs, Cpfl, and zinc finger nucleases). It will be readily apparent to those skilled in the art that various modifications to the example embodiments will be readily apparent to those skilled in the art, and that the general principles described herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention. Moreover, in the following description, for purposes of explanation, numerous specific details are set forth. However, those skilled in the art will recognize that the invention can be practiced without these specific details. [Example]

[0318] Immunogenicity and efficacy studies using genome-modified immune-privileged SRCs In the first animal study, genomically modified immune-privileged mice derived from wild-type rats were SRC was injected into the kidneys of mutant Sprague Dawley (SD) rats with polycystic kidney disease (PCK). The primary endpoint to be evaluated is the number of wild-type, genome-altered, immune-privileged SRCs remaining in mutant kidney nephrons. PCK SD rats with chronic kidney disease (CKD) and injected with wild-type syngeneic SD rat SRCs were used for qualitative examination of localization as well as for analysis. At the offspring level, the degree of wild-type incorporation and retention in affected nephrons will be assessed using tissue in situ hybridization and PCR, histological methods, to quantify the extent of wild-type incorporation and retention in affected nephrons.

[0319] In a second experiment, human SRC gene editing was evaluated using four in vitro assays to assess SRC function after ablation of genes controlling MHC class I, class II, or class I and II. CRISPR / Cas9 was introduced by electroporation, and SRC was examined for its effects on chemotaxis, tubule formation, cytokine release, and chemotaxis. [Example]

[0320] MHC repression in SRCs CRISPR / Cas9 is a flexible and simple method that offers high specificity and low cytotoxicity. The CRISPR / Cas9 genome editing system allows for specific genome disruption and replacement. The assembly system is driven by the Cas9 protein and expressed from the human U6 polymerase III promoter. It requires co-expression with a guide RNA vector. If a protospacer adjacent motif (PAM - sequence NGG) is present at the 3' end, Cas9 recognizes the target sequence via the guide RNA and then transduces it into DNA. The double strand is unwound and both strands are cut. A functional cassette synthesized in a rescue donor vector can then be inserted into the unwound DNA. The repaired genome is now: CRISPR was initially used to "knock out" target genes in various cell types and organisms, but modifications of the Cas9 enzyme have enabled the selective activation or repression of target genes, allowing specific regions of DNA to be expressed. The application of CRISPR has expanded to the point where it can even be purified and used to image DNA in living cells using fluorescence microscopy.

[0321] We chose to use CRISPR / Cas9 gene editing to target the B2M or HLA-A (subunit) components of MHC-I. Epigenetic modifications at the targeted genomic locus can alter the accessibility of the target DNA site to cas proteins. We found that guide RNAs that successfully knock down B2M gene expression target near the gene's transcription start site within open chromatin regions characterized by extensive methylation of nucleosomal H3K4 residues. Publicly available software (CHOPCHOP, WU-CRISPR) allows the derivation of CRISPR targeting constructs (guide RNAs that bind to specific DNA sequences). Electroporation was used to transfect kidney cells. The target DNA sequence is as follows: Target DNA sequence GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 346) PAM sequence AGG Target locus Chr.15: 44711563 - 44711585, GRCh38 (See UCSC (the University of California, Santa Cruz) Genome Browser genome assembly GRCh37 / hg19, chr15:45003685-45010357, NM_004048.2) Strand Reverse

[0322] Using electroporation to introduce CRISPR / Cas9 constructs into primary human kidney cells To deliver the CRISPR / Cas9 construct, lipofection, known to those skilled in the art, Other methods may also be applied, including transfection, microinjection, etc. Although the results shown below focus on the B2M subunit, a similar approach can be applied to target polypeptides (HLA-A).

[0323] Human primary kidney cells (1x10 6 ) were electroporated with a CRISPR / Cas9 construct that specifically targets the B2M component of the MHC-I complex. All work related to Figures 6–8 was performed in kidney tissue. This was done using human primary kidney cells cultured after enzymatic digestion of the tissue. These cells yield SRCs. Cells were not treated as described above. Cells were allowed to recover 48 hours after electroporation. B2M expression was assessed by FACS. Electroporation was performed using a Gene Pulser Xcell™ electroporation system (Bio-Rad Laboratories, Inc., Hercules, California, USA) with preset program #1: square wave pulse mode, in a total volume of 100 μL. , in a 0.2 cm cuvette at 160 volts for 5 ms.

[0324] Separately, human primary kidney cells (1x10 6 ) specifically targeting the B2M component of the MHC-I complex. The CRISPR / Cas9 constructs were introduced into the cells by electroporation. The cells were harvested 5 days after transfection, and B2M expression was assessed by FACS.

[0325] As shown in Figure 6, the present inventors measured the activity of IgG4-dependent ... By electroporation, we were able to reduce B2M expression by 47%. A similar reduction was observed 5 days after electroporation, indicating stable transfection. See Figure 7.

[0326] Positional molecular analysis showed that the B2M knockout occurred unambiguously at the B2M locus (see Figure 8), which is important for the stability of the cellular product.

[0327] This approach serves as a potency assay for SRC, regardless of the SRC donor cell ABO haplotype. B2M was successfully knocked out without affecting SRC function, as measured by secretion of VEGF and KIM1. See Figures 9 and 11.

[0328] Mixed lymphocyte reactions (MLR) are used in medicine to demonstrate the safety of drugs or implantable materials. It is a test used by the pharmaceutical and biotechnology community. It is commonly used as part of the U.S. Food and Drug Administration (FDA) approval process. Technically, it is the ex vivo cellular immunoassay that occurs between two allogeneic lymphocyte populations (same species but genetically distinct). In a one-way MLR, only one lymphocyte population can respond or proliferate. In a two-way MLR, both populations can proliferate. MLR is performed to assess how T cells respond to external stimuli. T cells are white blood cells that scan for cellular abnormalities and infection. T cells are essential for human immunity.

[0329] We performed a one-way MLR using CRISPR gene-edited cells as control and stimulator populations. It is predicted that if B2M expression is successfully knocked out or down, there should be a decrease in lymphocyte proliferation. As shown in Figure 10, three different SRC preparations, each with different levels of B2M downregulation based on FACS, were examined and associated. A concomitant decrease in lymphocyte proliferation was observed.

[0330] We now have a system that can demonstrate level-controlled gene knockout and correlation with in vitro immune responses. Minimizing, if not eliminating, the use of immunosuppressive drugs, which have their own deleterious effects on the human body, will be required for recipients of this therapy. [Example]

[0331] Typical NKA formulation components 1. Cellular components and materials SRC constitutes the biologically active component of NKA. SRC is primarily known for its regenerative capacity. Consists of tubular epithelial cells. Other parenchymal (vascular), mesenchymal, endothelial, and interstitial (collecting duct) cells may be present in the autologous SRC population.

[0332] SRC is a renal cortex biopsy obtained using standard-of-care renal biopsy techniques to obtain a core of kidney tissue. Renal cells are prepared from renal tissue by enzymatic digestion and expanded using standard cell culture techniques. Cells are assessed to verify renal cell morphology by visual observation of the cultures under a microscope. The cultures characteristically exhibit a tight, cobblestone-like appearance due to cell aggregation (Figure 13). SRCs are isolated and expanded cells at the density boundary. or obtained by separation across a density interface or a single-step discontinuous density gradient. do.

[0333] Centrifugation across a density boundary or interface is used to separate the collected renal cell population based on cell buoyant density. The renal cell suspension is diluted with OptiPrep (7% in OptiMEM). The cells are separated through a solution of iodixanol (60% (w / v)) medium. Cell fractions exhibiting a buoyant density greater than approximately 1.0419 g / mL are collected as individual pellets after centrifugation (Figure 14). Cells maintaining a buoyant density less than 1.0419 g / mL are discarded.

[0334] The SRC pellet is resuspended in DPBS. Carryover of residual Optiprep, FBS, media and supplements in the final product is minimized by the wash steps.

[0335] 2. Biomaterial components and auxiliary materials The following biomaterial components and auxiliary materials are used for the formulation of SRC into NKA: 1. Porcine gelatin - used to make thermoresponsive hydrogels. 2. Dulbecco's Phosphate Buffered Saline (DPBS) - Used to dissolve porcine gelatin. This buffer can be replaced with or mixed with human plasma or human platelet lysate.

[0336] Biomaterial samples The biomaterial consisted of porcine gelatin in a solution of gelatin in DPBS. The gelatin was prepared at the indicated concentrations in DPBS, human plasma / human platelet lysate, or a mixture of both. The gelatin solution is then dissolved to form a gelatin solution of thermo-responsive hydrogel. The gelatin solution is sterilized by filtration through a 0.1 μm filter, and can be divided into single-use doses that can be dispensed immediately and stored in the refrigerator. Or store frozen.

[0337] An important property of the biomaterial is that it is a thermoresponsive hydrogel, capable of gelling and liquefying at different temperatures. The liquid is liquid above room temperature (22-28°C) and gels when cooled to refrigerated temperatures (2-8°C).

[0338] Gelatin solution concentration Gelling properties - ability to form a gel at refrigeration temperatures (does not flow when inverted) Gelatin concentrations ranging from 0.5-1.0% were evaluated for their ability to be liquid (flow freely when inverted) at room temperature. Table 9 shows the gelatin content of gelatin solutions of various concentrations. This shows the characteristics of the

[0339] [Table 9]

[0340] Because NKA formulated with gelatin solutions of 0.63% or higher consistently met the criteria, the gelatin concentration range of 0.88 ± 0.12% was selected for NKA formulations. However, formulations containing gelatin in concentrations ranging from about 0.63% to about 1% are also suitable. I will leave it at that.

[0341] 3. NKA preparation SRCs are formulated into NKAs using a gelatin solution, a gelatin-based thermoresponsive hydrogel, which provides improved cell stability and therefore extends the shelf life of the product and facilitates delivery of SRCs into the renal cortex for clinical utility. and stability during delivery. Formulation development evaluated the composition, concentration, and stability of the gelatin solution.

[0342] Washed SRCs are counted by trypan blue exclusion. The gelatin solution is kept refrigerated. The SRCs are removed from the culture medium and liquefied by warming to 26-30°C. A volume of the SRC suspension containing the required number of cells is centrifuged and resuspended in liquefied gelatin solution for a final washing step. This suspension is centrifuged and the SRC pellet is resuspended in 100x10 ml of formulated NKA. 6 Resuspend in sufficient gelatin solution to achieve a resulting SRC concentration of 100 cells / mL.

[0343] NKA filling and gelling NKA products are aseptically filled into syringes. Viable sampling and Dynamic air sampling is performed, including viable and non-viable cell sampling. To form the final gelled NKA, the NKA package is rotated for a minimum of 2 hours to keep the cells suspended while cooling to 2-8°C. Rapid cooling is necessary for gelation to occur so that the cells do not settle in the gelatin solution. Immediately after placing in refrigerated conditions, the temperature of the gelatin solution in the syringe is monitored. A rapid temperature drop is observed, as shown in Figure 15. After 1 hour The temperature typically drops within 0.3°C from a final temperature of 4.4°C.

[0344] Cooling the gelatin solution initiates the gelation process, but the SRC remains suspended in the gel during storage. The formed gel requires a certain amount of time to stabilize so that it maintains its state. The syringe containing the formulated NKA was rotated overnight or for 1.25 hours, then allowed to stand overnight. The contents were then removed and the cell concentration was measured in four different portions of the product. Analysis showed no differences between the four sections, and NKA did not result in measurable cell settlement after a minimum of 1.25 hours of cold rotation (Figure 16).

Claims

1. A method for producing genomically modified bioactive renal cells (BRCs) comprising genetically modifying the genomic immunogenic genes of BRCs, wherein the genes are major histocompatibility complex (MHC) clones. The method as described above, wherein the polypeptide encodes a protein within an MHC class I molecule or an MHC class II molecule.

2. 2. The method of claim 1, wherein the gene is a B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, or HLA-DQB1 gene.

3. The method of claim 1, wherein genetically modifying the gene comprises mutating the gene. Law.

4. 3. The method of claim 3, wherein mutating the gene comprises deleting the gene or a portion thereof. The method described below.

5. Any combination of two or more of the B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1, and / or HLA-DQB1 genes The method of claim 3, comprising mutating the combination.

6. 2. The method of claim 1, wherein the BRCs are selected renal cells (SRCs).

7. The method of claim 6, wherein the SRC is in an SRC population.

8. The method of claim 7, wherein the SRC is a renal tubular cell.

9. The method of claim 8, wherein the tubular cells are proximal tubular cells.

10. The method of claim 6, wherein the SRC is an endocrine cell, a vascular cell, or a glomerular cell.

11. The method of claim 7, wherein the SRC population comprises hypoxia-resistant and iodixanol-resistant cells.

12. The method of claim 7, wherein the SRC population comprises cells that express hyaluronan synthase 2.

13. The method of claim 7, wherein the SRC population comprises cells capable of receptor-mediated albumin transport.

14. Genetically modifying a gene to (i) express a gene-edited protein in BRCs; or (ii) delivering a gene-editing protein across the cell membrane of the BRC.

15. The gene editing protein is a zinc finger nuclease (ZFN), a transcription activator-like Effector-directed nucleases (TALENs), megaTALs, or RNA-guided endonucleases 15. The method of claim 14, wherein

16. 16. The method of claim 15, wherein the RNA-guided endonuclease is a Cas protein.

17. 16. The method of claim 15, wherein the Cas protein is a Cas9 protein.

18. Genetically modifying the gene further comprises: (i) expressing a guide RNA (gRNA) in the BRC; or (ii) delivering a guide RNA (gRNA) across the cell membrane of the BRC.

17. The method of claim 16.

19. 19. The method of claim 18, wherein the Cas9 protein and the gRNA are part of a ribonucleoprotein complex.

20. and culturing the BRCs to produce progeny having the genetic modification in the gene. The method described in item 1.

21. 21. The method of claim 20, wherein the progeny exhibit a reduced likelihood of immune rejection compared to corresponding cells that do not contain the genetic modification in the gene.

22. 16. The method of claim 15, wherein the gene-editing protein is expressed from transfected mRNA.

23. The gene editing protein is a recombinant protein that forms a complex with the gRNA ex vivo. The method of claim 15.

24. The gene editing protein is a recombinant protein that forms a complex with the gRNA ex vivo. The protein / gRNA complexes can be used for transfection, lipofection, electroporation, and other applications.

16. The method of claim 15, wherein the antibody is delivered to the cell by troporation or microinjection.

25. Additional nucleic acid elements encoding selectable markers and / or target genes may be included.

18. The method of claim 17, wherein the specific mutation is introduced into the cell together with the Cas9 protein / gRNA complex.

26. 19. The method of claim 18, wherein the Cas protein is expressed from transfected mRNA and the gRNA is expressed from plasmid DNA.

27. 23. The method of claim 22, wherein the transfected mRNA is stabilized by including modified nucleobases or polyadenylation sequences.

28. The transfected mRNA is conjugated to at least one cell-penetrating peptide.

23. The method of claim 22.

29. 17. The method of claim 16, wherein the Cas protein is expressed from a DNA vector.

30. Cas protein expression occurs during at least part of the time that the gRNA is expressed in the cell.

30. The method of claim 29, wherein the induction occurs during

31. 30. The method of claim 29, wherein the DNA vector does not integrate into the genome.

32. 30. The method of claim 29, wherein the DNA vector is an episomal vector or an artificial chromosome.

33. 30. The method of claim 29, wherein the DNA vector is a transposon.

34. 19. The method of claim 18, wherein the gRNA is a transcript from a DNA vector.

35. The method of claim 1, wherein genetically modifying the gene reduces the amount of MHC class I on the cell surface.

36. Genetic modification of the gene reduces the amount of MHC class II on the cell surface. The method according to claim 1.

37. Genetic modifications in two or more genes, at least one of which is an MHC at least one of the genes encodes a protein within an MHC class II molecule The method of claim 1, wherein the protein is encoded by the method of claim 1.

38. The method of claim 1, wherein at least one of the genes is an HLA gene.

39. 10. The method of claim 1 for preparing a BRC for use as a medicament.

40. 10. The method of claim 1 for preparing a BRC for treating chronic kidney disease in a patient.

41. 21. The method of claim 20, further comprising propagating the progeny.

42. Propagating the progeny includes passage of the progeny at least one, two, three, four, or five times.

42. The method of claim 41.

43. 43. The method of claim 42, wherein the cell proliferation rate is monitored at each cell passage.

44. 42. The method of claim 41, wherein progeny cell number and viability are monitored by trypan blue dye exclusion and metabolism of PrestoBlue.

45. The method of claim 7, wherein the SRC expresses CK18.

46. 46. ​​The method of claim 45, wherein the SRC expresses GGT1.

47. PrestoBlue metabolism and VEGF and KIM-1 production are key factors in determining the presence of viable and functional progeny. The method of claim 41, wherein the antibody is used as a marker for the detection of HIV-1.

48. 45. The method of claim 44, wherein BRC or SRC functionality is further established by gene expression profiling or enzyme activity measurements.

49. The method according to claim 48, wherein the enzyme activity to be measured is the activity related to LAP and / or GGT. Law.

50. 10. The method of claim 1, wherein the BRC is obtained from a kidney biopsy.

51. 10. An engineered BRC population obtained by the method of claim 1.

52. Contained within major histocompatibility complex (MHC) class I or MHC class II molecules Engineered BRCs containing mutations within protein-coding genes.

53. At least part of a gene is deleted, and the gene is B2M, HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DPA1, HLA-DPA2, HLA-DQA1 , or HLA-DQB1 gene.

54. A method for treating kidney disease in a patient, the method comprising administering a BRC population to the patient. The BRC population includes engineered BRCs, which are , contained within major histocompatibility complex (MHC) class I or MHC class II molecules The method comprises a mutation in a gene encoding the protein.

55. 55. The method of claim 54, wherein the kidney disease is chronic kidney disease.

56. 55. The method of claim 54, wherein the BRC population is an SRC population.

57. 57. The method of claim 56, wherein the SRC population is derived from a patient.

58. 57. The method of claim 56, wherein the SRC population originates from one or more donors.

59. 57. The method of claim 56, wherein the SRC population is obtained after exposure to hypoxic culture conditions.

60. 57. The method of claim 56, wherein the SRC population is obtained after density gradient separation of expanded renal cells.

61. 57. The method of claim 56, wherein the SRC population exhibits a buoyant density greater than about 1.0419 g / mL.

62. Claims wherein the SRC population contains a higher proportion of one or more cell types and is devoid of or deficient in one or more other cell types compared to the starting renal cell population. Item 57. The method according to item 56.

63. a) a temperature-sensitive cell-stabilized biomaterial, and b) an injectable product containing a BRC population. an agent comprising: the BRC population contains engineered BRCs, the engineered BRCs comprising a mutation in a gene encoding a protein contained within a major histocompatibility complex (MHC) class I molecule or an MHC class II molecule; The temperature-sensitive cell-stabilizing biomaterial is a hydrogel, and the hydrogel comprises: (i) Maintaining a substantially solid state at temperatures below about 8°C, and this substantially solid state being a gel It is a state, (ii) remain substantially liquid at or above about ambient temperature; and (iii) At temperatures between about 8°C and about ambient temperature or higher, the solid-liquid transition occurs. Takes a transition state, The injectable formulation.

64. 64. The injectable formulation of claim 63, wherein the hydrogel contains extracellular matrix proteins of recombinant origin, is derived from extracellular matrix obtained from the kidney or another tissue or organ, or comprises gelatin.

65. 65. The injectable formulation of claim 64, wherein the gelatin is derived from type I alpha I collagen.

66. 66. The injectable formulation of claim 65, wherein the gelatin is derived from porcine type I alpha I collagen or recombinant human type I alpha I collagen.

67. 64. The injectable formulation of claim 63, wherein the BRC population is a selected renal cell (SRC) population and the engineered BRCs are engineered SRCs.

68. 62. A method of treating kidney disease in a patient, the method comprising injecting the formulation of claim 61 into the patient, wherein the formulation is injected through an 18-30 gauge needle.

69. Needles are available in approximately 27 gauge, 26 gauge, 25 gauge, 24 gauge, 23 gauge, and 22 gauge. , about 21 gauge, or about 20 gauge.

Citation Information

Patent Citations

  • Renal cell population and its use

    JP2016504017A

  • Cells lacking b2m surface expression and methods for allogeneic administration of such cells

    WO2016073955A2

  • US201218218-24

  • Isolated renal cells and uses thereof

    WO2010056328A1

  • Bioactive renal cells

    WO2011143499A1