Oligonucleotide-based therapeutics and uses thereof

Abstract

To provide compounds that are useful for delivering therapeutic, diagnostic, and imaging agents, to provide pharmaceutical compositions containing such compounds and methods of using the compounds and compositions, and to provide processes for manufacture of the compounds and the compositions containing the same.SOLUTION: Provided are compounds that are selective for cancer cells, are quickly bound to or are internalized into those cells and are quickly localized into appropriate compartments in the cell where the compounds can exact their greatest therapeutic effect in a patient specific fashion. In one aspect, provided is a compound of Formula (I): A-L1-G1-Q-G2(I), where A comprises at least one avidin-type molecule, each avidin-type molecule comprising 1 to 4 monomer units, L1 is a linker group, G1 is a forward primer binding site, Q is randomized single-stranded DNA, and G2 is a reverse primer binding site.SELECTED DRAWING: Figure 1

Description

[Background technology]

[0001] Cancer (malignant tumors) is the second leading cause of death in the United States. Over one million people are diagnosed with cancer each year in the United States, half of whom ultimately die from the disease. Cancer occurs when normal living mammalian cells undergo neoplastic (malignant) transformation. Cancer has a strong ability to metastasize uncontrollably and rapidly throughout the mammalian body, resulting in a high mortality rate.

[0002] Cancer cure rate has been increasing dramatically for several years.This positive trend is the result of the widespread use of selective treatment strategies by various targeting structural motifs, including oligonucleotide targeting motifs.Assuming that the compound that contains oligonucleotide targeting motifs can overcome the obstacle of poor permeability through biological membranes, even if it can be sufficiently selective, they are typically degraded quickly in vivo by endonuclease and exonuclease. Summary of the Invention

[0003] Therefore, there is a need for selective treatment strategies for cancer that are (i) selective (tumor-specific), (ii) overcome the obstacle of poor permeability across biological membranes, (iii) substantially stable to endonucleases and exonucleases without significantly altering their pharmacokinetic and targeting properties, and (iv) enable the development of patient-specific therapeutic agents. Because the compounds disclosed herein contain all of these characteristics, they are selective for cancer cells, are rapidly bound to or internalized by these cells, and are rapidly localized to the appropriate compartments within the cells where they can elicit their maximal therapeutic effect in a patient-specific manner. [Brief explanation of the drawings]

[0004] The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments discussed in the present document. [Figure 1]1 is a photograph of a gel, in which lane 1 corresponds to a water control, lane 2 corresponds to a double-stranded DNA (dsDNA) standard ladder, lane 3 corresponds to a PCR product of the compound of formula (IX), and lane 4 corresponds to a PCR product of the compound of formula (X). [Figure 2] Photograph of a gel showing successful isolation of a drug candidate. DETAILED DESCRIPTION OF THE INVENTION

[0005] Reference will now be made in detail to particular embodiments of the disclosed subject matter. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the illustrated subject matter is not intended to limit the claims to the disclosed subject matter.

[0006] This disclosure relates to AL 1 -G 1 -QG 2 (I) During the ceremony, A comprises at least one avidin-type molecule, each avidin-type molecule comprising 1 to 4 monomer units. L 1 is a linker group; G 1 is the forward primer binding site; Q is randomized single-stranded DNA; G 2 relates to a compound of formula (I) that is a reverse primer binding site.

[0007] As used herein, the term "avidin-type molecule" refers to a -14 ~10 -15 Dissociation constant K on the order of mol / L dExamples of avidin-type molecules include avidin, streptavidin, neutravidin, captavidin, and any other species that participate in avidin-biotin interactions (e.g., non-immunogenic or low-immunogenic forms of streptavidin). See, for example, published U.S. application 2012 / 0039879. Typically, but not necessarily, avidin exists as a tetrameric protein, where each of the four monomer units forming the tetramer can bind to at least one biotin moiety to form what may be referred to as a "biotin-avidin bond." As used herein, the term "biotin-avidin bond" and variations thereof refer to the specific linkage formed between a biotin moiety and an avidin moiety. Typically, the biotin moiety can bind to the avidin moiety with high affinity, typically within 10 -14 ~10 -15 Dissociation constant K on the order of mol / L d Typically, such binding occurs via non-covalent interactions. The compound of formula (I) may further comprise at least one, at least two, at least three, or four biotins or analogs thereof bound to at least one avidin-type molecule.

[0008] Therefore, the present disclosure provides: (B) n -AL 1 -G 1 -QG 2 (Ia) Compounds of formula (Ia) are contemplated, wherein B represents a biotin molecule or an analog thereof, and n is an integer from 1 to 4, and at least 1, at least 2, at least 3, or 4 biotins may be bound to an avidin-type molecule.

[0009] As used herein, the term "biotin" generally refers to a compound of the formula:

[0010] [ka]

[0011] This refers to a compound containing a biotin radical, for example:

[0012] [ka]

[0013] In the formula, each R 2 is a biotin analog of the formula, wherein R is independently H or alkyl. The term "biotin" also includes biotinidase-resistant biotin analogs, including, for example, biotin peptide-linked to unnatural D-amino acids that prevent or minimize recognition by serum biotinidase. See, e.g., Analyt. Biochem. 196:385-89 (1991). The term "biotin" also includes biotin analogs of the formula, wherein R is independently H or alkyl. 2 is an alkyl group, so that the compound is less susceptible to hydrolysis by biotinidase, and therefore the compound as a whole is biotinidase resistant.

[0014] [ka]

[0015] In the formula, L 4 is the linker and X 2 includes labeled biotin compounds of the formula: 211 At, 125 I, or 131 X such as I 2 Radioisotopes covalently bound to L 4 may be any suitable linker, and L 1 and L 2 is defined herein, L 1 and L 2 Thus, for example, L 4may be -alkyl-C(O)-NH-alkyl-NH-, such that L 4 -X 2 The compound comprising the formula:

[0016] [ka]

[0017] is a compound of X 2 is a chelating agent, imaging agent, diagnostic agent, or therapeutic agent, e.g.,

[0018] [ka]

[0019] In the formula, R 3 may be a group of the formula, which is a substituent as defined herein, such as OH. The imaging or diagnostic agent may be a radioisotope, such as, for example, a radioisotope of a metal coordinated to a chelating group. Exemplary radioisotopes of metals include technetium, rhenium, gallium, gadolinium, indium, copper, and the like, and the isotopes 111 In, 99m Tc, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 177 Lu, 89 Sr, 153 Sm, 117m Sn, 227 Th, 226 Th, 230 U, 47 Sc, 86 Y, or 223 Further illustrative examples of radioisotopes include radionuclide imaging agents such as those described in U.S. Pat. No. 7,128,893, the disclosure of which is incorporated herein by reference.

[0020] Exemplary chelating groups include those of formulae (a)-(l):

[0021] [ka]

[0022] [ka]

[0023] and Radiochim Acta 100:653-667 (2012), which is incorporated by reference as if fully set forth herein, and 4 is bound to the chelating groups (a) to (l) on one side, and

[0024] [ka]

[0025] Chelating groups (a)-(l) include chelating groups that bind to L. Chelating groups (a)-(l) are also known by four-letter abbreviations such as EDTA, DTPA, DOTA, TETA, NOTA, cyclam, CPTA, PCBA, DADT, and MAMA, and combinations thereof, each of which may be further substituted. However, chelating groups may be attached to L in any suitable manner. 4 For example, the chelating group can be bonded to chelating groups (a') to (e'):

[0026] [ka]

[0027] As in the case of L 4 may be bonded to Group X 2may also be an imaging agent (e.g., a fluorescent agent), including Oregon Green fluorescent agents, including but not limited to Oregon Green 488, Oregon Green 514, etc., AlexaFluor fluorescent agents, including but not limited to AlexaFluor 488, AlexaFluor 647, etc., fluorescein and related analogs, BODIPY fluorescent agents, including but not limited to BODIPY F1, BODIPY 505, etc., rhodamine fluorescent agents, including but not limited to tetramethylrhodamine, DyLight fluorescent agents, including but not limited to DyLight 680, DyLight 800, etc., CW 800, Texas Red, phycoerythrin, etc.

[0028] Group X 2 may also be an imaging agent (e.g., a PET, gamma imaging agent, or a FRET imaging agent). 2 PET contrast agents are not limited to these three types. 18 F, 11 C. 64 Cu, 65 Cu etc. FRET contrast agents include: 64 Cu, 65 Cu, etc. 18 F and 11 In the case of C, the imaging isotope can be present on an aryl group such as fluorophenyl, difluorophenyl, fluoronitrophenyl, etc. Radioisotopes that can be used for imaging can be adapted to commercially available dosimetry platforms so that subsequent therapeutic radioisotope administration can be calculated.

[0029] Group X 2The radioactive agent may be a therapeutic agent such as a radionuclide that emits alpha particles, beta particles, or Auger electrons, or a chemotherapeutic agent that includes a radical of a cytotoxic compound, including, but not limited to, compounds that enhance tumor permeability, inhibit tumor cell proliferation, promote apoptosis, or decrease anti-apoptotic activity in target cells, among others. Examples of cytotoxic compounds include, but are not limited to, aclamycin and aclamycin derivatives, estrogen, selective estrogen receptor modulators (SERMs), aromatase inhibitors, testosterone (a selective androgen receptor modulator (SARM)), antimetabolites such as cytosine arabinoside, purine analogs, pyrimidine analogs, and methotrexate, busulfan, carboplatin, chlorambucil, cisplatin and other platinum compounds, taxanes such as tamoxifen, taxol, paclitaxel, paclitaxel derivatives, TAXOTERE™, maytansine and its analogs and derivatives, cyclophosphamide, daunomycin, doxorubicin, rhizoxin, T2 toxin, plant alkaloids, prednisone, hydroxyurea, teniposide, mitomycin, discodermolide, microtubule inhibitors, epothilones, tubulysins, cyclosulfonyl 3-hydroxybenzoates, cyclosulfonyl 4-hydroxybenzoates, cyclosulfonyl 5 ... Propylbenz[e]indolone, seco-cyclopropylbenz[e]indolone, O-Ac-seco-cyclopropylbenz[e]indolone, bleomycin and any other antibiotic, nitrogen mustard, nitrosoureas, vincristine, vinblastine and its analogs and derivatives such as, for example, deacetylvinblastine monohydrazide, colchicine, colchicine derivatives, allocorchicine, thiocolchicine, trityl cysteine, Halichondrin B, dolastatins such as, for example, dolastatin 10, amanitins such as, for example, α-amanitin, camptothecin, irinotecan and other camptothecin derivatives thereof, geldanamycin and geldanamycin derivatives, estramustine, nocodazole, MAP4, colcemid, inflammatory and pro-inflammatory agents, peptide and peptidomimetic signal transduction inhibitors, and any other art-recognized drug or toxin.Other therapeutic agents include penicillin, cephalosporins, vancomycin, erythromycin, clindamycin, rifampin, chloramphenicol, aminoglycoside antibiotics, gentamicin, amphotericin B, acyclovir, trifluridine, ganciclovir, zidovudine, amantadine, ribavirin, maytansine and its analogs and derivatives, gemcitabine, and any other art-recognized antibacterial compound. Also included are natural food products and supplements that act as chemopreventive agents, such as, but not limited to, curcumin, resveratrol, EGCG (epigallocatechin-3-gallate), selenium, and emodin.

[0030] As used herein, a "linker group" (e.g., a linker group L 1 , L 2 , L 3 , L 4 , L 5 The term "linker," used interchangeably with "linker," may refer to any suitable linker (e.g., bivalent and polyvalent linkers). For example, the linker may be a hydrophilic linker, such as a linker comprising one or more amino acids (which may be the same or different), polyethylene glycol (PEG) monomers, PEG oligomers, PEG polymers, or any combination of the foregoing. The linker may comprise an oligomer of a peptidoglycan, a glycan, or an anion.

[0031] Linker groups described herein (e.g., L 1 , L 2 , L 3 , L 4 , and L 5) may have any suitable length and chemical composition. For example, the linker may have a chain length of at least about 7 atoms in length. In one variation, the linker is at least about 10 atoms in length. In one variation, the linker is at least about 14 atoms in length. In another variation, the linker is about 7 to about 31 (e.g., about 7 to 31, 7 to about 31, or 7 to 31), about 7 to about 24 (e.g., about 7 to 24, 7 to about 24, or 7 to 24), or about 7 to about 20 (e.g., about 7 to 20, 7 to about 20, or 7 to 20) atoms in length. In another variation, the linker is about 14 to about 31 (e.g., about 14 to 31, 14 to about 31, or 14 to 31), about 14 to about 24 (e.g., about 14 to 24, 14 to about 24, or 14 to 24), or about 14 to about 20 (e.g., about 14 to 20, 14 to about 20, or 14 to 20) atoms in length. In another variation, the linker can have a chain length of at least 7 atoms, at least 14 atoms, at least 20 atoms, at least 25 atoms, at least 30 atoms, at least 40 atoms, or 1 to 15 atoms, 1 to 5 atoms, 5 to 10 atoms, 5 to 20 atoms, 10 to 40 atoms, or 25 to 100 atoms. An example of a linker group having a chain length of 1 to 5 atoms is represented by the formula:

[0032] [ka]

[0033] where R z1 R can be H, alkyl, arylalkyl, or -alkyl-S-alkyl, or the side chain of any natural or non-naturally occurring amino acid, etc., and the number represents the atoms counted as part of the chain, which in this case is 3 atoms. z1 Examples of R include H (i.e., the side chain of glycine), alkyl (e.g., the side chain of alanine, valine, isoleucine, and leucine), -alkyl-S-alkyl (e.g., the side chain of methionine), arylalkyl (e.g., the side chain of phenylalanine, tyrosine, and tryptophan), and the like. z1 The atoms to which is attached may be chiral and may have any suitable relative configuration, such as D- or L-configuration.

[0034] The atoms used to form the linker can be combined in any chemically relevant way, such as a chain of carbon atoms forming an alkylene group, a chain of carbon and oxygen atoms forming a polyoxyalkylene group, or a chain of carbon and nitrogen atoms forming a polyamine. In addition, it is understood that the bonds connecting the atoms in the chain can be saturated or unsaturated, and that divalent radicals contained in L, such as alkanes, alkenes, alkynes, cycloalkanes, arylenes, imides, etc., can also be included. Furthermore, the atoms forming the linker can also be cyclized together to form saturated or unsaturated divalent cyclic radicals in the linker (e.g., of the formula:

[0035] [ka]

[0036] It is understood that a radical of the formula (X) may be formed, 5 are independently CH2, N(X 5 (if there is a bond attached to X), NH, or O, and each X 6 are independent of N, C(X 6 where there is a bond attached to the group, or CH. Thus, for example, the aforementioned group may be of the formula:

[0037] [ka]

[0038] etc. In each of the foregoing and other linker groups described herein, the chain forming the linker can be substituted or unsubstituted. Alternatively, or in addition to chain length, the linker may have any suitable substituents that can affect the hydrophobicity or hydrophilicity of L. Thus, for example, the linker may have a hydrophobic side chain group (e.g., an alkyl, cycloalkyl, aryl, arylalkyl, etc. group, each of which is optionally substituted). When the linker comprises one or more amino acids, the linker may contain hydrophobic amino acid side chains, such as one or more amino acid side chains derived from phenylalanine (Phe) and tyrosine (Tyr), including substitution variants thereof, and analogs and derivatives of such side chains. Variants, analogs, and derivatives of these side chains include, for example,

[0039] [ka]

[0040] and the like, which are variants of tyrosine, amine analogs of tyrosine, and methoxy derivatives of tyrosine, respectively. Other variants, analogs, and derivatives are contemplated.

[0041] The linker may contain a moiety that is neutral under physiological conditions. However, the linker may also contain a moiety that can be protonated or deprotonated to have one or more positive charges or one or more negative charges, respectively. Alternatively, the linker may contain a neutral moiety and a moiety that can be protonated to have one or more positive charges. Examples of neutral moieties include polyhydroxyl groups such as sugars, carbohydrates, saccharides, inositol, and / or polyether groups such as polyoxyalkylene groups including polyoxyethylene, polyoxypropylene, and the like. Examples of moieties that can be protonated to have one or more positive charges include amino groups such as polyaminoalkylenes including ethylenediamine, propylenediamine, butylenediamine, and the like, and / or heterocycles containing pyrrolidine, piperidine, piperazine, and other amino groups, each of which may be optionally substituted. Examples of moieties that can be deprotonated to have one or more negative charges include carboxylic acids such as aspartic acid, glutamic acid, and longer-chain carboxylic acid groups, and sulfate esters such as alkyl esters of sulfuric acid.

[0042] Exemplary polyoxyalkylene groups include those with specific length ranges of about 4 to about 20 polyoxyalkylene (e.g., polyethylene glycol) groups, such as about 4 to 20, 4 to about 20, or 4 to 20 polyoxyalkylene groups. Exemplary alkyl sulfates can also be directly incorporated into the backbone using click chemistry. Exemplary linker groups containing polyamines include EDTA and DTPA radicals:

[0043] [ka]

[0044] (Poly)peptides:

[0045] [ka]

[0046] β-amino acids, etc.

[0047] [ka]

[0048] and combinations thereof, wherein each R 31 are independently H, alkyl, arylalkyl, heterocyclylalkyl, ureido, aminoalkyl, alkylthio, or amidoalkyl, as in the side chains of naturally occurring amino acids such as alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, tryptophan, serine, threonine, asparagine, methionine, lysine, arginine, and histidine. Non-naturally occurring amino acids are also contemplated herein.

[0049] As described herein, a linker may include at least one releasable moiety. In one variation, the linker includes at least two releasable linkers (e.g., cleavable linkers). The choice of releasable or non-releasable linker can be made independently for each application or configuration of the compounds described herein. The releasable linkers described herein include various atoms, chains of atoms, functional groups, and combinations of functional groups. For example, a releasable linker can include about 1 to about 30 atoms (e.g., about 1 to 30, 1 to about 30, and 1 to 30 atoms), or about 2 to about 20 atoms (e.g., about 2 to 20, 2 to about 20, and 2 to 20 atoms). Lower molecular weight linkers (e.g., those having an approximate molecular weight of about 30 g / mol to about 1,000 g / mol, such as about 30 g / mol to about 300 g / mol, about 100 g / mol to about 500 g / mol, or about 150 g / mol to about 600 g / mol) are also described. Precursors to such linkers can be selected to have either nucleophilic or electrophilic functional groups, or both, optionally in protected form with readily cleavable protecting groups to facilitate their use in the synthesis of intermediate species.

[0050] The term "releasable linker" as used herein refers to a linker that contains at least one bond that can be broken under physiological conditions (e.g., a pH-labile, acid-labile, oxidation-labile, or enzyme-labile bond).Releasable groups also include photochemically cleavable groups.Examples of photochemically cleavable groups include linkers containing 2-(2-nitrophenyl)-ethan-2-ol groups, and o-nitrobenzyl, desyl, trans-o-cinnamoyl, m-nitrophenyl, or benzylsulfonyl groups (see, for example, Dorman and Prestwich, Trends Biotech. 18:64-77 (2000), and Greene and Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley & Sons, New York (1991)).

[0051] The cleavable bond may be present within the cleavable linker and / or at one or both ends of the cleavable linker. It should be understood that such physiological conditions that result in bond rupture include, for example, standard chemical hydrolysis reactions that occur at physiological pH or as a result of compartmentalization into organelles such as endosomes, which have a pH lower than that of the cytoplasm. Illustratively, the bivalent linkers described herein may be cleaved under other physiological or metabolic conditions, such as by the action of glutathione-mediated mechanisms. It should be understood that the instability of the cleavable bond can be adjusted by including functional groups or fragments within the bivalent linker that can assist or promote such bond rupture, also known as neighboring group assistance. The instability of the cleavable bond can also be adjusted by substitution changes at or near the cleavable bond, such as including an alpha branch adjacent to the cleavable disulfide bond, increasing the hydrophobicity of the substituent on the silicon in the moiety with a hydrolyzable silicon-oxygen bond, or homologizing the alkoxy group that forms part of a hydrolyzable ketal or acetal. Furthermore, it is understood that, if present, additional functional groups or fragments may be included within the bivalent linker that can assist or facilitate further fragmentation of the conjugate after bond disruption of the releasable linker.

[0052] In one example, the linker may include one or more releasable linkers that cleave under the conditions described herein by a chemical mechanism involving beta-elimination. Such releasable linkers include beta-thio, beta-hydroxy, and beta-amino substituted carboxylic acids and their derivatives (e.g., esters, amides, carbonates, carbamates, and ureas). Such linkers also include 2- and 4-thioaryl esters, carbamates, and carbonates.

[0053] Examples of releasable linkers include those of the formula:

[0054] [ka]

[0055] In the formula, X 4 is NR, n is an integer selected from 0, 1, 2, and 3, and R 32 is a substituent containing hydrogen or a substituent that can stabilize a positive charge on the aryl ring inductively or by resonance, such as, for example, alkoxy. The releasable linker may be further substituted.

[0056] Assisted cleavage of the releasable portion of the linker may include mechanisms involving a benzilnium intermediate, a benzyne intermediate, lactone cyclization, an oxonium intermediate, beta-elimination, etc. In addition to fragmentation following cleavage of the releasable portion of L, the initial cleavage of the releasable linker may be facilitated by an anchimeric-assisted mechanism. Thus, in the example of the releasable portion of the linker above, the cyclizable hydroxyalkanoic acid may facilitate cleavage of the methylene bridge, e.g., by an oxonium ion, facilitating bond cleavage or subsequent fragmentation of the releasable linker after bond cleavage. Alternatively, acid-catalyzed oxonium ion-assisted cleavage of the methylene bridge may initiate a cascade of fragmentation of this exemplary bivalent linker or its fragments. Alternatively, acid-catalyzed hydrolysis of the carbamate may facilitate beta-elimination of the cyclizable hydroxyalkanoic acid, e.g., cleavage of the methylene bridge by an oxonium ion. It is understood that other chemical mechanisms of bond breaking or cleavage under the metabolic, physiological, or cellular conditions described herein may initiate such a cascade of fragmentation. It is understood that other chemical mechanisms of bond breaking or cleavage under the metabolic, physiological, or cellular conditions described herein may initiate such a fragmentation cascade.

[0057] Exemplary mechanisms for cleavage of the bivalent linkers described herein include the following 1,4 and 1,6 fragmentation mechanisms for carbonates and carbamates:

[0058] [ka]

[0059] In the formula, Nuc - is an exogenous or endogenous nucleophile, glutathione, or a bioreductant, and R a and X a is linked via the other part of the bivalent linker. a and X a The positions of can be interchanged, so that, for example, the resulting product is X a -S-Nuc and HO-R a H2N-R a is.

[0060] While the above fragmentation mechanism is shown as a concerted mechanism, any number of separate steps may occur to achieve final fragmentation of the bivalent linker to the depicted end product. For example, bond cleavage can also occur by acid-catalyzed elimination of the carbamate moiety, which may be anchimerically assisted by stabilization provided by either the beta-sulfur or aryl group of the disulfide shown in the example above. In these variations of this embodiment, the releasable linker is the carbamate moiety. Alternatively, fragmentation can be initiated by nucleophilic attack on the disulfide group, resulting in cleavage to form a thiolate. The thiolate can intermolecularly displace a carbonate or carbamate moiety to form the corresponding thiacyclopropane. In the case of a benzyl-containing bivalent linker, following exemplary disruption of the disulfide bond, the resulting phenylthiolate can further fragment to release the carbonate or carbamate moiety by forming a resonance-stabilized intermediate. In any of these cases, the releasable nature of the exemplary bivalent linkers described herein can be achieved by any mechanism that may be related to the chemical, metabolic, physiological, or biological conditions present.

[0061] Thus, as noted above, the releasable linker may comprise a disulfide group. Further examples of releasable linkers included in the linker include divalent radicals comprising an alkyleneaziridin-1-yl, alkylenecarbonylaziridin-1-yl, carbonylalkylaziridin-1-yl, alkylenesulfoxylaziridin-1-yl, sulfoxylalkylaziridin-1-yl, sulfonylalkylaziridin-1-yl, or alkylenesulfonylaziridin-1-yl group, each of which is optionally substituted. Further examples of releasable linkers included in the linker include methylene, 1-alkoxyalkylene, 1-alkoxycycloalkylene, 1-alkoxyalkylenecarbonyl, 1-alkoxycycloalkylenecarbonyl, carbonylarylcarbonyl, carbonyl(carboxyaryl)carbonyl, carbonyl(biscarboxyaryl)carbonyl, haloalkylenecarbonyl, alkylene(dialkylsilyl), alkylene(alkylarylsilyl), alkylene(diarylsilyl), (dialkyl and divalent radicals comprising a (silyl)aryl, (alkylarylsilyl)aryl, (diarylsilyl)aryl, oxycarbonyloxy, oxycarbonyloxyalkyl, sulfonyloxy, oxysulfonylalkyl, iminoalkylidenyl, carbonylalkylideneiminyl, iminocycloalkylidenyl, carbonylcycloalkylideneiminyl, alkylenethio, alkylenearylthio, or carbonylalkylthio group, each of which is optionally substituted.

[0062] Further examples of releasable linkers contained in the linker include an oxygen atom and methylene, 1-alkoxyalkylene, 1-alkoxycycloalkylene, 1-alkoxyalkylenecarbonyl, or 1-alkoxycycloalkylenecarbonyl groups, each of which is optionally substituted.Alternatively, the releasable linker comprises an oxygen atom and a methylene group, wherein the methylene group is substituted with an optionally substituted aryl, and the releasable linker is bonded to the oxygen to form an acetal or ketal.Furthermore, the releasable linker may comprise an oxygen atom and a sulfonylalkyl group, and the releasable linker is bonded to the oxygen to form an alkylsulfonate.

[0063] Further examples of releasable linkers included in the linker include nitrogen and iminoalkylidenyl, carbonylalkylideneiminyl, iminocycloalkylidenyl, and carbonylcycloalkylideneiminyl groups, each of which is optionally substituted, where the releasable linker is attached to the nitrogen to form a hydrazone. In the alternative, the hydrazone can be acylated with a carboxylic acid derivative, an orthoformate derivative, or a carbamoyl derivative to form a variety of acylhydrazone releasable linkers.

[0064] Further examples of releasable linkers included in the linker can include an oxygen atom and an alkylene(dialkylsilyl), alkylene(alkylarylsilyl), alkylene(diarylsilyl), (dialkylsilyl)aryl, (alkylarylsilyl)aryl, or (diarylsilyl)aryl group, each of which is optionally substituted, and where the releasable linker is bonded to the oxygen to form a silanol.

[0065] Further examples of releasable linkers included in the linker include two independent nitrogens, as well as carbonylarylcarbonyl, carbonyl(carboxyaryl)carbonyl, or carbonyl(biscarboxyaryl)carbonyl. The releasable linker may be bonded to the heteroatom nitrogen to form an amide, and connected to X through an amide bond. a or R a It may also be bound to

[0066] Further examples of releasable linkers included in the linker include oxygen atoms, nitrogen atoms, and carbonylarylcarbonyl, carbonyl(carboxyaryl)carbonyl, or carbonyl(biscarboxyaryl)carbonyl. The releasable linker may form an amide and be connected to X via an amide bond. a or R a may be bonded to

[0067] The linker may comprise an optionally substituted 1-alkylenesuccinimide-3-yl group and a releasable moiety comprising a methylene, 1-alkoxyalkylene, 1-alkoxycycloalkylene, 1-alkoxyalkylenecarbonyl, or 1-alkoxycycloalkylenecarbonyl group, each of which may be substituted, to form a succinimide-1-yl alkyl acetal or ketal.

[0068] The linker may comprise carbonyl, thionocarbonyl, alkylene, cycloalkylene, alkylenecycloalkyl, alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, 1-alkylenesuccinimide-3-yl, 1-(carbonylalkyl)succinimide-3-yl, alkylenesulfoxyl, sulfonylalkyl, alkylenesulfoxylalkyl, alkylenesulfonylalkyl, carbonyltetrahydro-2H-pyranyl, carbonyltetrahydrofuranyl, 1-(carbonyltetrahydro-2H-pyranyl)succinimide-3-yl, or 1-(carbonyltetrahydrofuranyl)succinimide-3-yl, each of which is optionally substituted. In this example, the linker may further comprise an additional nitrogen, such that the linker comprises an alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, or 1-(carbonylalkyl)succinimide-3-yl group, each of which is optionally substituted to form an amide when bonded to the nitrogen. Alternatively, the linker may further comprise a sulfur atom and an alkylene or cycloalkylene group, each of which is optionally substituted with carboxy and bonded to the sulfur to form a thiol. In yet another example, the linker comprises a sulfur atom and a 1-alkylenesuccinimide-3-yl group and a 1-(carbonylalkyl)succinimide-3-yl group that are bonded to the sulfur to form a succinimide-3-yl thiol.

[0069] The linker may comprise a nitrogen and a releasable moiety comprising an alkyleneaziridin-1-yl, carbonylalkylaziridin-1-yl, sulfoxylalkylaziridin-1-yl, or sulfonylalkylaziridin-1-yl, each of which is optionally substituted. In this example, the linker may comprise a carbonyl, thionocarbonyl, alkylenecarbonyl, cycloalkylenecarbonyl, carbonylalkylcarbonyl, or 1-(carbonylalkyl)succinimide-3-yl, each of which is optionally substituted, attached to the releasable moiety to form an aziridine amide.

[0070] Examples of linkers include alkylene-amino-alkylenecarbonyl, alkylene-thio-(carbonylalkylsuccinimide-3-yl), and the like, and are represented by the following formula:

[0071] [ka]

[0072] wherein x′ and y′ are each independently 1, 2, 3, 4, or 5. The linker may be a C (e.g., -CH2-, C(O)), N (e.g., NH, NR b , where R b may have any suitable combination of atoms in the chain, including, for example, H, alkyl, alkylaryl, etc.), O (e.g., -O-), P (e.g., -OP(O)(OH)O-), and S (e.g., -S-). For example, the atoms used in forming the linker can be combined in all chemically relevant ways, such as chains of carbon atoms forming alkyl groups, chains of carbon and oxygen atoms forming polyoxyalkyl groups, chains of carbon and nitrogen atoms forming polyamines, and others containing rings, such as those forming aryl and heterocyclyl groups (e.g., triazoles, oxazoles, etc.). In addition, the bonds connecting the atoms in the chains in the linker can be either saturated or unsaturated, such that, for example, alkanes, alkenes, alkynes, cycloalkanes, arylenes, imides, etc., can be divalent radicals included in L. Furthermore, the chains forming the linker may be substituted or unsubstituted.

[0073] Further examples of linker groups include the groups 1-alkylsuccinimide-3-yl, carbonyl, thionocarbonyl, alkyl, cycloalkyl, alkylcycloalkyl, alkylcarbonyl, cycloalkylcarbonyl, carbonylalkylcarbonyl, 1-alkylsuccinimide-3-yl, 1-(carbonylalkyl)succinimide-3-yl, alkylsulfoxyl, sulfonylalkyl, alkylsulfoxylalkyl, alkylsulfonylalkyl, carbonyltetrahydro-2H-pyranyl, carbonyltetrahydrofuranyl, 1-(carbonyltetrahydro-2H-pyranyl)succinimide-3-yl, and 1-(carbonyltetrahydrofuranyl)succinimide-3-yl, wherein each group can be substituted or unsubstituted. Any of the foregoing groups can be a linker or can be included as part of L. In some cases, any of the foregoing groups may be used in combination (or more than one time) (e.g., -alkyl-C(O)-alkyl), and may further include an additional nitrogen (e.g., alkyl-C(O)-NH-, -NH-alkyl-C(O)-, or -NH-alkyl-), oxygen (e.g., -alkyl-O-alkyl-), or sulfur (e.g., -alkyl-S-alkyl-). Examples of such linker groups are alkylcarbonyl, cycloalkylcarbonyl, carbonylalkylcarbonyl, 1-(carbonylalkyl)succinimide-3-yl, and succinimide-3-ylthiol, where each group may be substituted or unsubstituted.

[0074] In some instances, linkers can be formed via click chemistry / click chemistry-derived. Those skilled in the art will understand that the terms "click chemistry" and "click chemistry-derived" generally refer to a class of small molecule reactions commonly used in conjugation, allowing for the attachment of selected substrates to specific molecules. Click chemistry describes a method for producing products that are not a single specific reaction but follow natural examples, which also produce substances by linking small modular units. In many applications, click reactions link biomolecules and reporter molecules. Click chemistry is not limited to biological conditions: the concept of "click" reactions has been used in pharmacological and various biomimetic applications. However, they have been found to be particularly useful in the detection, localization, and qualification of biomolecules.

[0075] The click reaction is "spring-loaded": it can occur in one pot, is typically not hindered by water, can produce minimal by-products, and is characterized by a high thermodynamic driving force that rapidly and irreversibly drives it to high yields of a single reaction product with high reaction specificity (in some cases, both regiospecificity and stereospecificity). These properties make the click reaction suitable for problems of molecular isolation and targeting in complex biological environments. Therefore, in such environments, the product must be physiologically stable, and any by-products must be non-toxic (for in vivo systems).

[0076] Examples of click chemistry include those in which linkers can be derived from copper-catalyzed azide-alkyne cycloaddition (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC), inverse electron-demand Diels-Alder reaction (IEDDA), and Staudinger ligation (SL). For example, X a and R a Schemes 1-5:

[0077] [ka]

[0078] wherein each R b are independently H, alkyl, arylalkyl, -alkyl-S-alkyl or arylalkyl, or the side chain of any natural or non-naturally occurring amino acid, etc. a and R a The wavy line connected to X a and R a and the groups to which they are attached. It should be understood that in Schemes 1-5, the triazole, oxazole, and -NH-SO2-NH- groups are considered to be part of the linker.

[0079] The linker may be a linker selected from the group consisting of pegylated, alkyl, sugar, and peptide-based dual linkers, and the linker may comprise, for example, a group X as described herein. 2 , T, and G 1 is either a non-releasable linker or a releasable linker bivalently covalently attached to one of

[0080] For example, the linker may be a group:

[0081] [ka]

[0082] wherein q is an integer encompassing a polyethylene (PEG) group having an average Mn of 5,000; each x" is independently an integer from 0 to 10; Each y″ is independently an integer from 3 to 100.

[0083] In some embodiments, x″ is an integer from 3 to 10. The linker is

[0084] [ka]

[0085] [ka]

[0086] wherein R 33 and R 34 each is independently H or C1-C6 alkyl; z is an integer of 1 to 8.

[0087] For example, the linker

[0088] [ka]

[0089] The linker may be

[0090] [ka]

[0091] wherein R 37 is H or C1-C6 alkyl; R 35a , R 35b , R 36a , and R 36b Each of is independently H or C1-C6 alkyl. The linker may comprise an amino acid. The linker may comprise an amino acid selected from the group consisting of Lys, Asn, Thr, Ser, Ile, Met, Pro, His, Gln, Arg, Gly, Asp, Glu, Ala, Val, Phe, Leu, Tyr, Cys, and Trp. The linker may comprise at least two amino acids independently selected from the group consisting of Glu and Cys. The linker may comprise Glu-Glu, in which glutamic acids are covalently linked to each other via carboxylic acid side chains.

[0092] The linker may comprise one or more hydrophilic spacer linkers containing multiple hydroxyl functional groups. An example of a linker is one having at least one 2,3-diaminopropionic acid group, at least one glutamic acid group (e.g., the unnatural amino acid D-glutamic acid), and at least one cysteine ​​group. An example of such a linker is one having an unnatural amino acid, for example, a linker having the formula:

[0093] [ka]

[0094] wherein q is an integer of 1 to 10 (e.g., 1 to 3 and 2 to 5), and is, for example, a linker having a repeating unit of the general formula:

[0095] [ka]

[0096] [ka]

[0097] wherein X may be O, NH, NR, or S, and q is an integer from 1 to 10, or a linker of the formula:

[0098] [ka]

[0099] where the disulfide group is part of a self-immolative group that can generally be described as a group of the formula -CH2-SS-CH2-. The compounds described herein may comprise a bond that allows a portion of the compounds described herein (e.g., NLS) to be released by any suitable mechanism, including reduction or hydrolysis-related release mechanisms.An example of a reduction mechanism is the reduction of a disulfide group into two separate sulfhydryl groups.Thus, for example, a group of formula -CH2-SS-CH2- is reduced into two separate groups of formula -CH2-SH, so that the linker has the formula:

[0100] [ka]

[0101] is of the formula:

[0102] [ka]

[0103] In this example, the NLS can be attached to the linker via a self-immolative moiety (e.g., a disulfide group). The compounds described herein can be, for example, NLS or X 2 may include a bond that can be attached to the linker via an ester, amide, phosphate, oxime, acetal, pyrophosphate, polyphosphate, disulfide, sulfate, hydrazide, imine, carbonate, carbamate, or an enzyme-cleavable amino acid sequence.

[0104] In the compound of formula (I), G 1 and G 2represent the forward primer binding site and the reverse primer binding site, respectively. The forward primer binding site and the reverse primer binding site can be any suitable forward primer binding site and reverse primer binding site. For example, see Biotechnol.Lett.35:1541-1549(2013). In some examples, at least one of the forward primer binding site and the reverse primer binding site can be pseudorandomly generated or randomly generated. Furthermore, in some cases, at least one of the forward primer binding site, the reverse primer binding site, and the primer itself can be chemically modified to incorporate functional units such as biotin, fluorescent reporters, click chemistry components, etc. These "functional units" can be used, among other things, to distinguish between various different molecules of formula (I) or to distinguish between primers when they are synthesized. Thus, for example, one molecule (M1) of Formula (I) can have at least one of its forward and reverse primer binding sites chemically modified with a fluorescent reporter that fluoresces at one wavelength (λ1), while a different molecule (M2) of Formula (I) can have at least one of its forward and reverse primer binding sites chemically modified with a second fluorescent reporter that fluoresces at a second wavelength (λ2) that is higher or lower than λ1. In this way, upon separation, molecules M1 and M2 can be readily distinguished based on their different fluorescence.

[0105] As used herein, the term "pseudorandomly generated" means that a sequence is generated randomly, taking into consideration certain design characteristics. The base pair sequences of the forward primer binding site and / or reverse primer binding site. There are several design characteristics that can be considered when generating a sequence. Examples of these considerations include, but are not limited to, the GC content of the sequence, the lack of identity to any known naturally occurring sequence or PCR-amplifiable region, and the lack of repeated regions of the same base pair. Pseudorandomly generated sequences can be designed by considering any combination of these various characteristics. As used herein, the phrase "lack of identity to any known naturally occurring sequence" means that the base pair sequences of the forward primer binding site and reverse primer binding site are designed so that they do not hybridize to naturally occurring nucleotide sequences in the PCR-amplifiable region of the genome of a single organism. Therefore, randomly generated primers, in combination (forward and reverse), typically will not be able to amplify naturally occurring sequences at the hybridization temperature and polymerase extension time typically used in real-time PCR.

[0106] In some instances, the sequence of the forward primer binding site and / or the reverse primer binding site does not have a string of more than four bases or less than five bases that are identical in sequence.

[0107] In the compounds described herein, Q represents RNA or randomized single-stranded DNA. The RNA or randomized single-stranded DNA may contain at least 5, at least 10, at least 20, at least 40, at least 60, at least 80, at least 100, or at least 120 nucleotides, or from about 10 to about 100 nucleotides, from about 10 to about 50 nucleotides, from about 25 to about 125 nucleotides, from about 10 to about 40 nucleotides, from about 10 to about 20 nucleotides, or from about 20 to about 60 nucleotides.

[0108] In the compounds described herein, G 1 , Q, and G 2 At least one of the 1 , Q, and G 2 and at least one binding arrangement that renders at least one of the G 1 G 1 contains at least one binding arrangement that renders Q nuclease resistant, or Q contains at least one binding arrangement that renders Q nuclease resistant, or G 2 G 2 contains at least one binding site that renders the G 1 and Q is G 1 and at least one binding arrangement that renders Q nuclease resistant, or G 1 and G 2 G 1 and G 2 or contains at least one binding arrangement that renders the nucleic acid nuclease resistant, or Q and G 2 Q and G 2 or G 1 , Q, and G 2 G 1 , Q, and G 2 contains at least one binding site that renders G resistant to nucleases. 1 , Q, and G 2 Linkage configurations that make at least one of the following nuclease-resistant include, but are not limited to, 5'-phosphorothioate, 5'-modified uracil, 4'-thio, 2'-fluoro, 5'-α-P-borano, 2'-amino, 2'-deoxy-L-ribose, 2'-methoxy, capping at the 3' end with an inverted thymidine, bridged nucleic acid (BNA), locked nucleic acid (LNA), and xenonucleic acid (XNA). See, for example, U.S. Patent No. 9,765,328 (incorporated herein in its entirety). 1 , Q, and G 2Examples of linkage arrangements that render at least one of the following nucleotides resistant to nuclease include 2'-OMe, 2'-F, and 2'-methoxyethyl derivatives.

[0109] [ka]

[0110] (In the formula, each R 1 is -NH2, -OCH3, -(CH2)2OCH3, -F (e.g., 2'-deoxy-2'-fluoro-β-D-arabinonucleic acid (2'F-ANA)), or G 1 , Q, and G 2 and any other group that renders at least one of

[0111] [ka]

[0112] more diverse structures such as locked nucleic acids (LNA), and

[0113] [ka]

[0114] Examples of such structures include: The present disclosure also relates to a compound of formula (I) having the formula (II): AL 1 -G 1 -QG 2 -L 2 -NLS(II) -NLS(II)

[0115] The present disclosure also relates to a compound of formula (I) having the formula (III): AL 1 -G 1 -QG 2 -L 2The present invention also relates to a compound of formula (III) which is a compound of formula (I) which further comprises a nuclear localization signal (NLS) and further comprises a cell-penetrating peptide (CPP), such as a compound of formula (III): -NLS-CPP(III).

[0116] The present disclosure also provides a compound of formula (IV): AL 1 -G 1 -QG 2 -L 2 - relates to the compound CPP(IV).

[0117] The compounds of formulae (II) to (IV) may further comprise, in addition to or instead of a CPP, a cell transfection molecule, an enzyme, a nuclear export inhibitor, and the like. The compounds of formulae (II)-(IV) may further comprise at least one, at least two, at least three, or four biotins or analogs thereof bound to at least one avidin-type molecule.

[0118] As used herein, the formula L 2 -CPP-NLS, L 2 -CPP, and L 2 Compounds of -NLS are also contemplated, which may be the building blocks of any of the compounds described herein, such as compounds of formulas (II)-(IV), among others. In any of the compounds of formulas (II)-(IV), L 1 and L 2 The groups may be the same or different.

[0119] Those skilled in the art will recognize that G 1 can be attached to the 5' end of Q and G 2 can be attached to the 3' end of Q, or G 1 can be attached to the 3' end of Q and G 2 It will be appreciated that Q may be attached to the 5' end of Q.

[0120] The term "nuclear localization signal" or "nuclear localization sequence" (NLS) generally refers to an amino acid sequence that is imported into the nucleus of a cell via nuclear transport. Examples of NLSs include, but are not limited to, PKKKRKV (SEQ ID NO: 1), PAAKRVKLD (SEQ ID NO: 2), K(K / R)X(K / R) (SEQ ID NO: 3), and KRPAATKKAGQAKKKK (SEQ ID NO: 4). Additional NLSs can be found in the NLS database described in Nair et al., Nucleic Acid Res., 2003, 1(31):397-9 (which is incorporated by reference as if fully set forth herein). See published U.S. application No. 2018 / 0346531A1 (which is incorporated by reference as if fully set forth herein).

[0121] The term "cell membrane penetrating peptide" (CPP) generally refers to peptides of less than 30 amino acids derived from either proteins or chimeric sequences. They are sometimes amphipathic and have a net positive charge. CPPs can penetrate biological membranes to induce the movement of molecules, such as those described herein, across the cell membrane into the cytoplasm and improve their intracellular routing, thereby facilitating interaction with targets. Examples of CPPs include, but are not limited to, RRRRRRRR (SEQ ID NO: 5), VEPEP-3 (e.g., Ac-X1KWFERWFREWPRKRR-cysteamide; SEQ ID NO: 6), VEPEP-4 (e.g., X1WWRLSLRWW (SEQ ID NO: 7), X1WFRLSLRFWR (SEQ ID NO: 8), X1WWRLRSWFR (SEQ ID NO: 9), and X1WFRLSLRFW (SEQ ID NO: 10) (wherein X1 is beta-A or S)), VEPEP-6 (e.g., Ac-X1LFRALWRLLRSLWRLLWK-cysteamide; SEQ ID NO: 11), VEPEP-9 (e.g., Ac-X1LRWWLRWASRWFSRWAWWR-cysteamide; SEQ ID NO: 12), CADY (SEQ ID NO: 13), MPG, PEP-1, PPTG1 (SEQ ID NO: 14), and a polyarginine motif. See, e.g., U.S. Patent No. 10,189,876, which is incorporated by reference as if fully set forth herein. See also U.S. Patent Nos. 9,376,468, 9,579,395, 9,598,465, and 9,834,581, all of which are incorporated by reference as if fully set forth herein. While the NLS can be directly attached to the CPP, the linker L 3 can link the NLS to the CPP. 3 may be any suitable linker as that term is defined herein, and may be any other linker present (e.g., L 1 , L 2 etc.) may be the same as or different from

[0122] Molecules containing CPPs are of interest herein because CPPs can not only translocate themselves across membranes by different mechanisms that depend on the CPP, but also enable carrier drugs to translocate across the plasma membrane. See Oncotarget 9:37252-37267 (2018), which is incorporated by reference as if fully set forth herein, for examples of CPPs, as well as examples of CPPs designed for preclinical and clinical cancer diagnosis and therapy, including, but not limited to, RI-Tat-9, TAT, MPG, BR2, and p28 carrying various cargoes. CPPs are also of interest herein because they have been shown to have reduced cytotoxicity, and because proteins, imaging reagents, and drugs, particularly anticancer drugs, can bind to these peptides and cross the plasma membrane in a receptor-independent manner. Id. CPPs have been successfully used to transport various types of drugs, liposomes, and nanoparticles for imaging and cancer therapy.

[0123] While not wishing to be bound by any particular theory, energy-dependent endocytosis is thought to be the primary entry pathway for the internalization of many CPPs. Endocytotic CPP internalization includes various models, such as macropinocytosis, clathrin-mediated endocytosis, and caveolin-mediated endocytosis. Which of these pathways plays a role at a particular time depends primarily on the size of the cargo molecule and its physiochemical properties. To reach their target site and avoid degradation from lysosomes present in endosomes, CPPs must escape from endosomes into the cytosol. One approach involves introducing a pH-sensitive domain into the peptide sequence of the CPP to facilitate its escape from the vesicle by disrupting the lipid membrane at low pH. Another approach involves introducing histidine residues into the CPP, which increases the osmotic pressure within the endosomal vesicle through a proton sponge effect, ultimately rupturing the endosomal membrane. In yet another approach, PepFect (PF) peptide modification by N-terminal stearylation can be used to promote endosomal escape. The presence of the lysosomotropic agent chloroquine (CQ) equivalent has also been shown to be important for improved endosomal escape.Examples of CPPs include, but are not limited to, MPG (GALFLGFLGAAGSTMGAWSQPKKKRKV (SEQ ID NO: 15); an amphipathic lysine-rich domain derived from a nuclear localization sequence (NLS)), Pep-1 (KETWWETWWTEWS QPKKKRKV (SEQ ID NO: 16); similar to MPG and efficiently delivers a wide range of peptides and proteins), Pep-2 (KETWFETWFTEWSQPKKKRKV (SEQ ID NO: 17); an amphipathic peptide with higher stability and potency than Pep-1), Pep-3 (KETWFETWFTEWSQPKKKRKV (SEQ ID NO: 18); can be used to form nano-sized complexes and can have improved cellular uptake), CADY (Ac-GLWRALWRLLRSLWRLLWRA-Cya (SEQ ID NO: 19); a secondary amphipathic peptide based on PPTG1), and Rath (TPWWRLWTKWHHKRRDLPRKPE (SEQ ID NO: 20)).

[0124] The present disclosure also provides a compound of formula (V):

[0125] [ka]

[0126] In the compound of formula L 1 and L 5 The term "linker group" refers to, for example, L 1 is a linker group as defined herein for 1 and L 5 may be the same or different, or L 5 can be a bond; T is a click chemistry derived core; G 1 is the forward primer binding site; Q is randomized single-stranded DNA; G 2 is the reverse primer binding site. In some instances, L 5is a bond. Examples of click chemistry-derived cores include triazoles, oxazoles, and other heterocycles that can be derived from electrocyclic reactions, including, for example, Diels-Alder electrocyclic reactions. Some examples of click chemistry-derived cores are shown in Schemes 7-12:

[0127] [ka]

[0128] [ka]

[0129] Such compounds also include those shown in Scheme 13

[0130] [ka]

[0131] As shown in Figure 1, it can be accessed from tretrazine and trans-cyclooctene via the so-called inverse electron demand Diels-Alder chemistry.

[0132] Examples of compounds that can be accessed from tretrazine and trans-cyclooctene via inverse electron demand Diels-Alder chemistry include compounds of the formula:

[0133] [ka]

[0134] for example,

[0135] [ka]

[0136] Examples of the compounds include: The present disclosure also provides a compound of formula (V) having formula (VI):

[0137] [ka]

[0138] The present invention also relates to compounds of formula (VI), which are compounds of formula (V) further comprising a nuclear localization signal (NLS), such as compounds of formula (VI). The present disclosure also provides a compound of formula (V) having formula (VII):

[0139] [ka]

[0140] The present invention also relates to compounds of formula (VI), which are compounds of formula (V) further comprising a nuclear localization signal (NLS) and further comprising a cell-penetrating peptide (CPP), such as compounds of formula (VI).

[0141] The present disclosure also provides a compound of formula (VIII):

[0142] [ka]

[0143] The present invention relates to the compound In any of the compounds described herein, such as compounds of Formulas (V)-(VIII) and compounds described in Schemes 7-13, X 2 It is contemplated that X may be an antibody or a fragment thereof, such as an Fc fragment. Such compounds are contemplated to be useful in forms of immunotherapy by mobilizing immune effector responses. Thus, for example, X 2 is a sequence in which one or more selected oligonucleotides are X 2 or can be attached directly to an oligonucleotide described herein (e.g., G 1 , G 2 , and at least one of Q)1 or L 5 ) through X 2 X can be either 2 It is envisioned that the resulting compound may have one or more tetrazine molecules attached (e.g., covalently) to the tetrazine molecule. Thus, for example, the resulting compound shown in Scheme 13 may be used to target cancer cells or pathogens (e.g., virions, bacteria, and prions).

[0144] The present disclosure also provides pharmaceutical compositions comprising a compound of any of the foregoing formulae and a pharmaceutically acceptable carrier. The present disclosure also provides pharmaceutical compositions comprising a therapeutically effective amount of a compound of one of formulae (I)-(VIII) and a pharmaceutically acceptable carrier.

[0145] A "pharmaceutical composition" refers to a chemical or biological composition suitable for administration to a subject (e.g., a mammal). Such compositions can be specifically formulated for administration via one or more of several routes, including, but not limited to, oral, dermal, epidermal, epidural, infusion, inhalation, intraarterial, intracardiac, intraventricular, intradermal, intramuscular, intranasal, intraocular, intraperitoneal, intraspinal, intrathecal, intravenous, oral, parenteral, pulmonary, rectal by enema or suppository, subcutaneous, subdermal, sublingual, transdermal, and transmucosal. Furthermore, administration can be via capsule, drip, foam, gel, gum, injection, liquid, patch, pill, porous pouch, powder, tablet, or other suitable means of administration.

[0146] A "pharmaceutical excipient" or "pharmaceutically acceptable excipient" is a carrier, sometimes a liquid, into which an active therapeutic agent is formulated. The excipient generally does not provide any pharmacological activity to the formulation, but may provide chemical and / or biological stability, and release characteristics. Examples of suitable formulations can be found, for example, in Remington, The Science And Practice of Pharmacy, 20th Edition, (Gennaro, AR, Chief Editor), Philadelphia College of Medicine. of Pharmacy and Science, 2000, which is incorporated by reference in its entirety.

[0147] As used herein, " pharmaceutically acceptable carriers " or " excipients " include, but are not limited to, any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents. Carriers may be suitable for parenteral administration. Alternatively, carriers may be suitable for intravenous, intraperitoneal, intramuscular, sublingual, or oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active compounds can also be incorporated into the composition.

[0148] The pharmaceutical composition can be sterile and stable under the conditions of manufacture and storage.The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable for high drug concentration.The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.Proper fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersion, and by using surfactants.

[0149] In many cases, it is preferable to include an isotonic agent, such as sugar, polyalcohol (e.g., mannitol, sorbitol), or sodium chloride in the composition. Prolonged absorption of an injectable composition can be achieved by including an agent that delays absorption, such as monostearate salts and gelatin, in the composition. Furthermore, the compounds described herein may be formulated into sustained-release preparations, for example, compositions containing sustained-release polymers. The active compound may be prepared with a carrier that protects the compound from rapid release, such as a controlled-release preparation, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and polylactic-polyglycolic acid copolymers (PLG), may also be used. Many methods for preparing such preparations are known to those skilled in the art.

[0150] Oral dosage forms are also contemplated herein. Pharmaceutical compositions may be orally administered as capsules (hard or soft), tablets (film-coated, enteric-coated, or uncoated), powders or granules (coated or uncoated), or liquids (solutions or suspensions). Formulations can be conveniently prepared by any method known in the art. Pharmaceutical compositions may contain one or more suitable manufacturing aids or excipients, including fillers, binders, disintegrants, lubricants, diluents, flow agents, buffers, wetting agents, preservatives, colorants, sweeteners, flavoring agents, and pharmaceutically acceptable carriers.

[0151] The compounds described herein can be administered by various dosage forms known in the art.Any biologically acceptable dosage form known to those skilled in the art and their combinations are contemplated.The examples of such dosage forms include but are not limited to chewable tablets, fast-dissolving tablets, effervescent tablets, reconstitutable powder, elixir, liquid, solution, suspension, emulsion, tablets, multi-layer tablets, bi-layer tablets, capsules, soft gelatin capsules, hard gelatin capsules, caplets, lozenges, chewable lozenges, beads, powder, gum, granules, particles, microparticles, dispersible granules, cachets, irrigation, suppositories, creams, topicals, inhalants, aerosol inhalants, patches, particle inhalants, implants, depot implants, ingestibles, injections (including subcutaneous, intramuscular, intravenous and intradermal), infusions, and combinations thereof.

[0152] Other compounds that can be included by mixing are, for example, medically inert ingredients (e.g., solid and liquid diluents) such as lactose, dextrose, saccharose, cellulose, starch, or calcium phosphate for tablets or capsules, olive oil or ethyl oleate for soft capsules, and water or vegetable oil for suspensions or emulsions; lubricants such as silica, talc, stearic acid, magnesium or calcium stearate, and / or polyethylene glycol; gelling agents such as colloidal clays; thickening agents such as gum tragacanth or sodium alginate; binders such as starch, gum arabic, gelatin, methylcellulose, carboxymethylcellulose, or polyvinylpyrrolidone; disintegrating agents such as starch, alginic acid, alginates, or sodium starch glycolate; effervescent mixtures; dyes; sweeteners; wetting agents such as lecithin, polysorbates, or lauryl sulfate; and other therapeutically acceptable auxiliary ingredients such as humectants, preservatives, buffers, and antioxidants, which are well-known additives for such formulations.

[0153] Liquid dispersions for oral administration may be syrups, emulsions, solutions, or suspensions. Syrups may contain, for example, sucrose, or sucrose with glycerol and / or mannitol and / or sorbitol as a carrier. Suspensions and emulsions may contain carriers such as natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol.

[0154] The amount of active compound in therapeutic compositions can vary according to factors such as the subject's disease state, age, sex, body weight, medical history, risk factors, predisposition to disease, administration route, existing treatment plan (for example, possible interaction with other drugs), and body weight.Dosage plan can be adjusted to provide optimal therapeutic response.For example, a single bolus can be administered, or several divided doses can be administered over time, or the dose can be proportionally reduced or increased according to the exigencies of the therapeutic situation.

[0155] "Unit dosage form," as used herein, refers to a physically discrete unit suitable as a unitary dose for a mammalian subject to be treated, each unit containing a predetermined amount of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications for the unit dosage form are determined by and directly depend on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, as well as the limitations inherent in the art of formulating such active compounds for the treatment of susceptibility in a subject. In therapeutic use for the treatment of conditions in mammals (e.g., humans) for which a compound described herein or an appropriate pharmaceutical composition thereof is effective, the compound can be administered in an effective amount. The appropriate dose can be a composition, pharmaceutical composition, or any other composition described herein.

[0156] Doses are typically administered once, twice, or three times daily, although more frequent dosing intervals are also possible. Doses may be administered daily, every two, three, four, five, six, and / or seven days (once a week). Doses can be administered daily for up to 30 days, preferably 7-10 days. Doses may be administered twice daily for 10 days. If a patient requires treatment for a chronic disease or condition, doses may be administered as long as signs and / or symptoms persist. Patients may require "maintenance therapy," in which the patient receives daily medication for months, years, or even lifelong use. Additionally, compositions may provide prophylaxis against recurrence of symptoms. For example, doses may be administered once or twice daily to prevent the onset of symptoms in at-risk patients, particularly asymptomatic patients.

[0157] The compositions described herein can be administered by any of the following routes: oral, epidermal, epidural, infusion, inhalation, intra-arterial, intracardiac, intraventricular, intradermal, intramuscular, intranasal, intraocular, intraperitoneal, intraspinal, intrathecal, intravenous, oral, parenteral, pulmonary, rectal by enema or suppository, subcutaneous, subdermal, sublingual, transdermal, and transmucosal. Preferred routes of administration are oral and oral. Administration can be local, in which the composition is administered directly, adjacent to, at, near, at, around, or near the site of disease, e.g., inflammation, or systemic, in which the composition is given to a patient and passes widely through the body, thereby reaching the site of disease. Local administration can be, for example, administration to tissues, organs, and / or organ systems that contain and / or are affected by disease and / or where signs and / or symptoms of disease are active or may occur. Administration may be topical, with a local effect, where the composition is applied directly to the location where its action is desired. Administration may be enteral, where the desired effect is systemic (non-local), where the composition is administered via the digestive tract. Administration may be parenteral, where the desired effect is systemic, where the composition is administered via a route other than the digestive tract.

[0158] The term "therapeutically effective amount," as used herein, refers to an amount of one or more compounds described herein that elicits the biological or medical response in a tissue system, animal, or human that is desired by a researcher, veterinarian, physician, or other clinician, including alleviation of symptoms of the disease or disorder being treated. In some instances, a therapeutically effective amount is an amount that can treat or alleviate a disease or disease symptom at a reasonable benefit / risk ratio applicable to any medical treatment. However, it should be understood that the total daily usage of the compounds and compositions described herein may be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the condition being treated and the severity of the condition; the activity of the specific compound used; the specific composition used; the patient's age, weight, general health, sex, and diet; the time, route of administration, and excretion rate of the specific compound used; the duration of treatment; drugs used in combination with or concurrently with the specific compound used; and similar factors well known to researchers, veterinarians, physicians, or other clinicians. It is also understood that a therapeutically effective amount may be selected with reference to any toxicity or other undesirable side effects that may occur during administration of one or more of the compounds described herein.

[0159] The term "alkyl," as used herein, refers to substituted or unsubstituted straight-chain, branched-chain, and cyclic saturated monovalent or divalent groups having 1 to 20 carbon atoms, 10 to 20 carbon atoms, 12 to 18 carbon atoms, 6 to about 10 carbon atoms, 1 to 10 carbon atoms, 1 to 8 carbon atoms, 2 to 8 carbon atoms, 3 to 8 carbon atoms, 4 to 8 carbon atoms, 5 to 8 carbon atoms, 1 to 6 carbon atoms, 2 to 6 carbon atoms, 3 to 6 carbon atoms, or 1 to 3 carbon atoms. 20 Examples of branched monovalent (C1-C3)-alkyl groups include those having 1 to 8 carbon atoms, such as methyl (i.e., CH3), ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. 20Examples of )-alkyl groups include isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, and isopentyl. 20Examples of alkyl groups include those having 1 to 6 carbon atoms, such as -CH-, -CHCH-, -CHCHCH-, -CHCHCHCH-, and -CHCHCHCHCHCH-. Examples of branched divalent alkyl groups include -CH(CH)CH- and -CHCH(CH)CH-. Examples of cyclic alkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclooctyl, bicyclo[1.1.1]pentyl, bicyclo[2.1.1]hexyl, and bicyclo[2.2.1]heptyl. Cycloalkyl groups further include polycyclic cycloalkyl groups, such as, but not limited to, norbornyl, adamantyl, bornyl, camphenyl, isocamphenyl, and carenyl groups, as well as fused rings, such as, but not limited to, decalinyl. Alkyl may include combinations of substituted and unsubstituted alkyls. By way of example, alkyl and (C1)alkyl include methyl and substituted methyl. As a specific example, (C1)alkyl includes benzyl. As a further example, alkyl may include methyl and substituted (C2-C8) alkyl. Alkyl may also include substituted methyl and unsubstituted (C2-C8) alkyl. Alkyl may be methyl and C2-C8 straight-chain alkyl. Alkyl may be methyl and C2-C8 branched alkyl. The term methyl is understood to be unsubstituted -CH3. The term methylene is understood to be unsubstituted -CH2-. For comparison, the term (C1)alkyl is understood to be substituted or unsubstituted -CH3 or substituted or unsubstituted -CH2-. Representative substituted alkyl groups may be substituted one or more times with any of the groups enumerated herein, such as cycloalkyl, heterocyclyl, aryl, amino, haloalkyl, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups.As a further example, representative substituted alkyl groups can be substituted with one or more of fluoro, chloro, bromo, iodo, amino, amido, alkyl, alkoxy, alkylamido, alkenyl, alkynyl, alkoxycarbonyl, acyl, formyl, arylcarbonyl, aryloxycarbonyl, aryloxy, carboxy, haloalkyl, hydroxy, cyano, nitroso, nitro, azido, trifluoromethyl, trifluoromethoxy, thio, alkylthio, arylthiol, alkylsulfonyl, alkylsulfinyl, dialkylaminosulfonyl, sulfonic acid, carboxylic acid, dialkylamino, and dialkylamido. Representative substituted alkyl groups can be substituted with a group that includes amino, hydroxy, cyano, carboxy, nitro, thio, and alkoxy, but does not include halogen groups. Thus, for example, alkyl can be substituted with non-halogen groups. For example, representative substituted alkyl groups can be substituted with fluoro, bromo, halogens other than bromo, or halogens other than fluoro. Representative substituted alkyl groups may be substituted with one, two, three, or more fluoro groups, or may be substituted with one, two, three, or more non-fluoro groups. For example, the alkyl may be trifluoromethyl, difluoromethyl, or fluoromethyl, or the alkyl may be a substituted alkyl other than trifluoromethyl, difluoromethyl, or fluoromethyl. The alkyl may be a haloalkyl, or the alkyl may be a substituted alkyl other than haloalkyl.

[0160] The term "alkenyl," as used herein, refers to substituted or unsubstituted, straight-chain, branched-chain, and cyclic, saturated monovalent or divalent groups having at least one carbon-carbon double bond and having 2 to 20 carbon atoms, 10 to 20 carbon atoms, 12 to 18 carbon atoms, 6 to about 10 carbon atoms, 2 to 10 carbon atoms, 2 to 8 carbon atoms, 3 to 8 carbon atoms, 4 to 8 carbon atoms, 5 to 8 carbon atoms, 2 to 6 carbon atoms, 3 to 6 carbon atoms, 4 to 6 carbon atoms, 2 to 4 carbon atoms, or 2 to 3 carbon atoms. The double bond may be in the trans or cis orientation. The double bond may be terminal or internal. Alkenyl groups may be bonded through a portion of the alkenyl group that contains a double bond (e.g., vinyl, propen-1-yl, and buten-1-yl) or through a portion of the alkenyl group that does not contain a double bond (e.g., penten-4-yl). Monovalent (C2-C 20 Examples of branched monovalent (C2-C6)-alkenyl groups include those having 1 to 8 carbon atoms, such as vinyl, propenyl, propen-1-yl, propen-2-yl, butenyl, buten-1-yl, buten-2-yl, sec-buten-1-yl, sec-buten-3-yl, pentenyl, hexenyl, heptenyl, and octenyl groups. 20 Examples of )-alkenyl groups include isopropenyl, isobutenyl, sec-butenyl, t-butenyl, neopentenyl, and isopentenyl. 20Examples of alkenyl groups include those having 2 to 6 carbon atoms, such as -CHCH-, -CHCHCH2-, -CHCHCH2CH2-, and -CHCHCH2CH2CH2-. Examples of branched divalent alkyl groups include -C(CH3)CH- and -CHC(CH3)CH2-. Examples of cyclic alkenyl groups include cyclopentenyl, cyclohexenyl, and cyclooctenyl. It is contemplated that alkenyl may also include masked alkenyl groups, precursors of alkenyl groups, or other related groups. Thus, where an alkenyl group is recited, compounds in which the carbon-carbon double bond of the alkenyl is replaced by an epoxide or aziridine ring are also contemplated. Substituted alkenyl also includes alkenyl groups that are substantially tautomeric with non-alkenyl groups. For example, substituted alkenyl can be 2-aminoalkenyl, 2-alkylaminoalkenyl, 2-hydroxyalkenyl, 2-hydroxyvinyl, or 2-hydroxypropenyl, but substituted alkenyl is also understood to include groups of substituted alkenyl groups other than alkenyl that are tautomeric with non-alkenyl-containing groups. Alkenyl can also be understood to include combinations of substituted and unsubstituted alkenyl. For example, alkenyl can be vinyl and substituted vinyl. For example, alkenyl can be vinyl and substituted (C3-C8) alkenyl. Alkenyl can also include substituted vinyl and unsubstituted (C3-C8) alkenyl. Representative substituted alkenyl groups can be substituted one or more times with any of the groups listed herein, such as monoalkylamino, dialkylamino, cyano, acetyl, amido, carboxy, nitro, alkylthio, alkoxy, and halogen groups.As a further example, representative substituted alkenyl groups can be substituted with one or more of fluoro, chloro, bromo, iodo, amino, amido, alkyl, alkoxy, alkylamido, alkenyl, alkynyl, alkoxycarbonyl, acyl, formyl, arylcarbonyl, aryloxycarbonyl, aryloxy, carboxy, haloalkyl, hydroxy, cyano, nitroso, nitro, azido, trifluoromethyl, trifluoromethoxy, thio, alkylthio, arylthiol, alkylsulfonyl, alkylsulfinyl, dialkylaminosulfonyl, sulfonic acid, carboxylic acid, dialkylamino, and dialkylamido. Representative substituted alkenyl groups can be substituted with a set of groups including monoalkylamino, dialkylamino, cyano, acetyl, amido, carboxy, nitro, alkylthio, and alkoxy, but not including halogen groups. Thus, for example, alkenyl can be substituted with non-halogen groups. Representative substituted alkenyl groups can be substituted with fluoro, bromo, halogens other than bromo, or halogens other than fluoro. For example, alkenyl can be 1-fluorovinyl, 2-fluorovinyl, 1,2-difluorovinyl, 1,2,2-trifluorovinyl, 2,2-difluorovinyl, trifluoropropen-2-yl, 3,3,3-trifluoropropenyl, 1-fluoropropenyl, 1-chlorovinyl, 2-chlorovinyl, 1,2-dichlorovinyl, 1,2,2-trichlorovinyl, or 2,2-dichlorovinyl. Representative substituted alkenyl groups may be substituted with one, two, three, or more fluoro groups, or may be substituted with one, two, three, or more non-fluoro groups.

[0161] The term "alkynyl" as used herein refers to substituted or unsubstituted straight- and branched-chain alkyl groups, except that at least one triple bond exists between two carbon atoms. Thus, alkynyl groups have 2 to 50 carbon atoms, 2 to 20 carbon atoms, 10 to 20 carbon atoms, 12 to 18 carbon atoms, 6 to about 10 carbon atoms, 2 to 10 carbon atoms, 2 to 8 carbon atoms, 3 to 8 carbon atoms, 4 to 8 carbon atoms, 5 to 8 carbon atoms, 2 to 6 carbon atoms, 3 to 6 carbon atoms, 4 to 6 carbon atoms, 2 to 4 carbon atoms, or 2 to 3 carbon atoms. Examples include, but are not limited to, ethynyl, propynyl, propyn-1-yl, propyn-2-yl, butynyl, butyn-1-yl, butyn-2-yl, butyn-3-yl, butyn-4-yl, pentynyl, pentyn-1-yl, and hexynyl. Examples include, but are not limited to, -C≡CH, -C≡C(CH3), -C≡C(CH2CH3), -CH2C≡CH, -CH2C≡C(CH3), and -CH2C≡C(CH2CH3), among others.

[0162] As used herein, the term "aryl" refers to a substituted or unsubstituted monovalent group derived by removing a hydrogen atom from an arene, which is a cyclic aromatic hydrocarbon having 6 to 20 carbon atoms, 10 to 20 carbon atoms, 12 to 20 carbon atoms, 6 to about 10 carbon atoms, or 6 to 8 carbon atoms. (C6-C 20Examples of aryl groups include phenyl, naphthalenyl, azulenyl, biphenylyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, and anthracenyl groups. Examples include substituted phenyl, substituted naphthalenyl, substituted azulenyl, substituted biphenylyl, substituted indacenyl, substituted fluorenyl, substituted phenanthrenyl, substituted triphenylenyl, substituted pyrenyl, substituted naphthacenyl, substituted chrysenyl, and substituted anthracenyl groups. Examples also include unsubstituted phenyl, unsubstituted naphthalenyl, unsubstituted azulenyl, unsubstituted biphenylyl, unsubstituted indacenyl, unsubstituted fluorenyl, unsubstituted phenanthrenyl, unsubstituted triphenylenyl, unsubstituted pyrenyl, unsubstituted naphthacenyl, unsubstituted chrysenyl, and unsubstituted anthracenyl groups. Aryl also includes phenyl and non-phenylaryl groups. From these examples, (C6~C 20 The term aryl includes fused and non-fused polycyclic (C6-C 20 ) Monocyclic and polycyclic (C6-C) containing aryl groups 20 ) aryl groups.

[0163] The term "heterocyclyl," as used herein, refers to substituted aromatic, unsubstituted aromatic, substituted nonaromatic, and unsubstituted nonaromatic rings containing three or more atoms in the ring, one or more of which are heteroatoms, such as, but not limited to, N, O, and S. Thus, a heterocyclyl can be a cycloheteroalkyl, or heteroaryl, or, if polycyclic, any combination thereof. Heterocyclyl groups contain from 3 to about 20 ring members, although other such groups have from 3 to about 15 ring members. Heterocyclyl groups include heterocyclyl groups containing 3 to 8 carbon atoms (C3-C8), 3 to 6 carbon atoms (C3-C6), or 6 to 8 carbon atoms (C6-C8). A heterocyclyl group designated as a C2-heterocyclyl can be a 5-membered ring having 2 carbon atoms and 3 heteroatoms, a 6-membered ring having 2 carbon atoms and 4 heteroatoms, etc. Similarly, a C4-heterocyclyl can be a 5-membered ring with one heteroatom, a 6-membered ring with two heteroatoms, etc. The number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms. A heterocyclyl ring can also contain one or more double bonds. A heteroaryl ring can be an example of a heterocyclyl group. The term "heterocyclyl group" includes fused ring species, including those containing fused aromatic and non-aromatic groups. Representative heterocyclyl groups include, but are not limited to, piperidinyl, piperazinyl, morpholinyl, furanyl, pyrrolidinyl, pyridinyl, pyrazinyl, pyrimidinyl, triazinyl, thiophenyl, tetrahydrofuranyl, pyrrolyl, oxazolyl, imidazolyl, triazolyl, tetrazolyl, benzoxazolinyl, and benzimidazolinyl groups. For example, heterocyclyl groups include:

[0164] [ka]

[0165] In particular, the formula includes, but is not limited to, 1 is H, (C1~C 20 ) Alkyl, (C6-C 20) aryl, or an amine protecting group (e.g., t-butyloxycarbonyl group), and the heterocyclyl group can be substituted or unsubstituted. Nitrogen-containing heterocyclyl groups are heterocyclyl groups that contain a nitrogen atom as a ring atom.

[0166] The term "alkoxy," as used herein, refers to an oxygen atom bonded to an alkyl group, including a cycloalkyl group, as defined herein. Examples of linear alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, and the like. Examples of branched alkoxy groups include, but are not limited to, isopropoxy, sec-butoxy, tert-butoxy, isopentyloxy, isohexyloxy, and the like. Examples of cyclic alkoxy groups include, but are not limited to, cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like. An alkoxy group can contain from 1 to about 12-20 or about 12-40 carbon atoms bonded to the oxygen atom, and can further contain double or triple bonds and heteroatoms. Thus, alkoxy also includes an oxygen atom bonded to an alkenyl group and an oxygen atom bonded to an alkynyl group. For example, an allyloxy group is an alkoxy group within the meaning herein. A methoxyethoxy group is also an alkoxy group within the meaning herein, as is a methylenedioxy group in the situation where two adjacent atoms of the structure are substituted therewith.

[0167] The term "aryloxy," as used herein, refers to an oxygen atom attached to an aryl group, as defined herein. As used herein, the terms "aralkyl" and "arylalkyl" refer to an alkyl group, as defined herein, in which a hydrogen or carbon bond of the alkyl group is replaced with a bond to an aryl group, as defined herein. Representative aralkyl groups include benzyl, biphenylmethyl, and phenylethyl groups, as well as fused (cycloalkylaryl)alkyl groups, such as 4-ethyl-indanyl. An aralkenyl group is an alkenyl group, as defined herein, in which a hydrogen or carbon bond of the alkyl group is replaced with a bond to an aryl group, as defined herein.

[0168] The terms "halo," "halogen," or "halide" group, as used herein, by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.

[0169] As used herein, the term "amino" refers to -NH2, -NHR, -NR2, -NR3 + where each R is independently selected, and substituents of the form -NR3 + "Amino" refers to the protonated form of each, excluding the protonated form of the amino group. Thus, any compound substituted with an amino group can be considered an amine. An "amino group" within the meaning herein can be a primary, secondary, tertiary, or quaternary amino group. An "alkylamino" group includes monoalkylamino, dialkylamino, and trialkylamino groups.

[0170] The term "acyl," as used herein, refers to a group containing a carbonyl moiety and is bonded through the carbonyl carbon atom, which is also bonded to another carbon atom, which may be part of a substituted or unsubstituted alkyl, alkenyl, alkynyl, alkoxy, aryl, cycloalkyl, heterocyclyl group, etc.

[0171] The term "formyl," as used herein, refers to a group that contains a carbonyl moiety and is bonded through the carbonyl carbon atom, which is also bonded to a hydrogen atom.

[0172] The term "alkoxycarbonyl" as used herein refers to a group containing a carbonyl moiety and bonded via a carbonyl carbon atom. The carbonyl carbon atom is also bonded to an oxygen atom, which is further bonded to an alkyl group. Alkoxycarbonyl also includes groups in which the carbonyl carbon atom is also bonded to an oxygen atom, which is further bonded to an alkenyl group. Alkoxycarbonyl also includes groups in which the carbonyl carbon atom is also bonded to an oxygen atom, which is further bonded to an alkynyl group. In additional cases where the term is included in the definition of alkoxycarbonyl as defined herein and is also included in the term "aryloxycarbonyl," the carbonyl carbon atom is bonded to an oxygen atom that is bonded to an aryl group instead of an alkyl group.

[0173] The term "arylcarbonyl," as used herein, refers to a group containing a carbonyl moiety and is bonded through the carbonyl carbon atom, which is also bonded to an aryl group.

[0174] The term "alkylamide" as used herein refers to a group containing a carbonyl moiety and bonded via a carbonyl carbon atom. The carbonyl carbon atom is also bonded to a nitrogen group bonded to one or more alkyl groups. In a further instance of alkylamide as defined herein, the carbonyl carbon atom is bonded to a nitrogen atom bonded to one or more aryl groups instead of, or in addition to, one or more alkyl groups. In a further instance of alkylamide as defined herein, the carbonyl carbon atom is bonded to a nitrogen atom bonded to one or more alkenyl groups instead of, or in addition to, one or more alkyl and / or aryl groups. In a further instance of alkylamide as defined herein, the carbonyl carbon atom is bonded to a nitrogen atom bonded to one or more alkynyl groups instead of, or in addition to, one or more alkyl, alkenyl, and / or aryl groups.

[0175] The term "carboxy" as used herein refers to a group containing a carbonyl moiety and attached via a carbonyl carbon atom. The carbonyl carbon atom is also attached to a hydroxy group or an oxygen anion, resulting in a carboxylic acid or carboxylate. Carboxy also includes both the protonated and salt forms of carboxylic acids. For example, carboxy can be understood as COOH or COH.

[0176] The term "alkylthio," as used herein, refers to a sulfur atom attached to an alkyl, alkenyl, or alkynyl group, as defined herein. The term "arylthio," as used herein, refers to a sulfur atom attached to an aryl group, as defined herein.

[0177] The term "alkylsulfonyl," as used herein, refers to a sulfonyl group attached to an alkyl, alkenyl, or alkynyl group, as defined herein. The term "alkylsulfonyl," as used herein, refers to a sulfonyl group attached to an alkyl, alkenyl, or alkynyl group, as defined herein.

[0178] The term "dialkylaminosulfonyl," as used herein, refers to a sulfonyl group attached to a nitrogen which is further attached to two alkyl groups, as defined herein, optionally joined together to form a ring with the nitrogen. This term also includes groups in which the nitrogen is further attached to one or two alkenyl groups instead of an alkyl group.

[0179] The term "dialkylamino," as used herein, refers to an amino group bound to two alkyl groups, as defined herein, which may optionally be joined together to form a ring with the nitrogen. This term also includes groups in which the nitrogen is further bound to one or two alkenyl groups instead of an alkyl group.

[0180] The term "dialkylamido," as used herein, refers to an amide group bound to two alkyl groups, as defined herein, which may optionally be joined together to form a ring with the nitrogen. This term also includes groups in which the nitrogen is further bound to one or two alkenyl groups instead of an alkyl group.

[0181] As used herein, the term "substituted" refers to a group substituted with one or more groups (substituents), including, but not limited to, the following groups: deuterium (D), halogen (e.g., F, Cl, Br, and I), R, OR, OC(O)N(R), CN, NO, NO, ONO, azido, CF, OCF, methylenedioxy, ethylenedioxy, (C-C 20 ) heteroaryl, N(R) 2、 Si(R) 3、SR, SOR, SO2R, SO2N(R)2, SO3R, P(O)(OR)2, OP(O)(OR)2, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, C(O)N(R)OH, OC(O)N(R)2, C(S)N(R)2, (CH2) 0-2 N(R)C(O)R, (CH2) 0-2 N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R)2, N(R)SO2R, N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(O)N(R)2, N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R)2, C(O)N(OR)R, or C(=NOR)R, where R is hydrogen, (C1-C 20 )alkyl, or (C6-C 20) aryl. Substitution also includes groups substituted with one or more groups, including, but not limited to, the following: fluoro, chloro, bromo, iodo, amino, amido, alkyl, alkoxy, alkylamido, alkenyl, alkynyl, alkoxycarbonyl, acyl, formyl, arylcarbonyl, aryloxycarbonyl, aryloxy, carboxy, haloalkyl, hydroxy, cyano, nitroso, nitro, azido, trifluoromethyl, trifluoromethoxy, thio, alkylthio, arylthiol, alkylsulfonyl, alkylsulfinyl, dialkylaminosulfonyl, sulfonic acid, carboxylic acid, dialkylamino, and dialkylamido. When two or more adjacent substituents are present, the substituents can be linked to form a carbocyclic or heterocyclic ring. Such adjacent groups can have a vicinal or geminal relationship, or they can be adjacent on the ring, for example, in an ortho configuration. Each instance of substitution is understood to be independent. For example, a substituted aryl can be substituted with bromo, and a substituted heterocycle on the same compound can be substituted with alkyl. It is contemplated that a substituted group may be substituted with one or more non-fluoro groups. As another example, a substituted group may be substituted with one or more non-cyano groups. As another example, a substituted group may be substituted with one or more groups other than haloalkyl. As yet another example, a substituted group may be substituted with one or more groups other than tert-butyl. As yet another example, a substituted group may be substituted with one or more groups other than trifluoromethyl. As a still further example, a substituted group may be substituted with one or more groups other than nitro, methyl, methoxymethyl, dialkylaminosulfonyl, bromo, chloro, amido, halo, benzodioxepinyl, polycyclic heterocyclyl, polycyclic substituted aryl, methoxycarbonyl, alkoxycarbonyl, thiophenyl, or nitrophenyl, or a combination of such groups.Additionally, substitution is also understood to include fluoro, cyano, haloalkyl, tert-butyl, trifluoromethyl, nitro, methyl, methoxymethyl, dialkylaminosulfonyl, bromo, chloro, amido, halo, benzodioxepinyl, polycyclic heterocyclyl, polycyclic substituted aryl, methoxycarbonyl, alkoxycarbonyl, thiophenyl, and nitrophenyl groups.

[0182] The compounds described herein (e.g., compounds of Formulas (I)-(VI)) may contain chiral centers. All diastereomers of the compounds described herein, as well as racemates, are contemplated herein.

[0183] As used herein, the terms "salt" and "pharmaceutically acceptable salt" refer to derivatives of the disclosed compounds, in which the parent compound is modified by making its acid salt or base salt. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic groups such as amines, and alkali or organic salts of acidic groups such as carboxylic acids. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts or quaternary ammonium salts of the parent compound formed from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, as well as those prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isethionic acid, and the like.

[0184] Pharmaceutically acceptable salts can be synthesized from parent compounds that contain basic or acidic moieties by conventional chemical methods.In some instances, such salts can be prepared by reacting the free acid or base form of these compounds with stoichiometric (or greater) amount of suitable base or acid in water or organic solvent, or in the mixture of these two, and generally non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, the disclosure of which is incorporated herein by reference.

[0185] The term "solvate" means a compound or a salt thereof that further contains a stoichiometric or non-stoichiometric amount of solvent bound by non-covalent intermolecular forces. When the solvent is water, the solvate is a hydrate.

[0186] The term "prodrug" refers to a derivative of a compound that can be hydrolyzed, oxidized, or otherwise reacted under biological conditions (in vitro or in vivo) to provide an active compound, particularly an active compound described herein. Examples of prodrugs include, but are not limited to, derivatives and metabolites of the compounds described herein that contain a biohydrolyzable moiety, such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogs. Particular prodrugs of compounds with a carboxyl functional group are lower alkyl esters of the carboxylic acid. Carboxylic acid esters are conveniently formed by esterifying any of the carboxylic acid moieties present on the molecule. Prodrugs are typically prepared according to the methods described in Burger's Medicinal Chemistry and Drug Discovery 6th ed. (Donald J. Abraham ed., 2001, Wiley) and Design and Application These compounds can be prepared using well-known methods, such as those described in "Prodrugs" (H. Bundgaard ed., 1985, Harwood Academic Publishers GmbH).

[0187] As used herein, the term "subject" or "patient" refers to any organism to which the compositions described herein can be administered, for example, for experimental, diagnostic, preventative, and / or therapeutic purposes. A subject refers to a mammal that receives the compositions disclosed herein or undergoes the disclosed methods. It is understood and contemplated herein that "mammals" include, but are not limited to, humans, non-human primates, cows, horses, dogs, cats, mice, rats, rabbits, and guinea pigs.

[0188] The present disclosure also relates to a method of treating a subject in need of such treatment, comprising administering a therapeutically effective amount of one or more compounds of Formulas (I)-(VI). Thus, for example, the present disclosure encompasses a method of treating cancer in a subject in need of such treatment, comprising administering a therapeutically effective amount of one or more compounds of Formulas (I)-(VI). Types of cancer that can be alleviated or treated include, but are not limited to, prostate cancer, breast cancer, pancreatic cancer, thyroid cancer, bone cancer, glioblastoma, and neuroendocrine tumors. The compounds of Formulas (I)-(VIII) can be administered in combination with at least one anti-cancer agent. Anticancer agents include those described herein as well as fluoropyrimidine-5-FU, fluorodeoxyuridine, ftorafur, 5'-deoxyfluorouridine, UFT, S-1 capecitabine; pyrimidine nucleosides-deoxycytidine, cytosine arabinoside, 5-azacytosine, gemcitabine, 5-azacytosine-arabinoside; purine-6-mercaptopurine, thioguanine, azathioprine, allopurinol, cladribine, fludarabine, pentostatin, 2-chloroadenosine; platinum analogs. Body - cisplatin, carboplatin, oxaliplatin, tetraplatin, platinum-DACH, ormaplatin, CI-973, JM-216; anthracyclines / anthracenediones - doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone; epipodophyllotoxins - etoposide, teniposide; camptothecins - irinotecan, topotecan, lurtotecan, ciratecan, 9-aminocamptothecin, 10,11-methylenedioxycamptothecin, 9-nitrocamptothecin, TAS 103, 7-(4-methyl-piperazino-methylene)-10,11-ethylenedioxy-20(S)-camptothecin, 7-(2-N-isopropylamino)ethyl)-20(S)-camptothecin; hormones and hormone analogues - diethylstilbestrol, tamoxifen, tremefine, Tolmudex, Thymitax, flutamide, bicalutamide, finasteride, estradiol, trioxyphene, droloxifene, medroxyprogesterone acetate, megestrol acetate, aminoglutethimide, testolactone, etc.;Enzymes, proteins and antibodies - asparaginase, interleukins, interferons, leuprolide, pegaspargase, etc.; Vinca alkaloids - vincristine, vinblastine, vinorelbine, vindesine; Taxanes - paclitaxel, docetaxel; Anastrozole; Antifolates - methotrexate, aminoptyline, trimetrexate, trimethoprim, piritrexim, pyrimethamine, edatrexate, MDAM; Antimicrotubule agents - taxanes and vinca alkaloids; Alkylating agents (classical and non-classical) - nitrogen mustards (mechlorethamine, chlorambucil, melphalan, uracil mustard), oxazaphosphorines (ifosfamide, cyclophosphamide, perfosfamide, trofosfamide), alkylating agents anti-metabolites - the purines, pyrimidines, and nucleosides listed above; antibiotics - anthracyclines / anthracenediones, bleomycin, dactinomycin, mitomycin, plicamycin, pentostatin, streptozocin; topoisomerase inhibitors - camptothecin (Topo I), epipodophyllotoxin, m-AMSA, ellipticine (Topo II); antivirals - AZT, zalcitabine, gemcitabine, didanosine, etc.; other cytotoxic agents - hydroxyurea, mitotane, fusogenic toxins, PZA, bryostatin, retinoids, butyric acid and derivatives, pentosan, fumagillin, etc. Small molecules include anthracyclines, doxorubicin, daunorubicin, mitomycin C, epirubicin, pirarubicin, rubidomycin, carcinomycin, N-acetyladriamycin, rubidazone, 5-imidodaunomycin, N-acetyldaunomycin, daunoryline, and mitoxantrone;Camptothecin compounds, camptothecin, 9-aminocamptothecin, 7-ethylcamptothecin, 10-hydroxycamptothecin, 9-nitrocamptothecin, 10,11-methylenedioxycamptothecin, 9-amino-10,11-methylenedioxycamptothecin, 9-chloro-10,11-methylenedioxycamptothecin, irinotecan, topotecan, lurtotecan, siratecan, (7-(4-methylpiperazino) methylene)-10,11-ethylenedioxy-20(S)-camptothecin, 7-(4-methylpiperazinomethylene)-10,11-methylenedioxy-20(S)-camptothecin, 7-(2-N-isopropylamino)ethyl)-(20S)-camptothecin; ellipticine compounds, ellipticine, 6-3-aminopropyl-ellipticine, 2-diethylaminoethyl-ellipticium and its salts, deteriptium (da telliptium, retelliptine; topoisomerase inhibitors, vinca alkaloids (e.g., vincristine, vinblastine, vinorelbine, vinflunine, and vinpocetine), microtubule depolymerizing or destabilizing agents, microtubule stabilizers (e.g., taxanes, aminoalkyl or aminoacyl analogs of paclitaxel or docetaxel, (e.g., 2'-[3-(N,N-diethylamino)propionyl]paclitaxel, 7-(N,N-dimethylglycyl)paclitaxel, and 7-L-alanylpaclitaxel)), alkylating agents, receptor binding agents, tyrosine kinase inhibitors, phosphatase inhibitors, cyclin-dependent kinase inhibitors, enzyme inhibitors, Aurora kinase inhibitors, nucleotides, polynicleotides, and farnesyltransferase inhibitors;

[0189] Values ​​expressed in range format should be interpreted flexibly to include not only the numerical values ​​expressly recited as the limits of the range, but also all individual numerical values ​​or subranges subsumed within that range, as if each numerical value and subrange were expressly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not only about 0.1% to about 5%, but also individual values ​​(e.g., 1%, 2%, 3%, and 4%) and subranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the stated range. The statement "about X to Y" has the same meaning as "about X to about Y" unless otherwise indicated. Similarly, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z" unless otherwise indicated.

[0190] As used herein, the terms "a," "an," or "the" are used to include one or more unless the context clearly dictates otherwise. The term "or" is used to refer to a non-exclusive "or" unless otherwise indicated. Furthermore, it should be understood that any expressions or terms used herein and not otherwise defined are for descriptive purposes only and not for limiting purposes. Any use of section headings is intended to aid in the reading and comprehension of the document and should not be construed as limiting. Furthermore, information associated with a section heading may occur within or outside of that particular section. Furthermore, all publications, patents, and patent documents referenced herein are incorporated herein by reference in their entirety, as if individually incorporated by reference. In the event of a conflict of usage between this specification and any document so incorporated by reference, the usage in the incorporated reference should be considered supplementary to the usage in this specification, and in the event of any irreconcilable conflict, the usage in this specification shall prevail.

[0191] In the methods described herein, steps may be performed in any order without departing from the principles of the invention, unless a temporal or operational order is explicitly recited. Furthermore, specified steps may be performed simultaneously unless express language in the claims recites them as being performed separately. For example, a claimed step of performing X and a claimed step of performing Y may be performed simultaneously in a single operation, and the resulting process would fall within the literal scope of the claimed process.

[0192] As used herein, the term "about" may allow for some degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or the limits of a stated range.

[0193] It is contemplated that each of the above-described embodiments can be applied in combination with other embodiments described herein. For example, an embodiment corresponding to formula (I) is contemplated as being applicable to formulas (II) and (III). As another example, an embodiment corresponding to formula (II) is contemplated as being applicable to formulas (I) and (III), etc.

[0194] As used herein, the term "about" may allow for some degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or the limits of a stated range.

[0195] Those skilled in the art will appreciate that many modifications to the embodiments described herein are possible without departing from the spirit and scope of the present disclosure. Accordingly, this description is not intended to be, and should not be construed as, limited to the examples given, and the full scope of protection afforded by the appended claims and their equivalents should be accorded. In addition, it is possible to use some of the features of the present disclosure without the corresponding use of other features. Therefore, the foregoing description or exemplary embodiments are provided for the purpose of illustrating the principles of the present disclosure and are not intended to limit the present disclosure, but may include modifications to and substitutions of the present disclosure. [Example]

[0196] The present invention may be better understood by reference to the following examples, which are provided for illustrative purposes only and are not intended to be limiting of the invention. Example 1 Compounds of formula (IX):

[0197] [ka]

[0198] (In the formula, X 7 is O or S, and q is the average M of 5,000 n (where q is an integer containing a polyethylene (PEG) group with an average M n The compounds of formula (IX) and formula (X) herein have one or more phosphorothioate linkages between nucleotides:

[0199] [ka]

[0200] It should be understood that the oligonucleotide sequence comprising Q can be nuclease (e.g., endonuclease and exonuclease) resistant, including: Q = ...

[0201] In one step, an NLS peptide with a cysteine ​​residue having the formula SHCH2CH(NH2)-C(O)PKKKRKV-CO2H (SEQ ID NO: 1) was synthesized (referred to herein as "Cys-NLS"). In another step, a randomized single-stranded DNA corresponding to Q herein was synthesized. In this example, the randomized single-stranded DNA may have the sequence TCGGGATCAACCCGAGTTCACGCAACT (SEQ ID NO: 22). Other sequences Q that may be incorporated into compounds of formula (IX) and then incorporated into compounds of formula (X) include the sequences: ACACTAGTACAGTCAGTACGCACGA (SEQ ID NO:23); TTTTGCGCCTGAAGCCTCCCCAGGA (SEQ ID NO:24); GTCCGTATCTTGGTCGAAGATGTAC (SEQ ID NO:25); AGGTTCAATCTACCTTCTGCCATGC (SEQ ID NO:26); CTGGAATTCCAAATATGCCGGCGAG (SEQ ID NO:27); ATCGTTCTGGGATACAAGCTTTTGA (SEQ ID NO:28); AAATATACATTATTCCCATCAAAAT (SEQ ID NO:29); GGACAAAAGTCTGAGTCTGACCTT (SEQ ID NO:30); GATGGCAGTATAGTCGTCATGAGTC (SEQ ID NO:31); TCGGGATCAACCCGAGTTCACGCAA (SEQ ID NO:32); SEQ ID NO: 32); ACTCTTTCTGTCACAAGATCTGCAT (SEQ ID NO: 33); AATGTGGATGGCATAGTGGCGGCGC (SEQ ID NO: 34); TACAACCTAGAGGATGAGCTCACGA (SEQ ID NO: 35); TTAGTGTTACATCACATCTCGAGCT (SEQ ID NO: 36); TAGGAGGCATTCATTTTTAAGGTAG (SEQ ID NO: 37); GTTACCACATCGATCTGCGAAAACT (SEQ ID NO: 38); CACCAGTGGTTTGATATACGGCCTA (SEQ ID NO: 39); TAGGTTGTGGTTCCCGAATCGTGAG (SEQ ID NO: 40); GCAACTTGGCTTCCGTCTAAACAAA (SEQ ID NO: 41); GCTATCCTTCTTTTAGCAGACAGTA (SEQ ID NO: 42); TACTCGTCGCGTTTTATTTTTTTGC (SEQ ID NO: 43);ATAAGCCCCCAGCTACTCCCGTTTT (SEQ ID NO: 44); CTTCATGTAGCAACTCATTGTGAAG (SEQ ID NO: 45); TCCCAAAATCTCGCCCCCCGGAATA (SEQ ID NO: 46); AGTTGCCACAAAAATTTACTAAGTC (SEQ ID NO: 47); CAGCTACATTCATTATTTGTTTCCG (SEQ ID NO: 48); TCATACGGAACCTCAGCCCATGACA (SEQ ID NO: 49); CACTTATTAGAAATGCATACCTATA (SEQ ID NO: 50); GTCTGAAA TTAATTGATCGTCATGC (SEQ ID NO: 51); GCATCCGATTCACACACTCGCTCAC (SEQ ID NO: 52); CATAACAGATGTTAAATTAGCGTAA (SEQ ID NO: 53); AAAATCATGAGTGGTTTACCGGTAG (SEQ ID NO: 54); CAACCCGCAAAAAGTCTCAGGAGTA (SEQ ID NO: 55); CAGCTTCGCCATCCCTACGGGTAAG (SEQ ID NO: 56); TTCTGCATGGCGGGTATACTCACTA (SEQ ID NO: 57); CCCGTAGCCAAGGAGCC TATACAAC (SEQ ID NO: 58); TTTAAGTTTCCGAATCCAACGTAAA (SEQ ID NO: 59); GGGGAGCAGCAGCGATTTGACCTAG (SEQ ID NO: 60); GAACCAAAGCGCTGCTTCCCATAAA (SEQ ID NO: 61); ATGGTTATCTTACCCTACCAAAGGA (SEQ ID NO: 62); GACCGGGTTCATTTAACCGTACGGG (SEQ ID NO: 63); CTCCAACGCAGTAGCCAGGTACACA (SEQ ID NO: 64); TAACTGTTGCCTCTCACATGGTCAA (SEQ ID NO: 65);CGCTTAAGTGGTATAGTCTCCATCG (SEQ ID NO: 66);TCGCACCCTATCATAGTCCGACACC (SEQ ID NO: 67);GAATCTAAACGTTAGCAATCGGCGT (SEQ ID NO: 68);CGGTTCCAGGTGGGCCCGTATACGT (SEQ ID NO: 69);AGCTCCCCCCCGCGTTATACCTGAC (SEQ ID NO: 70);GCCTAGCATCCAATCGACGTACCGC (SEQ ID NO: 71);CACAACTTCCATATGTCAGTTCAAC (SEQ ID NO: 72);AAGCAGTCTCATTCATCCATCACTA (SEQ ID NO: 73); GCTTGGATTTAAACCAAGCGTCCCG (SEQ ID NO: 74); TAGATATCGTATAATATGGGGATAA (SEQ ID NO: 75); TAATGCCACACGTTATGTCTCCCAA (SEQ ID NO: 76); ACGAAGGCGGCATGGTAATCTGCAC (SEQ ID NO: 77); GGCGTGGGTTGACCGGATACATGAA (SEQ ID NO: 78); TACAAGACCGAACCTGGTTTATACC (SEQ ID NO: 79); GTGGACTCG ACATCCGACAGTCAGT (SEQ ID NO: 80); TAACCGGTTGGATAGCGATTCGATT (SEQ ID NO: 81); GCCAGTCTAACAGTAATTAATGCAAA (SEQ ID NO: 82); TATTCATAATACATGAGATGGCACG (SEQ ID NO: 83); CATAGGATTCGTAATGTATAAGTGT (SEQ ID NO: 84); TATCTCAGAATACCGCACTCACGTG (SEQ ID NO: 85); CGGTCAAAGCACCTGGAGCGTATTC (SEQ ID NO: 86); CTGTACTTGATCCAAGGT TTGAAGG (SEQ ID NO: 87); GACTACGTCGCTTGCAAATCATCCG (SEQ ID NO: 88); TGTAGTCTATAACTCCCTGGCGCAG (SEQ ID NO: 89); GGTAGGCAGCACGTTTGTGTGAACC (SEQ ID NO: 90); CTCTTCACCATTTTATCGCCATGCA (SEQ ID NO: 91); GTCTGTCTGTATCATCCGAGCGACA (SEQ ID NO: 92); GGAAGCGGGATATATGGTGCCGTCC (SEQ ID NO: 93); TAACTCAGACAGCTAGCTATCGTTA (SEQ ID NO: 94) Sequence number 94); TAACTCTGCATTGCTCTCAGGGAGC (SEQ ID NO: 95); GTGTCTTGTACTCTGACCTGAAGCG (SEQ ID NO: 96); GGAATAAGAAGTCTTAGTAGCCCAC (SEQ ID NO: 97); AAATAGTAAATTGAGGAGCCGTTTA (SEQ ID NO: 98); CTACGTATAAACGGTTGGTTAGGTT (SEQ ID NO: 99); AGCATGAATGGAGGCCGTTAACAAA (SEQ ID NO: 100); TCCCGCAGTTATCGCGGCTGTCTCA (SEQ ID NO: 101);CGCCGTAGGGCGTATGGCGCGTCTG (SEQ ID NO: 102); CTACGTGCCAGTTTATACCCCGGAA (SEQ ID NO: 103); CCGCTAGAGAACCTTGATGATTCTG (SEQ ID NO: 104); TATCTTAAGTCAGTGGGGCTCGTCG (SEQ ID NO: 105); TTTATGAAGAGCACATCATAAGAAG (SEQ ID NO: 106); TGGCCGCCTAGAGTTAAGAACTATT (SEQ ID NO: 107); GGGTCGAATCTAGTTTTGTAACAG G (SEQ ID NO: 108); TGACAGTGGCGTCACCCGTTCACCC (SEQ ID NO: 109); CTGCGTACTGGATATGTAAAAGATG (SEQ ID NO: 110); GGAATGCGTGCAGACCCGTTGGTTT (SEQ ID NO: 111); GTACCCAAATGTGAGTGACGCCATT (SEQ ID NO: 112); CATCTCTGTGTACGGAAATCTTTGA (SEQ ID NO: 113); GTTTAGCGATCCTTTTGAGCATTAG (SEQ ID NO: 114); CTAAGTGTAAGCG CAGCACAGCGT (SEQ ID NO: 115); GAAACCTTGTGCAACGCTCGTGTT (SEQ ID NO: 116); CTTGTCTGTCCGCTAGTTTGGGGG (SEQ ID NO: 117); CTAAAACCGGGCGTAGACGATGGTC (SEQ ID NO: 118); CGGTAGTCGCCGCTTATATGCCGA (SEQ ID NO: 119); TTCTGATATCTGATGTTTTATGGCT (SEQ ID NO: 120); AGCTCGTCTAGAAACGTGGGCCAA (SEQ ID NO: 121); and G ATAAGGGTAGAGTCCAGTGAACGG (SEQ ID NO: 122), so that the complete aptamer that can be positioned between the two phosphates in compounds of formula (IX) and (X) is: TCGTGTGTAGTGTGTCTGTCGGGATCAACCCGAGTTCACGCAACTCTTAGGGATTTGGGCGG (SEQ ID NO: 123); TCGTGTGTAGTGTGTCTGGACCGGGTTCATTTAACCGTACGGGCTCTTAGGGATTTGGGCGG (SEQ ID NO: 124);TGCGTGTGTAGTGTGTCTGGCTTGGATTTAAACCAAGCGTCCCGCTCTTAGGGATTTGGGCGG (SEQ ID NO: 125); TCGTGTGTAGTGTGTCTGCGGTAGTCGCCGGCTTATATGCCGACTCTTAGGGATTTGGGCGG (SEQ ID NO: 126).

[0202] The randomized single-stranded DNA corresponding to Q herein was synthesized with a protected thiol group at the 5' end and an amino group at the 3' end. This compound is referred to herein as "5'-proc-S-oligo-NH2-3'." In a separate step, 5'-proc-S-oligo-NH2-3' was functionalized with SMCC to generate 5'-proc-S-oligo-Mal-3', which was then conjugated with an NLS peptide to generate the 5'-proc-S-oligo-NLS conjugate 5'-proc-S-oligo-linker1-NLS. The 5'-proc-S-oligo-NLS conjugate 5'-proc-S-oligo-linker1-NLS was subsequently deprotected to yield the 5'-HS-oligo-NLS conjugate. In a subsequent step, the 5'-HS-oligo-NLS conjugate was reacted with a compound comprising trans-cyclooctene (TCO) linked to a PEG group via a carbamyl group, referred to herein as "TCO-PEG-Mal," which was then linked to the maleimide nitrogen of a compound of formula (IX) as shown herein. This synthesis yielded approximately 414 μg of compound of formula (IX) (also referred to herein as "6867SP-1"). The compound of formula (IX) had a molecular weight of approximately 27,600 daltons. The compound of formula (IX) was shown to be stable at 95°C for 30 minutes.

[0203] Example 2 While the inverse electron demand Diels-Alder reaction described herein between tetrazine and cyclooctene compounds can occur rapidly under mild conditions and in the absence of a catalyst, compound 6867SP-1 can be subsequently subjected to a copper-catalyzed alkyne-azide cycloaddition click reaction to give the compound:

[0204] [ka]

[0205] to form a compound of formula (X):

[0206] [ka]

[0207] This compound, designated herein as 6867SP-1 DOTA, has an approximate molecular weight of 28,200 daltons. Compounds of formula (X) were shown to be stable at 95°C for 30 minutes. Regioisomers of formula (X) obtained from the cycloaddition click reaction between tetrazine and cyclooctene are also contemplated herein.

[0208] Example 3 The compounds of formula (IX) and formula (X) were subjected to PCR. The PCR products were analyzed by DNA polyacrylamide gel electrophoresis using an appropriate buffer (e.g., 5x Tris-borate-EDTA). Figure 1 is a photograph of the gel. Lane 1 corresponds to a water control, lane 2 corresponds to a double-stranded DNA (dsDNA) standard ladder, lane 3 corresponds to the PCR product of the compound of formula (IX), and lane 4 corresponds to the PCR product of the compound of formula (X). These results demonstrate that even when the compounds of formula (IX) and (X) have moieties conjugated at the 5' and 3' ends, the aptamer containing Q can still undergo multiple cycles of PCR (e.g., approximately 21 cycles).

[0209] Example 4 A random library of compounds related to the compound of formula (X) was synthesized, each differing from the others by an aptamer that can be located between the two phosphates. The compounds in the library were labeled with "cold" indium (i.e., non-radioactive indium). The resulting indium chelate was exposed to three separate cell lines: HTB-15 (glioblastoma); PANC-1 (pancreatic cancer); and HTB-26 (triple-negative breast cancer). Nuclear isolation techniques for each of the cell lines exposed to the indium chelate yielded supernatants containing nuclear membranes and nuclear pellets. Figure 2 is a photograph of a gel demonstrating the successful isolation of drug candidates. Compounds isolated from the nuclei of the tested cells were subjected to next generation sequencing using Perkin Elmer's NGS Express platform using forward primer: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus specific] (SEQ ID NO: 127); reverse primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus specific] (SEQ ID NO: 128); forward index primer: AATGATACGGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SEQ ID NO: 129); and reverse index primer: CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (SEQ ID NO: 130) (where [i5] and [i7] refer to the index sequence codes used by Illumina).

[0210] Adapter sequences (for post-run trimming) included: Read 1: CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 131); Read 2: CTGTCTCTTATACACATCTGACGCTGCCGACGANNNNNNNNGTGTAGATCTCGGTGGTCGCCGTATCATT (SEQ ID NO: 132).

[0211] Thorium and lutetium chelates were also prepared and, like the indium chelate, were shown to be readily prepared and stable at pH levels below 6. Example 4: Compounds The compounds of formulas A to D below can be synthesized by methods available to those skilled in the art.

[0212] [ka]

[0213] [ka]

[0214] These are all expressions:

[0215] [ka]

[0216] can be synthesized from a compound of the formula 1 , G 2 , Q, NLS, and CPP are defined herein, and g is the number average molecular weight (M n ) is an integer such that the G is about 500 g / mol to about 10,000 g / mol (e.g., about 500 g / mol to about 5,000 g / mol, about 2,500 g / mol to about 7,500 g / mol, and about 5,000 g / mol to about 10,000 g / mol). 1 ,Q,G 2 An example of a single-stranded DNA sequence is * TGCGTGTGTAGTGTGTCTG-(N * )25-CTCTTAGGGATTTGGGCGG * (SEQ ID NO: 133). Alternatively, or in addition, the NLS may have the sequence PKKKRKV (SEQ ID NO: 1) and be incorporated into the foregoing compounds using a compound of formula H2N-PKKKRKV-CO2H (SEQ ID NO: 1).

[0217] Example 5: In vivo approach In this example, one or more compounds of Formula (I)-(X) are administered intravenously to a subject. Initially, one or more compounds of Formula (I)-(X) are administered intravenously, for example, without an "on-board" therapeutic radionuclide (e.g., as a chelate) or without a non-toxic metal (e.g., a non-radioactive isotope; in the case of indium, the non-radioactive isotope is 113 In, and the radioisotope 111 In). Examples of therapeutic radionuclides include alpha particle emitters (e.g., 211 At, 213 Bi, 223 Ra, 227 Th, and 225 Ac), beta particle emitters (e.g., 33 P, 177 Lu, 67 Cu, 131 I, 186 Re, 165 Dy, 89 Sr, 32 P, 166 Ho, 188 Re, and 90 Y), and Auger electron emitters (e.g., 125 I, 123 I, 77 Br, 111 In, and 195mThese include, but are not limited to, phenylalanine ...

[0218] Example 6: Ex vivo approach In this example, biopsied tumor tissue and "normal" tissue are treated ex vivo with one or more compounds of Formulae (I)-(X). The tumor tissue and normal tissue are each treated with a "version" of one or more compounds of Formulae (I)-(X), e.g., without an "on-board" therapeutic radionuclide (e.g., as a chelate) or with a non-toxic metal (e.g., a non-radioactive isotope; in the case of indium, the non-radioactive isotope is 113 In, and the radioisotope 111The molecules of Formulas (I)-(X) are treated with a nucleotide sequence (Q) containing a nucleotide sequence (Q) of the target molecule. Some, but not all, of the molecules of Formulas (I)-(X) can bind to the cell membrane or penetrate the cell membrane of tumor cells into the cytoplasm, for example, because they have an appropriate CPP. The same applies to normal tissues. Some, but not all, of the molecules of Formulas (I)-(X) can then be localized on the cell membrane, in the cytoplasm, or in the nucleus of tumor tissue, for example, because they have an appropriate NLS in addition to or instead of a CPP. The same applies to normal tissues. The molecules of Formulas (I)-(X) found on or in the cell membrane, nucleus, and cytoplasm of tumor tissue and normal tissue can then be isolated. The isolated molecules can then be sequenced to identify, among other things, the sequence of Q. The molecules localized on the cell membrane or in the cytoplasm or nucleus can then be synthesized, and radioactive versions of these molecules can be made for treatment, such as systemic or local treatment.

[0219] Once molecules isolated from tumor tissue are sequenced, they are compared to molecules isolated from normal tissue. Matching sequences from tumor and normal tissue are "subtracted" so that tumor-specific molecules / compounds can be identified.

[0220] Selected embodiments of the present disclosure include, but are not limited to, the following. Embodiment 1 is a compound of formula I:AL 1 -G 1 -QG 2 I, wherein A comprises at least one avidin-type molecule, each avidin-type molecule comprising 1 to 4 monomer units. L 1 is a linker group; G 1 is the forward primer binding site; Q is randomized single-stranded DNA; G 2 refers to a compound that is a reverse primer binding site.

[0221] Embodiment 2 is a compound of formula (Ia): (B) n -AL 1 -G 1 -QG 2 The present invention relates to a compound of formula (Ia), wherein B represents a biotin molecule or an analog thereof, n is an integer from 1 to 4, and at least one, at least two, at least three, or four biotins may be bound to an avidin-type molecule.

[0222] Embodiment 3 relates to compounds of embodiments 1-2, wherein the avidin-type molecule comprises four monomer units. Embodiment 4 relates to compounds of embodiments 1-2, wherein the avidin-type molecule is avidin, streptavidin, neutravidin, or captavidin.

[0223] Embodiment 5 relates to compounds of embodiments 1 to 4, wherein the randomized single-stranded DNA has 10 to 100 nucleotides. Embodiment 6 relates to compounds of embodiments 1 to 5, wherein L1 is a click chemistry derived linker.

[0224] Embodiment 7 relates to compounds of embodiments 1-6, wherein the linker is derived from copper-catalyzed azide-alkyne cycloaddition (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC), inverse electron-demand Diels-Alder reaction (IEDDA), and Staudinger ligation (SL).

[0225] Embodiment 8 relates to compounds of embodiments 1-7, wherein the linker group is a releasable group. Embodiment 9 relates to compounds of embodiments 1-8, wherein the linker group is a photochemically, chemically, or enzymatically cleavable group.

[0226] Embodiment 10 is G 1 , Q, and G 2 At least one of the 1 , Q, and G 2The present invention relates to a compound of any one of embodiments 1 to 9, comprising at least one binding arrangement that renders at least one of the following nucleotides nuclease resistant:

[0227] Embodiment 11 relates to a compound of embodiment 10, wherein at least one linkage configuration is 5'-phosphorothioate, 5-modified uracil, 4'-thio, 2'-fluoro, 5'-α-P-borano, 2'-amino, 2'-deoxy-L-ribose, 2'-methoxy, capped at the 3' end with an inverted thymidine, bridged nucleic acid (BNA), locked nucleic acid (LNA), and xenonucleic acid (XNA).

[0228] Embodiment 12 is a method for treating a compound of Formula I comprising administering to a patient a compound of Formula II:AL 1 -G 1 -QG 2 -L 2 -NLS(II)

[0229] Embodiment 13 is a method for treating a compound of Formula I comprising administering to a patient a therapeutically effective amount of a compound of Formula (III): AL 1 -G 1 -QG 2 -L 2 13. The compound of embodiment 12, further comprising a cell-penetrating peptide (CPP), such as a compound of formula: -NLS-CPP(III).

[0230] Embodiment 14 relates to a linker L linking the NLS to the CPP. 3 14. The compound of any one of embodiments 12-13, further comprising: Embodiment 15 is L 2 and L 3 is a succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate based linker.

[0231] Embodiment 16 relates to compounds of embodiments 12 to 15, wherein the NLS comprises the amino acid sequence PKKKRKV (SEQ ID NO: 1). Embodiment 17 relates to compounds of embodiments 12-16, wherein the CPP comprises the amino acid sequence RRRRRRRR (SEQ ID NO: 5).

[0232] Embodiment 18 relates to compounds of embodiments 1 to 17, further comprising at least one biotin or analogue thereof bound to at least one avidin-type molecule. Embodiment 19 relates to a compound of embodiment 17, wherein at least one derivative of biotin is modified to be biotinidase resistant.

[0233] Embodiment 20 relates to a compound of embodiment 18, wherein the at least one biotin comprises at least one chelating group attached to the at least one biotin. Embodiment 21 relates to compounds of embodiment 20, wherein the chelator is EDTA, DTPA, DOTA, TETA, NOTA, cyclam, PCBA, DADT, or MAMA.

[0234] Embodiment 22 relates to compounds of embodiments 20-21, further comprising at least one of a radioactive isotope and a non-radioactive isotope chelated to a chelating agent. Embodiment 23 relates to compounds of embodiment 22, wherein the radioisotope is at least one of an alpha particle emitter, a beta particle emitter, and an Auger electron emitter.

[0235] Embodiment 24 is a method for treating a cancer cell comprising administering a non-radioactive isotope to a patient. 113 24. The compound of embodiment 23, wherein In is In. Embodiment 25 is a twenty-fifth embodiment, wherein the alpha particle emitter comprises: 211 At, 213 Bi, 223 Ra, 227 Th, and 225 24. The compound of embodiment 23, wherein at least one of Ac.

[0236] Embodiment 26 is a method for manufacturing a beta particle emitter, comprising: 33 P, 177 Lu, 67 Cu,131 I, 186 Re, 165 Dy, 89 Sr, 32 P, 166 Ho, 188 Re, and 90 24. A compound of embodiment 23, wherein at least one of Y.

[0237] Embodiment 27 is a twenty-seventh embodiment, wherein the Auger electron emitter is 125 I, 123 I, 77 Br, 111 In, and 195m 24. The compound of embodiment 23, wherein at least one of Pt.

[0238] Embodiment 28 is -G 1 -QG 2 is the single stranded DNA sequence -TGCGTGTGTAGTGTGTCTG-Q-CTCTTAGGGATTTGGGCGG- (SEQ ID NO: 21), and optionally 1 , Q, and G 2 28. The compound of any one of embodiments 1 to 27, comprising at least one binding arrangement that renders at least one of:

[0239] Embodiment 29 is G 1 , Q, and G 2 At least one of the 1 , Q, and G 2 28. The compound of any one of embodiments 1 to 27, comprising at least one binding arrangement that renders at least one of:

[0240] Embodiment 30 relates to compounds of embodiment 29, wherein at least one linkage configuration is 5'-phosphorothioate, 5-modified uracil, 4'-thio, 2'-fluoro, 5'-α-P-borano, 2'-amino, 2'-deoxy-L-ribose, 2'-methoxy, capped at the 3' end with an inverted thymidine, bridged nucleic acid (BNA), locked nucleic acid (LNA), and xenonucleic acid (XNA).

[0241] Embodiment 31 relates to a pharmaceutical composition comprising one or more compounds of embodiments 1 to 30 and a pharmaceutically acceptable carrier or excipient. Embodiment 32 relates to a method of treating cancer in a subject in need of such treatment, comprising administering a therapeutically effective amount of one or more compounds of embodiments 1-30.

[0242] Embodiment 33 relates to the method of embodiment 32, wherein the cancer is selected from all possible cancers, including prostate cancer, breast cancer, pancreatic cancer, thyroid cancer, bone cancer, glioblastoma, and neuroendocrine tumors. Embodiment 34 relates to the method of embodiments 32-33, further comprising administering one or more of the compounds of embodiments 1-30 in combination with at least one anti-cancer agent.

[0243] Embodiment 35 is

[0244] [ka]

[0245] During the ceremony, X 2 is a chelating agent, imaging agent, diagnostic agent, or therapeutic agent; L 1 is a linker group; L 5 is a linker group or bond, where L 1 and L 5 may be the same or different; T is a click chemistry-derived core; G 1 is the forward primer binding site; Q is randomized single-stranded DNA; G 2 relates to a compound of formula (V) or a pharmaceutically acceptable salt, polymorph, prodrug, solvate or clathrate thereof, which is a reverse primer binding site.

[0246] Embodiment 36 is X 236. The compound of embodiment 35, wherein is a chelating agent. Embodiment 37 relates to compounds of embodiments 35-36, wherein the chelating agent is EDTA, DTPA, DOTA, TETA, NOTA, cyclam, PCBA, DADT, or MAMA.

[0247] Embodiment 38 relates to compounds of embodiments 36-37, further comprising at least one of a radioactive isotope and a non-radioactive isotope chelated to a chelating agent. Embodiment 39 relates to compounds of embodiment 38, wherein the radioisotope is at least one of an alpha particle emitter, a beta particle emitter, and an Auger electron emitter.

[0248] Embodiment 40 is a method for treating a cancer cell comprising administering a non-radioactive isotope to a patient. 113 39. The compound of embodiment 38, wherein In is In. Embodiment 41 is a method for manufacturing an alpha particle emitter, comprising: 211 At, 213 Bi, 223 Ra, 227 Th, and 225 39. The compound of embodiment 38, wherein at least one of Ac.

[0249] Embodiment 42 is a method for manufacturing a beta particle emitter, comprising: 33 P, 177 Lu, 67 Cu, 131 I, 186 Re, 165 Dy, 89 Sr, 32 P, 166 Ho, 188 Re, and 90 Y.

[0250] Embodiment 39 is a thirty-ninth embodiment, wherein the Auger electron emitter comprises: 125 I, 123 I, 77 Br, 111 In, and 195m 39. The compound of embodiment 38, wherein at least one of Pt.

[0251] Aspect 40 relates to compounds of embodiments 35 to 39, wherein the randomized single-stranded DNA has 10 to 100 nucleotides. Embodiment 41 is -G 1 -QG 2 is the single stranded DNA sequence -TGCGTGTGTAGTGTGTCTG-Q-CTCTTAGGGATTTGGGCGG- (SEQ ID NO: 21), and optionally 1 , Q, and G 2 The compound of any one of embodiments 35 to 40, comprising at least one binding arrangement that renders at least one of the following nucleotides nuclease resistant:

[0252] Embodiment 42 is L 2 and L 3 42. The compound of any one of embodiments 35 to 41, wherein at least one of is a click chemistry derived linker. Embodiment 43 is L 1 and L 5 wherein at least one of the following is derived from copper-catalyzed azide-alkyne cyclocycloaddition (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC), inverse electron demand Diels-Alder reaction (IEDDA), and Staudinger ligation (SL).

[0253] Embodiment 44 is L 1 and L 5 44. The compound of any one of embodiments 35 to 43, wherein at least one of is a releasable group. Embodiment 45 is L 1 and L 5 is a photochemically, chemically, or enzymatically cleavable group.

[0254] Embodiment 46 is G 1 , Q, and G 2 At least one of the 1 , Q, and G 246. ​​The compound of any one of embodiments 35 to 45, comprising at least one binding arrangement that renders at least one of the following nucleotides nuclease resistant:

[0255] Embodiment 47 relates to compounds of embodiment 46, wherein at least one linkage configuration is 5'-phosphorothioate, 5-modified uracil, 4'-thio, 2'-fluoro, 5'-α-P-borano, 2'-amino, 2'-deoxy-L-ribose, 2'-methoxy, capped at the 3' end with an inverted thymidine, bridged nucleic acid (BNA), locked nucleic acid (LNA), and xenonucleic acid (XNA).

[0256] Embodiment 48 is a method for producing a compound of formula (V) comprising administering to a subject a compound of formula (VI):

[0257] [ka]

[0258] 48. The compound of any one of embodiments 35 to 47, further comprising a nuclear localization signal (NLS), such that Embodiment 49 is a case in which the compound of formula (V) is of formula (VII):

[0259] [ka]

[0260] 49. The compound of any one of embodiments 35 to 48, further comprising a nuclear localization signal (NLS) and further comprising a cell-penetrating peptide (CPP). Embodiment 50 relates to a linker L linking the NLS to the CPP. 3 50. The compound of embodiment 49, further comprising:

[0261] Embodiment 51 is L 2 and L 3 is a succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate based linker.

[0262] Embodiment 52 relates to compounds of embodiments 48 to 51, wherein the NLS comprises the amino acid sequence PKKKRKV (SEQ ID NO: 1). Embodiment 53 is a case in which the compound of formula (V) is of formula (VIII):

[0263] [ka]

[0264] 48. The compound of any one of embodiments 35 to 47, further comprising a cell-penetrating peptide (CPP), such that the compound is Embodiment 54 relates to compounds of embodiments 49 to 53, wherein the CPP comprises the amino acid sequence RRRRRRRR (SEQ ID NO: 5).

[0265] Embodiment 55 is a method for producing a compound having the formula:

[0266] [ka]

[0267] or a pharmaceutically acceptable salt, polymorph, prodrug, solvate or clathrate thereof. Embodiment 56 is a method for producing a compound having the formula:

[0268] [ka]

[0269] or a pharmaceutically acceptable salt, polymorph, prodrug, solvate or clathrate thereof. Embodiment 57 is a method for producing a compound having the formula:

[0270] [ka]

[0271] 48. The compound of any one of embodiments 35-47, wherein g is an integer such that the number average molecular weight (Mn) of the -OCH2CH2- moiety is from about 500 g / mol to about 10,000 g / mol.

[0272] Embodiment 58 relates to a pharmaceutical composition comprising one or more compounds of embodiments 35 to 57 and a pharmaceutically acceptable carrier or excipient. Embodiment 59 relates to a method of treating cancer in a subject in need of such treatment, comprising administering a therapeutically effective amount of one or more compounds of embodiments 35-57.

[0273] Embodiment 59 relates to the method of embodiment 59, wherein the cancer is selected from all possible cancers, including prostate cancer, breast cancer, pancreatic cancer, thyroid cancer, bone cancer, glioblastoma, and neuroendocrine tumors. Embodiment 60 relates to the method of embodiments 59-60, further comprising administering one or more of the compounds of embodiments 35-57 in combination with at least one anti-cancer agent.

[0274] (Addendum) The technical ideas that can be understood from the above-described embodiment and modified examples will be described. [Item 1] [ka] During the ceremony, X 2 is a chelating agent; L 1 is a linker group; L 5 is a linker group or bond, where L 1 and L 5 may be the same or different, and L 1 and / or L 5 has a chain length of 1 to 40 atoms; T is a click chemistry-derived core; G 1 is the forward primer binding site; Q is randomized single-stranded DNA; G 2 is the reverse primer binding site; The click chemistry-derived core may be (i) a triazole, (ii) an oxazole, (iii) a heterocycle derived from an electrocyclic reaction, or (iv) a heterocycle of the formula: [ka] is selected from one of In the formula, R b is alkyl, arylalkyl, -alkyl-S-alkyl or arylalkyl, or the side chain of any natural or non-naturally occurring amino acid; A compound of formula (V) or a pharmaceutically acceptable salt thereof: [Item 2] 2. The compound according to item 1, wherein the chelating agent is EDTA, DTPA, DOTA, TETA, NOTA, cyclam, PCBA, DADT, or MAMA. [Item 3] Item 1, wherein the compound further comprises at least one of a radioisotope and a non-radioisotope chelated to the chelating agent. [Item 4] 2. The compound according to item 1, wherein the randomized single-stranded DNA has 10 to 100 nucleotides. [Item 5] -G 1 -QG 2 is the single stranded DNA sequence -TGCGTGTGTAGTGTGTCTG-Q-CTCTTAGGGATTTGGGCGG- (SEQ ID NO: 21), and optionally 1 , Q, and G 2 2. The compound according to item 1, comprising at least one binding arrangement that renders at least one of the following nuclease-resistant: [Item 6] L 1 and L 5wherein at least one of (i) is a click chemistry-derived linker derived from copper-catalyzed azide-alkane cycloaddition (CuAAC), strain-promoted azide-alkyne cycloaddition (SPAAC), inverse electron demand Diels-Alder reaction (IEDDA), and Staudinger ligation (SL), or (ii) is a releasable group, optionally wherein the linker group is photochemically, chemically, or enzymatically cleavable. [Item 7] L 1 and L 5 Item 1, wherein at least one of the groups is a releasable group. [Item 8] G 1 , Q, and G 2 At least one of the 1 , Q, and G 2 2. The compound according to item 1, comprising at least one binding arrangement that renders at least one of the following nuclease-resistant: [Item 9] The compound of formula (V) may be represented by formula (VI): [ka] or The compound of formula (V) is of formula (VII): [ka] or The compound of formula (V) has formula (VIII): [ka] The compound further comprises a cell membrane penetrating peptide (CPP), The compound according to item 1. [Item 10] Linker L, which connects the NLS to the CPP 3 10. The compound according to item 9, further comprising: [Item 11] 10. The compound according to item 9, wherein the NLS comprises the amino acid sequence PKKKRKV (SEQ ID NO: 1). [Item 12] 10. The compound according to item 9, wherein the CPP comprises the amino acid sequence RRRRRRRR (SEQ ID NO: 5). [Item 13] The compound has the formula [ka] or a pharmaceutically acceptable salt thereof. [Item 14] The compound has the formula [ka] or a pharmaceutically acceptable salt thereof. [Item 15] The compound has the formula [ka] or a pharmaceutically acceptable salt thereof, Item 2. The compound according to item 1, wherein g is an integer such that the number average molecular weight (Mn) of the -OCH2CH2- moiety is about 500 g / mol to about 10,000 g / mol. [Item 16] A pharmaceutical composition comprising one or more compounds according to item 1 and a pharmaceutically acceptable carrier or excipient. [Item 17] 10. A pharmaceutical composition for administration to treat cancer in a subject in need thereof, comprising a therapeutically effective amount of one or more compounds according to item 1 as active therapeutic agents for treating cancer. [Item 18] 18. The pharmaceutical composition according to item 17, wherein the cancer is selected from all possible cancers including prostate cancer, breast cancer, pancreatic cancer, thyroid cancer, bone cancer, glioblastoma, and neuroendocrine tumors. [Item 19] Item 18. The pharmaceutical composition of item 17, wherein one or more compounds of item 1 are administered in combination with at least one anti-cancer agent.

Claims

[Claim 1] The invention described herein.

Images