Agent for controlling soil-borne disease of plant and method for controlling soil-borne disease of plant
Pseudomonas bacteria with specific 16S rRNA gene sequences effectively control soil-borne plant diseases, offering a safe, chemical-free alternative to traditional pesticides by preventing diseases like damping-off and black root rot.
Patent Information
- Application Number
- JP2025186095
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-11-05
- Publication Date
- 2026-01-19
AI Technical Summary
Chemical pesticides for controlling soil-borne plant diseases pose environmental and health risks, necessitating the development of a safer, effective biological alternative.
A soil-borne plant disease control agent utilizing Pseudomonas bacteria with specific 16S rRNA gene sequences (96% to 99% homology to SEQ ID NO: 1 or 2) is used to combat pathogens like Calonectria and Phytophthora fungi, applied to seeds or plants to prevent or reduce disease symptoms.
The Pseudomonas bacteria provide a phytotoxicity-free solution for controlling soil-borne diseases, allowing use up to harvest time, with demonstrated effectiveness against diseases such as damping-off and black root rot.
Smart Images

Figure 2026009325000001 
Figure 2026009325000002 
Figure 2026009325000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to an agent for controlling soil-borne plant diseases and a method for controlling soil-borne plant diseases. [Background technology]
[0002] Chemical pesticides such as fungicides and insecticides are widely used to protect plants from disease. However, while chemical pesticides have a high plant protection effect, they can also have a heavy environmental impact and can have adverse effects on plants and humans due to residual pesticides or pesticide exposure. To address these concerns about chemical pesticides, microorganisms that protect plants from disease have recently been used as biological pesticides. For example, Patent Document 1 reports a composition for controlling black root rot containing a microorganism belonging to the genus Trichoderma as an active ingredient. [Prior art documents] [Patent documents]
[0003] [Patent Document 1] Japanese Patent Application Laid-Open No. 2006-151898 Summary of the Invention [Problem to be solved by the invention]
[0004] An object of the present invention is to provide a novel agent for controlling soil-borne plant diseases containing a microorganism as an active ingredient, and a novel method for controlling soil-borne plant diseases using the microorganism. [Means for solving the problem]
[0005] As a result of extensive research, the present inventors have discovered that the Pseudomonas bacterium OFT2 strain having a 16S rRNA gene consisting of the base sequence shown in SEQ ID NO: 1 and the Pseudomonas bacterium OFT5 strain having a 16S rRNA gene consisting of the base sequence shown in SEQ ID NO: 2 have excellent control effects against soil-borne plant diseases, leading to the completion of the present invention.
[0006] That is, the present invention includes, for example, the following aspects. [1] A soil-borne plant disease control agent containing as an active ingredient a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof. [2] A soil-borne disease control agent according to [1], which contains as an active ingredient a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 98% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 99% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof. [3] The soil-borne disease control agent according to [1] or [2], wherein the pathogenic microorganisms of the soil-borne disease include Calonectria fungi, Phytophthora fungi, or a combination thereof. [4] The soil-borne disease control agent according to any one of [1] to [3], wherein the soil-borne disease is damping-off disease. [5] The soil-borne disease control agent according to any one of [1] to [4], wherein the plant is a legume. [6] A method for controlling soil-borne diseases of plants, comprising the step of applying to soil or plants a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof. [7] The method described in [6], which includes a step of applying to soil or a plant a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 98% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 99% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof. [8] The method according to [6] or [7], wherein the pathogenic microorganisms of soil-borne diseases include Calonectria fungi, Phytophthora fungi, or a combination thereof. [9] The method according to any one of [6] to [8], wherein the soil-borne disease is damping-off disease.
[10] The method according to any one of [6] to [9], wherein the plant is a legume.
[11] The method according to any one of [6] to
[10] , wherein the step of applying the bacteria to soil or a plant comprises adding a liquid containing the bacteria to seeds. [Effects of the Invention]
[0007] According to the present invention, a novel agent for controlling soil-borne plant diseases containing a microorganism as an active ingredient can be provided. The present invention also provides a novel method for controlling soil-borne plant diseases using a microorganism. Because the present invention uses a bacterium as an active ingredient, there is no need to worry about phytotoxicity, as occurs with non-natural chemical pesticides, and the agent can be used or practiced up until just before harvest. [Brief explanation of the drawings]
[0008] [Figure 1]1 shows photographs of soybean plants after two weeks of cultivation in Test Example 1, showing comparative observations. [Figure 2] 1 is a graph comparing the proliferation rate of pathogenic bacteria (Ci-rDNA / Gm-Act1) in Test Example 1 (Tukey's HSD test, P<0.05). [Figure 3] 1 is a graph comparing the dry weight (g / individual) of aboveground parts of soybean plants after 4 weeks of cultivation in Test Example 2 (Tukey's HSD test, P<0.05). [Figure 4] 1 shows photographs of comparative observation of mycelial colonies of the black root rot fungus on filter paper after 7 days of culture in Test Example 3. [Figure 5] 1 is a graph comparing the relative growth rate of the root rot fungus on filter paper after 7 days of culture in Test Example 3. [Figure 6] Photographs showing comparative observations of mycelial colonies of the black root rot fungus on plates after 7 days of culture in Test Example 3. The top plate is a plate on which various Pseudomonas bacteria were cultured or a mock, and the bottom plate is a plate inoculated with the black root rot fungus. [Figure 7] 1 is a graph comparing the relative growth rate of the root rot fungus on plates after 7 days of culture in Test Example 3. DETAILED DESCRIPTION OF THE INVENTION
[0009] Hereinafter, embodiments of the present invention will be described in detail, but the present invention is not limited to the following embodiments.
[0010] [Soil-borne plant disease control agent] In one embodiment of the present invention, a soil-borne disease control agent for plants contains as an active ingredient a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
[0011] (Pseudomonas bacteria) The base sequence of the 16S rRNA gene of the Pseudomonas bacterium contained in the control agent of this embodiment may have sequence homology to the base sequence shown in SEQ ID NO: 1 of 95%, 95.5% or more, 96% or more, 96.5%, 97% or more, 97.5%, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 100%. The base sequence shown in SEQ ID NO: 1 is the base sequence of the 16S rRNA gene of the Pseudomonas bacterium OFT2 strain. The Pseudomonas bacterium OFT2 strain has been deposited at the National Patent Microorganisms Depositary (NPMD), Biotechnology Center, National Institute of Technology and Evaluation (NITE) (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan), under the accession number NITE P-01743 (deposit date: October 31, 2013). The bacterium contained in the control agent of this embodiment may be the Pseudomonas bacterium OFT2 strain.
[0012] The base sequence of the 16S rRNA gene of the Pseudomonas bacterium contained in the control agent of this embodiment may have sequence homology to the base sequence shown in SEQ ID NO: 2 of 97% or more, 97.5%, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 100%. The base sequence shown in SEQ ID NO: 2 is the base sequence of the 16S rRNA gene of the Pseudomonas bacterium OFT5 strain. The Pseudomonas bacterium OFT5 strain has been deposited at the Patent Microorganisms Depositary, Biotechnology Center, National Institute of Technology and Evaluation, Japan, under the accession number NITE P-02593 (deposit date: December 14, 2017). The bacterium contained in the control agent of this embodiment may be the Pseudomonas bacterium OFT5 strain.
[0013] The Pseudomonas bacteria OFT2 strain, Pseudomonas bacteria OFT5 strain, and the Pseudomonas bacteria RH7 strain used as a comparative example in the examples are described in, for example, Matsuoka et al., Plant Soil (2016), 407:173-186.
[0014] The control agent of this embodiment may contain, as an active ingredient, Pseudomonas bacteria OFT2 strain, Pseudomonas bacteria OFT5 strain, or a combination thereof.
[0015] Bacteria having a 16S rRNA gene consisting of a base sequence that is highly homologous to the base sequence shown in SEQ ID NO: 1 and bacteria having a 16S rRNA gene consisting of a base sequence that is highly homologous to the base sequence shown in SEQ ID NO: 2 each have a control effect against soil-borne diseases, and therefore are effective when used alone, but they may also be used in combination.
[0016] Pseudomonas bacteria may be isolated by the user or provided by a facility. Alternatively, commercially available biopesticide products such as Pseudomonas sp. may be used. Bacteria (i.e., commercially available products) may be used, and there are no particular limitations regarding their use.
[0017] (soil-borne diseases) The soil-borne disease that is the target of the control agent of this embodiment is not particularly limited as long as it is a disease caused by pathogenic microorganisms that live in the soil, such as filamentous fungi (fungi, oomycetes, etc.) and bacteria. Specific examples of pathogenic filamentous fungi include Phytophthora fungi such as Phytophthora sojae, Phytophthora cactorum, Phytophthora capsici, and Phytophthora cinnamomi; Calonectria fungi such as Calonectria ilicicola; Pythium fungi such as Pythium ultimum, Pythium aphanidermatum, and Pythium megalacanthum; Fusarium oxysporum; and Fusarium cepa. Examples include fungi of the genus Fusarium such as Fusarium graminearum and Fusarium solani, fungi of the genus Rhizoctonia such as Rhizoctonia solani, and fungi of the genus Thielaviopsis.Specific examples of pathogenic microorganisms other than filamentous fungi include Erwinia species such as Erwinia carotovora, Ralstonia species such as Ralstonia solanacearum, Pectobacterium species such as Pectobacterium carotovorum, Burkholderia species such as Burkholderia glumae, and Agrobacterium species such as Agrobacterium tumefaciens. In this embodiment, the pathogenic microorganism of the soil-borne disease preferably includes a filamentous fungus, more preferably a fungus of the genus Calonectria, a fungus of the genus Phytophthora, or a combination thereof, and even more preferably Calonectria irishicola, Phytophthora soja, or a combination thereof. Calonectria irishicola is a pathogen that causes soybean black root rot and is known to infect a wide range of legumes, including peanut, alfalfa, wild soybean, tea plant, blueberry, avocado, and the like. Calonectria irishicola may be the UH2-1 strain.
[0018] Examples of soil-borne diseases that are targets of the control agent of this embodiment include seedling damping-off, Pythium rot, transplanted seedling root rot, wilt, leaf rot, root rot, vine splitting, damping-off, yellowing, bottom rot, root rot weakening, cone browning, rot, leaf blight, dry rot, foot blight, Fusarium head blight, bulb rot, stem rot wilt, stem rot, root rot wilt, black-streaked fruit rot, semi-blight, black spot, Panama disease, brown rot, Fusarium wilt, and foot rot Examples of diseases that can be caused by this disease include, but are not limited to, sheath blight, bud blight, spider blight, brown sheath blight, bottom rot, Rhizoctonia, corm rot, black spot, hole leaf blight, dry root rot, large-grain white blight, tiger spot, bottom rot, fruit rot, backbone, forest root rot, butt rot, pod rot, skin rot, brown spot, root rot, brown spot, white leaf rot, Rhizoctonia leaf sheath rot, Rhizoctonia root rot, and hydroponic seedling root rot. The soil-borne disease may also be damping-off disease. Damping-off disease is a general term for diseases that infect the roots or stems at ground level, causing poor growth of the entire plant and, as the disease progresses, eventually causing the entire plant to show symptoms of damping-off. Examples of damping-off diseases include black root rot, stem blight, and damping-off disease. The soil-borne disease may be black root rot and / or soybean stem rot, and if the plant is soybean, it may be soybean black root rot and / or soybean stem rot. Soybean black root rot is a disease caused by Calonectria irishicola, and occurs mainly in the underground parts (roots), causing damage in the later stages of growth. At present, no effective resistant varieties or highly effective techniques for completely suppressing the disease have been found. Soybean stem rot is a disease caused by Phytophthora soja, and occurs throughout the soybean growth period, causing damage mainly from immediately after sowing to the early stages of growth.
[0019] (plant) In this embodiment, the target plant for disease control is not particularly limited, but is preferably an agricultural product, such as, but not limited to, vegetables, grains, fruits, flowers, and beans.Specific examples thereof include legumes (soybean plants such as soybean and wild soybean, Medicago plants such as alfalfa, Vigna plants such as cowpea and adzuki bean, Phaseolus plants such as kidney beans, Pisum plants such as pea, Winged bean plants such as winged beans, Vicia plants such as broad beans, Jack beans such as jack beans, Arachis plants such as peanuts, and Lentil plants such as lentils), Psalmidae plants (sesame plants), Ericaceae plants (azalea plants such as azalea, blueberries, hillberries, cranberries, etc.) Plants of the genus Vaccinium such as moss), plants of the Lauraceae family (plants of the genus Alligator pear such as avocado), plants of the Theaceae family (plants of the genus Camellia such as tea plants), plants of the Cucurbitaceae family (plants of the genus Cucumber such as cucumber and melon, plants of the genus Melon such as watermelon, plants of the genus Cucurbita such as pumpkin and zucchini, plants of the genus Bottle gourd such as gourd and bottle gourd, plants of the genus Luffa such as loofah, plants of the genus Wax gourd such as wax gourd, plants of the genus Ecclesiastes such as Easter melon, plants of the genus Momordica such as bitter melon, plants of the genus Momordica (bitter melon) such as bitter gourd, plants of the genus Momordica (bitter melon) such as bitter melon, plants of the genus Solanaceae (plants of the genus Solanum such as eggplant, tomato, potato, etc., plants of the genus Tocopheryl Acre such as bell pepper and chili pepper, etc.), plants of the Solanaceae family (plants of the genus Solanum such as eggplant, tomato, potato, etc., plants of the genus Tocopheryl Acre such as bell pepper and chili pepper, etc.), plants of the family Solanaceae (plants of the genus Solanum such as eggplant, tomato, potato, etc., plants of the genus Tocopheryl Acre such as bell pepper and chili pepper, etc.), plants of the family Tocopheryl Acre Capsicum plants), Araceae (Coraceae plants such as taro), Convolvulaceae (Ipomoea plants such as sweet potato), Dioscoreaceae (Chinese yam, Dioscorea etc.), Brassicaceae (Brassica plants such as turnip, Radish plants such as radish, Wasabi plants such as wasabi, Horseradish plants such as horseradish), Asteraceae (Lactuca plants such as lettuce, Larch plants such as burdock, Garland chrysanthemum plants such as garland chrysanthemum), Lamiaceae (Perilla plants such as perilla), Zingiberaceae (Ginger etc.) plants of the genus Zingiber), plants of the Apiaceae family (plants of the genus Carrot such as carrot, plants of the genus Dropwort such as water dropwort, plants of the genus Ophiopogon such as parsley and celery), plants of the Allium family (plants of the genus Allium such as scallions, chives and leeks), plants of the Brassicaceae family (plants of the genus Brassica such as cabbage, mustard greens, Chinese cabbage, komatsuna, takana, and bok choy, plants of the genus Radish such as radish), plants of the Amaranthaceae family (plants of the genus Spinach such as spinach), plants of the Gramineae family (plants of the genus Oryza such as rice, plants of the genus Triticum such as wheat, plants of the genus Maize such as corn, plants of the genus Hordeum such as barley), etc.In this embodiment, the target plant to be disease-controlled may be a legume, a Theaceae, an Ericaceae, or a Lauraceae plant; a Glycine max, an Arachis hypogaea, an Alfalfa (Medicago sativa), a Glycine soja (Glycine soja), a Tea plant (Camellia sinensis), a Blueberry, or an Avocado (Persea americana). In this embodiment, the target plant to be disease-controlled may be a legume, a Glycine max or Arachis, or a Soybean. When the target plant to be disease-controlled is a legume, the bacteria contained in the control agent of this embodiment can also improve growth. Therefore, when the plant to be controlled is a leguminous plant, the control agent of this embodiment may be an agent for controlling soil-borne diseases and promoting plant growth.
[0020] As used herein, "control of soil-borne diseases" means preventing a plant from being infected with a pathogenic microorganism of a soil-borne disease, or reducing the symptoms of the disease if the plant is infected. Whether or not a soil-borne disease has been controlled can be determined by methods known to those skilled in the art, and can be determined based on, for example, the presence or absence and proliferation rate of pathogenic microorganisms in the plant, the presence or absence and severity of disease symptoms in the plant, plant growth (e.g., dry weight of the aboveground part), etc.
[0021] The control agent of this embodiment is a composition, and its form may be liquid, solid, gel, paste, or the like, and can be appropriately selected depending on the usage situation, etc. When the form is liquid, the Pseudomonas bacteria can be applied to soil or plants (including seeds) by operations such as spraying, dripping, or immersion. When the form is solid, the bacteria may be applied by placing the solid on or in the soil, or by contacting the solid with the surface of the plant. When the form is gel or paste, the bacteria may be applied by placing the gel or paste on or in the soil, or by applying the gel or paste to the surface of the plant, or by applying the gel or paste to the surface of the seed (for example, coating).
[0022] The amount of Pseudomonas bacteria contained in the control agent of this embodiment can be appropriately set depending on the type of plant to which it is applied, the type of formulation, the application method, etc. The bacterial concentration of the control agent is not particularly limited, but can be, for example, OD 600 =0.2 to 0.8, 0.2 to 0.4, 0.4 to 0.6, or 0.6 to 0.8. When two or more types of bacteria are used, the above bacterial concentration means the total concentration of all the bacteria.
[0023] The control agent of this embodiment may be in the form of a concentrate. In this case, the concentration ratio is not particularly limited and can be, for example, 2 to 1000 times, 5 to 100 times, or 10 to 50 times. When the control agent of this embodiment is a concentrate, it can be appropriately diluted with a solvent such as water, and the diluted solution can be applied to soil or plants. The content of Pseudomonas bacteria in the control agent of this embodiment can be set according to the concentration ratio.
[0024] The control agent of this embodiment does not need to be mixed into the soil, and a control effect can be obtained by simply dropping it directly onto the seeds or their surroundings. In this case, for example, the bacterial concentration of the control agent is OD 600=0.2 to 0.8, 0.2 to 0.4, 0.4 to 0.6, or 0.6 to 0.8, and 0.1 mL to 20 mL, 0.5 mL to 10 mL, or 1 mL to 5 mL of this can be dropped per seed.
[0025] The control agent of this embodiment may be a liquid, solid, gel, or paste containing bacteria. Examples of liquids include water, liquid culture media, buffer solutions, etc. The control agent of this embodiment may be a capsule in which bacteria contained in a liquid are encapsulated. Examples of solids include solid culture media, etc. Examples of gels include culture medium gel, etc. Examples of culture media include Tryptic Soy Broth (TSB) agar plate medium, YP medium, King B medium (Eiken Chemical Co., Ltd.), etc.
[0026] The method for adding Pseudomonas bacteria to the control agent of this embodiment is not particularly limited, and they may be added as is. For example, Pseudomonas bacteria can be cultured by a method known to those skilled in the art, and recovered by centrifugation or the like if they are in a liquid medium, or by using a platinum loop or the like to recover formed colonies if they are in a solid medium, and then added to the control agent of this embodiment. Alternatively, Pseudomonas bacteria stored in a liquid may be freeze-dried by a known method, and added as a solid to the control agent of this embodiment. Furthermore, the control agent of this embodiment may be the medium (culture solution, solid medium) itself in which the bacteria were cultured, or a suspension in which bacteria isolated / purified from the medium are suspended in water or the like. As a specific example, the control agent of this embodiment may be obtained by recovering the precipitate in a culture solution in which Pseudomonas bacteria have been cultured and suspending it in water.
[0027] The control agent of this embodiment may also contain additives such as excipients, thickeners, binders, stabilizers, preservatives, pH adjusters, colorants, and flavoring agents. The various additives are not particularly limited, but materials known in the technical field of biopesticides can be used, and the amount of each additive can be adjusted appropriately based on the techniques known to those skilled in the art.
[0028] As used herein, "sequence identity" refers to the percentage (%) of identical DNA bases in the total overlapping DNA sequence in an optimal alignment of two DNA sequences using a mathematical algorithm known in the art. For example, Multiple Sequence Alignment (Clustal Omega: https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) can be used to create the alignment, and Percent Identity Matrix (Clustal2.1) can be used to calculate sequence identity.
[0029] [Method for controlling soil-borne plant diseases] In one embodiment of the present invention, a method for controlling soil-borne diseases in plants includes a step of applying to soil or a plant a bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence identity to the base sequence shown in SEQ ID NO: 1, a bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
[0030] In the control method of this embodiment, the sequence homology of the base sequence of the 16S rRNA gene of the Pseudomonas bacterium applied to the soil or plants to the base sequence shown in SEQ ID NO: 1 may be 96% or more, 96.5%, 97% or more, 97.5%, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 100%.
[0031] In the control method of this embodiment, the sequence homology of the base sequence of the 16S rRNA gene of the Pseudomonas bacterium applied to the soil or plants to the base sequence shown in SEQ ID NO: 2 may be 97% or more, 97.5%, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 100%.
[0032] The Pseudomonas bacteria used in the control method of this embodiment, the soil-borne diseases to be controlled, the plants to be controlled, etc. are as described above.
[0033] The Pseudomonas bacteria described above are applied to soil or plants, and the method and means for applying them are not particularly limited as long as the effects of the control method of this embodiment can be obtained.
[0034] The Pseudomonas bacteria may be applied in either liquid or solid form. When the bacteria are in liquid form, they can be applied to soil or plants by spraying, dripping, immersion, or other procedures. For example, the application procedure can be carried out by preparing water (suspension) in which Pseudomonas bacteria are suspended and contacting the prepared suspension with soil or plants. When applying to soil, for example, a liquid containing Pseudomonas bacteria may be mixed into the soil into which plant seeds are sown or the soil in which plants are planted. In the case of immersion, a separate container may be prepared and the perforated container containing the soil or plants may be placed in the container containing the liquid. When the Pseudomonas bacteria are in solid form, they may be applied by placing the solid on or in the soil, or by contacting the surface of the plant body with the solid.
[0035] As used herein, "soil" refers to soil in which plants can grow. The soil used in the control method of this embodiment may be, for example, culture soil, fertilizer, seedling soil, or seedling culture soil. Alternatively, soil from mountains and fields that has not been treated may be used as is. The particle size of the soil is not particularly limited, and any soil may be used as long as plants can grow therein. In the present invention, artificial soil for soil improvement such as vermiculite may be used, but among various soils, it is particularly preferable to use seedling culture soil. Seedling culture soil is soil containing fertilizer that serves as the base for cultivation, and is classified as bed soil.
[0036] In the control method of this embodiment, soil containing plants means soil in which plants exist within or on top of the soil. When plants exist within the soil, the plants may be entirely embedded in the soil, or part of the plants may be embedded in the soil with the remaining part protruding from the soil. The soil to which the control method of this embodiment is applied is preferably soil near the plants (for example, soil within 10 cm of the plants).
[0037] The state of the plant to be controlled is not particularly limited, and may be a seed or a seedling, or an already grown plant. However, seeds or a seedling are preferred, and seeds are more preferred. By using seeds or seedlings in the early stages of growth, the onset of soil-borne diseases can be suppressed, allowing for more effective control of soil-borne diseases in plants. Furthermore, the young state of plant tissues makes it easier for Pseudomonas bacteria to colonize the plant body, which also allows for more effective control of soil-borne diseases. When the plant is already grown, Pseudomonas bacteria can be applied to any part of the plant, such as the roots, leaves, stems, branches, or trunk.
[0038] The amount of Pseudomonas bacteria to be applied to soil or plants is not particularly limited and can be appropriately determined depending on the application form, the type of target plant, etc. For example, when applying Pseudomonas bacteria to soil, for example, 1 cm 3 10 per soil 4 ~10 20 CFU, or 10 6 ~10 10 The amount of Pseudomonas bacteria to be added can be adjusted by adjusting the concentration of the bacteria in the formulation containing them and the amount of the formulation to be added. For example, when Pseudomonas bacteria are added to plants, 10 CFU of Pseudomonas bacteria can be added to one plant at a time. 4 ~10 20 CFU, preferably 10 6 ~10 10They can be applied in the form of bacterial counts of CFU. The amount of Pseudomonas bacteria applied can be adjusted by adjusting the concentration in a formulation containing them and the amount of the formulation applied. The control method of this embodiment is characterized in that a control effect can be obtained simply by directly dropping a formulation containing Pseudomonas bacteria onto seeds or their surroundings. Therefore, in the control method of this embodiment, the step of applying Pseudomonas bacteria to soil or plants may include adding a liquid containing the bacteria to seeds. In this case, for example, 2 x 10 per seed per application. 8 ~4×10 8 , 4×10 8 ~8×10 8 , or 8 x 10 8 ~2×10 9 For example, the OD of the liquid containing the bacteria can be 600 Alternatively, a liquid may be prepared so that the bacterium concentration becomes 0.3 to 0.5, and 0.5 mL to 3 mL of the liquid may be added to the seeds. Adding the liquid containing the bacteria to the seeds may be, for example, dropping the liquid containing the bacteria onto the seeds, or coating the seeds with the liquid containing the bacteria. When coating seeds with the liquid containing the bacteria, for example, 2 × 10 per seed per application. 8 ~4×10 8 , 4×10 8 ~8×10 8 , or 8 x 10 8 ~2×10 9 Addition of a liquid containing the bacteria to seeds, including direct dripping of the liquid containing the bacteria onto the seeds or their surroundings, or coating the seeds with the liquid containing the bacteria, can achieve a control effect with a small amount of Pseudomonas bacteria, and is therefore easier to prepare and more cost-effective than mixing a large amount of Pseudomonas bacteria into soil.
[0039] The timing of adding Pseudomonas bacteria may be any of before sowing the plants, at the time of sowing, and after sowing (including the seedling raising period, planting period, etc.), and is not particularly limited, but is preferably at the time of sowing the plants or immediately after sowing.
[0040] When Pseudomonas bacteria are applied before sowing of plants, the specific timing is not particularly limited, but may be, for example, within 7 days, within 6 days, within 5 days, within 4 days, within 3 days, within 2 days, within 1 day, within 12 hours, within 6 hours, within 3 hours, within 1 hour, within 30 minutes, within 10 minutes, within 5 minutes, within 1 minute, or within 30 seconds before sowing.
[0041] When Pseudomonas bacteria are applied when sowing plants, the specific timing is not particularly limited. For example, seeds that have been contacted with Pseudomonas bacteria in advance may be sown in soil.
[0042] When the bacterium is applied after sowing, the application time may be, for example, within 7 days, 6 days, 5 days, or 4 days after sowing, or within 2 days, 1 day, 12 hours, 6 hours, 3 hours, 1 hour, 30 minutes, 10 minutes, 5 minutes, 1 minute, or 30 seconds after sowing. In this specification, "immediately after sowing" refers to within 10 minutes after sowing. In the control method of this embodiment, it is preferable for the Pseudomonas bacterium and the plant to come into contact with each other at an early stage of plant growth. From this perspective, the shorter the period between the application time and the plant sowing time, the better. For example, it is preferable to apply the bacterium at least within 3 days before or after sowing, or at least within 1 day before or after sowing. When the composition is applied after sowing the plants of this embodiment, it is preferable to apply it before the plants are infected with a soil-borne disease, but it may also be applied after the plants are infected with a soil-borne disease. A control effect can be expected if it is applied before the plants are fatally damaged by the soil-borne disease.
[0043] When a combination of bacteria having a 16S rRNA gene consisting of a nucleotide sequence highly homologous to the nucleotide sequence shown in SEQ ID NO: 1 and bacteria having a 16S rRNA gene consisting of a nucleotide sequence highly homologous to the nucleotide sequence shown in SEQ ID NO: 2 is provided, either bacterium may be provided first. That is, bacteria having a 16S rRNA gene consisting of a nucleotide sequence highly homologous to the nucleotide sequence shown in SEQ ID NO: 1 may be provided first, followed by bacteria having a 16S rRNA gene consisting of a nucleotide sequence highly homologous to the nucleotide sequence shown in SEQ ID NO: 2. Alternatively, bacteria having a 16S rRNA gene consisting of a nucleotide sequence highly homologous to the nucleotide sequence shown in SEQ ID NO: 2 may be provided first, followed by bacteria having a 16S rRNA gene consisting of a nucleotide sequence highly homologous to the nucleotide sequence shown in SEQ ID NO: 1. Two types of bacteria may also be provided simultaneously. When two types of bacteria are provided simultaneously, for example, a composition containing the two types of bacteria (e.g., the control agent described above) may be provided.
[0044] The specific aspects of the method of this embodiment can be the same as those described above without any restrictions.
[0045] [Soil-borne plant disease control kit] As one embodiment, the present invention also provides a kit for controlling soil-borne plant diseases, comprising a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
[0046] The Pseudomonas bacteria used in the kit of this embodiment, the soil-borne disease to be controlled, and the plant to be controlled are as described above.
[0047] The Pseudomonas bacterium in the kit of this embodiment may be a preparation, and its form is not particularly limited. When the kit of this embodiment includes both a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence highly homologous to the base sequence shown in SEQ ID NO: 1 and a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence highly homologous to the base sequence shown in SEQ ID NO: 2, both may be contained in the same preparation, or may be contained separately in separate preparations. When separated into separate preparations, the preparations may be in different types of dosage forms or the same type of dosage form.
[0048] The form of the formulation used in the kit of this embodiment is not particularly limited, and may be any form such as liquid, solid, gel, paste, etc. The content of Pseudomonas bacteria in the formulation is also not particularly limited, and can be set as desired in accordance with the control agent or control method of this embodiment described above.
[0049] The preparation used in the kit of this embodiment may be individually packaged for single use, containing an amount for one use, or may be packaged in a form containing an amount for multiple uses (e.g., 2, 3, 4, 5, 10 or more). The container to be used is not particularly limited and can be selected appropriately depending on the amount of preparation to be used, etc.
[0050] The kit of this embodiment may include instructions on the use of the Pseudomonas bacterium and / or instructions on a control method using the kit.
[0051] The kit of this embodiment is used for controlling soil-borne diseases of plants. The target plants and soil-borne diseases are not particularly limited, and specific examples are the same as those described above. The kit of this embodiment can also be used as a biological pesticide or microbial pesticide.
[0052] The specific aspects of the method of this embodiment can be the same as those described above without any restrictions.
[0053] The present embodiment described above can also be understood as a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 96% or more identical to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 98% or more identical to the base sequence shown in SEQ ID NO: 2, or a combination thereof, for use in controlling soil-borne diseases. The present embodiment can also be understood as the use of a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 96% or more identical to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 98% or more identical to the base sequence shown in SEQ ID NO: 2, or a combination thereof, in the production of a soil-borne disease control agent.
[0054] [Growth enhancer and growth enhancer for legumes] As one embodiment, the present invention also provides a growth promoter for legumes, comprising a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence identity to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
[0055] In addition, as one embodiment, the present invention also provides a method for improving the growth of legumes, comprising the step of applying to soil or plants a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence identity to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
[0056] Whether or not the growth of a legume has improved can be determined by methods known to those skilled in the art. For example, if the dry weight of the aboveground parts of a legume treated with the specific Pseudomonas bacterium is increased compared to a legume not treated with the specific Pseudomonas bacterium, it can be determined that the growth of the legume has improved.
[0057] The present embodiment described above can also be understood as a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 96% or more identical to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 98% or more identical to the base sequence shown in SEQ ID NO: 2, or a combination thereof, for use in improving the growth of legumes. Furthermore, the present embodiment can also be understood as the use of a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 96% or more identical to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that is 98% or more identical to the base sequence shown in SEQ ID NO: 2, or a combination thereof, in the production of a growth improver for legumes.
[0058] The legume plant and the Pseudomonas bacterium are as described above. Specific aspects of the growth enhancer and growth enhancing method of this embodiment can be applied without limitation to the specific aspects described above. For example, the specific aspects described above in [Agent for controlling soil-borne diseases of plants] can be applied without limitation to the specific aspects of the growth enhancer. Specific examples include the form of the control agent described above in [Agent for controlling soil-borne diseases of plants]. Specific examples include the form of the growth enhancer that can be applied without limitation to the specific aspects of the growth enhancing method that can be applied without limitation to the specific aspects described above in [Method for controlling soil-borne diseases of plants]. Specific examples include the "step of applying Pseudomonas bacteria to soil or plants" that can be applied with the "step of applying Pseudomonas bacteria to soil or plants" described above in [Method for controlling soil-borne diseases of plants]. [Example]
[0059] The present invention will be described in more detail below with reference to examples, although the present invention is not limited to the following examples.
[0060] [Preparation of bacteria and fungi used in the test examples] The bacteria (Pseudomonas bacteria) whose disease control effects were examined in the test examples and the filamentous fungus (black root rot fungus) used as a pathogenic microorganism were cultured as follows.
[0061] Pseudomonas bacteria (OFT2 and OFT5 strains) were inoculated into Tryptic Soy Broth (TSB) liquid medium and cultured overnight at 28°C with shaking. The Pseudomonas bacteria were collected by centrifugation and suspended in sterilized water (OD 600 =0.4).
[0062] The black root rot fungus (Calonectria irishicola strain UH2-1) was transferred to a potato dextrose agar (PDA) plate and cultured at 25°C for several days. It was then transferred to an inoculation medium (wheat bran: vermiculite: water = 1:1:3) and cultured at 25°C for 2 weeks, and used as an inoculum for soybean seedlings.
[0063] [Test Example 1: Effect on the occurrence of soybean black root rot] Soybean (Enrei) seeds were sown in soil contaminated with the black root rot fungus (Calonectria irishicola UH2-1 strain, 1% w / v). At the time of sowing, 1 mL of sterile culture medium (Mock) or Pseudomonas OFT-2 or OFT-5 strain (OD ) was applied to each seed. 600 =0.4) was dropped at 1 mL per seed.
[0064] Figure 1 shows photographs of soybean plants grown for two weeks in a greenhouse (25°C) for comparative observation. In Figure 1, after two weeks of cultivation, "Un-inoculated" indicates an untreated plant grown in soil that does not contain the black root rot fungus, "Mock" indicates a plant inoculated with a sterile culture solution, "OFT2" indicates a plant inoculated with the OFT-2 strain, and "OFT-5" indicates a plant inoculated with the OFT-5 strain. Note that "Mock," "OFT2," and "OFT-5" were grown in soil mixed with the black root rot fungus.
[0065] In addition, DNA was extracted from each individual plant of "Mock," "OFT2," and "OFT-5" after two weeks of greenhouse cultivation (25°C). The relative ratio of the pathogen genome to the plant genome (Ci-rDNA / Gm-Act1) was calculated by quantitative PCR to compare the pathogen growth rate (Tukey's HSD test, P<0.05). Figure 2 shows the results. The primers used for quantitative PCR are as follows: Black root rot fungus rDNA: TCCATTGCCTCTATTTATCCTGC (SEQ ID NO: 4) / GCGTAAAGATTTTCCAACCCG (SEQ ID NO: 5); soybean ACTIN1: GAGCTATGAATTGCCTGATGG (SEQ ID NO: 6) / CGTTTCATGAATTCCAGTAGC (SEQ ID NO: 7).
[0066] This showed that compared to the "Mock" individual, the "OFT2" and "OFT-5" individuals had improved seedling growth, and correspondingly, the proliferation of pathogenic bacteria was suppressed, resulting in a significant reduction in the incidence of black root rot.
[0067] [Test Example 2: Growth promoting effect on soybeans] Soybean (Enrei) seeds were sown in sterilized soil, and 1 mL of sterile culture medium (Mock) or Pseudomonas bacteria OFT-2 or OFT-5 was applied to each seed at OD . 600 =0.4) 1 mL was dropped per seed.
[0068] After 4 weeks of cultivation in a greenhouse (25°C), the above-ground parts of soybean plants were harvested from the soil and dried in a dryer at 70°C for 3 days. After cooling to room temperature, the plants were weighed and the dry weight of the above-ground parts (g / plant) was calculated and compared (Tukey's HSD test, P<0.05).
[0069] The results are shown in Figure 3. "Mock" indicates plants inoculated with a sterile culture solution, "OFT2" indicates plants inoculated with the OFT-2 strain, and "OFT-5" indicates plants inoculated with the OFT-5 strain. Inoculation with the OFT-2 and OFT-5 strains increased the dry weight of the aboveground parts of soybean plants, demonstrating the growth-promoting effect of these bacteria on soybean plants.
[0070] [Test Example 3: Growth inhibitory effect on the growth of the root rot fungus on culture medium] The growth inhibitory effect of water-soluble substances produced by Pseudomonas bacteria on the growth of the black root rot fungus was tested as follows.
[0071] Pseudomonas bacteria OFT-2 or OFT-5 were cultured on TSB agar medium or sterile medium (mock), and an equal volume of sterile water was added to disrupt the bacteria. The mixture was then centrifuged at 3,000 rpm for 20 minutes to prepare the water-soluble supernatant fraction. The water-soluble fraction was then sterilized using a 0.22 μm filter and then impregnated onto sterile filter paper (90 mm). Black root rot fungus (5 mm diameter) was spot-inoculated onto the filter paper and cultured at 25°C for 7 days. The diameter of the mycelial colonies was measured using a ruler. The growth rate of black root rot fungus was calculated using OFT-2 or OFT-5 / Mock × 100, and the relative growth rate of black root rot fungus was expressed relative to the mock (Tukey's HSD test, P < 0.05).
[0072] A photograph of the mycelial colonies of black root rot fungus on filter paper after 7 days of culture is shown in Figure 4. A graph comparing the relative growth rates of black root rot fungus is shown in Figure 5. It was found that the water-soluble fractions produced by OFT-2 and OFT-5 strains have an inhibitory effect on the growth of black root rot fungus.
[0073] The effects of volatile compounds produced by Pseudomonas bacteria were investigated as follows. Agar plates containing the Pseudomonas bacteria strains OFT-2, OFT-5, or RH7 were cultured, or sterile agar plates (mock), and agar plates inoculated with the black root rot fungus (Calonectria irishicola UH2-1 strain) (5 mm diameter) were prepared. The rRNA gene sequence of the RH7 strain is shown in SEQ ID NO: 3 and has 94.14% and 96.59% sequence identity with the rRNA gene sequences of the OFT-2 and OFT-5 strains, respectively. This sequence identity was calculated using Multiple Sequence Alignment (Clustal Omega: https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) and Percent Identity Matrix (Clustal2.1). A Pseudomonas or Mock plate and an agar medium plate inoculated with black root rot fungus were placed together with the medium surfaces facing inward, sealed, and cultured at 25°C for 7 days. The diameter of the mycelial colonies after 7 days of culture was measured with a ruler. The growth rate of black root rot fungus was calculated using OFT-2 or OFT-5 / Mock × 100, and the relative growth rate of black root rot fungus was expressed as a value relative to Mock.
[0074] Figure 6 shows a photograph of mycelial colonies of black root rot fungus on a plate after 7 days of culture. The top plate is a plate cultured with Pseudomonas bacteria or a mock, and the bottom plate is a plate inoculated with black root rot fungus. Figure 7 also shows a graph comparing the relative growth rates of black root rot fungus. This indicates that the growth of black root rot fungus is inhibited by the volatile compounds produced by OFT-2 and OFT-5 strains. On the other hand, the volatile compounds produced by RH7, a Pseudomonas bacterium, did not have any inhibitory effect on the growth of black root rot fungus.
Claims
1. A plant soil-borne disease control agent comprising, as an active ingredient, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence homology to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence homology to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
2. 2. The soil-borne disease control agent according to claim 1, comprising as an active ingredient: a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 98% or more sequence homology to the base sequence shown in SEQ ID NO: 1; a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 99% or more sequence homology to the base sequence shown in SEQ ID NO: 2; or a combination thereof.
3. The soil-borne disease control agent according to claim 1 or 2, wherein the pathogenic microorganisms of the soil-borne disease include fungi of the genus Calonectoria, fungi of the genus Phytophthora, or a combination thereof.
4. The soil-borne disease control agent according to any one of claims 1 to 3, wherein the soil-borne disease is damping-off disease.
5. The soil-borne disease control agent according to any one of claims 1 to 4, wherein the plant is a legume.
6. A method for controlling soil-borne diseases of plants, comprising the step of applying to soil or plants a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 96% or more sequence identity to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence that has 98% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
7. 7. The method according to claim 6, comprising the step of applying to soil or a plant a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 98% or more sequence identity to the base sequence shown in SEQ ID NO: 1, a Pseudomonas bacterium having a 16S rRNA gene consisting of a base sequence having 99% or more sequence identity to the base sequence shown in SEQ ID NO: 2, or a combination thereof.
8. 8. The method of claim 6 or 7, wherein the pathogenic microorganisms of soil-borne diseases include Calonectria fungi, Phytophthora fungi, or a combination thereof.
9. The method according to any one of claims 6 to 8, wherein the soil-borne disease is damping-off disease.
10. The method according to any one of claims 6 to 9, wherein the plant is a legume.
11. The method according to any one of claims 6 to 10, wherein the step of applying the Pseudomonas bacteria to soil or a plant comprises adding a liquid containing the bacteria to seeds.
Citation Information
Patent Citations
Composition and method for biologically preventing infection with calonectria crotalariae
JP2006151898A