Method and assay kit for detecting single nucleotide substitutions in short-chain RNAs exhibiting sequence diversity at the 3' end.

A method for detecting single nucleotide substitutions in short-chain RNAs with sequence diversity on the 3' side using an artificial sequence and genome editing enzyme activation allows for efficient and cost-effective detection, suitable for disease diagnosis.

JP2026054822APending Publication Date: 2026-03-30KK TOSHIBA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024160137
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-17
Publication Date
2026-03-30

AI Technical Summary

Technical Problem

Existing methods for detecting single nucleotide substitutions in short-chain RNAs with sequence diversity on the 3' side are time-consuming and costly, making them unsuitable for multi-specimen diagnosis.

Method used

A method involving the addition of an artificial sequence to the 5' end of a short RNA, followed by contact with a guide RNA, a genome editing enzyme, and a label that becomes detectable upon enzyme activation, utilizing a guide RNA with a single-stranded structure and intramolecular hairpin structure to measure signal intensity for substitution detection.

Benefits of technology

Enables rapid and cost-effective detection of single nucleotide substitutions in short-chain RNAs, preserving sequence diversity and facilitating applications in disease detection such as cancer discrimination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026054822000001_ABST
    Figure 2026054822000001_ABST
Patent Text Reader

Abstract

This technology provides a way to identify single nucleotide substitutions on microRNAs with sequence diversity at their 3' end in a short time and at low cost. [Solution] The method according to the embodiment is a method for detecting single nucleotide substitutions in a group of short RNAs having sequence diversity on the 3' end. The method includes: obtaining a target nucleic acid by adding an artificial sequence to the 5' end of a short RNA contained in the test nucleic acid; contacting the obtained target nucleic acid with a guide RNA having a sequence complementary to the target nucleic acid and single nucleotide polymorphism recognition sites and singularities at specific intervals, a genome editing enzyme corresponding to the guide RNA, and a label that becomes detectable upon activation of the genome editing enzyme; measuring the signal derived from the label; and determining the presence or absence of a single nucleotide substitution in the test nucleic acid from the intensity of the signal.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Embodiments of the present invention relate to a method for detecting a single nucleotide substitution in a group of short-chain RNAs having sequence diversity on the 3' side.

Background Art

[0002] Genome editing has enabled various genetic modifications to microorganisms, animals, and plants. In recent years, in addition to editing by DNA cleavage, techniques such as sequence-specific modification and labeling have been developed by introducing functional domains such as DNA modification proteins. General genome editing is a technique that uses a DNA cleavage enzyme to introduce a specific DNA double-strand break to a target gene and accurately modifies the gene by utilizing the repair process.

[0003] On the other hand, it has been reported that microRNAs may be used for the detection and discrimination of various cancers. For example, it has been proposed to use the sequence ratio of single nucleotide substitutions (i.e., single nucleotide polymorphisms) of microRNAs as an index. However, since general sequence analysis requires a lot of time and cost, it is difficult to apply it to multi-specimen diagnosis such as primary screening.

Summary of the Invention

Problems to be Solved by the Invention

[0004] The problem to be solved by the present invention is to provide a technique for detecting a single nucleotide substitution in a group of short-chain RNAs having sequence diversity on the 3' side in a short time and at low cost.

Means for Solving the Problems

[0005] The method according to the embodiment is a method for detecting single nucleotide substitutions in a group of short RNAs having sequence diversity on the 3' end. The method includes: obtaining a target nucleic acid by adding an artificial sequence to the 5' end of a short RNA contained in the test nucleic acid; contacting the obtained target nucleic acid with a guide RNA having a single nucleotide polymorphism recognition site and a singularity located at a specific interval from a sequence complementary to the target nucleic acid, a genome editing enzyme corresponding to the guide RNA, and a label that becomes detectable upon activation of the genome editing enzyme; measuring the signal derived from the label; and determining the presence or absence of a single nucleotide substitution in the test nucleic acid from the intensity of the signal. The guide RNA includes a single-stranded structure and an intramolecular hairpin structure on the 5' end of this single-stranded structure. The single-stranded structure includes a complementary sequence to the target sequence and has a single nucleotide substitution site at a distance of 0 to 2 bases from the 5' end of this complementary sequence. The interval between the single nucleotide polymorphism recognition site and the singularity is 17 to 30 bases long, and the base of the singularity is a base that is not complementary to the target sequence. [Brief explanation of the drawing]

[0006] [Figure 1] A scheme diagram showing the flow of a method according to the first embodiment. [Figure 2] A schematic diagram illustrating the concept of the first embodiment. [Figure 3] A schematic diagram illustrating the concept of the first embodiment. [Figure 4] A graph showing the experimental results. [Modes for carrying out the invention]

[0007] The embodiments will be described below with reference to the attached drawings. In each embodiment, substantially identical components will be denoted by the same reference numerals, and their descriptions may be partially omitted. The drawings are schematic, and the relationship between the thickness of each part and its planar dimensions, the ratio of the thicknesses of each part, etc., may differ from those in reality.

[0008] (First embodiment) The first embodiment is a method for detecting single nucleotide substitutions in a group of short RNAs that have sequence diversity at the 3' end. As shown in Figure 1, the method includes the following four steps; • Obtain the target nucleic acid by adding an artificial sequence to the 5' end of the short RNA contained in the test nucleic acid (S11). The obtained target nucleic acid is brought into contact with a guide RNA having a sequence complementary to the target nucleic acid and single nucleotide polymorphism recognition sites and singularities at specific intervals, a genome editing enzyme corresponding to the guide RNA, and a label that becomes detectable upon activation of the genome editing enzyme (S12). • Measuring the signal originating from the sign (S13), and • Determine the presence or absence of a single nucleotide substitution in the nucleic acid based on the signal intensity (S14).

[0009] The test nucleic acid may be a group of short RNAs having a single-nucleotide substitution site to be detected, or it may be a group of nucleic acids containing such short RNAs. For example, a solution containing such a test nucleic acid may be an aqueous solution containing nucleic acids derived from humans, other animals, or plants. Short RNAs may be relatively short RNAs with base lengths of, for example, longer than 10 nucleotides, up to 100 nucleotides, 15 to 50 nucleotides, 15 to 30 nucleotides, or 15 to 25 nucleotides. Such short RNAs may be, for example, microRNAs, piRNAs, and siRNAs. The solution containing the group of short RNAs that are the test nucleic acids may also be called the test solution.

[0010] Referring to Figure 2, the test nucleic acid 10, target nucleic acid 11, and guide RNA 21 will be described. The test nucleic acid 10 includes a sequence diversity region 32 on its 3' end, and on its 5' end, i.e., adjacent to the 5' end of the sequence diversity region 32, it includes a predetermined target sequence, i.e., the target sequence 22a (Figure 2(a)). The target nucleic acid 11 is a sequence to which an artificial sequence 33 has been added to the 5' end of the test nucleic acid 10 (Figure 2(b)). That is, the target nucleic acid 11 includes a sequence diversity region 32 on its 3' end, and on its 5' end, i.e., adjacent to the 5' end of the sequence diversity region 32, it includes the target sequence 22a, and on its 5' end, i.e., adjacent to the 5' end of the target sequence 22a, it includes the artificial sequence 33 (Figure 2(b)). The target sequence 22a has a single nucleotide substitution site 12a in its sequence (Figure 2(b)). In the target nucleic acid 11, the portion 3' to the target sequence 22a is the sequence diversity region 32. The sequence diversity region 32 is a region that can be any sequence. This may also be called a freely determined sequence or an arbitrarily selected sequence, or it may be understood to include any sequence that spontaneously exists in nature in relation to the target sequence 22. For convenience, this region will be referred to here as the "sequence diversity region." The position of the single-nucleotide substitution site 12a in the target sequence 22a may be at position -1, -2, or -3, adjacent to the 5' end of the sequence diversity region 32 on the 3' side, with the 5' end being position 0. In other words, with the 3' end of the target sequence 22a being position -1, it may be located at positions -1, -2, or -3 toward the 5' side (Figures 2(c) and (d)).

[0011] Artificial sequence 33 is located at the 5' end of target sequence 22a in target nucleic acid 11 (Figure 2(b)). Artificial sequence 33 is not initially present in the test solution to be analyzed, but is a sequence added to the 5' end of the test nucleic acid contained in the test solution. The sequence of artificial sequence 33 can be any so-called artificial sequence. Examples of such artificial sequences include sequences that do not exist in nature, sequences that do not exist in living organisms, or sequences that do not exist in the test nucleic acid or test solution. The addition of the artificial sequence may be, for example, by elongation of the 5' end of the test nucleic acid, or by ligation of a desired nucleic acid fragment. Specifically, it can be added by methods known in themselves, such as nucleic acid addition using enzymes such as ligase, or elongation reactions using enzymes such as polymerase. The length of artificial sequence 33 may be, for example, 8 to 40 base pairs, 8 to 20 base pairs, 8 to 15 base pairs, 10 to 14 base pairs, 20 to 40 base pairs, etc.

[0012] The target sequence 22a can be obtained, for example, from a sequence in a microRNA database or from the results of miRNA sequence analysis. The target sequence 22a may also be selected, for example, from a subset of naturally occurring miRNA sequences. The target sequence 22a may be pre-selected as desired.

[0013] Guide RNA 21 includes an intramolecular hairpin structure 23 and a single-stranded structure 24 (Figure 2(d)). The single-stranded structure 24 includes a complementary sequence 22c of the target sequence 22a of the target nucleic acid 11 and a complementary sequence 25 of the artificial sequence 33 or a part thereof. Here, the single-stranded structure 24 can be rephrased as including the target sequence recognition site 22c (Figure 2(d)). The target sequence recognition site 22c has a single-nucleotide substitution site 12b at the position corresponding to the single-nucleotide substitution site 12a of the target nucleic acid 11. The length from the 5' end of the target sequence recognition site 22c to the single-nucleotide substitution site can be 0 to 2 nucleotides (Figure 2(d)). Here, the target sequence recognition site 22c includes, for example, a complementary sequence of the target sequence 22a and a complementary sequence 25 of the artificial sequence 33 or a part thereof. Figure 2(d) shows an example in which the target sequence recognition site 22c includes the complementary sequence of the target sequence 22a and the complementary sequence 25 of a portion of the artificial sequence 33 (Figure 2(d)), but is not limited to this. The single-stranded structure 24 of the guide RNA 21 has a singularity 26b. The singularity 26b is a site represented by non-complementary bases that are not complementary to the base sequences of the target nucleic acid 11 and the artificial sequence 33. The singularity 26b may be located in a region corresponding to the artificial sequence 33 or a portion thereof. The location of the singularity 26b may be, for example, 17 to 30 base lengths away from the single-base substitution site 12b, for example, 17 to 25 base lengths, 17 to 20 base lengths, or 17 to 19 base lengths. Such a structure improves the ability to distinguish single nucleotide polymorphisms. Furthermore, the single-stranded structure 24 may also contain one or two additional bases that are non-complementary to the target sequence 22a or the artificial sequence 33 at sites other than the single-base substitution site 12b and the singularity 26b.

[0014] Figure 2 shows an example where the length of the target sequence recognition site 22c is equal to the length of the single-stranded structure 24, but it is not limited to this, and the single-stranded structure 24 may be longer. The intramolecular hairpin structure 23 is a genome editing enzyme recognition site (i.e., a direct repeat) that recognizes and binds to the corresponding genome editing enzyme. For example, the genome editing enzyme may be an enzyme with collateral activity, such as a Cas protein, such as CRISPR-Cas13.

[0015] The sequence of the target sequence recognition site 22c of guide RNA 21 is selected according to the sequence of the target nucleic acid to be detected. This allows it to recognize and specifically bind to a specific group of short RNAs from a solution containing short RNAs with sequence diversity on the 3' end as the test nucleic acid. This activates the genome editing enzyme. Here, the single-nucleotide substitution site 12b of the target sequence recognition site 22c is selected to contain the type of base to be detected. For example, a base corresponding to either the wild type or the mutant type, or both, may be selected. That is, even for single-nucleotide polymorphism sites, the genome editing enzyme is activated if the bases in guide RNA 21 and target nucleic acid 11 are complementary. With this configuration, the group of test nucleic acids to be detected is not selected based on 3' end diversity; instead, diversity is maintained while detecting the presence or absence of single-nucleotide substitutions and polymorphisms in the target nucleic acid group. In the case of microRNAs, regardless of the miRNA name, information regarding the presence of polymorphisms or mutations in sequences that share the target nucleic acid sequence can be useful for the detection or identification of diseases such as cancer.

[0016] Using Figure 3, we will explain one specific example of distinguishing between the target mutant A and the non-target wild-type C. For example, when determining the base sequence of a single-nucleotide substitution site in miR_1 included in the group of test nucleic acids, the sequence diversity portion 32 of the miR_1 standard is designed to include the standard sequence 32 (Figure 3(a), (b)). Here, for example, the single-nucleotide substitution site 12a is assumed to be either the targeted mutant A (Figure 3(a)) or the non-target wild-type C (Figure 3(b)). In other words, if we consider a microRNA having a standard sequence containing a single-nucleotide substitution as the miR_1 standard, then more specifically, there is a target nucleic acid 11a containing mutant A and a non-target nucleic acid 31a containing wild-type C.

[0017] For example, guide RNA 21 may be designed to have the complementary base U of the target mutant A at the single-nucleotide substitution site (Figures 3(c) and (d)). Alternatively, wild-type C may be targeted, in which case the base at the single-nucleotide substitution site will be the complementary base G of wild-type C. In the method according to the embodiment, first an artificial sequence 33 is added to the 5' side of the test nucleic acid (not shown). Then, when guide RNA 21 encounters the corresponding genome editing enzyme 35, they bind to each other to form a complex (also referred to as the "[guide RNA-genome editing enzyme] complex"). Then, when the target sequence recognition site 22c encounters the target sequence 11a (i.e., target nucleic acid 11) containing its complementary strand, a double helix is ​​formed there, and a complex 37 (also referred to as the "[guide RNA-genome editing enzyme-target nucleic acid] complex") is formed. As a result, genome editing enzyme 35 is activated, and genome editing enzyme activity (i.e., nucleic acid cleavage activity) 38 is expressed. As a result, the cleavage recognition site (not shown) of the target nucleic acid 11a is cleaved (Figure 3(c)). In contrast, if the base of the guide RNA 21 and the corresponding site of the test nucleic acid are not complementary at the single-nucleotide substitution site 12, enzyme 35 is not activated, and cleavage does not occur at the cleavage recognition site (not shown) (Figure 3(d)).

[0018] For example, the formation of a sequence-specific double helix on such a target sequence can activate a genome editing enzyme (e.g., a Cas protein) by binding to the target sequence as a discriminant molecule capable of distinguishing single-base differences, for instance, if guide RNA21 is a crRNA. This can then cleave the target sequence.

[0019] On the other hand, the reaction system may contain a label that can be detected by activation of the genome editing enzyme. An example of such a label is the detection nucleic acid 41a shown below. The detection nucleic acid 41a includes a signal substance 42, a masking substance 45, and an oligonucleotide portion (Fig. 3(c)). The oligonucleotide portion has a cleavage recognition site for the genome editing enzyme. The length of the oligonucleotide portion can be, for example, 50 bases or less. The detection nucleic acid 41a is cleaved at the cleavage recognition site of the genome editing enzyme by the nucleic acid cleavage activity 38 of the genome editing enzyme 35 activated by double-strand formation. As a result, the signal from the signal substance 42 inhibited by the masking substance 45 becomes detectable (Fig. 3(c)). For example, the signal substance 42 may be a fluorescent substance, a chemiluminescent substance, a chromogenic substance, or the like. The signals they possess become detectable when the detection nucleic acid 41a is cleaved by the action of the cleavage activity 38 due to the activation of the genome editing enzyme 35. From such a configuration and function, it can be said that the signal substance 42 is a substance that specifically transmits specific information.

[0020] The signal 43 from the signal substance 42 is detected by an appropriate detection mechanism and detection device according to its type. For example, the method may be performed in a real-time PCR system or a microplate reader equipped with such a detection mechanism. The contacting (S12) can be carried out by reacting under the conditions of twenty-five degrees Celsius to fifty-five degrees Celsius for one minute to one hundred and twenty minutes. The reaction temperature is preferably thirty-seven degrees Celsius. The detection of the signal 43 may be performed over time in parallel with the reaction caused by the contacting according to the type of the signal substance, or may be measured once, one to two times, or two or more times, for example, one to one hundred and twenty times, at different time points when the reaction has proceeded for a certain period of time.

[0021] In this method, determining the presence or absence of a single nucleotide substitution in the test nucleic acid may further include determining the presence or absence of a single nucleotide substitution in the test nucleic acid based on the difference between the signal of the standard nucleic acid and the signal of the nucleic acid derived from the test substance. The signal of the standard nucleic acid may be measured in advance, or may be measured before, after, or parallel to the measurement of the signal from the test substance, i.e., the test nucleic acid. The presence or absence of a single nucleotide substitution may be determined from the presence or absence of a detection signal, e.g., the presence or absence of fluorescence intensity, or the difference in the magnitude of the detection signal, e.g., the magnitude of fluorescence intensity. For example, even when no standard nucleic acid is used, it is similarly possible to determine based on the presence or absence of a detection signal or the relative magnitude of the detection signal. The standard nucleic acid can be designed based on the target sequence, for example, the sequence of microRNA on a database containing the target sequence or the sequence obtained from sequence analysis such as next-generation sequencing. Also, if desired, a plurality of types of guide RNAs 21 with different types of bases assigned to the single nucleotide substitution site may be used in combination. In that case, the determination may be made comprehensively after the determination is made for each type of guide RNA 21, or the labeling may be designed so that the signals to be detected can be discriminated for each type of RNA 21.

[0022] In the case of conventional sequence analysis, a lot of time and cost are required to detect a single nucleotide substitution, and it is difficult to apply it to multi-specimen diagnosis. However, according to the method according to the embodiment, it is possible to perform detection in a short time and at low cost. Also, the test nucleic acid group to be detected can detect the presence or absence of a single nucleotide substitution and the polymorphic state of the target nucleic acid group while ensuring diversity without being separated by the diversity on the 3' side. Considering the sequence diversity on the 3' side of the single nucleotide substitution site of the target nucleic acid, for example, by using microRNA or the like as the test substance, it is possible to utilize it for the detection or discrimination of diseases such as cancer while also including information regarding the diversity on the 3' side of the target nucleic acid. For example, it can be applied to the discrimination method described in Japanese Patent Application No. 2023-150929.

[0023] (Second Embodiment) A second embodiment is an assay kit for detecting single nucleotide substitutions in a group of short RNAs having sequence diversity at the 3' end. The kit may be used to perform the method according to the first embodiment described above. The kit comprises a guide RNA, a genome editing enzyme corresponding to the guide RNA, and a label that becomes detectable upon activation of the genome editing enzyme. The guide RNA contains a complementary sequence to the target nucleic acid. The guide RNA comprises a single nucleotide substitution site contained at a specific position in this complementary sequence, and a singularity located at a specific interval from this single nucleotide substitution site. For example, the configuration of the guide RNA, genome editing enzyme, and label included in the kit may be as described above.

[0024] As shown in Figures 2 and 3, the guide RNA 21 contains an intramolecular hairpin structure 23 on its 5' end and a single-stranded structure 24 on its 3' end. The single-stranded structure 24 contains a complementary sequence 22c of the target sequence on its 5' end, and the distance from the 5' end of the complementary sequence 22c to the single-nucleotide substitution site is 0 to 2 nucleotides. The guide RNA also contains a sequence 25 complementary to the artificial sequence 33 or a portion thereof. Sequence 25 is designed to include a singularity 26b. The location of the singularity 26b can be, for example, 17 to 30 nucleotides away from the single-nucleotide substitution site 12b, for example, 17 to 25 nucleotides, 17 to 20 nucleotides, or 17 to 19 nucleotides. This structure improves the ability to distinguish single nucleotide polymorphisms. Furthermore, the single-stranded structure 24 may also contain one or two additional bases that are non-complementary to the target sequence 22a or the artificial sequence 33 at sites other than the single-base substitution site 12b and the singularity 26b.

[0025] The genome editing enzyme may be an enzyme with collateral activity, such as a Cas protein, for example, CRISPR-Cas13. The label that becomes detectable by activation of such a genome editing enzyme may be, for example, the detection nucleic acid 41a described below.

[0026] As shown in Figure 3, the detected nucleic acid 41a comprises a signaling substance 42, a masking substance 45, and an oligonucleotide moiety. The oligonucleotide moiety contains a cleavage recognition site for the genome editing enzyme. The length of the oligonucleotide moiety may be, for example, 50 nucleotides or less. The detected nucleic acid 41a is cleaved at the cleavage recognition site of the genome editing enzyme 35 by the nucleic acid cleavage activity 38 of the genome editing enzyme 35, which is activated by double-strand formation. As a result, the signal from the signaling substance 42, which was inhibited by the masking substance 45, becomes detectable. For example, the signaling substance 42 may be a fluorescent substance, a chemiluminescent substance, a color-developing substance, etc. For example, examples of a fluorescent substance and a quencher as the masking substance 45 are as follows: Fluorescent materials: FAM, HEX, VIC, ROX, Cy5, Texas Red, JOE Masking substances: Iowa Black, BHQ, TAMRA, ZEN: For example, a combination of at least one fluorescent substance and a masking substance selected from such a group may be used. For example, combinations of fluorescent substances and quenchers include, but are not limited to, FAM and Iowa Black® FQ, FAM and BHQ-1, ROX and Iowa Black® RQ, ROX and BHQ-2, Cyanine 5 and Iowa Black® RQ, and Cyanine 5 and BHQ-2.

[0027] Assay kits may be provided with each component dried by freeze-drying or other means and housed in a container. Alternatively, each component may be maintained in an appropriate solution, housed in an appropriate container, and then provided together as an assay kit. Providing assay kits makes it possible to detect single nucleotide substitutions quickly and at low cost. Furthermore, the group of test nucleic acids to be detected can be detected for the presence or absence of single nucleotide substitutions and the polymorphism status of the target nucleic acid group while maintaining diversity, without being separated by the diversity of the 3' side. The importance of considering the sequence diversity of the 3' side of the single nucleotide substitution site of the target nucleic acid is evident from the fact that, for example, by using microRNA as the test substance, it becomes possible to use it for the detection or identification of diseases and cancers while retaining information about the diversity of the 3' side of the target nucleic acid.

[0028] (Third embodiment) As a third embodiment, Table 1 shows examples of target sequences usable in the first and second embodiments described above, and Table 2 shows examples of artificial sequences. These sequences are examples of sequences that are effective for identifying single nucleotide polymorphisms in microRNAs.

[0029] [Table 1]

[0030] [Table 2]

[0031] By using these sequences, the target nucleic acid group can be detected without being separated by 3' side diversity, thus ensuring diversity while detecting the presence or absence of single nucleotide substitutions and the state of polymorphism in the target nucleic acid group. The importance of considering the 3' side sequence diversity of the single nucleotide substitution site of the target nucleic acid is evident from the fact that, for example, by using microRNA as the test substance, it becomes possible to use it for the detection or identification of diseases and cancers while still incorporating information about the 3' side diversity of the target nucleic acid.

[0032] [example] The following describes an example of a method performed according to the embodiment.

[0033] Experiment 1. Detection of single nucleotide substitutions in microRNAs with sequence diversity at the 3' end. Two types of microRNAs were prepared as shown in Figure 3. The microRNA used was miR_1. Specifically, it was the miR_1-standard (Figure 3(a)), which contains the standard sequence 32AUGGUUUGUG (SEQ ID NO: 5) as the sequence diversity region. For the single nucleotide substitution site 12a, both the targeted mutant A and the non-target wild-type C were prepared. That is, the microRNA with the standard sequence containing the single nucleotide substitution was the miR_1-standard, and more specifically, it was the target nucleic acid 11a (SEQ ID NO: 1) containing mutant A and the non-target nucleic acid 31a (SEQ ID NO: 2) containing wild-type C. These nucleic acids were synthesized, and the resulting nucleic acids were maintained in buffer solutions. The target nucleic acid 11a (SEQ ID NO: 1) and the non-target nucleic acid 31a (SEQ ID NO: 2) each contain an artificial sequence (SEQ ID NO: 6) at their 5' ends. These sequences are shown in Table 3.

[0034] Hereafter, the guide RNA used for mutant detection will be referred to as "gRNA". The design features of the miR-1 standard are as follows: Each gRNA in the miR-1 standard has 0 complementary bases in the sequence downstream of the mutation, and 10 bases in the diversity-tolerant sequence at the 3' end. The insertion site of the mutation recognition site is the miRNA sequence site, i.e., the 1st position from the 5' end of the complementary sequence of the target sequence. Furthermore, the following mismatches included in the complementary sequence of the target sequence were inserted as singularities. The insertion sites are the 13th (-13th), 14th (-14th), 15th (-15th), 16th (-16th), 17th (-17th), 18th (-18th), 19th (-19th), and 20th (-20th) positions from the 5' end of the complementary sequence of the target sequence. The sequences of each gRNA are shown in Table 3.

[0035] A reporter nucleic acid was used as the detection nucleic acid. The reporter nucleic acid used was poly-U reporter nucleic acid (sequence number c), and the fluorescent substance FAM and quencher Iowa Black® FQ were used, which are summarized in Table 6. Specifically, the fluorescent substance FAM was bound to the 5' end of the oligonucleotide shown in sequence number c, and Iowa Black® FQ was bound to the 3' end as a quencher to obtain the detection nucleic acid. The complementary base pair was AU.

[0036] [Table 3]

[0037] The genome editing enzyme used was the Cas protein CRISPR-Cas13 (Genscript, product number Z03472). The recognition sequence, cleavage sequence, and guide RNA structure corresponding to the genome editing enzyme were selected as needed.

[0038] Target nucleic acid 11a containing mutant A (SEQ ID NO: 1, labeled "Target (Mutant A)" in Figure 3(a)) and non-target nucleic acid 31a containing wild-type C (SEQ ID NO: 2, labeled "Non-target (Wild-type C)" in Figure 3) are each measured in 1 × 10⁻¹⁶ units. 8The molecules were suspended in buffer at a concentration of copies / μL. 2 μL of this was dispensed into microplates. 18 μL of a reaction solution containing 10 nM gRNA21 (any of sequence numbers 7-14) and 10 nM CRISPR-Cas13 (also in the final reaction solution) was added to each microplate, and the mixture was incubated at 37°C for 60 minutes. For gRNA21, all gRNAs represented by sequence numbers 7-14 were used for each type of gRNA in the study. Fluorescence intensity was measured using a plate reader at an excitation wavelength of 470 nm and an fluorescence wavelength of 520 nm. Relative fluorescence intensity was calculated by the difference between the detection signal obtained from the target nucleic acid and the background detection signal using a real-time PCR system. The results are shown in Figure 4.

[0039] The results in Figure 4 show that guide RNAs with singularities at positions -18 and beyond, for example, -18, -19, and -20, i.e., those with non-complementary bases, were able to significantly distinguish single nucleotide polymorphism sequences based on differences in fluorescence intensity. A tendency to distinguish between target and non-target sequences was also observed when the singularity was located at position -17. As the distance decreased to positions -16 and -15, it became more difficult to distinguish between target and non-target sequences. Here, when the singularity is at positions -18, -19, and -20, the distance from the single nucleotide substitution site is 17 nucleotides, 18 nucleotides, and 19 nucleotides, respectively. Furthermore, although specific results are not shown here, we felt confident that there is a high probability of achieving the desired discrimination for sequences between 20 and 30 nucleotides, and especially between 20 and 25 nucleotides.

[0040] From the above results, it became clear that, according to the embodiment, it is possible to detect the presence or absence of single nucleotide substitutions and the polymorphic state of target nucleic acids while ensuring diversity, without being separated by diversity on the 3' side. Furthermore, it became clear that a specific distance between the single nucleotide polymorphism identification site and the singularity enables more efficient identification.

[0041] The sequence described here is shown below: Sequence ID 1; 5' GUUCAGAGUUCUACAGUC CGACGAUCUAGCAGCACAUAAUGG UUUGUG 3' Sequence ID 2; 5' GUUCAGAGUUCUACAGUC CGACGAUCUAGCAGCACAUCAUGG UUUGUG 3' Sequence ID 3; 5' UAGCAGCACAUA 3' Sequence ID 4; 5' UAGCAGCACAUC 3' Sequence ID 5; 5' AUGGUUUGUG 3' Sequence ID c; 5' UUUUU 3' Sequence ID 6; 5' GUUCAGAGUUCUACAGUCCGACGAUC Sequence ID 7; 3' GCUGCUACAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG5' →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUACAUCGUCG 3') Sequence ID 8; 3' GCUGCUUGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG5' →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGUUCGUCG3') Sequence ID 9; 3' GCUGCAAGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGAACGUCG 3') Sequence ID 10; 3' GCUGGUAGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGAUGGUCG 3') Sequence ID 11; 3' GCUCCUAGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGAUCCUCG 3') Sequence ID 12; 3' GCAGCUAGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGAUCGACG 3') Sequence ID 13; 3' GGUGCUAGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGAUCGUGG 3') Sequence ID 14; 3' CCUGCUAGAUCGUCGUGUAUCAAAAUCAGGGGAAGUAAAAACCCCACCAG →(5' GACCACCCCAAAAAUGAAGGGGACUAAAAC UAUGUGCUGCUAGAUCGUCC 3').

[0042] Further examples of embodiments are described below. [1] A method for detecting single nucleotide substitutions in a group of short RNAs having sequence diversity on the 3' side, • Obtaining target nucleic acids by adding an artificial sequence to the 5' end of short RNA contained in the test nucleic acid. - Contacting the obtained target nucleic acid with a guide RNA having a sequence complementary to the target nucleic acid and single nucleotide polymorphism recognition sites and singularities at specific intervals, a genome editing enzyme corresponding to the guide RNA, and a label that becomes detectable upon activation of the genome editing enzyme. • Measuring signals originating from signs, and • Determine the presence or absence of a single nucleotide substitution in the test nucleic acid based on the signal intensity. Includes, The guide RNA comprises a single-stranded structure and an intramolecular hairpin structure on the 5' side of the single-stranded structure, the single-stranded structure comprises a complementary sequence of a predetermined target sequence, and has a single-base substitution site at a distance of 0 to 2 bases from the 5' end of the complementary sequence, the specific interval being 17 to 30 bases long, and the base of the singularity being different from the complementary base of the target sequence. [2] The method according to [1], wherein the specific interval is 17 to 19 base pairs long. [3] The method according to [1], wherein the self-intramolecular hairpin structure is a genome editing enzyme recognition site. [4] The method according to [1], wherein the short RNA is a microRNA. [5] The method according to [1], wherein the genome editing enzyme has collateral activity. [6] The method according to [1], wherein the genome editing enzyme is the Cas13a protein. [7] The method according to [1], wherein the genome editing enzyme is the LbuCas13a protein. [8] The method according to [1], wherein the label comprises a signaling substance that emits a detection signal and a masking substance that inhibits the detection signal, and an oligonucleotide to which the signaling substance and the masking substance are attached. [9] The method according to [8], wherein the length of the oligonucleotide is 50 bases or less.

[10] The method according to [8], wherein the signaling substance is a fluorescent substance and the masking substance is a quencher.

[11] The method according to [1], wherein the target sequence is either sequence shown in sequence number 3 or 4.

[12] The artificial sequence is the sequence shown in sequence number 6 or the method of [1] comprising the sequence.

[13] The method according to [1], wherein the measurement of the signal is performed by means selected from the group consisting of a real-time PCR system, a microplate reader, a digital PCR system, a fluorescence microscope, and a fluorescence detector.

[14] The method according to [1], wherein the presence or absence of the single nucleotide substitution in the test nucleic acid is determined by the presence or absence of a difference between the detection signal obtained by performing the same procedure on a standard nucleic acid and the signal obtained from the test nucleic acid.

[15] An assay kit for use in the method described in [1], comprising: a guide RNA containing a complementary sequence to a target sequence having the artificial sequence and the single nucleotide substitution site attached to its 5' end; a genome editing enzyme corresponding to the guide RNA; and a label that becomes detectable upon activation of the genome editing enzyme, The assay kit wherein the guide RNA comprises a single-stranded structure and an intramolecular hairpin structure on the 5' side of the single-stranded structure, the single-stranded structure comprises a complementary sequence of the target sequence, has a single-base substitution site at a distance of 0 to 2 bases from the 5' end of the complementary sequence, and has a singularity between the 17th and 30th bases from the single-base substitution site, the base of the singularity being different from the complementary base of the target sequence.

[16] The assay kit according to

[15] , wherein the short RNA is a microRNA.

[17] The assay kit described in

[15] wherein the genome editing enzyme is the Cas13a protein.

[18] The assay kit described in

[15] wherein the genome editing enzyme is the LbuCas13a protein.

[19] The assay kit according to

[15] , wherein the target sequence is the sequence shown in sequence number 3 or 4.

[20] The assay kit according to

[15] , wherein the artificial sequence is the sequence shown in Sequence ID No. 6 or the sequence said sequence.

[0043] While several embodiments of the present invention have been described, these embodiments are presented as examples only and are not intended to limit the scope of the invention. These novel embodiments can be carried out in a variety of other forms, and various omissions, substitutions, and modifications can be made without departing from the spirit of the invention. These embodiments and their variations are included in the scope and spirit of the invention, as well as in the claims of the invention and its equivalents. [Explanation of Symbols]

[0044] 10…Test nucleic acid, 11…Target nucleic acid, 11a,11b…Target nucleic acid (mutant), 12,12a,12c…Single nucleotide substitution site, 21…Guide RNA, 22a,22d…Target sequence, 22c…Target sequence recognition site, 23…Intramolecular hairpin structure (genome editing enzyme recognition site (direct repeat)), 24…Single-strand structure, 25…Complementary sequence of artificial sequence (or part thereof), 26a,26b…Singularity, 31a,31b…Non-target nucleic acid (wild type), 32,32a,32b…Sequence diversity region, 33…Artificial sequence, 35…Genome editing enzyme, 37…[Guide RNA-genome editing enzyme] complex, 38…Genome editing enzyme activity (nucleic acid cleavage activity), 41a,41b…Label (detected nucleic acid), 42…Signal substance, 43…Detection signal, 45…Masking substance

Claims

1. A method for detecting single nucleotide substitutions in a group of short RNAs that have sequence diversity on the 3' side, - Obtaining target nucleic acids by adding an artificial sequence to the 5' end of short RNA contained in the test nucleic acid. - Contacting the obtained target nucleic acid with a guide RNA having a sequence complementary to the target nucleic acid and single nucleotide polymorphism recognition sites and singularities at specific intervals, a genome editing enzyme corresponding to the guide RNA, and a label that becomes detectable upon activation of the genome editing enzyme. - Measuring signals originating from signs, and, - Determine the presence or absence of a single nucleotide substitution in the test nucleic acid based on the signal intensity. Includes, The guide RNA comprises a single-stranded structure and an intramolecular hairpin structure on the 5' side of the single-stranded structure, the single-stranded structure comprises a complementary sequence of a predetermined target sequence, and has a single-base substitution site at a distance of 0 to 2 bases from the 5' end of the complementary sequence, the specific interval being 17 to 30 bases long, and the base of the singularity being different from the complementary base of the target sequence.

2. The method according to claim 1, wherein the specific interval is 17 to 19 base pairs long.

3. The method according to claim 1, wherein the self-intramolecular hairpin structure is part of the genome editing enzyme recognition site.

4. The method according to claim 1, wherein the short-chain RNA is a microRNA.

5. The method according to claim 1, wherein the genome editing enzyme has collateral activity.

6. The method according to claim 1, wherein the genome editing enzyme is the Cas13a protein.

7. The method according to claim 1, wherein the genome editing enzyme is the LbuCas13a protein.

8. The method according to claim 1, wherein the label comprises a signaling substance that emits a detection signal and a masking substance that inhibits the detection signal, and an oligonucleotide to which the signaling substance and the masking substance are attached.

9. The method according to claim 8, wherein the length of the oligonucleotide is 50 bases or less.

10. The method according to claim 8, wherein the signaling substance is a fluorescent substance and the masking substance is a quencher.

11. The method according to claim 1, wherein the target sequence is the sequence shown in sequence number 3 or 4.

12. The method according to claim 1, which includes the artificial sequence indicated by sequence number 6 or the sequence said.

13. The method according to claim 1, wherein the measurement of the signal is performed by means selected from the group consisting of a real-time PCR system, a microplate reader, a digital PCR system, a fluorescence microscope, and a fluorescence detector.

14. The method according to claim 1, wherein the presence or absence of the single nucleotide substitution is determined by determining the presence or absence of a single nucleotide substitution in the test nucleic acid based on the presence or absence of a difference in detection signals obtained from the target nucleic acid and the non-target nucleic acid.

15. An assay kit for use in the method of claim 1, comprising: a guide RNA containing a complementary sequence to a target sequence having the artificial sequence and the single-nucleotide substitution site attached to its 5' end; a genome editing enzyme corresponding to the guide RNA; and a label that becomes detectable upon activation of the genome editing enzyme, The assay kit wherein the guide RNA comprises a single-stranded structure and an intramolecular hairpin structure on the 5' side of the single-stranded structure, the single-stranded structure comprises a complementary sequence of the target sequence, has a single-base substitution site at a distance of 0 to 2 bases from the 5' end of the complementary sequence, and has a singularity between the 17th and 30th bases from the single-base substitution site, the base of the singularity being different from the complementary base of the target sequence.

16. The assay kit according to claim 15, wherein the short-chain RNA is a microRNA.

17. The assay kit according to claim 15, wherein the genome editing enzyme is the Cas13a protein.

18. The assay kit according to claim 15, wherein the genome editing enzyme is the LbuCas13a protein.

19. The assay kit according to claim 15, wherein the target sequence is the sequence shown in sequence number 3 or 4.

20. The assay kit according to claim 15, wherein the artificial sequence is the sequence shown in Sequence ID No. 6 or comprises the sequence.