Composition containing Lactobacillus lactiplantiformis

A heat-killed Lactiplantibacillus bacteria composition effectively promotes IL-10 production and improves liver function, cholesterol levels, and skin barrier integrity, addressing the limitations of existing compositions.

JP2026055457APending Publication Date: 2026-03-31SANWA SHURUI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024161083
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-18
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing compositions fail to effectively promote IL-10 production in intestinal epithelial cells, suppress blood IL-10 concentration fluctuations, improve impaired liver function and cholestasis, reduce cholesterol levels, and maintain skin barrier function, while being stable and easy to consume.

Method used

A composition containing heat-killed Lactiplantibacillus bacteria, particularly Lactiplantibacillus plantarum N1487-7, which promotes IL-10 production and provides anti-inflammatory benefits by directly interacting with intestinal cells and tissues.

Benefits of technology

The composition enhances IL-10 production, stabilizes blood IL-10 levels, improves liver function, reduces cholesterol, and maintains skin barrier integrity, offering a stable and efficient health-promoting supplement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026055457000001_ABST
    Figure 2026055457000001_ABST
Patent Text Reader

Abstract

To provide a composition that can promote the production of IL-10 in intestinal epithelial cells. [Solution] A composition containing dead lactic acid bacteria belonging to the genus Lactiplantibacillus, which has an effect of promoting IL-10 production in intestinal epithelial cells, promotes the production of IL-10, an anti-inflammatory immune-related cytokine, in intestinal epithelial cells, thereby increasing or suppressing the decrease in blood IL-10 concentration, preventing or improving liver function decline, preventing or improving cholestasis, reducing total blood cholesterol or LDL cholesterol, promoting the polarization of macrophages from M1 to M2, or suppressing the decline in skin barrier function.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a composition having useful biological activity containing lactic acid bacteria of the genus Lactiplantibacillus.

Background Art

[0002] Lactic acid bacteria are food materials that have been used for a long time with high safety and reliability. Live bacteria have been ingested in the form of lactic acid bacteria beverages and yogurt as probiotics. Humans absorb nutrients from food and excrete unnecessary substances. Carbohydrates include digestible carbohydrates that can be digested by digestive enzymes possessed by humans, and indigestible carbohydrates such as oligosaccharides and dietary fibers that cannot be easily digested and absorbed as they are. Short-chain fatty acids are produced by the decomposition of these indigestible carbohydrates (referred to as prebiotics) by probiotics. Representative short-chain fatty acids are acetic acid, butyric acid, propionic acid, etc. Short-chain fatty acids have been reported to have effects such as obesity prevention, inflammation suppression, and regulation of immune functions such as allergies. The health functionality exhibited by probiotics is attributed to the fermentation products of lactic acid bacteria.

[0003] On the other hand, dead lactic acid bacteria are called postbiotics and have been ingested in the form of supplements. Postbiotics, unlike probiotics, are defined as "substances that act directly on the body without passing through the intestinal flora and work to normalize the balance of the intestinal flora." Dead bacteria are lactic acid bacteria cells that have been sterilized by heating or the like. Since lactic acid bacteria are made of organic matter, they die by the denaturation and loss of function (inactivation) of the enzymes and proteins possessed by lactic acid bacteria. The health functionality exhibited by postbiotics is substances in which all cell components of lactic acid bacteria, such as enzymes and proteins, have been thermally denatured, and is different in functional components and action mechanisms from probiotics (live bacteria) in which fermentation products function.

[0004] Furthermore, because dead lactic acid bacteria are resistant to heat and digestive fluids, they can be stored at room temperature and for long periods, making them easy to apply to food and beverages and transport, thus offering advantages over probiotics. In addition, unlike probiotics, they are not affected by stomach acid or intestinal fluids, so they have the advantage of reaching the intestines stably. Due to the remarkable progress in elucidating their functionality in recent years, many types of lactic acid bacteria are being developed and researched as functional food ingredients for health promotion and well-being.

[0005] For example, regarding lactic acid bacteria of the genus Lactiplantibacillus alone, compositions for suppressing gastrointestinal disorders containing acid-heat-treated lactic acid bacteria (Patent Document 1), compositions for improving human glucose metabolism or for anti-inflammatory purposes (Patent Document 2), and regulatory T cell differentiation inducers (Patent Document 3) have been reported. Furthermore, it has been reported that live and dead strains of Lactobacillus (now Lactiplantibacillus) plantarum species, as well as their metabolites, increase the production of the anti-inflammatory cytokine IL-10 in immune cells such as bone marrow-derived dendritic cells and / or macrophages (Patent Document 4, Non-Patent Document 1). [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] Japanese Patent Publication No. 2024-42259 [Patent Document 2] Japanese Patent Publication No. 2023-175938 [Patent Document 3] Japanese Patent Publication No. 2019-80497 [Patent Document 4] Re-tabled publication No. 2012-14971 [Non-patent literature]

[0007] [Non-Patent Document 1] Journal of Applied Microbiology (2009) Vol.107, p.1588-1597 [Overview of the project] [Problems that the invention aims to solve]

[0008] The problem that this invention aims to solve is to provide a composition that has biological activity useful for maintaining health and well-being, based on the novel functions and activities of lactic acid bacteria of the genus Lactiplantibacillus. In other words, the problem that the present invention aims to solve is to provide a composition for promoting the production of IL-10, an anti-inflammatory cytokine, in intestinal epithelial cells, and to provide an oral composition, specifically a supplement, food or beverage, feed, or pharmaceutical product, for the purpose of suppressing an increase or decrease in blood IL-10 concentration, preventing or improving impaired liver function, preventing or improving cholestasis, reducing total blood cholesterol or LDL cholesterol, promoting the polarization of macrophages from M1 to M2, or suppressing impaired skin barrier function. [Means for solving the problem]

[0009] The present inventors conducted intensive research to solve the above problems and discovered that dead lactic acid bacteria of the genus Lactiplantibacillus have an effect of promoting IL-10 production in intestinal epithelial cells. Based on this discovery, the present invention relating to compositions for use as supplements, foods and beverages, pharmaceuticals, etc., was completed.

[0010] The present invention relates to compositions for promoting IL-10 production in intestinal epithelial cells, as described in [1] to [6] below. [1] A composition for promoting IL-10 production in intestinal epithelial cells, containing dead lactic acid bacteria belonging to the genus Lactiplantibacillus as an active ingredient. [2] The composition according to [1] above, wherein the promotion of IL-10 production in the intestinal epithelial cells is (1) to (5) below. (1) Suppression of the increase or decrease in blood IL-10 concentration, and / or (2) Prevention or improvement of impaired liver function, and prevention or improvement of cholestasis, and / or (3) Reduction of total blood cholesterol or LDL cholesterol, and / or (4) Promotion of macrophage polarization from M1 to M2, and / or (5) Suppression of the decline in skin barrier function [3] The composition according to claim 2, wherein the reduction of serum γ-GTP and serum ALP prevents or improves the decline in liver function and the prevention or improvement of cholestasis described in (2) above. [4] The composition according to [1] above, wherein the lactic acid bacterium is Lactiplantibacillus plantarum. [5] The composition according to [4] above, wherein the lactic acid bacterium is Lactiplantibacillus plantarum N1487-7 strain (NITE P-04128). [6] A composition according to any one of [1] to [5] above, which is a preparation, food or beverage, or pharmaceutical. [Effects of the Invention]

[0011] According to the present invention's composition for promoting IL-10 production in intestinal epithelial cells, the production of IL-10, an anti-inflammatory immune-related cytokine, is promoted in intestinal epithelial cells, which can lead to an increase or decrease in blood IL-10 concentration, prevention or improvement of impaired liver function, prevention or improvement of cholestasis, reduction of total blood cholesterol or LDL cholesterol, promotion of macrophage polarization from M1 to M2, or suppression of impaired skin barrier function. Furthermore, we can provide safe and easy-to-consume supplements, foods, pharmaceuticals, and animal feed that have an IL-10 production-promoting effect.

[0012] Probiotics (live bacteria) cannot produce functional components without pre-ingesting or co-ingesting indigestible carbohydrates such as oligosaccharides and dietary fibers, and they cannot exert their functions unless they reach the intestine alive. On the other hand, the composition of the present invention is composed of heat-killed bacterial cells, and the heat-denatured enzymes, proteins, and other bacterial cell components themselves function as active ingredients to exhibit functionality. Therefore, regardless of the ingestion of other foods (prebiotics) such as indigestible carbohydrates, a very high effect can be obtained by ingesting only the composition of the present invention compared to probiotics. In addition, probiotics need time to ferment in the intestinal tract and produce functional components, but the composition of the present invention exhibits its effects from the time it reaches the intestinal tract, so the effects can be obtained earlier than those of probiotics.

[0013] Furthermore, since the composition of the present invention is a heat-denatured product, it is not affected by gastric acid or intestinal fluid like probiotics, so it has the merit of being able to reach the intestine stably. Since it has already been heat-denatured, it is resistant to heat and digestive juices, and can be stored at room temperature or for a long time. In addition, dead bacteria are easy to apply to foods and beverages and are also easy to transport. Therefore, they are easier to handle than probiotics and have the advantage of being able to be distributed in various forms.

Brief Description of the Drawings

[0014] [Figure 1] Graph showing the expression level of IL-10 mRNA by real-time PCR after adding heat-killed Lactiplantibacillus bacteria to Caco-2 cells. [Figure 2] Graph showing the expression level of IL-10 protein by Western blotting after adding heat-killed Lactiplantibacillus bacteria to Caco-2 cells. [Figure 3] Graph showing the expression level of IL-10 mRNA by real-time PCR after adding heat-killed Lactiplantibacillus bacteria to human macrophage 28SC-ES cells. [Figure 4]This graph shows the expression level of IL-10 protein in human macrophage 28SC-ES cells after adding dead Lactobacillus lactiplanticus bacteria, as measured by Western blotting. [Figure 5] This graph shows the time course of measured dorsal transcutaneous water loss (TEWL) from week 0 to week 5 in hairless mice that were stressed by forced oral administration, excluding the normal group, in the normal group, the dead bacteria control group, and the dead bacteria administration group. [Figure 6] This graph shows the time course of measured dorsal transepidermal water loss (TEWL) from week 0 to week 5 in hairless mice subjected to stress by forced oral administration of bacteria, in both the live bacteria control group and the live bacteria administration group. [Figure 7] This graph shows the blood IL-10 concentrations after 5 weeks in hairless mice that were stressed by forced oral administration (excluding the normal group), in the normal group, the dead bacteria control group, and the dead bacteria administration group. [Figure 8] This graph shows the blood IL-10 concentrations after 5 weeks in hairless mice subjected to stress by forced oral administration, in both the live bacterial control group and the live bacterial administration group. [Figure 9] This graph shows the blood IL-10 concentration before and 8 weeks after ingestion in humans who ingested one capsule / day (low-dose group) and two capsules / day (high-dose group) of dead Lactobacillus lactiplanticus bacteria. [Figure 10] This graph shows the blood γ-GTP levels before and 8 weeks after ingestion in humans who ingested one capsule / day (low-dose group) and two capsules / day (high-dose group) of dead Lactobacillus lactiplanticus bacteria samples. [Figure 11] This graph shows the expression levels of TNFR2 mRNA measured by real-time PCR after adding various dead lactic acid bacteria to Caco-2 cells. [Figure 12] This graph shows the expression levels of TNFR2 mRNA measured by real-time PCR after adding different concentrations of dead Lactiplantibacillus bacteria to Caco-2 cells. [Modes for carrying out the invention]

[0015] The present invention relates to a composition that has the effect of promoting IL-10 production in intestinal epithelial cells. The intestinal epithelium is a single layer of cells that lines the lumen of the digestive tract, serving as a physical boundary between the inside and outside of the body. Its total surface area is larger than that of the skin, and because it is in contact with the outside world over the largest area, it interacts broadly with the external environment and possesses the function of responding appropriately to changes in the internal and external environments. The intestinal epithelium is not merely a boundary; it plays a functional mediating role in maintaining harmony between the external environment (intestinal bacteria and dietary antigens) and the internal environment (host immune system, etc.).

[0016] Interleukin-10 (IL-10) is an anti-inflammatory cytokine that plays a role in suppressing excessive inflammation in the body and maintaining a normal immune response. By inducing IL-10 production, inflammation and even inflammation-related diseases can be prevented and improved. While IL-10 is known to be produced by immune cells, it is also produced by intestinal epithelial cells and is an important cytokine for maintaining intestinal barrier function. Many diseases are known to be triggered by inflammation, and promoting IL-10 production may suppress inflammation and potentially prevent or slow the progression of these diseases.

[0017] In this invention, promoting IL-10 production means that the expression levels of IL-10 protein and mRNA expressed by target cells increase statistically significantly upon stimulation with dead lactic acid bacteria. Statistical analysis can be performed using standard statistical methods after considering normality and variance, such as the Turkey-Kramer test, Steel-Dwass multiple testing, paired t-test, and Wilcoxon signed-rank test.

[0018] The lactic acid bacteria of this invention belong to the genus Lactiplantibacillus. The genus Lactiplantybacillus is a group of lactic acid bacteria that were reclassified from the genus Lactobacillus in 2020. Previously, over 200 species of Lactobacillus were classified, and a re-evaluation of the genus classification at the genome level resulted in the reclassification of eight genera, one of which had their names changed. Currently, 16 species of Lactiplantybacillus have been identified, with *Lactiplantybacillus plantarum* being the type species.

[0019] Lactiplantibacillus plantarum was reclassified from Lactobacillus plantarum in 2020. Lactobacillus plantarum is a lactic acid bacterium isolated from saliva and found in plants and many fermented foods. These are available from the National Institute of Technology and Evaluation (NITE) Biotechnology Center (NBRC) and the American Type Culture Collection (ATCC) in the United States. The lactic acid bacteria of the present invention can be any lactic acid bacteria of the genus Lactiplantiobacillus without any particular limitations. Preferably, it is Lactiplantiobacillus plantarum.

[0020] In the embodiments of this specification, the strain of Lactiplantybacillus plantarum N1487-7 is used as Lactiplantybacillus plantarum. Lactiplantybacillus plantarum N1487-7 was deposited with the Patent Microorganism Depository Center (NPMD) of the National Institute of Technology and Evaluation (NITE) (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba Prefecture 292-0818, Japan) on July 5, 2024, under accession number NITE P-04128. The Lactiplantybacillus plantarum N1487-7 strain includes not only the deposited strain itself, but also strains that are substantially equivalent to it. For example, it includes strains that are descendants of the deposited strain, such as breeding strains and subcultured strains, that have the same mycological properties as the deposited strain.

[0021] For culturing lactic acid bacteria, conventional liquid culture media containing skim milk powder, yeast extract, peptone, meat extract, salts, minerals, etc., suitable for culturing lactic acid bacteria are used. For example, commercially available media such as MRS (deMan, Rogosa, Sharpe) medium, which is mainly used for culturing lactic acid bacteria, or a medium made by adding glucose to fermented barley extract can also be used.

[0022] Lactic acid bacteria cultured in a culture medium are collected during the logarithmic growth phase, its later phase, or the stationary phase, and then heat-sterilized using an autoclave or the like to obtain dead bacteria. Lactic acid bacteria that have been stored frozen may also be heat-sterilized. The heat treatment conditions are not particularly limited and can be carried out using conditions commonly used to sterilize lactic acid bacteria, for example, 90°C to 140°C for 5 to 120 minutes. In the examples of this specification, the treatment was carried out at 110°C for 10 minutes.

[0023] The term "dead bacteria" in the composition of the present invention refers to dead bacteria and their processed products. The processed products are not particularly limited as long as they are derived from dead bacteria, but examples include dried dead bacteria (spray drying, freeze-drying, vacuum drying, drum drying), and products obtained by processing such as crushing. The concentration of dead lactic acid bacteria in the composition of the present invention is not particularly limited as long as the effects of the present invention are achieved. In the case of a concentrated solution, 10 6 ~10 14 A concentration of cells / g is preferred, and in the case of dried bacterial cells, 1 to 100% by mass per unit of the solid content in the composition is preferred.

[0024] The composition of the present invention is an orally administered preparation, food or beverage, or pharmaceutical product, but it is preferably in the form of a food or beverage. The form of food and beverages is not particularly limited, but it may be formed into powder, granules, capsules, or tablets. Other forms include food ingredients, food additives, or syrups, suspensions, drinks, liquid foods, soft drinks, dairy drinks, lactic acid bacteria drinks, functional seasonings, gel-like foods, dairy products such as pudding and yogurt, confectionery and cakes, bread, noodles, pasta, chocolate, candy, chewing gum, etc.

[0025] Furthermore, the term "food and beverages" is not limited to human consumption, but also includes feed for mammals such as dogs and cats kept as pets or livestock. The concept of "food and beverages" also encompasses not only ordinary food and beverages, but also drinks, so-called supplements and health foods, enteral nutrition foods, foods for special dietary uses, foods with nutritional function claims, and foods for specified health uses.

[0026] When the composition of the present invention is used in pharmaceuticals, there are no particular limitations, but examples include oral formulations such as powders, granules, capsules, pills, and tablets. The effective dose of the pharmaceutical composition varies depending on the condition of the recipient (including age, physical condition, etc.) and dosage form, but the oral dose for a human (an adult weighing 60 kg) can be set within the range of the above-mentioned daily intake for humans. For example, the intake (administration) amount of the composition of the present invention is used in adults in the range of 0.01 to 50 g / day.

[0027] Next, specific examples of the present invention will be described by the following embodiments, but the present invention is not limited to these embodiments. [Examples]

[0028] [Experiment 1] Preparation of dead Lactobacillus bacteria Lactobacillus plantarum strain N1487-7 was thawed from the lactic acid bacteria library stock and inoculated onto MRS medium. The culture was performed at 30°C for 24 hours with shaking (100 rpm). The bacterial cells obtained by centrifugation of the culture medium were washed twice with deionized water and then autoclaved to kill them (110°C, 10 minutes). Hereafter, these will also be referred to as Lpb. plantarum N1487-7 dead bacteria. The samples were dried using a centrifugal evaporator, and the bacterial mass was measured. Suspensions were prepared by adding 1 mL of PBS to each sample.

[0029] [Test 1] Enhancement of IL-10 production in Caco-2 cells by dead Lactobacillus bacteria of the genus Lactiplantibacillus. (1) Caco-2 cells, which are human colon cancer cells, were used as a model for intestinal epithelial cells. 20,000 cells / cm³ in a 24-well plate 2 Caco-2 cells (human colon cancer cells) were seeded (culture medium: DMEM + 10% bovine serum + 1% penicillin / streptomycin) and cultured at 37°C in the presence of 5% carbon dioxide. On day 4 of culture, the supernatant of the cell culture medium was removed, and lactic acid bacteria were suspended in DMEM + 1% bovine serum medium (evaluation medium) to the specified concentration and added to the cells (1 mL / well). Interferon (IFN)-γ solution (50 ng / well) was then added, and the cells were cultured at 37°C in the presence of 5% carbon dioxide. The evaluation medium containing lactic acid bacteria and IFN-γ was replaced every 24 hours.

[0030] (2) Measurement of IL-10 mRNA expression level (real-time PCR) Total RNA was extracted from cells on day 7 of culture using the TRIzol Plus RNA Purification Kit (Thermo Fisher SCIENTIFIC). cDNA was synthesized using SuperScript IV VILO Master Mix with ezDNase Enzyme (Thermo Fisher SCIENTIFIC). Samples were prepared using FastStart Essential DNA Green Master (Roche), and IL-10 mRNA expression levels were measured using the LightCycler96 system. GAPDH was used as the internal standard. The primer sequences are shown below. Target mRNA expression levels were determined as a percentage of GAPDH mRNA expression levels. Human GAPDH Fw: GGTGAAGGTCGGAGTCAACGGA Human GAPDH Rv: GAGGGATCTCGCTCCTGGAAGA Human IL-10 Fw: GCCTAACATGCTTCGAGATC Human IL-10 Rv: TGATGTCTGGGTCTTGGTTC

[0031] (3) Measurement of IL-10 protein expression level (Western blotting method) Protein expression levels were confirmed using the Western blotting method. All Western blotting reagents were manufactured by Thermo Fisher SCIENTIFIC. On day 7 of culturing the cells described in (1) above, the cell supernatant was removed, and proteins were extracted using M-PER Reagent supplemented with protease and phosphatase inhibitor. The amount of extracted protein was measured using the Bradford Assay. Samples were prepared to contain 20 μg of protein per well. Bolt LDL Sample Buffer and Reducing Agent were added to the protein solution and heat-treated at 70°C for 10 minutes. Electrophoresis (200V, 22 minutes) was performed using Bolt MES SDS Running Buffer and a 15-well gel, after which the gel was removed and transferred using the iBlot2 dry blotting system. Antigen-antibody reactions of GAPDH and IL-10 proteins were performed using the iBind Western System. The primary antibodies used were GAPDH Monoclonal Antibody proteintech 60004-1-Ig and Anti IL-10 proteintech 60269-1-Ig, and the secondary antibody used was Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP Catalog #31430 (Thermo Fisher SCIENTIFIC). After washing the membrane, 1.0 mL each of the two reagents included in Super Signal west Dura was mixed and the membrane was reacted for 5 minutes. The membrane was inserted into the BIO RAD chemi Doc XRS+ system and imaging was performed. In addition, the intensity of the detected bands was quantified using image analysis software.

[0032] (4) Statistical processing The data from each of the experiments described in (2) and (3) above are shown as mean ± standard deviation. Statistical analysis was performed using the Shapiro-Wilk test to confirm normality. For data that could not be definitively classified as non-normal, the Bartlett test was used to check for equal variances. For data where equal variances were confirmed, significance testing was performed using the Tukey-Kramer method. For data that were not normally classified, significance testing was performed using the Steel-Dwass multiple testing method. The significance level for the tests was set at 5% (two-sided). The same statistical analysis was performed in tests 2, 3, and 7.

[0033] (5) Results The results for IL-10 mRNA expression levels are shown in Figure 1. Compared to the control group stimulated with IFN-γ, the test group treated with dead Lactobacillus lactiplantibacillus at a concentration of 100 μg / mL (Lpb. plantarum N1487-7) showed significantly higher levels of IL-10 mRNA expression. The results for IL-10 protein expression levels are shown in Figure 2. Compared to the control group stimulated with IFN-γ, the test group (Lpb. plantarum N1487-7) to which dead Lactobacillus bacteria of the genus Lactoplastibacillus were added at a concentration of 100 μg / mL showed significantly higher levels of IL-10 protein expression. Therefore, it was suggested that dead Lactobacillus bacteria promote IL-10 production in intestinal epithelial cells.

[0034] [Test 2] Promotion of IL-10 production in human macrophage cells by dead Lactobacillus bacteria of the genus Lactiplantibacillus. Immune cells called macrophages (M) are classified into type 1 (M1) and type 2 (M2). M1 are inflammatory cells that release inflammatory cytokines, while M2 are anti-inflammatory cells that release the anti-inflammatory cytokine IL-10. Furthermore, it is known that M can reversibly change from M1 to M2 or from M2 to M1 depending on the environment (polarization). Therefore, we directly exposed human macrophage cells to dead Lactobacillus bacteria and investigated the effects on IL-10 mRNA and protein expression. The dead bacteria of Lactiplantybacillus plantarum strain N1487-7 obtained in Experiment 1 above were dried using a centrifugal evaporator and powdered for use.

[0035] (1) Human macrophage 28SC-ES cells were used. RPMI medium + FBS 1% + Penicillin-Streptomycin Solution 1% (8 × 10⁻⁶) 4 cells / ml (20,000 cells / cm³) 2The cell suspension prepared in ) was seeded in 1 mL portions into 24-well plates. The control group was treated with 10% sterile PBS, while the test group was treated with Lpb. plantarum N1487-7 dead bacterial suspension (PBS) at the specified concentration. Both groups were incubated at 37°C in the presence of 5% carbon dioxide for 24 hours.

[0036] (2) Measurement of IL-10 mRNA and protein expression levels in human macrophage 28SC-ES cells After 24 hours, the expression level of IL-10 mRNA was measured by real-time PCR using the same method as in (2) of Test 1 above. After 24 hours, the culture medium was changed again, and PBS or N1487-7 dead bacterial suspension was added. The cultures were then incubated at 37°C in the presence of 5% carbon dioxide for 24 hours. On the following day and the day after, the culture medium was changed again, and PBS or N1487-7 dead bacterial suspension was added. The cultures were then incubated at 37°C in the presence of 5% carbon dioxide for 24 hours. The cell supernatant was removed, and the protein was extracted using M-PER Reagent to which protease and phosphatase inhibitors were added. The expression level of IL-10 protein was then measured by Western blotting in the same manner as in (3) of Test 1 above.

[0037] (3) Results Figure 3 shows the results of real-time PCR for IL-10 mRNA expression levels. Compared to the control group, Lpb. plantarum N1487-7 dead bacteria showed significantly higher IL-10 mRNA expression levels in a concentration-dependent manner. Furthermore, the results of Western blotting, as shown in Figure 4, also showed that IL-10 protein expression levels were significantly higher in a concentration-dependent manner compared to the control group (Lpb. plantarum N1487-7 dead bacteria).

[0038] (4) Discussion In human macrophages, dead Lpb. plantarum N1487-7 significantly increased the expression of the IL-10 gene and protein, an anti-inflammatory cytokine released from M2, in a concentration-dependent manner (10-100 μg / mL), suggesting that dead Lpb. plantarum N1487-7 promotes polarization from M1 to M2.

[0039] [Study 3] Administration of Lactobacillus lactiplantiformis cells (dead and live) increased blood IL-10 concentration and improved skin barrier function in stressed mice. Hairless mice (stress-loaded mice) that were given dextran sulfate sodium (DSS), a colitis-inducing agent, with periods of rest in between, were forcibly orally administered dead or live Lactobacillus bacteria, and the effects on blood IL-10 concentration and skin barrier function were examined. Lactobacillus plantarum strain N1487-7 was cultured in a jar on Barlex medium, and the resulting bacterial cells were washed twice with deionized water. A portion was then freeze-dried to obtain live bacterial powder. Another portion was heat-treated at 110°C for 10 minutes to sterilize and obtain dead bacterial powder.

[0040] (1) Test to confirm the effect of improving skin barrier function in hairless mice This experiment was commissioned to SLC Japan Co., Ltd. It was confirmed to comply with the company's animal experiment regulations, and the experiment was approved (Approval No. BT20039). Thirty-two female, six-week-old hairless mice (Hos:HR-1) were used. After a six-day preliminary rearing period, the mice were divided into five groups of six (groups 1-5). A total of 12 mice were moved to an isolator building under sterile conditions: four groups (live bacterial administration control group) and five groups (live bacterial administration group). The composition of the test groups is shown in Table 1.

[0041] [Table 1]

[0042] The test group received forced oral administration of the test substance (dead or live Lpb. plantarum N1487-7 strain) or the medium once daily for 35 days. The normal group did not receive forced oral administration. To induce mild colitis, the colitis-inducing agent DSS 1.5% was added to the drinking water of both the control and test groups for 2-3 weeks and 4-5 weeks, respectively, allowing for ad libitum intake.

[0043] Body weight and dorsal transcutaneous water loss (TEWL) were measured weekly (for groups 4 and 5, measurements were taken only before administration and on the final day of the study). TEWL was measured using a TEWL measuring device (VAPO SCAN AS-VT100RS; Asahi Techno Lab Co., Ltd.). Fecal matter was observed weekly and scored according to the following criteria: Score 0; Normal (moderately dry and retaining its shape), Score 1; Retaining its shape but slightly loose, Score 22; Loose (sticks to toilet paper), Score 3; Loose (loose in shape), Score 4; Diarrhea. Although not scored, the presence or absence of occult blood in the feces was also observed. The degree of colitis due to DSS was examined based on this fecal score. On the final day of the study (5 weeks later), total blood was collected from the posterior vena cava under isoflurane inhalation anesthesia. The obtained blood was centrifuged to separate the serum, and the IL-10 concentration in the serum was measured. The IL-10 concentration was measured using the Mouse IL10 ELISA Kit 8 Publications KE10008 (proteintech). After total blood collection, the patient was dissected, the colon and rectum were removed, and the length from the colon to the anus was measured as the colonic length to examine the degree of colitis caused by DSS.

[0044] (2) Experimental results Body weight increased steadily in all groups, and no significant differences were observed between groups. Furthermore, no weight loss was observed with DSS administration. Figure 5 shows the results of measured TEWL values ​​in groups 1-3 (normal group, dead bacteria control group, and dead bacteria administration group). At weeks 1 and 2 of administration, the control group showed significantly higher values ​​compared to the normal group. On the other hand, the Lpb. plantarum N1487-7 dead bacteria administration group (Lpb. plantarum N1487-7 group) did not show a significant difference from the normal group. At week 4 of administration, the dead bacteria administration group showed significantly lower values ​​compared to before administration. Figure 6 shows the measured TEWL values ​​for groups 4-5 (live bacteria control group and live bacteria administration group). No significant differences were observed between groups, but within groups, the live bacteria administration group showed an increasing trend.

[0045] In terms of fecal scores, all groups had a fecal score of 0 during weeks 0-2, the period without DSS intake. During the DSS intake period (weeks 3 and 5), most mice had a fecal score of 1 or 2, blood on the bedding, and bloody stools. During the DSS cessation period (week 4), the stool condition generally improved, and the fecal score was almost the same as during weeks 0-2, before DSS intake. No significant differences were observed between groups in any of the evaluation periods. Furthermore, no significant differences were found in colon length in any group. These results suggest that colitis was not significantly induced under the conditions of this study. Furthermore, as shown in Figure 7, serum IL-10 concentrations were significantly higher in the Lpb. plantarum N1487-7 dead bacteria administration group (Lpb. plantarum N1487-7 group) compared to the control group. On the other hand, no significant difference was observed in serum IL-10 concentrations in the Lpb. plantarum N1487-7 live bacteria administration group compared to the control group (Figure 8).

[0046] (3) Discussion DSS was mixed into drinking water and allowed to be consumed ad libitum only during weeks 2-3 and 4-5. Forced oral administration was not performed on the normal group; forced oral administration was only performed on the control and treatment groups. Since there was little diarrhea or bloody stool during the ad libitum DSS intake period, and no shortening of the large intestine was observed at autopsy, it was determined that colitis was not induced by DSS. During the period without DSS intake, transepidermal water loss (TEW) was significantly increased in the control group compared to the normal group. This suggests that stress from forced oral administration (psychological, physical restraint, and physical stress from direct insertion of a tube into the stomach) was the cause, and that dead N1487-7 bacteria suppressed this significant increase in TWD.

[0047] In detail, in the study examining the effects of dead bacteria administration in groups 1-3, at weeks 1 and 2 (the period without DSS administration), the control group showed significantly higher TEWL compared to the normal group, while no significant difference was observed in the Lpb. plantarum N1487-7 dead bacteria administration group. At week 4 (the period without DSS administration), the Lpb. plantarum N1487-7 dead bacteria administration group showed a significant decrease in TEWL compared to week 0. At week 2 (the period without DSS administration), the control group showed a significantly higher rate of change in TEWL compared to the normal group, while no significant difference was observed in the Lpb. plantarum N1487-7 dead bacteria administration group. Forced oral administration via tube was not performed in the normal group. On the other hand, the control group and the Lpb. plantarum N1487-7 dead bacteria administration group underwent forced oral administration once daily for 35 days, with the subjects being physically restrained and a tube directly inserted into the stomach. Forced oral administration in rats and mice has been shown to induce significant stress responses, including elevated blood pressure, heart rate, and plasma corticosterone levels.

[0048] Corticosterone is a glucocorticoid primarily released in mice. It is a hormone secreted from the adrenal cortex, and its secretion increases sharply when the body and mind are under stress, hence it is also called a "stress hormone." In humans, cortisol is the primary glucocorticoid released. A positive correlation exists between corticosterone and inflammatory cytokines such as IL-2, IL-6, and IL-12. It has been reported that stress due to sleep disorders increases IL-12 and decreases IL-10. Furthermore, inflammatory cytokines such as IL-12 have been shown to cause impaired skin barrier function and increase TEWL (Tissue-Endoscopic Water Leakage). Therefore, since administration of dead bacteria increased serum IL-10 concentration, suppressed the increase in corticosterone caused by stress resulting from forced oral administration, and suppressed a significant increase in TEWL, it was suggested that administration of dead Lactobacillus bacteria suppresses stress-induced decline in skin barrier function.

[0049] On the other hand, in the study investigating the efficacy of live bacterial administration in groups 4 and 5, it was difficult to measure TEWL in a sterile environment, so TEWL was measured only before administration and on the final day of the study. No significant difference in TEWL was observed between groups, but the live bacterial administration group showed higher values ​​compared to the control group and showed an increasing trend compared to week 0. In addition, serum IL-10 concentration was higher in the live bacterial administration group compared to the control group, but no significant difference was observed between groups. The serum IL-10 concentration was approximately 100 pg / mL in the control group administered with live bacteria, compared to approximately 30 pg / mL in the control group administered with dead bacteria, showing a significant difference despite both groups being the same control. This difference is presumed to be due to environmental differences. The live bacteria administration group and the control group were tested in an SPF area of ​​an isolator building. An isolator is a structure where the rearing cages are covered with thick, transparent plastic sheeting, and an SPF area is a state free from infection by specific pathogenic microorganisms.

[0050] The dead bacteria administration group, the control group, and the normal group were all tested in a normal rearing room (open system). Compared to the SPF area, it is hypothesized that in a normal rearing room, even if it does not cause disease, various bacteria may enter the mouse body, activating immune cells that release inflammatory cytokines, and suppressing the release of the anti-inflammatory cytokine IL-10. On the other hand, it is possible that mice in the SPF group, which are free from bacterial contamination, release inflammatory cytokines and IL-10 in a balanced manner. From the above, it is thought that the control group administered live bacteria had a higher IL-10 concentration than the control group administered dead bacteria. Under the conditions of this study, it was suggested that ingestion of live Lactobacillus bacteria did not increase IL-10 levels, and furthermore, that live Lactobacillus bacteria did not have an effect on suppressing the decline of skin barrier function.

[0051] [Study 4] Increase in human blood IL-10 concentration and reduction in γ-GTP levels after ingestion of dead Lactobacillus bacteria (open-label study) Inflammatory cytokines are known to cause inflammation in the liver and promote liver fibrosis. Therefore, we compared blood IL-10 levels and γ-glutamyl trans-transpeptidase (γ-GTP) levels, a liver function marker, before and after ingestion of dead Lactobacillus lactiplanticus bacteria into humans.

[0052] (1) Test food 60 L of culture medium, prepared to contain 5% glucose, was sterilized at 110 °C for 20 minutes in Barlex II (Sanwa Shurui Co., Ltd.) adjusted to Brix 4. After cooling the medium, 25% (w / w) sodium hydroxide for food additives was added to adjust the pH to 6.0. 3 L of pre-culture solution of Lpb. plantarum strain N1487-7 was inoculated into the Barlex II (Brix 4) medium containing 1% glucose. The culture was incubated at 100 rpm, pH 5.5, and 30 °C for 22.5 hours. The cells were collected using a high-speed continuous centrifuge, suspended in 60 L of tap water, and collected again using the high-speed continuous centrifuge for cell washing. The obtained cells were suspended in 30 L of tap water and returned to the fermenter, where they were treated at 110 °C for 10 minutes to obtain dead cells. The obtained cell suspension was dried in a freeze-dryer, and the dried material was pulverized in a mixer. The test food was in the form of a hard capsule (size 1), white and opaque, and packaged in an aluminum pouch. The low-dose group received 25 mg of dead bacteria per capsule per day, and the high-dose group received 50 mg per capsule (2 capsules per day). Participants took one or two capsules once a day within 30 minutes after dinner.

[0053] (2) Open-label testing The study was an open-label trial, with subjects aged 20 to 74 years who gave their consent to participate. There were two groups of 18 subjects each (low-dose group and high-dose group). Pre-test measurements were taken before the start of intake, and post-test measurements were taken 8 weeks after intake. Blood IL-10 levels were measured using the Human IL-10 ELISA Kit KE00012 (proteintech). Blood tests were performed on items commonly tested in general health checkups, including γ-GTP.

[0054] (3) Subject background There were no significant differences between the groups in terms of gender ratio, age, or weight. Table 2 shows the subject characteristics (male-female ratio: chi-squared test, age and weight: paired t-test). [Table 2]

[0055] (4) Participants in the analysis Of the 36 participants (13 males and 23 females) enrolled in this study, one participant in the low-dose group withdrew from the study midway, and data could not be collected from another participant, so they were excluded. The analysis included 34 participants in total: 16 from the low-dose group and 18 from the high-dose group who completed the study. Measurement values ​​that could not be obtained due to incomplete questionnaire responses were treated as missing values, and no substitute values ​​were used. The intake rate calculated using the number of intake days was 98.21% for the low-dose group and 98.41% for the high-dose group.

[0056] (5) Statistical analysis A chi-squared test was performed to determine the male-female ratio of the subjects. The normality of each test value and questionnaire was confirmed using the Shapiro-Wilk test. For data that could not be definitively ruled out as being normally distributed, a paired two-sample t-test was used for before-and-after comparison. For data that were not normally distributed, the Wilcoxon signed-rank test was used for before-and-after comparison. The significance level for the tests was set at a two-sided 5%, and missing values ​​were not imputed.

[0057] (6) Experimental results The obtained blood was centrifuged to collect serum, and the IL-10 concentration was measured by ELISA. As shown in Figure 9, blood IL-10 concentrations in both the low-dose and high-dose groups significantly increased after ingestion compared to before ingestion (p < 0.001). Each data point represents the mean and standard deviation. Furthermore, as shown in Figure 10, blood γ-GTP concentration significantly decreased after ingestion in the low-dose group (p < 0.05), while showing a decreasing trend in the high-dose group (p = 0.067).

[0058] [Study 5] Promotion of polarization to human type 2 macrophages by ingestion of dead Lactobacillus lactiplanticus bacteria (open-label study) The effects of human ingestion of dead Lpb. plantarum N1487-7 bacteria on immune cells were investigated. The test food was the same as in Study 4.

[0059] (1) Open-label testing The study was an open-label trial in which 20 healthy men and women aged 40 to under 65 who gave their consent to participate were given one hard capsule containing dead Lpb. plantarum N1487-7 bacteria for eight weeks. Pre-test measurements were taken before the start of administration, and post-test measurements were taken after eight weeks of administration. The effects on macrophages and T cells, which are immune cells, were investigated. Peripheral blood mononuclear cells were purified from whole blood by centrifugation and stained with various fluorescent dye-labeled antibodies. The expression of macrophage cell surface antigens CD80, CD86, and HLA-DR, as well as CD69 expression in CXCR3-positive Th1 subsets of CD4-positive cells and CD69 expression in CD8-positive cytotoxic T cells, were measured using a BD FACSVia Flow Cytometer (BD Biosciences, Code# 656874). The FACSVia Research software (BD Biosciences, Code# 660563) included with the system was used for data analysis. Negative signals were measured using each isotype control.

[0060] (2) Subjects and analysis participants No significant differences were observed between men and women regarding the subject characteristics shown in Table 3. [Table 3] Since there were no subjects that needed to be excluded, all subjects who consumed the test food were included in the analysis.

[0061] (3) Statistical analysis Statistical analysis was performed using R (version 4.1.1). The effectiveness was evaluated by comparing the 8-week measurement with the screening (SCR) measurement. For SCR and 8-week measurements, the effect of the test food was evaluated using a paired t-test if normality could be confirmed, and a Wilcoxon signed-rank test if normality could not be confirmed.

[0062] (4) Experimental results Table 4 shows a comparison of immune indicators. CD80 expression in macrophages was significantly decreased before and after ingestion (p = 0.017). In addition, CD69 expression in CD8-positive cytotoxic T cells showed an increasing trend before and after ingestion (p = 0.081).

[0063] [Table 4]

[0064] A comparison was performed before and after intake on 10 individuals whose CD69 expression in the CD4-positive Th1 subset was below the median value at week 0 prior to the start of intake. The results of the comparison of immune indicators for the 10 individuals are shown in Table 5. CD69 expression in the Th1 subset of CD4-positive cells was significantly increased (p = 0.024), and CD69 expression in CD8-positive cytotoxic T cells was significantly increased (p = 0.011). Furthermore, CD80 expression in macrophages was significantly decreased before and after ingestion, similar to the results of the all-case analysis (p = 0.023).

[0065] [Table 5]

[0066] (5) Discussion Ingestion of dead Lpb. plantarum N1487-7 bacteria significantly reduced CD80 expression in macrophages. Macrophages consist of inflammatory type 1 macrophages and anti-inflammatory type 2 macrophages, and are known to reversibly change depending on the environment. Furthermore, the change in polarity is rapid and is involved in the reconstruction of the signaling network at both the transcriptional and translational levels. Type 1 macrophages express CD80, 86, and HLA-DR (MHC II), while some type 2 macrophages (M2b) express CD86 and HLA-DR (MHC II), but do not express CD80. The significant suppression of CD80 expression in this study suggests that ingestion of dead bacteria promoted the polarization from type 1 inflammatory macrophages to type 2 anti-inflammatory macrophages. Type 1 macrophages do not produce IL-10, while type 2 macrophages do. Cell experiments in which dead Lpb. plantarum N1487-7 bacteria were added to human macrophage cells (28SC-ES) showed increased IL-10 expression, suggesting that dead bacteria promote polarization into type 2 macrophages. Therefore, the results of this study were consistent with those of the cell experiments.

[0067] [Study 6] Ingestion of dead Lactobacillus bacteria increased human blood IL-10 concentration, reduced γ-GTP levels, reduced ALP levels, and reduced cholesterol levels (double-blind study). The effects of ingestion of dead Lpb. plantarum N1487-7 bacteria on blood IL-10 concentration and liver function were investigated. The test food was the same as in Study 4, and participants were given one white hard capsule containing 25 mg (test food) or 25 mg of dextrin (control food) once a day within 30 minutes after dinner.

[0068] (1) Double-blind test The study was double-blind, with two groups consisting of 50 healthy men and women aged 20 to 64 years who gave their consent. Participants were selected based on their γ-GTP levels: men with a γ-GTP level between 61 U / L and 100 U / L, women with a γ-GTP level between 31 U / L and 65 U / L, ALT levels between 31 U / L and 50 U / L, or AST levels between 31 U / L and 50 U / L. Participants were divided into a test food group and a control food group, and each group consumed their assigned food for 12 weeks. Tests were performed at weeks 0, 6, and 12 before intake, and blood IL-10 concentration, γ-GTP, ALP, AST, ALT, total cholesterol, and LDL cholesterol were measured. IL-10 was measured using the Interleukin-10 Human IL-10 ProQuantum Immunoassay Kit, manufactured by Thermo Fisher Scientific KK.

[0069] (2) Statistical analysis IBM SPSS Statistics (ver28) was used for data aggregation and analysis. Basic statistics (mean ± standard deviation) were calculated for each measurement item. For values ​​(actual value and change) at each measurement time point, the test food and the control food were compared using an independent t-test. Within-group comparisons at each measurement time point before and after intake of the test food were performed using a Bonferroni-corrected paired t-test. The tests were two-tailed, and the significance level was set at 5%.

[0070] (3) Subjects and analysis participants No significant differences were observed between the groups regarding the subject characteristics (those included in the analysis) shown in Table 6. [Table 6] Two participants dropped out, and two participants met the exclusion criteria for analysis. The analysis was performed on the 96 participants who were excluded from the analysis. The intake rate of the test food was 94.8±10.7% in the group that consumed the test food (Lpb. plantarum N1487-7 dead bacteria) and 97.0±11.3% in the group that consumed the control food.

[0071] (4) Experimental results Table 7 shows the changes in blood IL-10 concentration. [Table 7] In the control group, blood IL-10 levels decreased significantly at both 6 and 12 weeks compared to pre-intake levels (p<0.01 in both cases). On the other hand, in the group that consumed the test food, no significant decrease was observed at either 6 or 12 weeks, and levels remained high.

[0072] Table 8 shows the changes in blood IL-10 concentration in individuals with a median total cholesterol level of less than 228.5 mg / dL. [Table 8] In individuals with a median total cholesterol level of less than 228.5 mg / dL, blood IL-10 concentrations in the group consuming the test food tended to be higher at 6 weeks and significantly higher at 12 weeks compared to the control group.

[0073] Table 9 shows the changes in blood γ-GTP levels in individuals whose median γ-GTP level in week 0 prior to intake (SCR) was 52.5 U / L or higher. [Table 9] In the group with a median γ-GTP level of 52.5 U / L or higher at week 0 prior to intake (SCR), γ-GTP levels tended to be lower in the test food intake group than in the control food intake group at week 0 prior to intake (SCR), and were significantly lower at week 6 of intake.

[0074] Table 10 shows the changes in blood ALP levels in individuals whose ALT level in week 0 prior to intake (SCR) was between 31 U / L and 50 U / L, which is the selection criterion. [Table 10] In the group with an ALT level of 31 U / L or higher and 50 U / L or lower at week 0 before intake (SCR), which was the selection criterion, ALP levels were significantly lower in the test food intake group than in the control food intake group at week 6, and a tendency for lower values ​​was observed in the change from week 0 before intake (SCR) to week 6 of intake.

[0075] Table 11 shows the changes in total blood cholesterol and LDL cholesterol levels. [Table 11] In terms of total cholesterol, the group consuming the test food showed significantly lower values ​​than the control food group in both the change from week 0 (SCR) before intake to week 6 after intake and the change from week 0 (SCR) before intake to week 12 after intake. In the within-group comparison, the control food group showed a significant increase at week 12 after intake compared to week 0 (SCR) before intake, but no significant difference was observed in the test food group. In terms of LDL cholesterol, the group consuming the test food showed significantly lower values ​​than the group consuming the control food in terms of the change from week 0 before intake (SCR) to week 12 after intake.

[0076] (5) Discussion In Study 4, human ingestion of dead Lpb. plantarum N1487-7 bacteria resulted in an increase in blood IL-10 concentration, suggesting that the dead bacteria possess anti-inflammatory effects. Furthermore, in Study 4, ingestion of the dead bacteria reduced γ-GTP levels. γ-GTP is a liver function marker, and decreased liver function is thought to be caused by inflammation. Therefore, to confirm the liver function improvement effect of ingesting this strain through its anti-inflammatory mechanism, a placebo-controlled, double-blind, parallel-group comparative study was conducted.

[0077] In a comparison of serum IL-10 concentrations within the groups, the control food intake group showed a significant decrease at 6 and 12 weeks, while no significant change was observed in the test food intake group. Subgroup analysis revealed that in the group with a median total cholesterol of less than 228.5 mg / dL (test food intake group: 23 people, control food intake group: 25 people), IL-10 concentrations were significantly higher in the test food intake group than in the control food intake group at 12 weeks. In the group with a median γ-GTP of 52.5 U / L or higher (test food intake group: 24 people, control food intake group: 22 people), γ-GTP levels were significantly lower in the test food intake group than in the control food intake group at 6 weeks. Furthermore, in the group with ALT levels between 31 U / L and 50 U / L (test food intake group: 24 people, control food intake group: 22 people), ALP levels were significantly lower in the test food intake group than in the control food intake group at 6 weeks of intake, and a tendency for lower values ​​was observed in the change from pre-intake week 0 (SCR) to 6 weeks of intake. IL-10 is an anti-inflammatory cytokine that minimizes tissue damage by preventing excessive activation of the immune response. IL-10 has been reported to have anti-inflammatory and hepatocyte regeneration-promoting effects in the liver. Therefore, it is suggested that the dead Lpb. plantarum N1487-7 bacteria in this test food promote IL-10 production, and that IL-10's anti-inflammatory and hepatocyte regeneration-promoting effects contribute to improving liver function.

[0078] The liver is responsible for the synthesis, metabolism, and excretion of cholesterol, and liver function and blood cholesterol levels are closely related. Participants in this study were recruited from individuals with elevated liver function markers, but also showed elevated total cholesterol and LDL cholesterol levels, often near the borderline. At 6 and 12 weeks of intake, the test food intake group showed significantly lower total cholesterol levels than the control food intake group. At 12 weeks of intake, the test food intake group also showed significantly lower LDL cholesterol levels compared to the control food intake group. These results suggest that, in individuals with impaired liver function and borderline total and LDL cholesterol levels, Lpb. plantarum N1487-7 dead bacteria increase blood IL-10 concentration, thereby improving liver function and the metabolism of total and LDL cholesterol.

[0079] Bile is a fluid necessary for digesting fats. It is secreted by the liver and stored in the gallbladder. When the gallbladder contracts due to stimuli such as eating, bile flows through the bile duct into the duodenum, assisting the action of lipase, a fat-digesting enzyme. Bile is composed of cholesterol and bile salts, but it is known that when liver function declines, bile stagnates, causing γ-GTP, ALP, and cholesterol to leak into the bloodstream, leading to elevated levels of γ-GTP, ALP, and total cholesterol. The subjects in this study showed high levels of these three factors from week 0 before the start of intake, suggesting a state of bile stagnation. The results of the study showed that γ-GTP, ALP, and total cholesterol levels significantly decreased after intake of Lpb. plantarum N1487-7 dead bacteria, suggesting that bile stagnation was prevented or improved. Based on the medical interviews and diaries, no adverse events that could be considered to be causally related to the test food were observed, and no safety issues were found with this test food.

[0080] [Experiment 7] Suppression of TNFR2 expression in Caco-2 cells by various dead lactic acid bacteria It is known as the gut-skin axis that a decrease in intestinal barrier function is correlated with a decrease in skin barrier function. Furthermore, ingested lactic acid bacteria act on the intestines, and it is unlikely that they directly affect the skin. Therefore, given that TNFR2 expression, a receptor for the inflammatory cytokine TNF-α, is known to be involved in intestinal barrier function, we selected lactic acid bacteria that suppress TNFR2 expression. TNFR2 is expressed in intestinal epithelial cells, and suppressing its expression may suppress inflammatory responses.

[0081] (1) Preparation of lactic acid bacteria The sources of isolation for the stocked lactic acid bacteria library are diverse, including whole barley, shochu mash, barley fermentation liquid, sake mash, grapes, yogurt, cheese, and pickled vegetables. From this collection, stocks of strains from different sources and genera were thawed and inoculated onto MRS medium. Culture was performed at 30°C for 24 hours with shaking (100 rpm). After obtaining bacterial cells by centrifugation of the culture medium, they were washed twice with deionized water and then autoclaved to kill the cells (110 °C, 10 minutes). The sample was dried using a centrifugal evaporator and the bacterial weight was measured. Suspensions were prepared by adding 1 mL of PBS to each sample.

[0082] (2) Caco-2 cells, which are human colon cancer cells, were used as a model for intestinal epithelial cells. 20,000 cells / cm³ in a 24-well plate 2 Caco-2 cells (human colon cancer cells) were seeded (culture medium: DMEM + 10% bovine serum + 1% penicillin / streptomycin) and cultured at 37°C in the presence of 5% carbon dioxide. On day 4 of culture, the supernatant of the cell culture medium was removed, and lactic acid bacteria were suspended in DMEM + 1% bovine serum medium (evaluation medium) to the specified concentration and added to the cells (1 mL / well). Interferon (IFN)-γ solution (50 ng / well) was then added, and the cells were cultured at 37°C in the presence of 5% carbon dioxide. On day 6, the culture medium was changed with the same sample and evaluation medium containing IFN-γ.

[0083] (3) Measurement of TNFR2 mRNA expression level (real-time PCR) Total RNA was extracted from cells on day 7 of culture using the TRIzol Plus RNA Purification Kit (Thermo Fisher SCIENTIFIC). cDNA was synthesized using SuperScript IV VILO Master Mix with ezDNase Enzyme (Thermo Fisher SCIENTIFIC). Samples were prepared using FastStart Essential DNA Green Master (Roche), and TNFR2 mRNA expression levels were measured using the LightCycler96 system. GAPDH was used as the internal standard. The primer sequences are shown below. Target mRNA expression levels were determined as a percentage of GAPDH mRNA expression levels. Human GAPDH Fw : GGTGAAGGTCGGAGTCAACGGA Human GAPDH Rv: GAGGGATCTCGCTCCTGGAAGA Human TNFR2 Fw : TTCCAGAAAACCCCAGCA Human TNFR2 Rv: TGGCCTGAGGTGATGCTT

[0084] (4) Results Figure 11 shows the results of TNFR2 mRNA expression levels from each type of dead lactic acid bacteria. Compared to the IFN-γ-stimulated control group, three strains strongly suppressed TNFR2 mRNA expression, all of which belonged to the genus Lactiplantibacillus. Among these, strain N1487-7, which showed the highest growth rate, was selected as a lactic acid bacterium of the genus Lactiplantibacillus, and experiments 1-6 were conducted. Furthermore, as shown in Figure 12, TNFR2 mRNA expression was significantly lower in the group treated with 100 μg / mL of N1487-7 compared to the control group stimulated with IFN-γ.

[0085] (5) Discussion From among lactic acid bacteria of different sources and genera, Lactiplantibacillus plantarum strain N1487-7 (dead bacteria) was selected as a lactic acid bacterium that suppresses the expression of TNFR2, one of the receptors for the inflammatory cytokine TNF-α. Since TNF-α is an inflammatory cytokine, it enhances inflammation and causes a decrease in intestinal barrier function. There are two types of receptors for TNF-α, TNFR1 and TNFR2. TNFR1 is activated by both membrane-bound and free TNF-α, while TNFR2 is mainly activated by membrane-bound TNF-α. When TNF-α binds to receptors on the cell surface, a signal is sent, and an inflammatory response occurs. A decrease in intestinal barrier function leads to a decrease in skin barrier function. Therefore, it was suggested that administering dead Lactiplantibacillus bacteria, which reduce TNFR2 expression, to intestinal epithelial cells suppresses the decrease in intestinal barrier and skin barrier function.

Claims

1. A composition for promoting IL-10 production in intestinal epithelial cells, containing dead lactic acid bacteria belonging to the genus Lactiplantibacillus as an active ingredient.

2. The composition according to claim 1, wherein the promotion of IL-10 production in the intestinal epithelial cells is as follows (1) to (5). (1) Suppression of the increase or decrease in blood IL-10 concentration, and / or (2) Prevention or improvement of impaired liver function, and prevention or improvement of cholestasis, and / or (3) Reduction of total blood cholesterol or LDL cholesterol, and / or (4) Promotion of macrophage polarization from M1 to M2, and / or (5) Suppression of the decline in skin barrier function

3. The composition according to claim 2, wherein the reduction of blood γ-GTP and blood ALP prevents or improves the decline in liver function and the prevention or improvement of cholestasis described in (2) above.

4. The composition according to claim 1, wherein the lactic acid bacterium is Lactiplantibacillus plantarum.

5. The composition according to claim 4, wherein the lactic acid bacterium is Lactiplantibacillus plantarum N1487-7 strain (NITE P-04128).

6. The composition according to any one of claims 1 to 5, which is a pharmaceutical preparation, food or beverage, or medicine.

Citation Information

Patent Citations

  • Differentiation inducer of regulatory t cells and differentiation induction method

    JP2019080497A

  • Glucose metabolism improving composition

    JP2023175938A

  • Gastrointestinal dysfunction inhibitory composition

    JP2024042259A