Double bifunctional vector for AAV generation
The dual expression cassette system with optimized promoters and VP1 start codons in the DuoDuoBac approach addresses the instability of baculovirus systems, enhancing AAV production efficiency and scalability.
Patent Information
- Application Number
- JP2026014272
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-04-02
- Filing Date
- 2026-01-30
- Publication Date
- 2026-05-26
AI Technical Summary
The instability of protein production levels in baculovirus systems due to recombination between repeated homologous sequences and the suboptimal timing and ratio of Rep and Cap proteins in AAV generation hinder the scalability and efficiency of recombinant adeno-associated virus (rAAV) production.
A dual expression cassette system using separate baculovirus vectors for Rep and Cap proteins, optimized with different promoters and VP1 start codons, combined with a DuoDuoBac approach to enhance simultaneous infection and capsid stoichiometry, improving AAV production quality and quantity.
This approach achieves higher AAV yields with improved capsid stoichiometry and reduced contamination, facilitating scalable and cost-effective production of recombinant parvovirus vectors.
Smart Images

Figure 2026086516000009 
Figure 2026086516000010 
Figure 2026086516000011
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of medicine, molecular biology and gene therapy. The present invention relates to the production of proteins in cells in which imperfect palindromes / homologous repeats repeated by a baculovirus vector are used. In particular, the present invention relates to the production of parvovirus vectors that can be used in gene therapy and to the improvement of the expression of the viral replicase (Rep) protein that increases the productivity of parvovirus vectors.
Background Art
[0002] The baculovirus expression system is well-known for its use as a eukaryotic cloning and expression vector (King, L.A. and R.D. Possee, 1992, "The baculovirus expression system", Chapman and Hall, United Kingdom; O'Reilly, D.R. et al., 1992. Baculovirus Expression Vectors: A Laboratory Manual. New York: W.H. Freeman). The advantages of the baculovirus expression system include, inter alia, that the proteins expressed are usually soluble, correctly folded and biologically active. Further advantages include high protein expression levels, faster production, compatibility with the expression of large proteins and compatibility with large-scale production. However, in the large-scale or continuous production of heterologous proteins using the baculovirus system in insect cell bioreactors, the instability of production levels, also known as the passage effect, is a major obstacle. This effect is due, at least in part, to recombination between repeated homologous sequences in baculovirus DNA.
[0003] Baculovirus expression systems have also been successfully used for the production of recombinant adeno-associated virus (rAAV) vectors (Urabe et al., 2002, Hum. Gene Ther. 13: pp. 1935-1943; U.S. Patent No. 6,723,551 and U.S. Patent Application Publication No. 20040197895). AAV can be considered one of the most promising viral vectors for human gene therapy. To date, two main platforms have emerged as the primary production systems capable of delivering research and clinical-grade AAV material. In both cases, an expression cassette containing replicase (Rep, DNA replication and packaging protein) and capsid (Cap, structural protein) coding genes is delivered to producer cells along with a to-be-packaged transgene adjacent to the AAV2 reverse terminal repeat sequence (ITR). One approach relies on transient chemical transfection of plasmids into Hek293 cells to deliver these components and produce AAV. In the second approach, a baculovirus expression vector (BEV) delivers these components to suspension cultures of invertebrate cells. While mammalian cell-based production systems for rAAV can produce high-titer AAV material, they are less suitable for scale-up. This is largely due to the high cost of plasmid production and the need to adapt Hek293 cells for growth in suspension and AAV production, and even then, the yield is not on the same order as with insect cells. In contrast, since baculoviruses, once produced and characterized, can be amplified with insect cells and grown in suspension before inoculation for AAV production, BEV production systems provide a more scalable platform for rAAV production. Generally, the yield per cell is comparable between suspended insect cells and adherent Hek293 cells.
[0004] The most frequently used method for generating rAAV in insect cells is the TripleBac system, which involves co-infection with three separate baculoviruses. These baculoviruses each contain a Rep, Cap, and transgene (Trans) expression cassette. A major drawback of using co-infection with three baculoviruses during rAAV generation is the possibility of non-simultaneous infection. By constructing baculovirus vectors each containing a dual expression cassette, referred to herein as the DuoBac system (each vector containing Cap and Rep or Cap and Trans, Figure 1), the number of different baculovirus vectors required for rAAV generation can be reduced, thereby improving the likelihood of simultaneous infection. This reduction in process complexity has several potential benefits: 1. Lower risk of contamination; 2. Higher average AAV yield in unpurified lysate bulk (CLB); 3. More robust baculovirus MOI response; 4. Increased compatibility with upscaling; 5. Lower commodity costs as one less seed virus is required; and 6. Reduced whole / complete ratio in AAV batches. All these benefits are brought about because the molecular components required for good AAV production are more likely to be present in the cells at the right time.
[0005] For AAV generation using baculoviruses in insect cells, optimizing Cap and Rep protein expression in terms of both timing and quantity is crucial for the quantity and quality of the AAV produced. Previously, it was observed that early Rep78 expression (replicating Rep) and late Rep52 expression (packaging Rep) improved the quality of the AAV produced (US Patent No. 8,697,417). By utilizing different baculovirus promoters that become active in different phases of infection, it is possible to exercise control over the timing of expression (Chaabihi, H. et al., 1993, J Virol 67(5), pp. 2664-71; Hill-Perkins, MS and Possee, RD, 1990, J Gen Virol 71(4), pp. 971-976; Pullen, SS and Friesen, PD, 1995, J Virol 69(1), pp. 156-65). The pre-early (IE) promoter is active immediately after the initial stages of baculovirus infection but then declines. Both the p10 and polyhedrin promoters are potent but late-stage promoters, with peak expression observed 20–24 hours after infection. By isolating the Rep52 and Rep78 expression cassettes and controlling their expression with different promoters, the inventors have better control over the individual strength and timing of the Rep proteins, thereby improving the quality of the AAV produced. Furthermore, in international application 2007 / 148971, the inventors significantly improved the stability of rAAV vector generation in insect cells by using a single coding sequence for the Rep78 and Rep52 proteins, where the Rep78 protein uses a suboptimal start codon that is partially skipped by scanning ribosomes, allowing translation initiation to occur even at the start codon of the downstream Rep52 protein. In international application 2009 / 014445, the stability of rAAV vector generation in insect cells is further improved by using separate expression cassettes for Rep52 and Rep78, where the repeating coding sequences have different codon biases to reduce homologous recombination.
[0006] The stoichiometric ratios of capsid proteins (VP1, VP2, and VP3) should be as close as possible to the native ratio of 1:1:10. Once the capsid enters the cell, VP1 possesses phospholipase A2 activity and is essential for endosomal escape. If this ratio deviates from its optimal value, the capsid becomes less potent; for example, low VP1 generally leads to reduced infectivity (measured by cell entry and transgene expression) but results in high-titer AAV production (gc / ml). The combination of selected capsid promoters and VP1 start codons exerts the greatest influence on this ratio and needs to be optimized for individual AAV serotypes. By mixing different promoter intensities and VP1 start codons, the VP1:2:3 ratio of the resulting capsid, and thus its titer, can be altered (Bosma, B. et al., 2018, Gene Ther 25(6), pp. 415-424). International application 2007 / 084773 discloses a method for generating rAAV in insect cells, which increases the production of infectious viral particles by supplementing VP1 with VP2 and VP3. The supplementation can be carried out by introducing a capsid vector containing nucleotide sequences expressing VP1, VP2, and VP3 into insect cells, and further introducing a nucleotide sequence expressing VP1, which may be on the same capsid vector or a different vector, into the insect cells.
[0007] In the past, baculovirus constructs containing dual-expression cassettes were designed for AAV serotype 1 (International Application 2009 / 104964). While these constructs presented improved whole / complete ratios and normal capsid stoichiometry, viral yields were roughly one-third of those produced by TripleBac AAV1. One explanation for the reduced yield may be the use of a single Rep expression cassette, where the timing of expression and the ratio of Rep52 to Rep78 were suboptimal. This likely led to high heterologous (non-AAV) DNA capsid inclusion in the particles and low yields. Therefore, there remains a need for means and methods to improve the quality and quantity of recombinant parvovirus gene therapy vectors such as rAAV. [Overview of the project]
[0008] In a first aspect, the present invention relates to a cell comprising one or more nucleic acid constructs comprising: i) a first expression cassette comprising a first promoter operably ligated to a nucleotide sequence encoding mRNA, wherein the translation of the first expression cassette in a cell produces at least one of the parvovirus Rep78 and 68 proteins; ii) a second expression cassette comprising a second promoter operably ligated to a nucleotide sequence encoding mRNA, wherein the translation of the second expression cassette in a cell produces at least one of the parvovirus Rep52 and 40 proteins; iii) a third expression cassette comprising a third promoter operably ligated to nucleotide sequences encoding parvovirus VP1, VP2 and VP3 capsid proteins; and iv) a nucleotide sequence comprising a transgene adjacent to at least one parvovirus reverse terminal repeat sequence; wherein at least one of the first and second expression cassettes is present in the first nucleic acid construct together with the third expression cassette, and after transfection of the cell with one or more nucleic acid constructs, the first promoter is active before the second and third promoters. Preferably, a nucleotide sequence containing a transgene adjacent to a parvovirus reverse terminal repeat sequence is located on top of a second nucleic acid construct. Preferably, the second nucleic acid construct further comprises a fourth expression cassette including a fourth promoter operably ligated to nucleotide sequences encoding parvovirus VP1, VP2, and VP3 capsid proteins, wherein the first promoter is active before the second, third, and fourth promoters, optionally the third and fourth promoters are identical, and optionally the parvovirus VP1, VP2, and VP3 capsid proteins encoded by the nucleotide sequences of the third and fourth expression cassettes are identical.
[0009] In a preferred embodiment, at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins contain a common amino acid sequence including the amino acid sequence from the second amino acid to the C-terminal amino acid of at least one of the parvovirus Rep52 and 40 proteins, where the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins are at least 90% identical, and the nucleotide sequences encoding the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and the nucleotide sequences encoding the common amino acid sequence of at least one of the parvovirus Rep52 and 40 proteins are less than 90% identical. Preferably, the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins are at least 99% identical, and preferably 100% identical. It is more preferable that a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep78 and 68 proteins has an improved codon use frequency bias for cells compared to a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep52 and 40, or that a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep52 and 40 proteins has an improved codon use frequency bias for cells compared to a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep78 and 68 proteins, and more preferably that the difference in codon adaptation indices between the nucleotide sequences encoding the common amino acid sequences in at least one of parvovirus Rep78 and 68 proteins and at least one of parvovirus Rep52 and 40 proteins is at least 0.2.
[0010] In one embodiment, the first promoter is a constitutive promoter.
[0011] In one embodiment, at least one of the second, third, and fourth promoters is an inducible promoter. Preferably, the inducible promoter is a viral promoter that is induced later in the viral infection cycle, preferably a viral promoter that is induced at least 24 hours after viral transfection or infection of cells.
[0012] In one embodiment, at least one of the first and second nucleic acid constructs is stably incorporated into the cell's genome.
[0013] In a preferred embodiment, the cells are insect cells, where at least one of the first and second nucleic acid constructs is an insect cell-compatible vector, preferably a baculovirus vector. Preferably in insect cells, a) the first promoter is selected from the deltaEl promoter and the El promoter; b) the second, third and fourth promoters are selected from the polH promoter and the p10 promoter. More preferably in insect cells, at least one expression cassette comprises at least one baculovirus enhancer element and / or at least one ecdysone response element, where the preferred enhancer element is selected from the group consisting of hr1, hr2, hr2.09, hr3, hr4, hr4b and hr5, preferably selected from the group hr2.09, hr4b and hr5.
[0014] In one embodiment, the nucleotide sequence encoding the mRNA, which is translated in a cell to produce at least one of the parvovirus Rep78 and Rep68 proteins, contains an intact parvovirus p19 promoter.
[0015] In preferred embodiments, at least one of the parvovirus Rep 78 and 68 proteins, at least one of the parvovirus Rep 52 and 40 proteins, the parvovirus VP1, VP2 and VP3 capsid proteins, and at least one parvovirus reverse terminal repeat sequence are derived from adeno-associated virus (AAV).
[0016] In one embodiment, the first nucleic acid construct is DuoBac CapRep6 (SEQ ID NO: 10), and the second nucleic acid construct is DuoBac CapTrans1 (SEQ ID NO: 12), where the first and second constructs are preferably present in a molar ratio of 3:1.
[0017] In a second aspect, the present invention relates to a method for generating recombinant parvovirus virions in cells, comprising the steps of: a) culturing cells as defined herein under conditions that generate recombinant parvovirus virions; and b) recovering the recombinant parvovirus virions. Preferably, in this method, the cells are insect cells and / or the parvovirus virions are AAV virions. In the preferred method, the recovery of recombinant parvovirus virions in step b) comprises at least one of affinity purification of the virions using an immobilized anti-parvovirus antibody, preferably a single-chain camel antibody or a fragment thereof, or filtration through a filter having a nominal pore size of 30 to 70 nm.
[0018] In a third aspect, the present invention relates to nucleic acid constructs as defined herein, more specifically to the first and second nucleic acid constructs as defined herein.
[0019] In a fourth aspect, the present invention relates to a kit of parts comprising at least the first and second nucleic acid constructs as defined herein. [Brief explanation of the drawing]
[0020] [Figure 1]The figure shows that in TripleBac AAV generation, three baculoviruses, including Rep, Cap, and transgene cassettes, co-infect expressSF+ insect cells. In contrast, in the DuoBac process, the Cap and Rep cassettes are combined on a single baculovirus genome, co-infecting expressSF+ insect cells with a separate baculovirus containing the transgene cassette. In the DuoDuoBac generation process, the Cap-Rep and Cap-Trans expression cassettes are combined on two baculoviruses, co-infecting expressSF+ cells. [Figure 2] Expression cassettes and orientations of Cap-Rep and Cap-Trans DuoBac baculovirus constructs used in the examples, and schematic diagrams of the single expression cassette baculovirus used. [Figure 3] This figure shows the viral titers measured by CLB for BacCap2 or BacCap3 DuoBac AAV generation. Generation was performed using a volume ratio of 5% Cap-Rep baculovirus conserved strain and 1% transgene conserved strain. High titers were obtained with constructs DuoBac CapRep2, 3, 4, and 7, while low titers were obtained with DuoBac CapRep1 and 6. [Figure 4] This figure shows the whole / perfect ratio for wtAAV5 and AAV2 / 5 DuoBac generation. A low whole / perfect ratio (<2) is observed for AAVs generated from all DuoBac constructs. These whole / perfect ratios are significantly lower than those typically observed in TripleBac AAV generation (whole / perfect >5, Table 2). [Figure 5] This figure shows the execution of SDS Page gels using purified AAV material prepared with DuoBac CapRep1-5. Construct DuoBac CapRep6 was not included due to low yield. DuoBac CapRep3 and DuoBac CapRep7 present the correct capsid stoichiometry of 1:1:10, while DuoBac CapRep2,4, and5 present suboptimal capsid stoichiometry (low VP1 for DuoBac CapRep2,4, and5, or very high VP1 for DuoBac CapRep1). [Figure 6] Figure showing the Gc / ip of AAVs generated by the DuoBac constructs DuoBac CapRep1-6. The infectivity of the generated AAVs reflects the stoichiometry of the VP123 capsid of the DuoBac constructs. Here, low VP1 results in low infectivity (high gc / ip) of DuoBac CapRep2, 4, and 5, while high or normal VP1 results in high infectivity (low gc / ip) of DuoBac CapRep3 and 1. [Figure 7] Figure showing the running of an SDS Page gel with purified AAV materials produced in the DuoBac and TripleBac production processes. The ideal stoichiometry of 1:1:10 capsid VP1, 2, 3 proteins for AAV was maintained after switching to the DuoBac process (lanes 1-2, 11, 13 vs. lanes 5-10, 12, 14). [Figure 8] Figure showing a comparison of the overall / complete ratios between DuoBac and TripleBac AAV production. [Figure 9] Figure showing the running of an SDS Page gel with purified DuoDuoBac and TripleBac produced AAVs. Similar VP123 stoichiometries of 1:1:10 were observed when comparing AAVs produced by the DuoDuoBac and TripleBac processes. [Figure 10] Figure showing the running of a formaldehyde gel with genomic AAV DNA obtained from AAVs produced by the DuoDuoBac or TripleBac production processes. AAVs produced using DuoDuoBac at different Rep:Cap ratios have similar genomic DNA packaged in the AAV particles. The DuoDuoBac AAV fragments match the DNA fragments found after TripleBac production. The main band is 2.4 kb in length and represents a single copy of the transgene. **Modes for Carrying Out the Invention**
[0021] definition Unless otherwise defined, technical and scientific terms used herein have the same meanings as those commonly understood by a person skilled in the art to which this disclosure belongs. A person skilled in the art will find many similar or equivalent methods and materials that may be used in the practice of the present invention. In fact, the present invention is not limited in any way to these methods.
[0022] In this document and its claims, the verb “includes” and its conjugations are used in their non-restrictive sense to mean that the items following the word are included, but not excluded, unless specifically mentioned. Furthermore, references to elements with the indefinite article “a” or “an” do not exclude the possibility that there are multiple elements unless the context clearly requires that there be one or just one element. Thus, the indefinite article “a” or “an” usually means “at least one.”
[0023] As used herein, the term "and / or" indicates that one or more of the specified cases may occur alone or together with all of at least one of the specified cases.
[0024] As used herein, “at least” a particular value means that particular value or more. For example, “at least two” is understood to be the same as “two or more,” i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, etc.
[0025] When the words "about" or "approximately" are used in relation to a number (for example, about 10), it preferably means that the value may be 0.1% greater or less than the given value (10).
[0026] The use of a substance as a medicine as described in this document may also be interpreted as the use of such substance in the manufacture of a medicine. Similarly, whenever a substance is used for therapeutic purposes or as a medicine, it may also be used for the manufacture of a medicine for therapeutic purposes. The medicinal products described herein may be used in therapeutic methods, where such therapeutic methods include the administration of the product for use.
[0027] The terms “homology” and “sequence identity” are used interchangeably herein. Herein, sequence identity is defined as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, determined by a comparison of sequences. In the art, “identity” also means the degree of sequence relationship between amino acid or nucleic acid sequences, and in some cases, the degree of sequence relationship determined by the agreement between strings of such sequences. “Similarity” between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions with the sequence of a second polypeptide. “Identity” and “similarity” can be readily calculated by known methods.
[0028] Sequence identity and sequence similarity can be determined by the alignment of two peptide or nucleotide sequences using a global or local alignment algorithm, depending on the lengths of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithm (e.g., Needleman-Wunsch) that optimally aligns the sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith-Waterman). Sequences can be said to be "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity (as defined below) (when they are optimally aligned by the program GAP or BESTFIT using default parameters, for example). GAP uses the Needleman-Wunsch global alignment algorithm to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. Global alignment is preferably used to determine sequence identity when two sequences have similar lengths. Generally, the default parameters for GAP are used, with a gap formation penalty of 50 (nucleotides) / 8 (proteins) and a gap elongation penalty of 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, pp. 915-919).Sequence alignment and scoring for percentage sequence identity can be determined using computer programs such as the GCG Wisconsin Package, version 10.3, available from Accelrys, Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open-source software such as the "needle" program (using the global Needleman-Wunsch algorithm) or "water" program (using the local Smith-Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as above for GAP, or default settings (for both "needle" and "water," and for both protein and DNA alignment, the default gap opening penalty is 10.0 and the default gap stretching penalty is 0.5; the default scoring matrix is Blossum62 for protein and DNAFull for DNA). When sequences have substantially different full lengths, local alignment, such as that using the Smith-Waterman algorithm, is preferred.
[0029] Alternatively, percentage similarity or identity can be determined by searching public databases using algorithms such as FASTA and BLAST. Therefore, the nucleic acid and protein sequences of the present invention can be further used as "query sequences" to perform searches against public databases to identify other family members or related sequences, for example. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul et al. (1990) J.Mol.Biol.215:403-4010. To obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecule of the present invention, a BLAST nucleotide search can be performed using the NBLAST program, score=100, and word length=12. To obtain amino acid sequences homologous to the protein molecule of the present invention, a BLAST protein search can be performed using the BLASTx program, score=50, and word length=3. For comparative purposes, gap alignment can be obtained using Gapped BLAST, as described by Altschul et al. (1997) Nucleic Acids Res. 25(17): pp. 3389-3402. When using the BLAST and Gapped BLAST programs, the default parameters of each program (e.g., BLASTx and BLASTn) can be used. Refer to the National Center for Biotechnology Information homepage at http: / / www.ncbi.nlm.nih.gov / .
[0030] As used herein, the terms “selectively hybridizing,” “selectively hybridizing,” and similar terms describe hybridization and washing conditions in which nucleotide sequences that are homologous to each other by at least 66%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, preferably at least 95%, more preferably at least 98%, or more preferably at least 99% remain hybridized to each other. That is, such hybridizing sequences may share at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% sequence identity.
[0031] A preferred, non-limiting example of such hybridization conditions is hybridization with 6 × sodium chloride / sodium citrate (SSC) at about 45°C, followed by one or more washes with 1 × SSC, 0.1% SDS at about 50°C, preferably about 55°C, preferably about 60°C, and even more preferably about 65°C.
[0032] High stringent conditions include, for example, hybridization with 5×SSC / 5×Denhart solution / 1.0%SDS at approximately 68°C and washing with 0.2×SSC / 0.1%SDS at room temperature. Alternatively, washing can be performed at 42°C.
[0033] Those skilled in the art will be aware of the conditions that should be applied to stringent and highly stringent hybridization conditions. Additional guidance on such conditions is readily available in the art, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, NY; and Ausubel et al. (eds.), Sambrook and Russell (2001), "Molecular Cloning: A Laboratory Manual (3rd Edition)," Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York; and 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, NY).
[0034] Naturally, polynucleotides that hybridize only with poly(A) sequences (such as the poly(A) pathway at the 3' end of mRNA) or only with complementary T (or U) residue segments are not included in the polynucleotides of the present invention used to specifically hybridize with a portion of the nucleic acids of the present invention. This is because such polynucleotides hybridize with any nucleic acid molecule containing a poly(A) segment or its complementary strand (e.g., practically any double-stranded cDNA clone).
[0035] In this specification, “nucleic acid construct” or “nucleic acid vector” is understood to mean an artificial nucleic acid molecule resulting from the use of recombinant DNA technology. Therefore, the term “nucleic acid construct” does not include naturally occurring nucleic acid molecules, although a nucleic acid construct may include (some) naturally occurring nucleic acid molecules. A “vector” is a nucleic acid construct (generally DNA or RNA) that serves to transfer an exogenous nucleic acid sequence (i.e., DNA or RNA) into a host cell. The term “expression vector” or “expression construct” refers to a nucleotide sequence that is capable of influencing the expression of a gene in a host cell or host organism that is compatible with such a sequence. These expression vectors generally contain at least one “expression cassette,” which is a functional unit capable of influencing the expression of a sequence encoding the product to be expressed, where the coding sequence is operably linked to a suitable expression regulatory sequence that includes a suitable transcriptional regulatory sequence and, optionally, at least a 3' transcription termination signal. Additional factors that are necessary or useful in influencing expression, such as expression enhancer elements, may be present. Expression vectors are introduced into suitable host cells and can influence the expression of the coding sequence in in vitro cell cultures of the host cells. Expression vectors are suitable for viral vectors, particularly recombinant AAV vectors, for replication in host cells or organisms according to the present invention.
[0036] As used herein, the terms “promoter” or “transcriptional regulatory sequence” refer to a nucleic acid fragment that functions to regulate the transcription of one or more coding sequences, and are structurally identified by the presence of any other DNA sequence, which is located upstream of the transcription start site of the coding sequence with respect to the direction of transcription and includes, but is not limited to, a binding site for DNA-dependent RNA polymerase, a transcription start site, and transcription factor binding sites, repressor and activating protein binding sites, and any other sequence of nucleotides known to those skilled in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A “constitutive” promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An “inducible” promoter is a promoter that is physiologically or developmentally regulated, for example, by the application of a chemical inducer or biological entity.
[0037] The term "reporter" can be used interchangeably with "marker," but it is primarily used to refer to visible markers such as green fluorescent protein (GFP) or luciferase.
[0038] The terms "protein" and "polypeptide" are used interchangeably and refer to molecules consisting of chains of amino acids, regardless of their specific mode of action, size, three-dimensional structure, or origin.
[0039] The term “gene” refers to a DNA fragment containing a region that is transcribed into an RNA molecule (e.g., mRNA) in a cell, operably ligated to a suitable regulatory region (e.g., a promoter). A gene typically consists of several operably ligated fragments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) containing polyadenylation sites. “Genetic expression” refers to the process by which a DNA region operably ligated to a suitable regulatory region, particularly a promoter, is transcribed into RNA that is biologically active, i.e., capable of being translated into a biologically active protein or peptide.
[0040] When used to describe the relationship between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, the term “homogeneous” is understood to mean that in nature, the nucleic acid or polypeptide molecule is produced by a host cell or organism of the same species, preferably the same variant or lineage. If homogeneous with the host cell, the nucleic acid sequence encoding the polypeptide is generally (but not necessarily) operably linked to a different (heterogeneous) promoter sequence in its natural environment, and, if applicable, to a different (heterogeneous) secretory signal sequence and / or terminator sequence. Regulatory sequences, signal sequences, terminator sequences, etc., are understood to be homogeneous with the host cell. In this regard, the use of “homogeneous” sequence elements alone enables the construction of “autocloning” genetically modified organisms (GMOs) (autocloning is defined herein as per European Directive 98 / 81 / EC Annex II). When used to describe the relationship between two nucleic acid sequences, the term “homogenetic” means that one single-stranded nucleic acid sequence can hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization can depend on several factors, including the amount of identity between sequences, as well as hybridization conditions such as temperature and salt concentration, which will be discussed later.
[0041] When used in reference to nucleic acids (DNA or RNA) or proteins, the terms “heterogeneous” and “exogenous” refer to nucleic acids or proteins that are not naturally present as part of the organism, cell, genome, or DNA or RNA sequence in which they exist, or that are found at a different location in the cell, genome, or DNA or RNA sequence than where they are found naturally. Heterogeneous and exogenous nucleic acids or proteins are not endogenous to the cell into which they are introduced, but are obtained from another cell, or are produced synthetically or recombinantly. Generally, though not always, such nucleic acids encode proteins that are not normally produced by the cell in which the DNA is transcribed or expressed, i.e., exogenous proteins. Similarly, exogenous RNA encodes proteins that are not normally expressed in the cell in which exogenous RNA exists. Heterogeneous / exogenous nucleic acids and proteins may also be called foreign nucleic acids or proteins. Any nucleic acid or protein that a person skilled in the art would recognize as foreign to the cell in which it is expressed is included herein in the term heterogeneous or exogenous nucleic acid or protein. The terms heterogeneous and exogenous also apply to unnatural combinations of nucleic acids or amino acid sequences, i.e., combinations in which at least two of the combination sequences are foreign to one another.
[0042] As used herein, the term “not naturally occurring” when used in reference to an organism means that the organism has at least one genetic alteration not normally found in naturally occurring lineages of the referenced species, including wild lineages of the referenced species. Genetic alterations include, for example, modifications introducing expressible nucleic acids encoding proteins or enzymes, additions of other nucleic acids, deletions, substitutions, or other functional disruptions of the organism’s genetic material. Such modifications include, for example, coding regions and functional fragments of heterologous or homologous polypeptides for the referenced species. Additional modifications include, for example, non-coding regulatory regions in which the modification alters the expression of a gene or operon. Genetic modifications to nucleic acid molecules encoding enzymes or functional fragments thereof can confer biochemical reaction capacity or metabolic pathway capacity to an organism not naturally occurring that is altered from its naturally occurring state.
[0043] As used herein, the term “operatably linked” refers to the functional linkage between polynucleotide (or polypeptide) elements. A nucleic acid is “operatably linked” when it is placed in a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence is operatably linked to a coding sequence if it affects the transcription of that coding sequence. Being operatably linked means that the linked DNA sequences are generally contiguous, and if it is necessary to connect two protein-coding regions, they are contiguous and within a reading frame.
[0044] An "expression cassette" refers to a nucleic acid sequence that includes an expression control sequence and a nucleic acid sequence to be expressed.
[0045] An "expression regulatory sequence" or "regulatory regulatory sequence" refers to a nucleic acid sequence that regulates the expression of a nucleotide sequence to which it is functionally ligated.
[0046] A regulatory sequence is "operably ligated" to a nucleotide sequence when it controls and regulates the transcription and / or translation of that nucleotide sequence. Thus, regulatory sequences can include promoters, enhancers, ribosome internal entry sites (IRESs), transcriptional terminators, pre-start codons for protein-coding genes, splicing signals for introns, and stop codons.
[0047] The term “expression regulatory sequence” includes, at a minimum, sequences designed so that their presence affects expression, and may also include additional beneficial components. For example, leader sequences and fusion partner sequences are expression regulatory sequences. The term may also include the design of nucleic acid sequences such that undesirable potential start codons inside or outside a frame are removed from the sequence. It may also include the design of nucleic acid sequences such that undesirable potential splice sites are removed. It includes sequences or polyadenylation sequences (pA) that instruct the addition of a string of adenine residues at the 3' end of mRNA, which are called poly-A tails, i.e., sequences called poly-A sequences. It may also be designed to enhance mRNA stability. Expression regulatory sequences that affect transcriptional and translational stability, such as promoters, and sequences that affect translation, such as Kozak sequences, are known in insect cells. Expression regulatory sequences may have properties that modulate the nucleotide sequence to which they are operably ligated so that lower or higher expression levels are achieved.
[0048] The term "complete virion" refers to a virion particle containing a parvovirus structure / capsid protein (VP1:2:3) that encapsulates the transgene DNA adjacent to the reverse terminal repeat (ITR) sequence. The term "empty virion" refers to a virion particle that does not contain parvovirus genomic material. In preferred embodiments of the present invention, the ratio of complete virions to empty virions is at least 1:50, more preferably at least 1:10, and even more preferably at least 1:1. Even more preferably, empty virions cannot be detected, and most preferably, empty virions do not exist. Those skilled in the art will know how to determine the ratio of complete virions to empty virions, for example, by dividing the number of gene copies by the total number of particles by the number of AAV capsids collected (or by all collected capsids:number of genome copies), since there is only one genome copy per virion. Those skilled in the art will know how to determine such a ratio. For example, the ratio of empty virions to total capsids can be determined by dividing the amount of genome copies (i.e., genome copy number) by the amount of total parvovirus particles (i.e., number of parvovirus particles), where the amount of genome copies per ml is measured by quantitative PCR, and the amount of total parvovirus particles per ml is measured, for example, by enzyme immunoassay from Progen.
[0049] As used herein, the term "TripleBac" refers to a system of baculovirus vectors for generating rAAV in insect cells that requires co-infection with three separate baculovirus vectors, i.e., three different baculovirus vectors for each of the Rep, Cap, and Trans expression cassettes. As used herein, the term "DuoBac" refers to a system using only two different baculovirus vectors, one of which contains two expression cassettes, e.g., a Cap and Rep expression cassette or a Cap and Trans cassette. As used herein, the term "DuoDuoBac" refers to a system using two different baculovirus vectors, each containing at least two different expression cassettes, e.g., one vector containing a Cap and Rep cassette and the other vector containing a Cap and Trans cassette.
[0050] [Detailed description of the invention] The expression dynamics and ratios between parvovirus (AAV), structural, and non-structural proteins are crucial for the yield and quality of vector production from production platforms, particularly those using baculovirus and insect cell platforms. Vector quality is strongly related to the ratio of complete virions to empty virions, which contributes to the potency of the vector itself.
[0051] The inventors further optimized rAAV production from baculovirus vectors in insect cells by one or more of the following: 1) using two DuoBac vectors, namely the Cap-Rep baculovirus vector and the Cap-Trans baculovirus vector (referred to as "DuoDuoBac" AAV production, see Figure 1); 2) optimizing the promoter / VP1 start codon combination; and 3) replacing a single Rep expression cassette with a dual Rep expression cassette. The advantage of using the DuoDuoBac system, in which the Cap-Rep baculovirus vector is combined with the Cap-Trans baculovirus vector, is that more control of the Cap:Rep ratio during AAV production is achieved. Previous TripleBac AAV production experiments have shown that changing the Cap:Rep baculovirus inoculation ratio affects the whole / complete ratio and AAV yield (gc / ml).
[0052] The inventors have found that increasing the amount of Rep during rAAV production suppresses capsid formation and the whole / complete ratio, while increasing the amount of Cap increases the whole / complete ratio and yield. As described above, those skilled in the art will see that the whole / complete ratio is one parameter that can be used to characterize an AAV batch. The whole / complete ratio, as used herein, refers to the ratio of DNA-filled AAV particles (expressed as gc / ml) to the total number of AAV particles (expressed as VP / ml). Consequently, a lower whole / complete ratio means fewer empty particles per complete particle, and vice versa. Reducing the whole / complete ratio of the AAV produced can be potentially beneficial for the AAV product, as fewer particles can be doped to achieve a similar amount of genomic copies per kilogram. A lower whole / complete ratio also results in a more uniform production profile, which is beneficial for setting up robust downstream processes.
[0053] Furthermore, because the number of baculoviruses used for inoculation is reduced, it is possible to explore higher Cap:Rep ratios that are not normally achievable with the TripleBac system. In the TripleBac system, a reduction in the number of baculoviruses used for inoculation also means a lower overall amount of baculovirus added to the production culture. It is known to those skilled in the art that adding high inoculations to AAV production has been undesirable. Firstly, it is difficult to robustly produce large quantities of baculovirus, and secondly, adding large quantities of baculovirus to AAV production inhibits its production. This is thought to be particularly due to the addition of large amounts of used culture medium to the production culture.
[0054] In a first aspect, the present invention therefore provides a cell comprising one or more nucleic acid constructs comprising: i) a first expression cassette comprising a first promoter operably ligated to a nucleotide sequence encoding mRNA, wherein its translation in a cell produces at least one of parvovirus Rep78 and 68 proteins; ii) a second expression cassette comprising a second promoter operably ligated to a nucleotide sequence encoding mRNA, wherein its translation in a cell produces at least one of parvovirus Rep52 and 40 proteins; iii) a third expression cassette comprising a third promoter operably ligated to nucleotide sequences encoding parvovirus VP1, VP2 and VP3 capsid proteins; and iv) a nucleotide sequence comprising a transgene adjacent to at least one parvovirus reverse-terminal repeat sequence, wherein at least one of the first and second expression cassettes is present in the first nucleic acid construct together with the third expression cassette, and after transfection of the cell with one or more nucleic acid constructs, the first promoter is active before the second and third promoters. The cells are preferably insect cells, for example, as defined below herein. The nucleotide sequence encoding mRNA that produces at least one of the parvovirus Rep52 and 40 proteins or at least one of the parvovirus Rep78 and 68 proteins is preferably the nucleotide sequence described below herein. The nucleotide sequence encoding the parvovirus VP1, VP2 and VP3 capsid proteins is preferably the nucleotide sequence described below herein. Nucleotide sequences containing transgenes adjacent to one or more parvovirus reverse-terminal repeat sequences are described in further detail below. Thus, the first nucleic acid construct is preferably a single type of nucleic acid construct comprising each of the first, second and third expression cassettes. In one embodiment, the first nucleic acid construct does not contain transgenes adjacent to one or more parvovirus reverse-terminal repeats.
[0055] Therefore, in one embodiment, a nucleotide sequence containing a transgene adjacent to the parvovirus reverse terminal repeat sequence is located on top of a second nucleic acid construct. The second nucleic acid construct is preferably different from the first nucleic acid construct.
[0056] In a preferred embodiment, the second nucleic acid construct further comprises a fourth expression cassette including a fourth promoter operably ligated to nucleotide sequences encoding parvovirus VP1, VP2, and VP3 capsid proteins, wherein the first promoter is active before the second, third, and fourth promoters. Preferably, the parvovirus VP1, VP2, and VP3 capsid proteins encoded by the nucleotide sequences of the third and fourth expression cassettes are identical. The third and fourth promoters may be identical or they may be different promoters.
[0057] Suitable promoters to be applied as the first, second, third and / or fourth promoters in the construct of the present invention are described in more detail below.
[0058] Replicase protein Parvovirus, particularly AAV, replicases, or Rep proteins, are non-structural proteins encoded by the rep gene cassette. Due to the endogenous P19 promoter, this gene produces two duplicated messenger ribonucleic acids (mRNAs) of different lengths. Each of these mRNAs can be spliced out or ultimately fail to produce four Rep proteins: Rep78, Rep68, Rep52, and Rep40. Rep78 / 68 and Rep52 / 40 are crucial for ITR-dependent AAV genome or transgene replication and viral particle assembly. Rep78 / 68 acts as a viral replication initiator protein and functions as a replicase for the viral genome (Chejanovsky, N., Carter, BJ. Mutation of a consensus purine nucleotide consensus binding site in the adeno-associated virus rep gene generates a dominant negative phenotype for DNA replication, J Virol., 1990, 64:1764-1770; Hong, G., Ward, P., Berns, KI. In vitro replication of adeno-associated virus DNA, Proc Natl Acad Sci USA, 1992, 89:4673-4677; Ni.TH. et al. In vitro replication of adeno-associated virus DNA, J Virol., 1994, 68:1128-1138).Rep52 / 40 proteins are DNA helicases with 3'-5' polarity and play a crucial role in the packaging of viral DNA into empty capsids, where they are thought to be part of the packaging motility complex (The Rep52 Gene Product of Adeno-Associated Virus Is a DNA Helicase with 3'-5' Polarity; Smith and Kotin, J. Virol., 1998, pp. 4874-4881; DNA helicase-mediated packaging of adeno-associated virus type 2 genomes into preformed capsids; King, JA et al., EMBO J., 2001, 20:3282-3291). The presence of both Rep68 and Rep40 is not a requirement for generating AAV from baculovirus and insect cell platforms (Urabe, et al., 2002).
[0059] According to the present invention, a cell comprises a first nucleic acid construct comprising at least first and second expression cassettes for the expression of parvovirus Rep proteins. The first expression cassette comprises a first promoter operably ligated to a nucleotide sequence encoding mRNA, and its translation in the cell produces at least one of parvovirus Rep78 and 68 proteins.
[0060] In a preferred embodiment, the first expression cassette comprises a first promoter operably ligated to a nucleotide sequence encoding mRNA, and its translation in a cell produces only one of the parvovirus Rep78 and 68 proteins. Thereafter, it is understood that the nucleotide sequence encoding the parvovirus Rep78 and / or 68 protein encodes an open reading frame for the parvovirus Rep78 and / or 68 protein, which does not have suboptimal translational initiations affecting partial exon skipping, so that the Rep52 and / or 40 protein is also translated from the mRNA (see below). Preferred nucleotide sequences that encode mRNA for use in the present invention, whose translation in cells produces at least one of the parvovirus Rep78 and 68 proteins, can be defined as: a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 50, 60, 70, 80, 88, 89, 90, 95, 97, 98 or 99% sequence identity with the amino acid sequence of SEQ ID NO: 18; b) a nucleotide sequence having at least 50, 60, 70, 80, 81, 82, 85, 90, 95, 97, 98 or 99% sequence identity with the nucleotide sequence at positions 11-1876 of SEQ ID NO: 19; c) a nucleotide sequence whose complementary strand hybridizes to the nucleic acid molecule sequence of (a) or (b); and d) a nucleotide sequence whose sequence differs from the sequence of the nucleic acid molecule of (c) for the sake of synonymy of the gene code. It is understood that these Rep78 / 60 coding sequences may or may not encode suboptimal translation initiations.
[0061] Therefore, the first nucleic acid construct further comprises a second expression cassette for the expression of parvovirus Rep52 and / or 40 proteins. The second expression cassette comprises a second promoter operably ligated to a nucleotide sequence encoding mRNA, the second promoter whose translation in a cell produces at least one of the parvovirus Rep52 and 40 proteins.
[0062] In a preferred embodiment, the second expression cassette comprises a second promoter operably ligated to a nucleotide sequence encoding mRNA, and its translation in a cell produces only one of the parvovirus Rep52 and 40 proteins. Thereafter, the nucleotide sequence encoding the parvovirus Rep52 and / or 40 protein is understood not to be part of a larger coding sequence that also encodes the parvovirus Rep78 and / or 68 protein. Preferably, the nucleotide sequence encoding mRNA, which produces only one of the parvovirus Rep52 and 40 proteins, comprises an open reading frame consisting of an amino acid sequence from the translation start codon to the most C-terminal amino acid of at least one of the parvovirus Rep52 and 40 proteins, and more preferably, this open reading frame is the only open reading frame contained within the nucleotide sequence encoding mRNA. Preferred nucleotide sequences encoding mRNA that, when translated in a cell, produces at least one of the parvovirus Rep52 and 40 proteins for use in the present invention, can be defined as: a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 50, 60, 70, 80, 88, 89, 90, 95, 97, 98 or 99% sequence identity with the amino acid sequence of SEQ ID NO: 20; b) a nucleotide sequence having at least 50, 60, 70, 80, 81, 82, 85, 90, 95, 97, 98 or 99% sequence identity with any one of the nucleotide sequences of SEQ ID NOs: 21 to 25; c) a nucleotide sequence whose complementary strand hybridizes to the nucleic acid molecule sequence of (a) or (b); and d) a nucleotide sequence whose sequence differs from the nucleic acid molecule sequence of (c) for the sake of synonymy of the gene code.
[0063] Preferably, the nucleotide sequence encodes a parvovirus Rep protein that is required and sufficient for parvovirus vector production in insect cells.
[0064] In one embodiment, potential false translation initiation sites in the Rep protein coding sequence, other than the Rep78 and Rep52 translation initiation sites, are excluded. In one embodiment, putative splice sites that can be recognized in insect cells are excluded from the Rep protein coding sequence. The exclusion of these sites will be readily apparent to those skilled in the art.
[0065] In a further embodiment, at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins include a common amino acid sequence comprising the amino acid sequence from the second amino acid to the most C-terminal amino acid of at least one of the parvovirus Rep52 and 40 proteins, and the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins comprises at least 9 The nucleotide sequences encoding at least one common amino acid sequence among parvovirus Rep78 and 68 proteins, and the nucleotide sequences encoding at least one common amino acid sequence among parvovirus Rep52 and 40 proteins, are 0, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical, and are 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, or less than 60% identical.
[0066] In one embodiment, a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep78 and 68 proteins has an improved codon use frequency bias for cells compared to a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep52 and 40, or a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep52 and 40 proteins has an improved codon use frequency bias for cells compared to a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep78 and 68 proteins. In a further embodiment, the difference in codon adaptation indices between the nucleotide sequences encoding common amino acid sequences in at least one of parvovirus Rep78 and 68 proteins and at least one of parvovirus Rep52 and 40 proteins is at least 0.2.
[0067] The adaptability of a nucleotide sequence encoding a common amino acid sequence to the codon usage frequency of a host cell can be expressed by a codon adaptability index (CAI). Preferably, the codon usage frequency is adapted to insect cells expressing the Rep protein having the common amino acid sequence. Typically, this is cells of the genus Spodoptera, more preferably Spodoptera fludiperda cells. Therefore, the codon usage frequency is preferably adapted to Spodoptera fludiperda or cells infected with Autographa californica nuclear polyhedron virus (AcMNPV). The codon adaptability index is defined herein as a measure of the relative adaptability of a gene's codon usage frequency to the codon usage frequency of a highly expressed gene. The relative adaptability (w) of each codon is the ratio of the usage frequency of each codon to that of the most abundant codon for the same amino acid. The CAI index is defined as the geometric mean of these relative adaptability values. Non-synonymous codons and termination codons (dependent on the gene code) are excluded. CAI values range from 0 to 1, with higher values indicating a higher proportion of the most abundant codons (Sharp and Li, 1987, Nucleic Acids Research 15: pp. 1281-1295; see also: Kim et al., Gene. 1997, 25 199: pp. 293-301; zur Megede et al., Journal of Virology, 2000, 74: pp. 2628-2635).
[0068] Preferably, the difference in codon adaptation indices between the nucleotide sequences encoding the common amino acid sequence in at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins is at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8, thereby, more preferably, the CAI of the nucleotide sequence encoding the common amino acid sequence in at least one of the parvovirus Rep52 and 40 proteins is at least 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0.
[0069] Therefore, in an alternative embodiment, at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins include a common amino acid sequence comprising the amino acid sequence from the second amino acid to the most C-terminal amino acid of at least one of the parvovirus Rep52 and 40 proteins, wherein the common amino acid sequences of at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins are at least 90% identical, and the nucleotide sequences encoding the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and the nucleotide sequences encoding the common amino acid sequence of at least one of the parvovirus Rep52 and 40 proteins are less than 90% identical, and A nucleotide sequence encoding at least one common amino acid sequence among the 68 proteins has an improved codon usage frequency bias for cells compared to a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep52 and 40, or a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep52 and 40 proteins has an improved codon usage frequency bias for cells compared to a nucleotide sequence encoding at least one common amino acid sequence among parvovirus Rep78 and 68 proteins, preferably the difference in codon adaptation indices between the nucleotide sequences encoding the common amino acid sequence in at least one of parvovirus Rep78 and 68 proteins and at least one of parvovirus Rep52 and 40 proteins is at least 0.2. Codon optimization of parvovirus Rep proteins will be discussed in further detail later.
[0070] Temperature optimization of the parvovirus Rep protein refers to using optimal conditions with respect to the temperature at which insect cells grow and the temperature at which Rep functions. The Rep protein may be optimally active at, for example, 37°C, and insect cells can grow optimally at 28°C. The temperature at which the Rep protein is active and insect cells grow may be 30°C. In preferred embodiments, the optimized temperature is higher than 27, 28, 29, 30, 31, 32, 33, 34, or 35°C, and / or lower than 37, 36, 35, 34, 33, 32, 31, 30, or 29°C.
[0071] As those skilled in the art will understand, the complete virion:empty virion ratio can also be improved by attenuated Cap expression, for example, by a weaker promoter, compared to moderate to high Rep expression.
[0072] In one embodiment, the nucleotide sequence encoding the mRNA whose translation in a cell produces at least one of the parvovirus Rep78 and 68 proteins includes, for example, an intact parvovirus p19 promoter as present in the native parvovirus nucleotide sequences encoding the parvovirus Rep78 and 68 proteins.
[0073] In one embodiment, the first and second expression cassettes in the first nucleic acid construct are optimized to obtain a desired molar ratio of Rep78 to Rep52 in (insect) cells. Preferably, the first nucleic acid construct yields a molar ratio of Rep78 to Rep52 in the range of 1:10 to 10:1, 1:5 to 5:1, or 1:3 to 3:1 in (insect) cells. More preferably, the first nucleic acid construct yields a molar ratio of Rep78 to Rep52 that is at least 1:2, 1:3, 1:5, or 1:10. The molar distribution ratio of Rep78 and Rep52 can preferably be determined by Western blotting using a monoclonal antibody that recognizes a common epitope of Rep78 and Rep52, or by Western blotting using, for example, a mouse anti-Rep antibody (303.9, Progen, Germany; dilution 1:50).
[0074] The desired molar ratio of Rep78 to Rep52 can be obtained by selecting promoters in the first and second expression cassettes, respectively, as further described below herein. Alternatively, or in combination, the desired molar ratio of Rep78 to Rep52 can be obtained by means of reducing the steady-state level of at least one of the parvovirus Rep78 and 68 proteins.
[0075] Therefore, in one embodiment, the nucleotide sequence encoding at least one mRNA of the parvovirus Rep78 and 68 proteins includes a modification that affects a reduced steady-state level of at least one of the parvovirus Rep78 and 68 proteins. The reduced steady-state condition can be achieved, for example, by truncating a regulatory element or upstream promoter (Urabe et al., op. cit., Dong et al., op. cit.), adding a proteolytic signal peptide, such as PEST or a ubiquitinated peptide sequence, by substituting the start codon with something less than optimal, or by introducing an artificial intron as described in International Application 2008 / 024998.
[0076] In preferred embodiments, the nucleotide sequence encoding at least one of the parvovirus Rep78 and Rep68 proteins includes an open reading frame beginning with a suboptimal translation start codon. The suboptimal start codon is preferably a start codon that affects partial exon skipping. Partial exon skipping is understood herein to mean that at least a portion of the ribosome does not begin translation at the suboptimal start codon of the Rep78 protein but can begin at a further downstream start codon, thereby preferably meaning that this further downstream (first) start codon is the start codon of the Rep52 protein. Alternatively, the nucleotide sequence encoding at least one of the parvovirus Rep78 and Rep68 proteins includes an open reading frame beginning with a suboptimal translation start codon and does not have a further downstream start codon. The suboptimal start codon preferably affects partial exon skipping after the expression of the nucleotide sequence in insect cells.
[0077] In this specification, the term “suboptimal start codon” refers not only to the trinucleotide start codon itself but also to the context in which it occurs. Therefore, a suboptimal start codon can consist of an “optimal” ATG codon in a suboptimal context, such as a non-Kozak context. However, a suboptimal start codon is more preferable if the trinucleotide start codon itself is suboptimal, i.e., not ATG. In this specification, suboptimal is understood to mean that, compared to a normal ATG codon, the codon is less efficient at initiating translation in otherwise identical circumstances. Preferably, the efficiency of a suboptimal codon is less than 90, 80, 60, 40, or 20% of the efficiency of a normal ATG codon in otherwise identical circumstances. Methods for comparing the relative efficiency of translation initiation are known to those skilled in the art. Preferred suboptimal start codons can be selected from ACG, TTG, CTG, and GTG. ACG is more preferred. In this specification, the nucleotide sequence encoding a parvovirus Rep protein is understood to be a nucleotide sequence encoding a non-structural Rep protein, such as Rep78 and Rep52 proteins, which is required and sufficient for parvovirus vector production in insect cells.
[0078] Capsid protein The nucleotide sequence encoding the parvovirus capsid (Cap) protein is understood herein to include a nucleotide sequence encoding one or more of the three parvovirus capsid proteins, VP1, VP2, and VP3. The parvovirus nucleotide sequence is preferably derived from a depend virus, more preferably from a human or monkey adeno-associated virus (AAV), most preferably from an AAV that typically infects humans (e.g., serotypes 1, 2, 3A, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13) or primates (e.g., serotypes 1 and 4), the nucleotide and amino acid sequences of which are fully incorporated herein by reference in Lubelski et al., U.S. Patent Application Publication 2017356008. Accordingly, the nucleic acid construct according to the present invention may include the full open reading frame of the AAV capsid protein, as disclosed in Lubelski et al., U.S. Patent Application Publication 2017356008. Alternatively, the sequence may be artificial, for example, in a hybrid form, or codon-optimized by using codons from, for example, AcmNPv or Spodoptera fludiperda. For example, the capsid sequence may consist of the VP2 and VP3 sequences of AAV1, while the remainder of the VP1 sequence is from AAV5. Preferred capsid proteins are AAV5 or AAV8, provided in SEQ ID NO: 26, as published in Lubelski et al., U.S. Patent Application Publication No. 2017356008. Thus, in preferred embodiments, the AAV capsid protein is the AAV serotype 5 or AAV serotype 8 capsid protein modified according to the present invention. More preferably, the AAV capsid protein is the AAV serotype 5 capsid protein modified according to the present invention. It is understood that the exact molecular weight of the capsid protein and the exact position of the translation start codon may differ among different parvoviruses. However, those skilled in the art will know how to identify the corresponding positions in the nucleotide sequences of AAV5 and other parvoviruses. Alternatively, the sequence encoding the AAV capsid protein may be an artificial sequence, for example, the result of directional evolution experiments.This may include the construction of a capsid library through DNA shuffling, mutagenic PCR, bioinformatics rational design, and site-saturated mutagenesis. The resulting capsids may be based on existing serotypes but contain various amino acid or nucleotide changes that enhance the characteristics of such capsids. The resulting capsids may be combinations of various parts of existing serotypes, "shuffled capsids," or may contain completely novel changes, i.e., additions, deletions, or substitutions of one or more amino acids or nucleotides, organized into groups or extending throughout the full length of a gene or protein. For example, see Schaffer and Maheshri; Proceedings of the 26th Annual International Conference of the IEEE EMBS San Francisco, CA, USA; September 1-5, 2004, pp. 3520-3523; Asuri et al., 2012, Molecular Therapy 20(2): pp. 329-3389; Lisowski et al., 2014, Nature 506(7488): pp. 382-386.
[0079] In a preferred embodiment of the present invention, the open reading frame encoding the VP1 capsid protein begins with an unconventional translation start codon selected from the group consisting of ACG, ATT, ATA, AGA, AGG, AAA, CTG, CTT, CTC, CTA, CGA, CGC, TTG, TAG, and GTG. Preferably, the unconventional translation start codon is selected from the group consisting of GTG, CTG, ACG, and TTG, and more preferably the unconventional translation start codon is CTG.
[0080] The nucleotide sequences of the present invention for the expression of AAV capsid proteins more preferably comprise at least one modification of the nucleotide sequence encoding the AAV VP1 capsid protein, selected from G at nucleotide position 12, A at nucleotide position 21, and C at nucleotide position 24 of the VP1 open reading frame, where the nucleotide positions correspond to the nucleotide positions of the wild-type nucleotide sequence. “Potential / possible false start site” or “potential / possible false translation start codon” is understood herein to mean an in-frame ATG codon located in the coding sequence of the capsid protein(s). The elimination of potential false start sites for translation in other serotype VP1 coding sequences will be well understood by those skilled in the art, as is the elimination of putative splice sites that can be recognized in insect cells. For example, since nucleotide T does not produce a false ATG codon, the modification of the nucleotide at position 12 is not required for recombinant AAV5. Specific examples of nucleotide sequences encoding parvovirus capsid proteins are given in SEQ ID NOs: 27-29. The nucleotide sequences encoding the parvovirus Cap and / or Rep proteins of the present invention can also be defined by their ability to hybridize to the nucleotide sequences of SEQ ID NOs. 27-29 and 21-25, respectively, under mild, or preferably stringent, hybridization conditions.
[0081] Capsid protein coding sequences can exist in various forms. For example, separate coding sequences can be used for each of the capsid proteins VP1, VP2, and VP3, thereby operably linked each coding sequence to an expression control sequence for expression in insect cells. However, more preferably, the second expression cassette comprises a nucleotide sequence containing a single open reading frame encoding all three parvovirus (AAV) VP1, VP2, and VP3 capsid proteins, where the start codon for translation of the VP1 capsid protein is a suboptimal start codon other than ATG, as described, for example, in Urabe et al. (2002, op. cit.) and International Application 2007 / 046703. The suboptimal start codon for the VP1 capsid protein may be as defined above for the Rep78 protein. More preferred suboptimal start codons for the VP1 capsid protein can be selected from ACG, TTG, CTG, and GTG, of which CTG and ACG are most preferred.
[0082] In an alternative embodiment, the second expression cassette comprises a nucleotide sequence containing a single open reading frame encoding all three parvovirus (AAV) VP1, VP2, and VP3 capsid proteins, where the start codon for translation of the VP1 capsid protein is ATG, and the mRNA encoding the VP1 capsid protein encoded in the nucleotide sequence comprises an alternative start codon outside the frame of the VP1 capsid protein in the open reading frame (as described in International Application 2019 / 016349). Preferably, the alternative start codon is selected from the group consisting of CTG, ATG, ACG, TTG, GTG, CTC, and CTT, of which ATG is preferred. Preferably, the AAV capsid protein is the AAV5 serotype capsid protein. In this embodiment, preferably, the nucleotide sequence comprises an alternative open reading frame beginning with an alternative start codon containing the ATG translation start codon for VP1, thereby preferably, the alternative open reading frame following the alternative start codon encoding a peptide of up to 20 amino acids.
[0083] The nucleotide sequences contained in the second expression cassette for capsid protein expression may further include one or more modifications as described in International Application 2007 / 046703. Various further modifications of the VP coding region are known to those skilled in the art, which may increase the yield of VP and virions, or have other desired effects such as altering the tropism or reducing the antigenicity of virions. These modifications are within the scope of the present invention.
[0084] In one embodiment, VP1 expression is increased compared to the expression of VP2 and VP3. As described in International Application 2007 / 084773, VP1 expression can be increased by supplementing VP1, by introducing a single vector containing the nucleotide sequence for VP1 into insect cells.
[0085] Generally, the method of the present invention includes at least one open reading frame comprising at least one open reading frame comprising at least one open reading frame comprising at least one nucleotide sequence encoding VP1, VP2, and VP3 capsid proteins, or an open reading frame comprising at least one of Rep78 and Rep68 proteins. In one embodiment, the at least one open reading frame comprising an open reading frame comprising at least one nucleotide sequence encoding VP1, VP2, and VP3 capsid proteins, or at least one of Rep78 and Rep68 proteins, does not contain artificial introns (or sequences derived from artificial introns). That is, at least one open reading frame used to encode a Rep or VP protein does not contain artificial introns. An artificial intron means an intron that does not naturally exist in the adeno-associated virus Rep or Cap sequence, for example, an intron that has been engineered to allow functional splicing in insect cells. Therefore, in this context, artificial introns include wild-type insect cell introns. The expression cassette of the present invention may include naturally truncated intron sequences (meaning sequences naturally present in adeno-associated viruses) - such sequences do not fall under the category of artificial introns as defined herein.
[0086] In the present invention, one possibility is that neither the open reading frame containing nucleotide sequences encoding VP1, VP2, and VP3 capsid proteins, nor the open reading frame containing nucleotide sequences encoding at least one of the Rep78 and Rep68 proteins, contains artificial introns.
[0087] promoter Preferably, the nucleotide sequence of the present invention encoding the AAV protein is operably ligated to an expression regulatory sequence for expression in insect cells. These expression regulatory sequences include at least a promoter that is active in insect cells.
[0088] Suitable promoters to be used as third and / or fourth promoters for controlling the transcription of the nucleotide sequence of the present invention encoding the parvovirus capsid protein are, for example, the polyhedron promoter (polH), provided in SEQ ID NO: 30, and its abbreviated version, SEQ ID NO: 31, disclosed in, for example, Lubelski et al., U.S. Patent Application Publication No. 2017356008. However, other promoters that are active in insect cells and can be selected by the present invention are known in the art, for example, the polyhedrin (polH) promoter, the p10 promoter, the p35 promoter, the 4xHsp27 EcRE+minimal Hsp70 promoter, the deltaE1 promoter, the E1 promoter or IE-1 promoter, and further promoters described in the above references. In one embodiment, the promoter for the transcription of the nucleotide sequence of the present invention encoding the AAV capsid protein is p10 or polH. In a further embodiment, the promoter for the transcription of the nucleotide sequence of the present invention encoding the AAV capsid protein is p10. In an alternative embodiment, the promoter for transcription of the nucleotide sequence of the present invention encoding the AAV capsid protein is polH.
[0089] These promoters described above can also be used as first and second promoters for controlling the transcription of the nucleotide sequence of the present invention encoding the parvovirus Rep protein. In one embodiment, the first promoter is a constitutive promoter. As used herein, the terms “promoter” or “transcriptional regulatory sequence” refer to a nucleic acid fragment that performs the function of controlling the transcription of one or more coding sequences, and are structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, a transcription initiation site and any other DNA sequence, located upstream of the transcription initiation site of the coding sequence with respect to the transcription direction, and including, but not limited to, a transcription factor binding site, a repressor and an activating protein binding site, and any other sequence of nucleotides known to those skilled in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A “constitutive” promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An “inducible” promoter is a promoter that is physiologically or developmentally regulated, for example, by the application of a chemical inducer. A “tissue-specific” promoter is active only in specific types of tissues or cells. A “cryptic promoter” is an epigenetically silenced promoter that can be activated.
[0090] In a preferred embodiment, the expression ratio of Rep78 protein to Rep52 protein is regulated by: (a) the second promoter being more potent than the first promoter, as determined by, for example, reporter gene expression (e.g., luciferase or SEAP) or Northern blotting; (b) the presence of nucleotide spacers or more and / or more potent enhancer elements upstream of the second expression cassette compared to the first expression cassette; (c) the nucleotide sequence encoding the parvovirus Rep52 protein having a higher codon adaptation index compared to the nucleotide sequence encoding the Rep78 protein; (d) temperature optimization of the parvovirus Rep protein; and one or more variant Rep proteins having one or more amino acid sequence changes compared to the corresponding wild-type Rep protein, where one or more amino acid changes result in increased Rep functional activity, as investigated by detecting increased AAV production in insect cells. As investigated by detecting increased AAV production in insect cells, methods for generating, selecting, and / or screening variant Rep proteins with increased Rep functional activity are obtained by adapting to insect cells the method described in U.S. Patent Application Publication No. 20030134351 for obtaining variant Rep proteins with increased function with respect to AAV production in mammalian cells. Variant Rep proteins having one or more changes in the amino acid sequence compared to the corresponding wild-type Rep protein are understood herein to include Rep proteins having one or more amino acid substitutions, insertions, and / or deletions in the variant amino acid sequence compared to the amino acid sequence of the corresponding wild-type Rep protein.
[0091] The second promoter being more potent than the first promoter means that the nucleotide sequence encoding the Rep52 protein is expressed more than the nucleotide sequence encoding the Rep78 protein. Since the expression of the Rep52 protein subsequently increases compared to the expression of the Rep78 protein, equally potent promoters can be used. The strength of the promoters can be determined by the expression obtained under the conditions used in the method of the present invention. In one embodiment, at least one of the second, third, and fourth promoters is an inducible promoter, preferably selected from polH and p10. In a further embodiment, the inducible promoter is a viral promoter that is induced later in the viral infection cycle, preferably a viral promoter that is induced at least 24 hours after viral transfection or infection of cells.
[0092] In one embodiment, the first promoter is selected from the deltaEl promoter and the El promoter; the second, third, and fourth promoters are selected from the polH promoter or the p10 promoter. In a further embodiment, the first promoter is deltaE1 and the second promoter is polH.
[0093] Using the same baculovirus promoter twice in the same baculovirus construct to activate separate AAV genes can lead to competition between promoters. This competition results in reduced expression of Cap and Rep genes, thereby reducing AAV yield. Proximity of similar elements in the expression cassette can potentially enhance this effect. Attenuated gene expression can be improved by using a stronger start codon or by changing the promoter that activates the capsid protein (e.g., from polH to P10). Therefore, in a preferred embodiment, the first, second, and third promoters are different promoters, and more preferably, the first, second, third, and fourth promoters are different promoters.
[0094] Enhancer An "enhancer element" or "enhancer" is defined as a sequence that enhances promoter activity (i.e., increases the transcription rate of sequences downstream of the promoter), does not possess promoter activity in contrast to the promoter, and can function regardless of its position relative to the promoter (i.e., upstream or downstream of the promoter). Enhancer elements are well known in the art. Non-limiting examples of enhancer elements (or parts thereof) that can be used in the present invention include baculovirus enhancers and enhancer elements found in insect cells. It is preferable that the enhancer element increases the mRNA expression of a gene to which the promoter is operably linked in the cell by at least 25%, more preferably at least 50%, even more preferably at least 100%, and most preferably at least 200% compared to the mRNA expression of the gene in the absence of the enhancer element. mRNA expression can be determined, for example, by quantitative RT-PCR.
[0095] In this specification, it is preferable to use enhancer elements to enhance the expression of parvovirus Rep proteins. Accordingly, in one embodiment, at least one expression cassette comprises at least one baculovirus enhancer element and / or at least one ecdysone response element, the preferred enhancer element being selected from the group consisting of hr1, hr2, hr3, hr4 and hr5. Preferably, the enhancer element is responsive to the baculovirus pre-initial protein (IE1) or its splice variant (IE0), such as the baculovirus homologous region (hr) enhancer element, and preferably the baculovirus is Autographa californica multicapsid polyhedrosis virus. IE1 is a highly conserved 67kDa DNA-binding protein that transactivates the baculovirus early gene promoter in plasmid transfection assays, supporting late gene expression (see, e.g., Olson et al., 2002, J Virol., 76:9505-9515). AcMNPV IE1 possesses separable domains that contribute to promoter transactivation and DNA binding. The N-terminal half of this 582-residue phosphoprotein contains transcription-stimulating domains at residues 8-118 and 168-222. IE1 binds to an approximately 28-bp incomplete palindrome (28mer) that constitutes a repeating sequence within multiple homologous regions (hr) found distributed throughout the AcMNPV genome. The hr 28mer is the minimal sequence motif required for IE1-mediated enhancer and origin-specific replication function.
[0096] In one embodiment, the hr enhancer element is an hr enhancer element other than hr2-0.9 (U.S. Patent Application Publication 2012 / 100606). In a further embodiment, the hr enhancer element is selected from the group consisting of hr1, hr3, hr4b, and hr5, of which hr4b and hr5 are preferred, and hr4b is most preferred. In an alternative embodiment, the hr enhancer element is a variant hr enhancer element, such as an element designed not to exist in nature. The variant hr enhancer element preferably contains at least one copy of the hr28mer sequence CTTTACGAGTAGAATTCTACGCGTAAAA (SEQ ID NO: 32), and / or at least 18, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides identical to the sequence CTTTACGAGTAGAATTCTACGCGTAAAA (SEQ ID NO: 32), and preferably binds to the baculovirus IE1 protein, more preferably to the AcMNPV IE1 protein. A variant hr enhancer element is functionally defined, more preferably, when the variant element is operably ligated to an expression cassette containing a reporter gene operably ligated to a polH promoter, in that a) under non-inducible conditions, the cassette having the variant element produces less reporter transcript than the same expression cassette otherwise containing an hr2-0.9 element instead of the variant element, or the cassette having the variant element produces 1.1, 1.2, 1.5, 2, 5, or 1 / 10 of the amount of reporter transcript produced by the same expression cassette otherwise containing an hr4b element instead of the variant element; and b) under induced conditions, the cassette having the variant element produces at least 50, 60, 70, 80, 90, or 100% of the amount of reporter transcript produced by the same expression cassette otherwise containing an hr4b or hr2-0.9 element instead of the variant element.Non-inducible conditions are understood as conditions in which the IE1 protein is not present in the cells when the cassette is tested, while inducible conditions are understood as conditions in which sufficient IE1 protein is present to obtain maximum reporter expression with a reference cassette containing the hr4b or hr2-0.9 element. Binding of variant hr enhancer elements to the baculovirus IE1 protein can be analyzed using a transfer-shift assay, for example, as described by Rodems and Friesen (J Virol. 1995; 69(9): pp. 5368-75).
[0097] Viral vector This invention relates to the use of parvoviruses, particularly dependent viruses such as infectious human or monkey AAV, and their components (e.g., parvovirus genomes) as vectors for the introduction and / or expression of nucleic acids in mammalian cells, preferably human cells. In particular, this invention relates to improving the productivity of such parvovirus vectors when they are produced in insect cells.
[0098] The productivity associated with this includes an improvement in the production titer and an improvement in the quality of the resulting product, such as an improved whole-to-complete ratio (a measure of the number of particles containing nucleic acids). That is, the final product may have an increased proportion of filled particles, where filled means that the particles contain nucleic acids.
[0099] A “parvovirus vector” is defined as a recombinantly produced parvovirus or parvovirus particle containing polynucleotides that are delivered to a host cell in vivo, ex vivo, or in vitro. Examples of parvovirus vectors include, for example, adeno-associated virus vectors. In this specification, a parvovirus vector construct refers to the viral genome or a portion thereof, and polynucleotides containing the transgene. Viruses of the family Parvoviridae are small DNA viruses. The family Parvoviridae can be divided into two subfamilies: the subfamily Parvovirinae, which infects vertebrates, and the subfamily Densovirinae, which infects invertebrates, including insects. Members of the subfamily Parvovirinae are referred to herein as parvoviruses and include the genus Dependovirus. As can be inferred from their genus names, members of Dependovirus are unique in that they typically require co-infection with a helper virus, such as an adenovirus or herpesvirus, for proliferative infection in cell culture. The Dependovirus genus includes AAV, which typically infects humans (e.g., serotypes 1, 2, 3A, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 13) or primates (e.g., serotypes 1 and 4), and related viruses that infect other warm-blooded animals (e.g., adeno-associated viruses of cattle, dogs, horses, and sheep). Further information regarding parvoviruses and other members of the Parvoviridae family is found in Chapter 69, Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," of Fields Virology (3rd edition, 1996). While it is understood that the present invention is not limited to AAV and can be equally applied to other parvoviruses, for convenience, the present invention is further illustrated and described herein by reference to AAV.Therefore, in one embodiment, at least one of the parvovirus Rep78 and 68 proteins, at least one of the parvovirus Rep52 and 40 proteins, the parvovirus VP1, VP2 and VP3 capsid proteins, and at least one parvovirus reverse terminal repeat sequence are derived from AAV, preferably from a serotype that infects humans.
[0100] The genomic makeup of all known AAV serotypes is remarkably similar. The AAV genome is a linear, single-stranded DNA molecule less than approximately 5,000 nucleotides (nt) in length. Reverse terminal repeat sequences (ITRs) flank specific coding nucleotide sequences for unstructured replication (Rep) proteins and structural viral particle (VP) proteins. VP proteins (VP1, -2, and -3) form a capsid. The 145nt ITRs at the ends are self-complementary and configured to form energetically stable intramolecular double helices that form a T-shaped hairpin. These hairpin structures function as the starting point for viral DNA replication and act as primers for cellular DNA polymerase complexes. Following wild-type (wt) AAV infection in mammalian cells, Rep genes (i.e., Rep78 and Rep52) are expressed from the P5 promoter and P19 promoter, respectively, and both Rep proteins play a role in viral genome replication and packaging. Splicing events in Rep ORFs actually result in the expression of four Rep proteins (i.e., Rep78, Rep68, Rep52, and Rep40). However, unspliced mRNA encoding Rep78 and Rep52 proteins in mammalian cells has been shown to be sufficient for AAV vector generation. In insect cells as well, Rep78 and Rep52 proteins are sufficient for AAV vector generation. Three capsid proteins, VP1, VP2, and VP3, are expressed from a single VP read frame from the p40 promoter. wtAAV infection in mammalian cells depends on a combination of alternating use of two splice receptor sites and suboptimal use of the ACG start codon of VP2 for capsid protein generation.
[0101] A “recombinant parvovirus or AAV vector” (or “rAAV vector”) refers herein to a vector comprising one or more polynucleotide sequences of interest, a gene of interest, or a “transgene” flanked by at least one reverse terminal repeat (ITR) of parvovirus or AAV. Preferably, the transgene(s) are flanked by one ITR on each side. Such an rAAV vector can replicate and package into infectious viral particles when present in insect host cells expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). If an rAAV vector is incorporated into a larger nucleic acid construct (e.g., into a chromosome, or into another vector such as a plasmid or baculovirus used for cloning or transfection), the rAAV vector is generally referred to as a “provector” that can “rescue” by replication and capsid formation in the presence of AAV packaging function and necessary helper functions.
[0102] The nucleotide sequence of (ii) preferably includes an open reading frame containing a nucleotide sequence encoding at least one of the Rep78 and Rep68 proteins. Preferably, the nucleotide sequences are of the same serotype. More preferably, the nucleotide sequences differ from one another in that they may be codon-optimized, AT-optimized, or GC-optimized to minimize or inhibit recombination. Preferably, the first expression cassette includes two nucleotide sequences encoding the parvovirus Rep protein, i.e., a first nucleotide sequence and a second nucleotide sequence. Preferably, the difference in the first and second nucleotide sequences encoding the common amino acid sequence of the parvovirus Rep protein is maximized by one or more of the following (i.e., nucleotide identity is minimized): a) changing the codon bias of the first nucleotide sequence encoding the parvovirus Rep common amino acid sequence; b) changing the codon bias of the second nucleotide sequence encoding the parvovirus Rep common amino acid sequence; c) changing the GC content of the first nucleotide sequence encoding the common amino acid sequence; and d) changing the GC content of the second nucleotide sequence encoding the common amino acid sequence. Codon optimization can be performed based on the codon usage frequencies of insect cells, preferably Spodoptera fludiperda, used in the method of the present invention, as found in a codon usage frequency database (see, for example, http: / / www.kazusa.or.jp / codon / ). Suitable computer programs for codon optimization are available to those skilled in the art (see, for example, Jayaraj et al., 2005, Nucl. Acids Res. 33(9): pp. 3011-3016; and the Internet). Alternatively, optimization can be performed manually using the same codon usage frequency database.
[0103] Transgene In one embodiment, the present invention relates to a cell in which a nucleotide sequence containing a transgene adjacent to a parvovirus reverse terminal repeat sequence is present on a second nucleic acid construct (different from the first nucleic acid construct). In a preferred embodiment, the nucleotide sequence containing a transgene adjacent to a parvovirus reverse terminal repeat sequence is present on a second nucleic acid construct (different from the first nucleic acid construct).
[0104] In relation to the present invention, "at least one parvovirus reverse terminal repeat nucleotide sequence" is understood to mean a palindromic sequence containing largely complementary, symmetrically arranged sequences, also known as the "A," "B," and "C" regions. The ITR functions as an origin of replication, a site that plays a "cis" role in replication, i.e., a recognition site for trans-acting replication proteins such as Rep78 (or Rep68), and it recognizes the palindrom and specific sequences within the palindrom. One exception to the symmetry of the ITR sequence is the "D" region of the ITR. It is unique (it does not have a complement within a single ITR). Nicking of single-stranded DNA occurs at the junction between the A and D regions. This is the region where novel DNA synthesis begins. The D region is usually located on one side of the palindromic sequence and provides directionality to the nucleic acid replication steps. Parvoviruses that replicate in mammalian cells generally have two ITR sequences. However, it is possible to engineer the ITR such that the binding sites on both the A and D regions of the DNA are symmetrically located, with one on each side of the palindrome. On a double-stranded circular DNA template (e.g., a plasmid), nucleic acid replication assisted by Rep78 or Rep68 proceeds in both directions, and a single ITR is sufficient for parvovirus replication of the circular vector. Therefore, one ITR nucleotide sequence can be used in connection with the present invention. However, preferably, two or another even number of conventional ITRs are used. Most preferably, two ITR sequences are used. A preferred parvovirus ITR is the AAV ITR. More preferably, the AAV2 ITR is used. For safety reasons, it may be desirable to construct a recombinant parvovirus (rAAV) vector that cannot grow further after initial introduction into cells in the presence of a second AAV. Such a safety mechanism to limit undesirable vector proliferation in the recipient can be provided using an rAAV having a chimeric ITR described in U.S. Patent Application Publication No. 2003148506.
[0105] In this specification, the term “adjacent” with respect to a sequence being adjacent to another element(s) indicates the presence of one or more elements adjacent to the sequence upstream and / or downstream, i.e., at 5' and / or 3'. The term “adjacent” does not necessarily indicate that the sequence is contiguous. For example, there may be an intervening sequence between the nucleic acid encoding the transgene and the adjacent element. A sequence in which two other elements (e.g., ITRs) are “adjacent” indicates that one element is located at 5' of the sequence and the other at 3' of the sequence, but there may be an intervening sequence between them. In a preferred embodiment, the nucleotide sequence of (iv) is adjacent to a parvovirus reverse-terminal repeat nucleotide sequence on either side.
[0106] In embodiments of the present invention, a nucleotide sequence containing a transgene (encoding the gene product of interest) adjacent to at least one parvovirus ITR sequence is preferably incorporated into the genome of a recombinant parvovirus (rAAV) vector produced in insect cells. Preferably, the transgene encodes the gene product of interest for expression in mammalian cells. Preferably, the nucleotide sequence containing the transgene is adjacent to two parvovirus (AAV) ITR nucleotide sequences, and the transgene is located between the two parvovirus (AAV) ITR nucleotide sequences. Preferably, the nucleotide sequence encoding the gene product of interest (for expression in mammalian cells) is incorporated into a recombinant parvovirus (rAAV) vector produced in insect cells if it is located between two normal ITRs or on either side of an ITR engineered with two D regions.
[0107] The AAV sequences that can be used in this invention for the generation of recombinant AAV virions in insect cells can be derived from the genome of any AAV serotype. Generally, AAV serotypes have genomic sequences with considerable homology at the amino acid and nucleic acid levels, provide an identical set of gene functions, and generate virions that are essentially physically and functionally equivalent, replicating and assembling by virtually identical mechanisms. For an overview of the genomic sequences and genomic similarities of various AAV serotypes, see, for example, GenBank accession numbers U89790, J01901, AF043303, AF085716, Chlorini et al. (1997, J.Vir.71: pp. 6823-33); Srivastava et al. (1983, J.Vir.45: pp. 555-64); Chlorini et al. (1999, J.Vir.73: pp. 1309-1319); Rutledge et al. (1998, J.Vir.72: pp. 309-319); and Wu et al. (2000, J.Vir.74: pp. 8635-47). AAV serotypes 1, 2, 3, 4, and 5 are preferred sources of AAV nucleotide sequences for use in connection with the present invention. Preferably, the AAV ITR sequences for use in connection with the present invention are derived from AAV1, AAV2, AAV4 and / or AAV7. Similarly, the Rep(Rep78 / 68 and Rep52 / 40) coding sequences are preferably derived from AAV1, AAV2, AAV4 and / or AAV7. However, the sequences encoding the VP1, VP2 and VP3 capsid proteins for use in connection with the present invention may be obtained from any of the 42 known serotypes, more preferably from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 or AAV13, or from newly developed AAV-like particles obtained, for example, by capsid shuffling technology and AAV capsid libraries, or from newly and synthetically designed, developed or evolved capsids such as Anc-80 capsids.
[0108] AAV Rep and ITR sequences are conserved, particularly among most serotypes. Rep78 proteins from various AAV serotypes are, for example, over 89% identical, and the total nucleotide sequence identity at the genomic level between AAV2, AAV3A, AAV3B, and AAV6 is approximately 82% (Bantel-Schaal et al., 1999, J. Virol., 73(2):939-947). Furthermore, many AAV serotype Rep and ITR sequences are known to efficiently cross-complement (i.e., functionally substitute) for corresponding sequences from other serotypes in the generation of AAV particles in mammalian cells. U.S. Patent Application Publication 2003148506 reports that AAV Rep and ITR sequences efficiently cross-complement other AAV Rep and ITR sequences in insect cells.
[0109] The AAV capsid protein, also known as the VP protein, is known to determine the cytotropy of AAV virions. The VP protein coding sequence is not significantly conserved among different AAV serotypes compared to the Rep protein and gene. The ability of the Rep and ITR sequences to cross-complement the corresponding sequences of other serotypes allows for the creation of pseudotyped rAAV particles containing the capsid protein of one serotype (e.g., AAV3) and the Rep and / or ITR sequences of another AAV serotype (e.g., AAV2). Such pseudotyped rAAV particles are part of the present invention.
[0110] The modified "AAV" sequences can also be used in connection with the present invention, for example, for the production of rAAV vectors in insect cells. Such modified sequences include, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13ITR and a sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more nucleotide and / or amino acid sequence identity (e.g., a sequence having about 75-99% nucleotide sequence identity), and Rep or VP can be used in place of the wild-type AAV ITR, Rep, or VP sequence.
[0111] While similar in many respects to other AAV serotypes, AAV5 differs from other known human and monkey AAV serotypes more than other human and monkey AAV serotypes. Given this, the production of rAAV5 in insect cells may differ from the production of other serotypes. When the method of the present invention is used to produce rAAV5, in the case of multiple constructs, it is preferable that one or more constructs collectively include a nucleotide sequence containing the AAV5 ITR, a nucleotide sequence containing the AAV5 Rep coding sequence (i.e., the nucleotide sequence contains AAV5 Rep78). Such ITR and Rep sequences can be modified as desired to obtain efficient production of rAAV5 or pseudotyped rAAV5 vectors in insect cells. For example, to improve the production of rAAV5 vectors in insect cells, the start codon of the Rep sequence can be modified, the VP splice site can be modified or eliminated, and / or the VP1 start codon and nearby nucleotides can be modified.
[0112] Generally, the target gene product containing the ITR is 5,000 nucleotides (nt) or less in length. In another embodiment, oversized DNA molecules, i.e., those longer than 5,000 nt, can be expressed in vitro or in vivo using the AAV vectors described in this invention. Oversized DNA is understood here to be DNA that exceeds the maximum AAV packaging limit of 5.5 kbp. Therefore, the production of AAV vectors capable of generating recombinant proteins encoded by genomes typically larger than 5.0 kb is also feasible.
[0113] The nucleotide sequences comprising the transgenes defined herein may therefore include nucleotide sequences encoding a gene product of interest (for expression in mammalian cells) or nucleotide sequences targeting a gene of interest (for repressing the gene of interest in mammalian cells), and may be positioned to be incorporated into a recombinant parvovirus (rAAV) vector replicating in insect cells. In connection with the present invention, it is understood that human cells are particularly preferred mammalian cells for expressing or repressing the “gene product of interest.” Any nucleotide sequences may be incorporated for subsequent expression in mammalian cells transfected with the recombinant parvovirus (rAAV) vector produced by the present invention. The nucleotide sequences may, for example, encode proteins, or they may express RNAi agents, i.e., RNA molecules capable of RNA interference, such as shRNA (short hairpin RNA) or siRNA (short interfering RNA). "siRNA" refers to a small interfering RNA, which is a short, double-stranded RNA that is not toxic in mammalian cells (Elbashir et al., 2001, Nature 411: pp. 494-498; Caplen et al., 2001, Proc. Natl. Acad. Sci. USA 98: pp. 9742-47). In a preferred embodiment, the nucleotide sequence containing the transgene may contain two coding nucleotide sequences, each encoding one gene product of interest for expression in mammalian cells. Each of the two nucleotide sequences encoding the product of interest is positioned so that it is incorporated into a recombinant parvovirus (rAAV) vector that replicates in insect cells.
[0114] The product of interest for expression in mammalian cells may be a therapeutic gene product. The therapeutic gene product may be a polypeptide or RNA molecule (si / sh / miRNA) or other gene product that provides a desired therapeutic effect when expressed in target cells. The desired therapeutic effect may be, for example, removal of undesirable activity (e.g., VEGF), complementation of gene deficiencies, suppression of disease-causing genes, repair of enzyme activity deficiencies, or any other disease-modifying effect. Examples of therapeutic polypeptide gene products include, but are not limited to, growth factors, factors forming part of the coagulation cascade, enzymes, lipoproteins, cytokines, neurotrophic factors, hormones, and therapeutic immunoglobulins and their variants. Examples of therapeutic RNA molecule products include miRNAs effective in suppressing diseases, but are not limited to polyglutamine diseases, dyslipidemia, or amyotrophic lateral sclerosis (ALS).
[0115] The diseases that can be treated using the recombinant parvovirus (rAAV) vector produced by the present invention are not particularly limited, except for those that generally have a genetic cause or basis. For example, diseases that can be treated with the disclosed vector include, but are not limited to, acute intermittent porphyria (AIP), age-related macular degeneration, Alzheimer's disease, arthritis, Batten disease, Canavan disease, citrullinemia type 1, Kriglan-Najar, congestive heart failure, cystic fibrosis, Duchesne muscular dystrophy, dyslipidemia, glycogen storage disease type 1 (GSD-I), hemophilia A, hemophilia B, hereditary emphysema, homozygous familial hypercholesterolemia (HoFH), Huntington's disease (HD), Leber's congenital amaurosis, methylmalonic acidemia, and ornithine trachea. This may include scarbamylase deficiency (OTC), Parkinson's disease, phenylketonuria (PKU), spinal muscular atrophy, paralysis, Wilson's disease, epilepsy, Pompe disease, amyotrophic lateral sclerosis (ALS), Tay-Sachs disease, hyperoxaluria 9PH-1, spinocerebellar ataxia type 1 (SCA-1), SCA-3, u-dystrophin, Gaucher disease type II or III, arrhythmic right ventricular cardiomyopathy (ARVC), Fabry disease, familial brucellosis (FMF), propionic acidemia, fragile X syndrome, Rett syndrome, Niemann-Pick disease, and Krabbé disease. Examples of therapeutic gene products expressed include N-acetylglucosaminidase, alpha (NaGLU), Treg167, Treg289, EPO, IGF, IFN, GDNF, FOXP3, factor VIII, factor IX, and insulin.
[0116] Alternatively, as another gene product, the nucleotide sequence containing the transgene defined herein may further include a nucleotide sequence encoding a polypeptide that serves as a select marker protein for investigating cell transformation and expression. Suitable marker proteins for this purpose include, for example, the fluorescent protein GFP, and the select marker genes HSV thymidine kinase (for selection in HAT medium), bacterial hygromycin B phosphotransferase (for selection in hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection in G418), and dihydrofolate reductase (DHFR) (for selection in methotrexate), CD20, and the low affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for using them are provided in Sambrook and Russell cited above. Furthermore, the nucleotide sequence containing the transgene defined herein may, if deemed necessary, include further nucleotide sequences encoding a polypeptide that can serve as a fail-safe mechanism, enabling the healing of a target from cells transduced with the recombinant parvovirus (rAAV) vector of the present invention. Such nucleotide sequences, often called suicide genes, encode proteins that can be converted into prodrugs capable of killing transgenic cells expressing that protein. Preferred examples of such suicide genes include, for example, the Escherichia coli (E. coli) cytosine deaminase gene, or one of the thymidine kinase genes from herpes simplex virus, cytomegalovirus, and varicella-zoster virus, in which case ganciclovir can be used as a prodrug to kill transgenic cells in the target (see, e.g., Clair et al., 1987, Antimicrob. Agents Chemother. 31: pp. 844-849).
[0117] Various modifications of the nucleotide sequences specified herein, including, for example, wild-type parvovirus sequences, for proper expression in insect cells can be achieved, for example, by applying well-known genetic engineering techniques described in Sambrook and Russell (2001), "Molecular Cloning: A Laboratory Manual" (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York. Various further modifications of coding regions that may increase the yield of coding proteins are known to those skilled in the art. These modifications are within the scope of the present invention.
[0118] cell The cells according to the present invention may be any cells suitable for the production of heterologous proteins. Preferably, the cells are insect cells, more preferably insect cells that can replicate baculovirus vectors and be maintained in culture. More preferably, the insect cells can also replicate recombinant parvovirus vectors, including rAAV vectors. For example, the cell lines used may be from Spodoptera frugiperda, Drosophila cell lines, or mosquito cell lines, such as Aedes albopictus cell lines. Preferred insect cells or cell lines are cells from insect species susceptible to baculovirus infection, including, for example, S2 (CRL-1963, ATCC), Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, Ha2302, Hz2E5, High Five (Invitrogen, CA, USA), and expressSF+ (registered trademark) (U.S. Patent No. 6,103,526; Protein Sciences, Inc., CT, USA). Preferred insect cells according to the present invention are insect cells for the production of recombinant parvovirus vectors.
[0119] Those skilled in the art are aware of methods for stably introducing nucleotide sequences into insect genomes and for identifying cells having such nucleotide sequences in their genomes. Integration into the genome can be facilitated, for example, by the use of vectors containing nucleotide sequences that are highly homologous to regions of the insect genome. The use of specific sequences, such as transposons, is another method for introducing nucleotide sequences into the genome. Integration into the genome may involve one or more steps. Those skilled in the art will recognize that any reference to the term "integrated" also implies the term "stably integrated."
[0120] In one embodiment, a cell according to the present invention is provided, wherein at least one of the first and second nucleic acid constructs is stably incorporated into the cell's genome. In one embodiment, the first nucleic acid construct is stably incorporated into the cell's genome. In an alternative embodiment, the second nucleic acid construct is stably incorporated into the cell's genome. In a further embodiment, both the first and second nucleic acid constructs are stably incorporated into the cell's genome.
[0121] The growth conditions for insect cells in culture, and the generation of heterologous products in cultured insect cells, are well known in the art and are described, for example, in the above-mentioned references relating to the molecular engineering of insect cells (see also International Application 2007 / 046703).
[0122] An "insect cell-compatible vector" or "vector" is understood to be a nucleic acid molecule capable of proliferative transformation or transfection of an insect or insect cell. Exemplary biological vectors include plasmids, linear nucleic acid molecules, and recombinant viruses. Any vector can be used as long as it is compatible with insect cells. While vectors can be incorporated into the insect cell genome, the presence of the vector in the insect cell does not need to be permanent, and transient episomal vectors are also included. Vectors can be introduced by any known means, such as chemical treatment of cells, electroporation, or infection. In preferred embodiments, the vector is a baculovirus, a viral vector, or a plasmid. In more preferred embodiments, the vector is a baculovirus, i.e., the nucleic acid construct is a baculovirus expression vector. For baculovirus expression vectors and methods of use thereof, see, for example, Summers and Smith. 1986. A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures, Texas Agricultural Experimental Station Bull. No. 7555, College Station, Tex.; Luckow. 1991.The sources are Prokop et al., Cloning and Expression of Heterologous Genes in Insect Cells with Baculovirus Vectors' Recombinant DNA Technology and Applications, pp. 97-152; King, LA and RD. Possee, 1992, The baculovirus expression system, Chapman and Hall, United Kingdom; O'Reilly, DR., LK. Miller, VALuckow, 1992, Baculovirus Expression Vectors: A Laboratory Manual, New York; WH. Freeman and Richardson, CD, 1995, Baculovirus Expression Protocols, Methods in Molecular Biology, Vol. 39; U.S. Patent No. 4,745,051; U.S. Patent Application Publication No. 2003148506; and International Publication No. 03 / 074714.
[0123] The number of nucleic acid constructs used in insect cells for the production of recombinant parvovirus (rAAV) vectors is not limited in this invention. However, in preferred embodiments, two or fewer nucleic acid constructs are used in insect cells for the production of recombinant parvovirus (rAAV) vectors. Preferably, the two nucleic acid constructs are the first and second nucleic acid constructs defined herein. Preferably, the first nucleic acid construct is a Rep-Cap construct, and therefore preferably comprises first, second and third expression cassettes, thereby encoding the Rep78 / 68 protein and the Rep52 / 40 protein, respectively, and the third expression cassette encoding the Cap protein. The second nucleic acid construct is a Trans construct or Cap-Trans construct, and therefore comprises at least a nucleotide sequence containing a transgene adjacent to at least one parvovirus reverse-terminal repeat sequence.
[0124] However, in preferred (DuoDuoBac) embodiments, the second nucleic acid construct also further comprises a second expression cassette, preferably for the Cap protein, i.e., a fourth expression cassette. In preferred DouDuoBac embodiments, the first nucleic acid construct comprises: i) a first expression cassette comprising a dEl promoter operably ligated to a nucleotide sequence encoding at least one of the parvovirus Rep78 and 68 proteins; ii) a second expression cassette comprising a polH promoter operably ligated to a nucleotide sequence encoding at least one of the parvovirus Rep52 and 40 proteins; and iii) a third expression cassette comprising a polH promoter operably ligated to a nucleotide sequence encoding the parvovirus VP1, VP2 and VP3 capsid proteins, preferably AAV5 VP1, VP2 and VP3 capsid proteins, thereby more preferably the VP1 start codon is ACG. The second nucleic acid construct comprises a fourth expression cassette comprising a transgene adjacent to a parvovirus reverse terminal repeat sequence, and a polH promoter operably linked to nucleotide sequences encoding parvovirus VP1, VP2, and VP3 capsid proteins, preferably AAV5 VP1, VP2, and VP3 capsid proteins, thereby more preferably the VP1 start codon is ACG. In this embodiment, the fourth expression cassette is therefore preferably identical to the third expression cassette. Preferably, in this embodiment, the second and first nucleic acid constructs are present in and / or transfected into cells in molar ratios in the range of 5:1 to 1:10, preferably in the range of 1:1 to 1:8, more preferably in the range of 1:2 to 1:6, and most preferably in the range of 1:3 to 1:5. For example, the first nucleic acid construct may be DuoBac CapRep6 (SEQ ID NO: 10), and the second nucleic acid construct may be DuoBac CapTrans1 (SEQ ID NO: 12), where preferably the first and second constructs exist in a molar ratio of 3:1. It is understood that the "Trans" in the second construct may be any target gene between the two ITRs.
[0125] In this specification, the nucleotide sequences encoding parvovirus Rep proteins are understood to be nucleotide sequences encoding unstructured Rep proteins, such as Rep78 or Rep68 and / or Rep52 or Rep40 proteins, which are required and sufficient for parvovirus vector production in insect cells. The parvovirus nucleotide sequences are preferably derived from dependviruses, more preferably from human or monkey adeno-associated viruses (AAVs), most preferably from AAVs that commonly infect humans (e.g., serotypes 1, 2, 3A, 3B, 4, 5, 6, 8, and 9) or primates (e.g., serotypes 1 and 4). An example of a nucleotide sequence encoding a parvovirus Rep protein is given in SEQ ID NO: 33, which represents a portion of the AAV serotype 2 sequence genome encoding the Rep protein. The Rep78 coding sequence contains nucleotides 11-1876, and the Rep52 coding sequence contains nucleotides 683-1876, also represented separately in SEQ ID NOs: 33 and 19. It is understood that the exact molecular weights of the Rep78 and Rep52 proteins, as well as the precise locations of the translation start codons, may differ among different parvoviruses. However, those skilled in the art will know how to identify the corresponding locations in the nucleotide sequences of AAV-2 and other parvoviruses.
[0126] Preferably, the nucleic acid constructs of the present invention are insect cell-compatible vectors. “Insect cell-compatible vector” or “vector” is understood to be sufficient for the production of parvovirus vectors in insect cells, such as Rep78 or Rep68 and / or Rep52 or Rep40 proteins. The parvovirus nucleotide sequences are preferably derived from dependviruses, more preferably from human or monkey adeno-associated viruses (AAVs), most preferably from AAVs that commonly infect humans (e.g., serotypes 1, 2, 3A, 3B, 4, 5, and 6) or primates (e.g., serotypes 1 and 4). Examples of nucleotide sequences encoding parvovirus Rep proteins are given in SEQ ID NOs: 33 and 19.
[0127] Therefore, in an alternative embodiment, the cell is an insect cell, where at least one of the first and second nucleic acid constructs is an insect cell-compatible vector, preferably a baculovirus vector, and at least one expression cassette comprises at least one baculovirus enhancer element and / or at least one ecdysone response element, the preferred enhancer element being selected from the group consisting of hr1, hr2, hr2.09, hr3, hr4, hr4b, and hr5. In a preferred embodiment, the present invention relates to an insect cell comprising one or fewer nucleotide sequences including a single open reading frame encoding a parvovirus Rep protein. Preferably, the single open reading frame encodes one or more of the parvovirus Rep proteins, more preferably the open reading frame encodes all of the parvovirus Rep proteins, and most preferably the open reading frame encodes a full-length Rep78 protein that can preferably express at least Rep52 and Rep78 proteins in insect cells. In this specification, insect cells may contain multiple copies of a single type of nucleotide sequence within, for example, a multi-copy episome vector, but these are understood to be essentially identical nucleic acid molecules, or at least multiple copies of nucleic acid molecules encoding an identical Rep amino acid sequence, e.g., multiple copies of nucleic acid molecules that differ only from one another due to the synonymy of the gene code. The presence of only a single type of nucleic acid molecule encoding the parvovirus Rep protein avoids recombination between homologous sequences, which may result in defective Rep expression constructs that affect the level (stability) of parvovirus production in insect cells, as can occur in different types of vectors containing the Rep sequence.
[0128] method In a further embodiment, the present invention is a method for generating recombinant parvovirus virions in cells: a) the step of culturing the cells specified herein under conditions that generate recombinant parvovirus virions; and b) Step of recovering recombinant parvovirus virions This provides a method that includes this.
[0129] Recovery preferably involves a step of affinity purification of the virion containing a recombinant parvovirus (rAAV) vector using an anti-AAV antibody, preferably an immobilized antibody. The anti-AAV antibody is preferably a monoclonal antibody. Particularly preferred antibodies are single-chain camel antibodies or fragments thereof, such as those obtained from camels or llamas (see, e.g., Muyldermans, 2001, Biotechnol. 74: pp. 277-302). The antibody for affinity purification of rAAV is preferably an antibody that specifically binds to an epitope on the AAV capsid protein, thereby preferably an epitope present on the capsid proteins of multiple AAV serotypes. For example, an antibody can be produced or selected based on specific binding to the AAV2 capsid, but at the same time, it can also specifically bind to the AAV1, AAV3, and AAV5 capsids.
[0130] In one embodiment, the cell is an insect cell and / or the parvovirus virion is an AAV virion.
[0131] In further embodiments, the recovery of recombinant parvovirus virions in step b) includes at least one of affinity purification of the virions using an immobilized anti-parvovirus antibody, preferably a single-chain camel antibody or a fragment thereof, and filtration through a filter having a nominal pore size of 30 to 70 nm.
[0132] Therefore, in one embodiment, the present invention is a method for generating recombinant parvovirus virions in cells: a) the step of culturing the cells specified herein under conditions that generate recombinant parvovirus virions; and b) Step of recovering recombinant parvovirus virions The present invention provides a method comprising, for the recovery of recombinant parvovirus virions in step b), at least one of affinity purification of the virions using an immobilized anti-parvovirus antibody, preferably a single-chain camel antibody or a fragment thereof, or filtration through a filter having a nominal pore size of 30 to 70 nm.
[0133] In further embodiments, the present invention relates to batches of parvovirus virions produced by the method described above. “Batch of parvovirus virions” is defined herein as all parvovirus virions produced in the same round of production, optionally per container of insect cells. In preferred embodiments, batches of parvovirus virions include the above-described ratio of complete virions to total virions, and / or the above-described ratio of complete virions to empty cells.
[0134] Structures and kits In further embodiments, the present invention provides a first nucleic acid construct as defined herein. In one embodiment, a second nucleic acid construct as defined herein is provided.
[0135] In further embodiments, the present invention provides a kit of parts comprising at least a first nucleic acid construct as defined herein and a second nucleic acid construct as defined herein. The kit may further comprise an insect cell and / or a nucleic acid sequence encoding a nucleotide sequence and / or a baculovirus helper function for expression in an insect cell.
[0136] Advantages of the invention The inventors of this invention further optimized the design of the inducible plasmid vector (expressing parvovirus replicase protein) in two ways.
[0137] Firstly, we will investigate the use of alternative baculovirus promoters in regulating AAV gene expression. To date, in BEV settings, the polyhedral promoter (polH) has been the most studied promoter in AAV generation (van Oers, MM et al., J Gen Virol. January 2015; 96(Pt 1): pp. 6-23). Although alternative late promoters such as p10 have been reported to share host factors with polH (Ghosh, S. et al., J Virol. September 1998; 72(9): pp. 7484-93), other baculovirus promoters have been reported to exhibit different induction intensities and temporal profiles (Dong, ZQ et al., J Biol Eng. December 4, 2018; 12:30; Lin, CH and Jarvis, DL, J Biotechnol. May 10, 2013; 165(1): pp. 11-7; Martinez-Solis, M. et al., Peer J., January 28, 2016; 4: e2183). Nevertheless, their potential usefulness for AAV generation in insect cells has not been reported at all.
[0138] Secondly, this study also explores tighter regulation of AAV Rep expression, which is highly toxic to host cells. The use of baculovirus homologous region (hr)2 or hr2.09 enhancer sequences in combination with polH has become the default molecular design for the inducible OneBac platform (Aslanidi, G. et al., Proc Natl Acad Sci USA. March 31, 2009; 106(13): 5059-64). Here, we investigated the potential usefulness of alternative baculovirus promoters in combination with other baculovirus hrs, with the aim of upgrading the OneBac platform, particularly OneBac Cap Trans. By investigating different baculovirus promoters and enhancers in different molecular conformations, we aim to optimize the expression of AAV genes (Cap, Rep) so that we can ultimately obtain a stable and robust AAV-producing platform that yields high-titer, high-quality AAV batches.
[0139] The present invention therefore provides the use of alternative and non-conservative baculovirus promoters (p10, 39k, p6.9, pSel120) having similar or different expression intensities and temporal profiles to form inducible expression constructs that modulate the expression of a single or split cassette of wild-type (wt) AAV Rep or other AAV genes. This enables the generation of inducible plasmid vector constructs, which have the advantage of being less susceptible to cis:trans promoter competition after transactivation of recombinant baculovirus. Furthermore, the novel non-hr2-0.9 baculovirus hr enhancers provided by the present invention are less leaky under non-inducible conditions, thereby providing the advantage of tighter regulation of toxic Rep proteins from inducible plasmid vector constructs.
[0140] Additional benefits of the present invention include improved AAV production yield and quality for OneBac and insect cell platforms; the generation of inducible promoters that do not express harmful AAV genes such as Rep when the switch is "off," enabling more viable and stable AAV packaging cells; and the adaptation of split cassette Rep AAV designs to inducible plasmid vectors. [Examples]
[0141] In the examples provided, the inventors aim to investigate the effects of using dual expression cassettes (e.g., Bac.Cap-Rep and Bac.Cap-Trans or Bac.Cap-Rep and Bac.Trans) on product quality and vector yield. In Example 1, the inventors characterize the effects of molecular optimization of dual Rep-Cap cassettes on the yield and product quality of wtAAV5 and AAV2 / 5. In Example 2, the inventors produce wtAAV5 with optimized wtAAV5 Cap-Rep and transgene baculovirus (DuoBac) and compare it to wtAAV5 produced by triple infection. In Example 3, the inventors extrapolate DuoBac yield to a larger production scale versus a triple Bac system. Finally, in Example 4, the inventors examine the effects of using various combinations of Cap-Trans and Cap-Rep dual baculovirus (DuoDuoBac) on quality and vector yield and compare these to triple-infection wtAAV5 production.
[0142] Methods and materials Expression cassette In short, Cap-Rep DuoBac constructs (DuoBac CapRep1-7) include combinations of Cap cassettes (wtAAV5 or AAV2 / 5) and Rep cassettes under the control of a polyhedrin (PolH) or P10 promoter. Here, the Rep cassettes are split designs with Rep52 and Rep78 controlled by PolH and dIE1 promoters, respectively. DuoBac CapTrans1 combines a wtAAV5 Cap cassette under the control of the PolH promoter with a BacTrans4 transgene cassette. Single expression cassette constructs were also required for DuoBac and TripleBac AAV generation. These constructs were always kept the same: BacCap1 or BacCap2, (wtAAV5), and BacRep1, a split Rep cassette. Figure 2 summarizes the orientations used in the cassette designs, and Tables 1A and 1B summarize the different promoter / start codon combinations used for each construct.
[0143] [Table 1]
[0144] Cell culture and baculovirus amplification ExpresSF+ insect cells were maintained in SF-900II SFM medium (Gibco) in a shaking flask at 28°C and 135 RPM. Fresh baculovirus was produced for the generation of each example. Here, ExpresSF+ cells were inoculated with a frozen baculovirus stock at a concentration of 3 μl of stock per 1 ml of insect cells. 72 hours after the start of infection, fresh baculovirus was collected by centrifugation of the cells at 1900xg for 15 minutes and preservation of the cell supernatant.
[0145] AAV production and purification AAV material was produced by co-infecting expressSF+ insect cells with various combinations of newly amplified recombinant baculoviruses, including dual expression cassettes (Cap-Rep and Cap-Trans) or single expression cassettes (Cap, Rep, Trans), based on volumetric measurements, or with combinations of dual expression (Cap-Rep) and single (Trans) expression cassettes. The exact ratios are described in the examples. After incubation at 28°C for 72 hours, the cells were lysed in lysis buffer (1.5M NaCl, 0.5M Tris-HCl, 1mM MgCl2, 1% Triton x-100, pH=8.5) for 1 hour. Next, the genomic DNA was digested with benzonase (Merck) at 37°C for 1 hour, and then the cell debris was pelleted at 1900xg for 15 minutes (unpurified lysate sample). The supernatant was stored at 4°C until the start of purification. Next, AAV was purified from unpurified lysed bulk (CLB) by batch binding with AVB Sepharose (GE Healthcare). Briefly, the AVB Sepharose resin was washed with 0.2 M HPO4 pH=7.5 buffer, and the cleared unpurified lysate was added to the resin and incubated at room temperature (RT) for 2 hours with incubator shaking at 85 rpm. The resin was washed again with 0.2 M HPO4 pH=7.5 buffer. The bound virus was then eluted from the resin by adding 0.2 M glycine pH=2.5. The pH of the eluted virus was immediately neutralized by adding 0.5 M Tris-HCl pH=8.5 and stored at -20°C until further use.
[0146] Titration by Q-PCR and measurement of whole / complete ratio by A260 / A280 or HPLC The viral titers of unpurified lysates and purified AAV batches were determined by Q-PCR. Q-PCR was performed using primers specific to the promoter region of the transgene. Q-PCR was performed using an Applied Biosystems 7500 rapid Q-PCR system. The whole / complete ratio of the purified AAV batches was measured by UV / visible absorbance spectroscopy. 1 μl of 10% SDS was mixed with 100 μl of purified AAV and incubated at 75°C for 10 minutes. After heat treatment, absorbance at 260 and 280 nm was measured using Nanodrop. The whole / complete ratio of the AAV material was calculated using the calculation described by Sommer et al. 2003. Alternatively, the whole particles were measured by HPLC. Here, the purified AAV material was loaded onto a size exclusion column. The whole particles were determined by integrating the area under the curve of the capsid peak. The whole / complete ratio was then calculated by dividing the whole particles by the viral titer measured by Q-PCR.
[0147] Purified AAV batch total protein gel The purified AAV batches were diluted in 4×Laemmli sample buffer (Biorad) supplemented with 10% β-mercaptoethanol (Bio-Rad) heated at 95°C for 5 minutes, and loaded onto 4-20% MiniPROTEAN® TGX stain-free gels (Biorad). After 35 minutes of electrophoresis at 200 volts in TGS buffer (Biorad), the gels were exposed to ultraviolet light for 5 minutes, and gel staining was observed by visualizing the bands with a Chemidoc touch imaging device (Biorad).
[0148] Infection assay in HelaRC32 The genome copy number (gc / ip) required for a single infectious particle was determined by limiting dilution-based infectivity titer assays. Briefly, HelaRC32 (ATCC) cells stably expressing AAV-derived Rep and Cap proteins were transduced in 10 replicates of the AAV dilution series and infected with 50 wtAd5:HeLaRC32 MOI WT adenovirus 5 (wtAd5) with or without. Plates were incubated at 37°C for 48 hours, and wells were investigated for the presence or absence of vector genomic DNA by Q-PCR using a vector genome-specific primer probe set. The number of infectious particles per seeded vector genome was calculated using the Spearman-Karber method [5].
[0149] Formaldehyde gel electrophoresis using genomic AAV DNA Genomic AAV DNA was isolated from a purified AAV batch using a PCR-purified nucleospin kit (Machery Nagel). Before the electrophoresis run, 500 ng of AAV genomic DNA was denatured at 95°C for 10 minutes in formaldehyde hydroding buffer (1 ml of 20x MOPS, 3.6 ml of 37% formaldehyde, and 2 ml of 5 mg / ml Orange G MQ in 67% sucrose, totaling 10 ml), and immediately placed on ice. The sample was then run on a 1% agarose gel prepared with 1x MOPS (40 mM MOPS, 10 mM NaAc, 1 mM EDTA, pH=8.0) supplemented with 6.6% formaldehyde. The sample was then electrophoresed for 2 hours at 100 volts in 1x MOPS supplemented with 6.6% formaldehyde running buffer. After electrophoresis, the DNA was stained with SYBR Gold (Thermofisher), and the bands were visualized using a Chemidoc Touch Imager (Biorad).
[0150] Design of Experiments (DoE) To study the effect of upstream bioprocess dispersion on the whole:complete ratio of DuoBac and TripleBac systems, two studies were subjected to experimental design (DoE) and analysis. Although the two studies were performed using slightly different methods, in both cases the experimental dispersion was introduced into a shaking flask, and AAV purification was performed using equivalent methods. Furthermore, for both studies, two types of analysis were performed on the purified samples for each experimental condition: qPCR was used to determine the vector genome copy number (gc), and SEC-HPLC was used to determine the total amount of particles regardless of content. These two metrics were then used to calculate the whole:complete ratio, which represents the ratio of total AAV capsid to complete capsid containing genome copies. The differences between the two studies are described in the following two sections.
[0151] DoE DuoBac System: Design Space and Experimental Platform As shown in Table 2, a central composite design (CCD) was used to introduce experimental variance during DuoBac-mediated transduction of Sf+ cells. This resulted in a total of 17 experimental conditions ("generative cultures") across three replicates.
[0152] [Table 2]
[0153] Amplified baculoviruses and seed cells were produced in 10L wave bags (Flexsafe, Sartorius) using a oscillating bioreactor (BioWave PU-Biostat, Sartorius). The culture medium used throughout this experiment was Sf900 II medium (ThermoFisher). All incubation settings were as follows: T=28°C; stirring at 25 rpm and an angle of 8°; DO=50%; and airflow rate of 0.2 L / min. One dedicated bioreactor with a working volume of 5L and 1.2 × 10⁶ cells was used for cell amplification. 6 It was used in the initial VCD with VC / mL (reactor A). 18.5 hours after inoculation with reactor A, the two bioreactors were 0.8 × 10⁻⁶ 6Cells were inoculated at a concentration of VC / mL and a working volume of 5.25 L (reactors B and C). For separate amplification of baculovirus BacTrans5 and DuoBac CapRep3, 15.75 mL of baculovirus working strain virus (WSV) was added to reactors B and C 18 hours after cell inoculation. After an additional 48 hours of incubation, all reactors were collected. The resulting material (cells and baculoviruses) was used to prepare AAV-producing cultures.
[0154] For cell regeneration, a fresh medium exchange step was performed before transduction to control the VCD and medium composition at TOI. This medium exchange involved gentle centrifugation of various cultures at 300g, discarding the supernatant, and resuspending the cells in fresh medium to achieve the target VCD at TOI. The regeneration culture composition was carried out according to the specifications in Table 2.
[0155] After 70 hours, transduction was completed by a series of steps: lysis (addition of 10 v / v% of 10× lysis buffer, incubation at 37°C and 135 rpm for 60 minutes), benzonase treatment (addition of 10 units of benzonase per mL, incubation at 37°C and 135 rpm for 60 minutes), clarification (centrifugation at room temperature and 4100 g for 15 minutes), and filtration (filtration through a 0.22 μm bottle-top filter under vacuum). For incidental virus inactivation, the filtrate was incubated at room temperature for 12 hours. (1) Preparation of AVB Sepharose HP resin (1:1 volume ratio) in 0.2 M phosphate buffer pH 7.5; (2) Addition of 250 μL of resin suspension to 40 mL of filtrate and incubation at 40 rpm for 4 hours; (3) Centrifugation of resin at 4100 g for 5 minutes; (4) Washing of pellet with 0.2 M phosphate buffer pH 7.5; (5) Extraction of pellet with 500 μL of 0.5 M glycine / HCl pH 2.5 during incubation for 4 minutes; (6) Centrifugation of used pellet using benchtop centrifugation; (7) Neutralization of supernatant with 200 μL of Tris / HCl pH 8.5 buffer; and (8) Purification of the remaining filtrate using a batch binding affinity chromatography protocol including filtration of the neutralized eluate through a 0.22 μm PVDF syringe filter. The purified material was used for qPCR and SEC-HPLC analysis to determine the whole:complete ratio.
[0156] result Example 1: Characterization of wtAAV5 and AAV2 / 5 Cap-Rep DuoBac constructs AAV generation in insect cells is typically performed by co-infection with three baculoviruses containing Rep, Cap, and Trans cassettes. To improve the statistical probability of all three components being present in the cell simultaneously, the Cap and Rep expression cassettes were moved to a single baculovirus (Figure 1). To investigate whether the quality and quantity of wtAAV5 and AAV2 / 5 generated in the co-infection setting could be improved, the inventors replaced the single Rep expression cassette with a split Rep expression cassette and optimized the promoter / VP1 start codon combination of the Cap. The introduction of the split Rep cassette can provide better control over the timing and expression intensity of Rep52 and Rep78. Furthermore, optimization of the VP123 ratio of the capsid is essential for the generation of infectious AAV.
[0157] The constructs DuoBac CapRep1-7 (Table 1A and Figure 1) were designed to optimize the expression of wtAAV5 and AAV2 / 5 Cap to balance them with the Reps expressed from the split Rep cassette. To investigate the effects of these changes on AAV vector yield and quality, DuoBac generation was performed with a therapy-related transgene (BacTrans4). AAVs were generated in expressSF+ insect cells (50 ml) containing 5% newly amplified Cap-Rep baculovirus and 1% newly amplified transgene baculovirus. After generation, the viruses were purified, and several assays were performed on the resulting AAV material. Viral titers (by Q-PCR) were determined in unpurified lysates. The whole / complete ratio (by HPLC / Q-PCR) and capsid stoichiometry (by SDS-Page gel) were determined in purified AAVs. The genome copy number (gc / IP) required for one infectious particle was determined by an infectivity assay in HelaRC32 cells.
[0158] Figure 3 summarizes the viral titers measured in unpurified lysates of wtAAV5 and AAV2 / 5 DuoBac production. High viral yields (>1e11 gc / ml) were obtained with constructs DuoBac CapRep2, 5, and 7, while relatively low yields were observed with constructs DuoBac CapRep1 and 6. The whole / complete ratio of the purified viral batches was determined by dividing total particles / ml (determined by HPLC) by genome copies / ml (determined by Q-PCR). Generally, a low whole / complete ratio (<2.0) was observed with all DuoBac constructs (Figure 4). This observation is in stark contrast to the whole / complete ratio typically observed with TripleBac AAV production, which is usually greater than 5 (see Example 2). The capsid stoichiometry of purified AAV was determined by SDS-Page gel electrophoresis (Figure 5; the capsid stoichiometry of DuoBac CapRep6 could not be determined due to low viral yield). The capsid stoichiometry was significantly affected by which DuoBac construct was used. DuoBac CapRep3 and 7 presented the correct 1:1:10 capsid stoichiometry, while DuoBac CapRep2, 4, and 5 presented suboptimal capsid stoichiometry (low VP1 for DuoBacCapRep2, 4, and 5, or very high VP1 for DuoBac CapRep1). The potential impact of these variations on AAV infectivity was determined by limiting dilution infectivity assays in HelaRC32 (Figure 6). The AAV infectivity results reflected the capsid stoichiometry results. Here, DuoBac CapRep1, 3, and 6 showed high infectivity (low gc / ip) due to normal or high VP1 levels in the capsid. On the other hand, DuoBac CapRep2, 4, and 5 (high gc / ip) showed reduced infectivity due to low levels of VP1 in the capsid. Table 3 summarizes the data from these experiments.
[0159] [Table 3]
[0160] These results suggest that promoter competition significantly affects the viral titer of the wtAAV5 DuoBac construct (PolH Rep + PolH Cap = low titer for wtAAV5, DuoBac CapRep1 and 6), but less so for AAV2 / 5 (PolH Rep + PolH Cap = high titer for AAV2 / 5, DuoBac CapRep3). Introducing the P10 promoter before the wtAAV5 cassette improves the titer (DuoBac CapRep2) but results in a suboptimal VP123 smear. Introducing a stronger start codon before VP1 (dual ATG) rescues the VP123 smear and results in a high titer (DuoBac CapRep7). This indicates that balancing the promoter type and initiation strength for CapVP1 is essential to produce a high titer with the correct AAV capsid smear. Furthermore, combining Rep and Cap with the same baculovirus reduces process complexity. This combination of AAV genes led to a further significant improvement in the whole / complete ratio. How DuoBac AAV production rivals TripleBac AAV production is examined in Example 2.
[0161] Example 2: Comparison of AAV5 DuoBac (Bac.Cap-Rep and Bac.Transgene) and Triple Bac (Bac.Cap, Bac.Rep, Bac.Transgene) AAV generation.
[0162] Previous examples demonstrated that improved AAV products could be produced by combining Cap and Rep cassettes on the same baculovirus and by molecularly optimizing the Cap cassette. This example compares AAVs produced by the DuoBac and TripleBac processes. To compare the two production systems, DuoBac (DuoBac CapRep7:Cap wtAAV5-Rep), the production was compared with TripleBac AAV production (BacCap1 wtAAV5, BacRep1) in terms of vector yield and quality. Reporter and two therapy-related transgenes were used in AAV production (BacTrans1, 3, and 4). To perform AAV production, expressSF+ insect cells (50 ml or 2.5 L) were inoculated with several volume ratios of newly amplified baculovirus stockpiles. Inoculation amounts ranged from 1 to 5% of the culture volume. After production, the viruses were purified and several assays were performed on the material. Viral titers (expressed as gc / ml by Q-PCR) were determined from unpurified lysates and purified AAV. The whole / complete ratio (by A260 / A280) and VP123 ratio (by SDS-Page gel) were determined from purified AAV material.
[0163] Table 4 summarizes the results for 50 ml production, and Table 5 summarizes the results for 2.5 L production. At both the 50 ml and 2.5 L scales, DuoBac production outperformed TripleBac production in both viral yield and whole / complete ratio. Depending on the inoculation or transgene used for production, the titer (gc / ml) in CLB increased 4–10 times with DuoBac CapRep7 compared to equivalent TripleBac production. Whole genome copies purified from production increased by similar multipliers. Interestingly, the whole / complete ratio also improved with the DuoBac process. Here, the transgene used appears to influence the amount of improvement in this parameter, but the whole / complete ratio consistently improved in DuoBac production (roughly 2–8 times depending on the transgene cassette used for production). VP123 capsid protein expression was identical between DuoBac and TripleBac AAV production (Figure 7), maintaining an ideal 1:1:10 stoichiometric ratio.
[0164] Reducing process complexity by combining Cap and Rep expression cassettes on the same baculovirus resulted in a clear improvement in yield and whole / complete ratio (Figure 8), while maintaining the ideal VP protein stoichiometry of AAV. Although not investigated here, the reduction from three variables to two could potentially improve process robustness (batch-to-batch variability) in the DuoBac process.
[0165] [Table 4]
[0166] [Table 5]
[0167] Example 3: Comparison of DuoDuoBac (Bac.Cap-Rep and Bac.Cap-Trans) with TripleBac AAV (Bac.Cap, Bac.Rep, Bac.Transgene) Previous studies have shown that the Cap:Rep baculovirus inoculation ratio in TripleBac AAV production directly affects the whole / complete ratio and titer yield of AAV production. Here, increasing Rep baculovirus inoculation resulted in a decrease in capsid production and the whole / complete ratio. In contrast, increasing the Cap baculovirus inoculation ratio increased the whole / complete ratio and yield. By introducing Cap cassettes into both Rep and transgene baculoviruses, thereby forming a dual DuoBac or DuoDuoBac process (Figure 1), we have more freedom to control the Cap:Rep ratio in cells during AAV production. Furthermore, this would allow us to explore Cap:Rep production ratios (especially high Cap ratios) that are impossible to achieve in the TripleBac AAV process (due to inoculations that are too high, inhibiting AAV production).
[0168] In this example, we aimed to investigate the effect of changing the Cap:Rep ratio during insect cell infection on AAV quality and yield, which was achieved by varying the inoculation ratio of DuoBac CapTrans1 to DuoBac CapRep6. DuoDuoBac AAV production was compared with TripleBac AAV production. AAV production was performed on expressSF+ insect cells on a 50 ml scale. Inoculation amounts ranged from 1–5% of the culture volume for each baculovirus. After production, the viruses were purified with AVB Sepharose. Viral titer (gc / ml determined by Q-PCR) was measured in unpurified lysates and purified AAV. Whole / complete ratio (by A260 / A280) and capsid composition (by SDS-Page gel) were determined in purified AAV. Furthermore, genomic DNA packaged in AAV particles was also investigated by formaldehyde gel electrophoresis.
[0169] Table 6 summarizes the results for DuoDuoBac and TripleBac AAV production. For DuoDuoBac production, it lists the inoculation conditions used, as well as equivalent inoculation conditions that would be required to achieve a similar ratio in TripleBac AAV production. In all DuoDuoBac AAV productions tested, the vector yield in the unpurified lysate decreased to 7e+11–1.4e+12 gc / ml compared to 6–7e+11 for the TripleBac productions tested, meaning that a twofold increase in titer was observed under the best DuoDuoBac conditions. The whole / complete ratio in all DuoDuoBac productions was reduced compared to TripleBac production. When comparing DuoDuoBac productions, a lower whole / complete ratio was generally observed when more Rep was present, and a higher whole / complete ratio was associated with an increase in Cap. The best condition tested was a 1:3 ratio of DuoBac CapTrans1 to DuoBac CapRep6 co-infection, which resulted in a whole / complete ratio of approximately 1.5 and an average titer of 1.2e+12 gc / ml in CLB. Compared to its closest TripleBac equivalent (5:5:1 ratio), the titer was twofold (1.2e+12 vs. 6e+11), and the whole / complete ratio was approximately fourfold (1.5 vs. 6). When comparing the expression of capsid proteins VP-1, -2, and -3 between DuoDuoBac and TripleBac production, similar stoichiometric amounts of 1:1:10 were observed under all conditions tested (Figure 9). This indicates that introducing the Cap cassette into the Rep and transgene baculovirus did not alter the optimal ratio, maintaining it at 1:1:10. Furthermore, the genomic DNA packaged in the AAV particles was similar between DuoDuoBac and TripleBac generation (Figure 10). Genomic AAV DNA isolated from both generation yielded identical band patterns on formaldehyde gel. The main band was 2.4 kb long and represented a single copy of the BacTrans4 transgene.
[0170] In summary, the DuoDuoBac process yields improved vector yield and complete-to-whole ratio compared to TripleBac by using a wide range of inoculation ratios of Bac.Cap-Rep to Bac.Cap-Trans. The increased freedom to modify the Cap:Rep ratio in the generating cells during AAV generation (due to the presence of two Cap expression cassettes and a reduced number of baculovirus species used for infection) allows for steering and optimization of the whole / complete ratio of the generated AAV. We observed that increasing Rep yielded slightly lower yields and whole / complete ratios, while increasing Cap yielded higher whole / complete ratios. DuoDuoBac generation minimizes variability in yield and whole / complete ratios compared to TripleBac. Furthermore, DuoDuoBac AAV generation allows us to explore Cap:Rep ratios that we cannot successfully achieve with the TripleBac process. This extended operational room provided by the DuoDuoBac process may potentially enable the development of more robust AAV generation processes.
[0171] [Table 6]
[0172] Example 4: Comparison of DuoDuoBac (Bac.Cap-Rep and Bac.Cap-Trans) with DuoBac AAV (Bac.Cap, Bac.Rep, Bac.Transgene) 4.1 Cell culture and baculovirus amplification ExpresSF+ insect cells were cultured in SF-900II SFM medium under the conditions described above. Fresh baculovirus inoculant was produced as described above.
[0173] 4.2 DOE study using a 1L shaking flask 4.2.1 DOE Plan A central composite design (CCD) was used to investigate two factors (volume-infectivity ratio of two amplified baculoviruses within the range of 0.33–3%) and their interactions. Statistical analysis was performed using DesignExpert 11 (Statease, Minneapolis, MN) and JMP 15 (SAS Institute, Cary, NC). A secondary response surface model was constructed using a rotational CCD (α=1.414) and three center points. Genomic copy titers and the (tp / gc) ratio of total particles to genome copies in filtered, unpurified lysed bulk were set as responses. Only statistically significant model items (p<0.1) were included in each model and selected through stepwise regression, while the model hierarchy was maintained.
[0174] 4.2.2 Production and Purification of AAV Amplified baculovirus and seed cells (pre-culture) were produced in a 1 L shaking flask at 135 rpm at 28°C. The medium used throughout this experiment was SF900 II medium (ThermoFisher). Based on the VCD of the pre-culture, 1.3 × 10⁶ was produced in a final working volume of 400 mL. 6To achieve the target seeded cell density of VC / mL, the calculated volume of culture was added to each 1 L shaking flask. Additional SF900 II medium was added to each shaking flask to bring the culture volume to 400 mL as needed. Cell volume increase in the 1 L shaking flask was performed at 135 rpm at 28°C. 15–21 hours after inoculation, the amplified baculovirus inoculum pool was added at the volume-to-infection ratio planned by the DOE. After infection, the set temperature was increased to 30°C and culture was continued at 135 rpm for 68–76 hours. The culture was then harvested by adding 10% (v / v) 10× lysis buffer (Lonza). 30 minutes after the start of lysis, the set temperature was increased to 37°C. Upon reaching the set temperature, benzonase (9 units / mL) was added, and the culture was incubated for a further 60 minutes. Clarification of the unpurified lysate bulk was performed by centrifugation at 4100 g and room temperature (20-25°C) for 15 minutes, followed by filtration through a 0.2 μm membrane filter. The filtered bulk was then purified using AVB Sepharose HP resin from Cytiva. The product was eluted using 0.2 M glycine / HCl pH 2.4 buffer and then neutralized using 60 mM Tris pH 8.5. The purified samples were then analyzed by qPCR (to determine vector genome copy number and GC concentration in the unpurified lysate) and SEC-HPLC (to determine the total amount of AAV particles). The results in Table 7 show that the DuoDuoBac system achieves higher vector yields than comparable DuoBac systems across a wide range of infection ratios of the two baculoviruses.
[0175] [Table 7]
[0176] 4.3 Production in a 2L agitated tank bioreactor 4.3.1 Production and Purification of AAV Amplified baculoviruses and seed cells (pre-cultures) were produced in a 1 L shaking flask at 135 rpm at 28°C. The medium used throughout this experiment was SF900 II medium (ThermoFisher). For each baculovirus combination, rAAV production was performed in two replicates using two 2 L stirred tank reactors (STR, UniVessel® SU, Satorious). Based on the VCD of the pre-cultures, 0.5 × 10⁶ cells were produced in a final working volume of 2 L. 6 To achieve the target seeded cell density of VC / mL, the calculated amount of culture was added to a 2L STR. Additional SF900 II medium was added to the 2L STR to bring the culture volume to 2L as needed. Cell volume expansion in the 2L STR was performed at 28°C. Dissolved oxygen (DO) was maintained at 30% by continuous fixed airflow through an overlay at 0.2 L / min and oxygenation through a sparger with a flow rate of 0–150 ccm using agitation speeds of 100–300 rpm. 43–48 hours after inoculation, a pool of amplified baculovirus inoculum was added at the volume-to-infection ratios shown in Table 8. After infection, the set temperature was increased to 30°C and culture was continued using the above settings.
[0177] Cultures were collected 68–76 hours after infection by adding 10% (v / v) 10× lysis buffer (Lonza). Thirty minutes after initiating lysis, the set temperature was raised to 37°C. Upon reaching the set temperature, benzonase (9 units / mL) was added, and the cultures were incubated for a further 60 minutes. Clarification of the unpurified lysis bulk was performed by centrifugation at 4100 g and room temperature (20–25°C) for 15 minutes, followed by filtration through a 0.2 μm membrane filter. The filtered bulk was then purified using a column packed with AVB Sepharose HP resin from Cytiva. The product was eluted using 0.2 M glycine / HCl 2 M urea pH 2.4 buffer and then neutralized using 60 mM Tris 2 M urea pH 8.5. The neutralized eluate was then loaded onto a 5 mL Mustang Q membrane (Pall). Product elution was performed using 60 mM Tris, 150 mM NaCl, and 2 M urea pH 8.5 buffer, followed by filtering through a Planova 35N filter (0.01 m³).2 Nanofiltration was performed using ). Finally, the product was ultrafiltered against phosphate-buffered saline (Merck) containing 5% sucrose and concentrated to the desired volume.
[0178] The purified samples were then analyzed by qPCR (to determine vector genome copy number and GC concentration in unpurified lysate), SEC-HPLC (to determine the total amount of AAV particles), FIX titer assay, and HelaRC32 infectivity assay. Table 8 shows that the DuoDuoBac system (BacCapTrans1 + BacCapRep6) is superior to the equivalent DuoBac system (BacCapRep6 + BacTrans4) in terms of vector yield, titer, and infectivity.
[0179] [Table 8]
[0180] References: 1. Chaabihi, H., etal., Competition between baculovirus polyhedrin and p10 gene expression during infection of insect cells. J Virol, 1993. 67(5): p. 2664-71. 2. Hill-Perkins, MS and RD Possee, Abaculovirus expression vector derived from the basic protein promoter ofAutographa californica nuclear polyhedrosis virus. J Gen Virol, 1990. 71 ( Pt4): p. 971-6. 3. Pullen, S.S. and P.D. Friesen, Earlytranscription of the ie-1 transregulator gene of Autographa californica nuclearpolyhedrosis virus is regulated by DNA sequences within its 5' noncoding leaderregion. J Virol, 1995. 69(1): p. 156-65. 4. Bosma, B., et al., Optimization of viralprotein ratios for production of rAAV serotype 5 in the baculovirus system.Gene Ther, 2018. 25(6): p. 415-424. 5. Grieger, J.C., S. Snowdy, and R.J.Samulski, Separate basic region motifs within the adeno-associated virus capsidproteins are essential for infectivity and assembly. J Virol, 2006. 80(11): p.5199-210.
Claims
1. i) A first expression cassette comprising a first promoter operably ligated to a nucleotide sequence encoding mRNA, wherein its translation in a cell produces at least one of the parvovirus Rep78 and 68 proteins; ii) A second expression cassette comprising a second promoter operably ligated to a nucleotide sequence encoding mRNA, wherein its translation in a cell produces at least one of the parvovirus Rep52 and 40 proteins; iii) A third expression cassette comprising a third promoter operably ligated to nucleotide sequences encoding parvovirus VP1, VP2, and VP3 capsid proteins; and iv) A nucleotide sequence containing an introduced gene adjacent to at least one parvovirus reverse terminal repeat sequence, A cell comprising one or more nucleic acid constructs including, At least one of the first and second expression cassettes is present in the first nucleic acid construct together with the third expression cassette. After transfection of the cells with the one or more nucleic acid constructs, the first promoter is active before the second and third promoters in the cells.
2. The cell according to claim 1, wherein the nucleotide sequence containing the transgene adjacent to the parvovirus reverse terminal repeat sequence is present in the second nucleic acid construct.
3. The cell according to claim 2, wherein the second nucleic acid construct further comprises a fourth expression cassette comprising a fourth promoter operably ligated to nucleotide sequences encoding parvovirus VP1, VP2, and VP3 capsid proteins, the first promoter being active before the second, third, and fourth promoters, optionally the third and fourth promoters being identical, and optionally the parvovirus VP1, VP2, and VP3 capsid proteins encoded by the nucleotide sequences of the third and fourth expression cassettes being identical.
4. The cell according to claim 3, wherein at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins include a common amino acid sequence comprising the amino acid sequence from the second amino acid to the C-terminal amino acid of at least one of the parvovirus Rep52 and 40 proteins, the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins are identical by at least 90%, and the nucleotide sequence encoding the common amino acid sequence of at least one of the parvovirus Rep78 and 68 proteins and the nucleotide sequence encoding the common amino acid sequence of at least one of the parvovirus Rep52 and 40 proteins are identical by less than 90%.
5. The cell according to claim 4, wherein the common amino acid sequences of at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins are at least 99% identical, preferably 100% identical.
6. The cell according to claim 4 or 5, wherein the nucleotide sequence encoding the common amino acid sequence in at least one of the parvovirus Rep78 and 68 proteins has an improved codon use frequency bias for the cell compared to the nucleotide sequence encoding the common amino acid sequence in at least one of the parvovirus Rep52 and 40 proteins, or the nucleotide sequence encoding the common amino acid sequence in at least one of the parvovirus Rep52 and 40 proteins has an improved codon use frequency bias for the cell compared to the nucleotide sequence encoding the common amino acid sequence in at least one of the parvovirus Rep78 and 68 proteins, preferably the difference in codon adaptation indices between the nucleotide sequences encoding the common amino acid sequence in at least one of the parvovirus Rep78 and 68 proteins and at least one of the parvovirus Rep52 and 40 proteins is at least 0.
2.
7. The cell according to any one of the claims, wherein the first promoter is a constitutive promoter.
8. The cell according to any one of the claims, wherein at least one of the second, third, and fourth promoters is an inducible promoter.
9. The cell according to claim 8, wherein the inducible promoter is a viral promoter that is induced later in the viral infection cycle, preferably a viral promoter that is induced at least 24 hours after transfection or infection of the cell by the virus.
10. The cell according to any one of the claims, wherein at least one of the first and second nucleic acid constructs is stably incorporated into the genome of the cell.
11. The cell according to any one of the claims, wherein the cell is an insect cell, and at least one of the first and second nucleic acid constructs is an insect cell-compatible vector, preferably a baculovirus vector.
12. a) The first promoter is selected from the deltaEl promoter and the El promoter; b) The second, third, and fourth promoters are selected from the pollH promoter and the p10 promoter. The cell according to claim 11.
13. The cell according to claim 11 or 12, wherein at least one expression cassette comprises at least one baculovirus enhancer element and / or at least one ecdysone response element, the preferred enhancer element being selected from the group consisting of hr1, hr2, hr2.09, hr3, hr4, hr4b, and hr5.
14. The cell according to any one of the claims, wherein the nucleotide sequence encoding mRNA whose translation in the cell produces at least one of the parvovirus Rep78 and 68 proteins comprises an intact parvovirus p19 promoter.
15. The cell according to any one of the claims, wherein at least one of the parvovirus Rep78 and 68 proteins, at least one of the parvovirus Rep52 and 40 proteins, the parvovirus VP1, VP2 and VP3 capsid proteins, and the at least one parvovirus reverse terminal repeat sequence are derived from adeno-associated virus (AAV).
16. The cell according to any one of claims 4 to 15, wherein the first nucleic acid construct is DuoBac CapRep6 (SEQ ID NO: 10), the second nucleic acid construct is DuoBac CapTrans1 (SEQ ID NO: 12), and preferably the first and second constructs are present in a molar ratio of 3:
1.
17. A method for generating recombinant parvovirus virions in cells, a) the step of culturing the cells according to any one of claims 1 to 16 under conditions that generate recombinant parvovirus virions; and b) Step of recovering the recombinant parvovirus virion. Methods of including.
18. The method according to claim 17, wherein the cell is an insect cell and / or the parvovirus virion is an AAV virion.
19. The method according to claim 17 or 18, wherein the recovery of the recombinant parvovirus virions in step b) comprises at least one of affinity purification of the virions using an immobilized anti-parvovirus antibody, preferably a single-chain camel antibody or a fragment thereof, or filtration through a filter having a nominal pore size of 30 to 70 nm.
20. A first nucleic acid construct according to any one of claims 1 to 15.
21. A second nucleic acid construct according to any one of claims 2 to 15.
22. A kit of parts comprising at least one first nucleic acid construct according to any one of claims 1 to 15 and one second nucleic acid construct according to any one of claims 2 to 15.