Bicistronic constructs for allogeneic gene therapy

Bicistronic constructs for allogeneic CAR T-cell therapy address the limitations of autologous therapy by using B2M nonfunctional polypeptides and HLAs to mask immunogenicity, enabling scalable and cost-effective production of CAR-manipulated cells for cancer treatment.

JP2026511056APending Publication Date: 2026-04-10LUNG BIOTECH PBC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025555282
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-21
Filing Date
2024-03-20
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The limitations of autologous CAR T-cell therapy, such as facility availability, cell quality issues, time delays, and high costs, hinder widespread application in cancer treatment, while allogeneic cell therapy faces risks of graft-versus-host disease and host-mediated rejection.

Method used

Development of bicistronic constructs for allogeneic gene therapy using immune cells with chimeric antigen receptors (CARs) that incorporate beta-2-microglobulin (B2M) nonfunctional polypeptides and human leukocyte antigens (HLAs) to mask immunogenicity, reducing immune response and enabling scalable, cost-effective production of CAR-manipulated cell products.

Benefits of technology

The bicistronic constructs provide a scalable and cost-effective solution for allogeneic CAR T-cell therapy by minimizing immune rejection and ensuring consistent product quality, thus overcoming the limitations of autologous therapy and expanding access to cancer treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026511056000009
    Figure 2026511056000009
  • Figure 2026511056000010
    Figure 2026511056000010
  • Figure 2026511056000011
    Figure 2026511056000011
Patent Text Reader

Abstract

This disclosure relates to bicistronic polypeptide constructs for use in allogeneic gene therapy, such as CAR-T cell therapy. A bicistronic construct comprises a first polynucleotide encoding a therapeutic molecule (e.g., CAR-T or antibody) and a second polynucleotide encoding an immune surveillance masking molecule (ISMM). The ISMM includes a non-functional version of a protein knockout, such as a human leukocyte antigen E genetically fused to a fragment, by insertion of a bicistronic construct, such as beta-2 microglobulin or B2M. Also provided are vectors comprising bicistronic constructs, cells (e.g., CAR-T cells), and methods of use. Kits and manufacturing articles are also provided. This disclosure also provides four novel insertion sites that may be used to insert expression constructs into the B2M gene.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-referencing and incorporation by reference of related applications This PCT application claims priority to U.S. Provisional Patent Application No. 63 / 491,492, filed on 21 March 2023, which is incorporated herein by reference in its entirety.

[0002] References to electronically submitted sequence listings The contents of the electronically submitted ST.26 sequence listing in XML format (name 5064_003PC01_SequenceListing_ST26.xml, size: 158,640 bytes, creation date: March 18, 2023) filed using this application are incorporated herein by reference in their entirety.

[0003] This disclosure provides a bicistronic construct for allogeneic gene therapy. [Background technology]

[0004] Gene therapy, particularly adaptive cellular immunotherapy, using immune cells expressing chimeric antigen receptors (CARs), has shown promise in treating malignancies. Adoptive cell therapy refers to the isolation of immune cells, subsequent ex vivo manipulation, and subsequent delivery to the patient as a therapeutic intervention. CARs combine antibody specificity with the signaling domains and costimulatory molecules of effector cells. When constitutively expressed on the surface of immune cells via non-viral or viral transduction, CARs enable effector cells to recognize targets in an antigen-specific manner. CARs designed to target specific tumor-associated antigens (TAAs) can then be used in anticancer therapy.

[0005] The majority of clinically evaluated CAR products originate from autoimmune cells, i.e., cells harvested from the patient receiving the therapy. The autologous (patient-derived) CAR T-cell paradigm has several key advantages, including the infusion of CAR-manipulated cell products without immunological mismatch between donor and recipient. However, this strategy has considerable clinical and economic constraints, such as the availability of facilities to successfully perform leukocyte apheresis from patients (e.g., patients with relapsed / refractory malignancies) and obtain cells, the transportation of cells to and from processing centers, the quality of cells (which may have been adversely affected by previous therapies for high-grade cancers), and the time required to manufacture and test cells before clinical use. Time delays can be particularly significant in patients with high-grade, relapsed / resistant cancers, where there is a risk of clinical deterioration that may hinder the progress of CAR cell therapy. Furthermore, the production of cell products is not guaranteed, and for patients who can successfully produce products, the proportion of products has limited short- or long-term efficacy. This is likely due to the poor adaptability of autoimmune cells in cancer patients, particularly after therapy targeting aggressive cancers. Finally, autologous cell therapy is administered on an individual patient basis and is associated with significant costs, which limits its wider application.

[0006] Using allogeneic cells, i.e., cells obtained from healthy donors who are not ultimately candidates for gene therapy, could overcome many of these limitations. For example, the use of allogeneic cells could make the production of CAR-manipulated cell products more cost-effective, readily available, and provide higher quality products. Healthy donor cells provide a homogeneous starting material, enabling more predictable production and performance of the resulting cell products. Allogeneic therapy could offer a “ready-made” immunotherapy solution, where a single production chain allows for administration to several patients and / or multiple doses to individual patients. Furthermore, increasing production scale and creating a bank of CAR immune cells produced from healthy donors would increase access to the product while reducing the cost per patient. However, allogeneic CAR cell products carry the risk of potentially inducing graft-versus-host disease or host-mediated rejection, which could limit therapeutic efficacy. [Overview of the project]

[0007] This disclosure provides (i) therapeutic agents and (ii) bicistronic polynucleotides encoding immune surveillance masking molecules (ISMMs), the ISMMs comprising beta-2-microglobulin (B2M) nonfunctional polypeptides and human leukocyte antigens (HLAs). In some embodiments, the therapeutic agent is a chimeric antigen receptor (CAR) comprising an antigen-binding domain that specifically binds to an epitope on a tumor antigen on a target cell. In some embodiments, the antigen-binding domain comprises an antibody or its antigen-binding moiety. In some embodiments, the tumor antigen is disiaroganglioside GD2. In some embodiments, the antibody is dinutuximab or its antigen-binding moiety. See www.accessdata.fda.gov / drugsatfda_docs / label / 2015 / 125516s000lbl.pdf, the full text of which is incorporated herein by reference.

[0008] In some embodiments, the antibody is a single-stranded variable fragment (scFv) containing the variable regions of the heavy chain (VH) and light chain (VL) of dinutuximab. In some embodiments, the dinutuximab scFv contains the protein sequence described in SEQ ID NO: 22. In some embodiments, the antigen-binding domain cross-competes with dinutuximab. In some embodiments, the antigen-binding domain binds to the same epitope as dinutuximab. In some embodiments, the antigen-binding domain contains the VH CDR3 of dinutuximab. In some embodiments, the antigen-binding domain further contains VH CDR1 and VH CDR2. In some embodiments, VH CDR1 contains the VH CDR1 of dinutuximab, and / or VH CDR2 contains the VH CDR2 of dinutuximab. In some embodiments, the antigen-binding domain further contains VL CDR1, VL CDR2, and / or VL CDR3. In some embodiments, VL CDR1 comprises VL CDR1 of dinutuximab, VL CDR2 comprises VL CDR2 of dinutuximab, and / or VL CDR3 comprises VL CDR3 of dinutuximab.In some embodiments, the antigen-binding domain is (i) VH CDR1 of SEQ ID NO: 59, VH CDR2 of SEQ ID NO: 63, and VH CDR3 of SEQ ID NO: 67, and / or VL CDR1 of SEQ ID NO: 71, VL CDR2 of SEQ ID NO: 75, and VL CDR3 of SEQ ID NO: 79, or (ii) VH CDR1 of SEQ ID NO: 60, VH CDR2 of SEQ ID NO: 64, and VH CDR3 of SEQ ID NO: 68, and / or VL CDR1 of SEQ ID NO: 72, VL CDR2 of SEQ ID NO: 76, and VL CDR3 of SEQ ID NO: 80, or (iii) VH CDR1 of SEQ ID NO: 61; VH CDR2 of SEQ ID NO: 65, and VH CDR3 of SEQ ID NO: 69, and / or VL CDR1 of SEQ ID NO: 73, VL CDR2 of SEQ ID NO: 77, and VL CDR3 of SEQ ID NO: 81, or (iv) VH CDR1 of SEQ ID NO: 62, VH CDR1 of SEQ ID NO: 66 (v) VH CDR3 of SEQ ID NO: 70, and / or VL CDR1 of SEQ ID NO: 74, VL CDR2 of SEQ ID NO: 78, and VL CDR3 of SEQ ID NO: 82, or (v) VH CDR1 of SEQ ID NO: 53, VH CDR3 of SEQ ID NO: 54, and VL CDR1 of SEQ ID NO: 55, and / or VL CDR2 of SEQ ID NO: 56, VL CDR2 of SEQ ID NO: 57, and VL CDR3 of SEQ ID NO: 58.

[0009] In some embodiments, the antigen-binding domain comprises VH and VL, where VH comprises the protein sequence described in SEQ ID NO: 44, or VL comprises the protein sequence described in SEQ ID NO: 46. In some embodiments, the antigen-binding domain comprises VH containing the protein sequence described in SEQ ID NO: 44, and VL containing the protein sequence described in SEQ ID NO: 46. In some embodiments, VH and VL are bound via a linker. In some embodiments, VH and VL are bound in a VH-linker-VL or VL-linker-VH configuration. In some embodiments, the linker is a Gly4-Ser linker. In some embodiments, the Gly4-Ser linker contains the sequence described in SEQ ID NO: 84. In some embodiments, the CAR construct is designed as a standard CAR, a split CAR, an off-switched CAR, an on-switched CAR, a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR.

[0010] In some embodiments, the antigen-binding domain is an ig NAR, Fab, Fab', F(ab)'2, F(ab)'3, Fv, single-strand variable fragment (scFv), bis-scFv, (scFv)2, minibody, diabody, triabody, tetrabody, intrabody, disulfide-stabilized Fv protein (dsFv), unibody, nanobody, aphibody, DARPin, monobody, adnectin, alphabody, or a designed binder. In some embodiments, the CAR construct further comprises a transmembrane domain, an intracellular domain, and a spacer located between the antigen-binding domain and the transmembrane domain. In some embodiments, the intracellular domain of the CAR construct is a signaling domain derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD66d, or CD28. In some embodiments, the intracellular domain of the CAR construct is derived from CD28. In some embodiments, the transmembrane domain of the CAR construct is derived from CD28. In some embodiments, the transmembrane domain is linked to the intracellular domain by a linker. In some embodiments, the intracellular and transmembrane domains of the CAR construct are derived from the same molecule. In some embodiments, the transmembrane and intracellular domains are derived from CD28. In some embodiments, the spacer of the CAR construct is a CD8 alpha hinge. In some embodiments, the CAR construct further includes a co-stimulatory domain or a combination thereof. In some embodiments, the co-stimulatory domain is derived from 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, CD3 zeta, and combinations thereof. In some embodiments, the co-stimulatory domain includes a 4-1BB activating domain. In some embodiments, the co-stimulatory domain includes a CD3 zeta activating domain. In some embodiments, the co-stimulatory domain includes both a 4-1BB activating domain and a CD3 zeta activating domain.In some embodiments, the CAR construct comprises the nucleic acid sequence described in SEQ ID NO: 19. In some embodiments, the CAR construct encodes the protein described in SEQ ID NO: 20.

[0011] In some embodiments, the therapeutic agent comprises an antibody or its antigen-binding moiety, an enzyme, a receptor, a cytokine, a coagulation factor, or a hormone. In some embodiments, the B2M nonfunctional polypeptide is a B2M nonfunctional fragment. In some embodiments, the B2M nonfunctional polypeptide is a B2M nonfunctional variant. In some embodiments, the HLA is HLA-E or HLA-G. In some embodiments, the B2M polypeptide and HLA are linked by a linker. In some embodiments, the linker is a Gly4-Ser linker. In some embodiments, the Gly4-Ser linker comprises the sequence described in Sequence ID No. 84. In some embodiments of the bicistronic polynucleotides of this disclosure, (i) the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the ISMM are linked by a 2A (e.g., P2A) element, or (ii) the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the ISMM are linked by an internal ribosome entry site (IRES).

[0012] In some embodiments, the nucleic acid sequence encoding the therapeutic agent includes the sequence described in Sequence ID No. 5. In some embodiments, the nucleic acid sequence encoding ISMM includes the sequence described in Sequence ID No. 6. In some embodiments, the nucleic acid sequence encoding the therapeutic agent includes the sequence described in Sequence ID No. 5, and the nucleic acid sequence encoding ISMM includes the sequence described in Sequence ID No. 6. In some embodiments, the bicistronic polynucleotide is selected from the group consisting of bicistronic construct 1, bicistronic construct 2, bicistronic construct 3, bicistronic construct 4, bicistronic construct 5, bicistronic construct 6, bicistronic construct 7, or bicistronic construct 8. In some embodiments, the bicistronic polynucleotide further includes a 5' sequence complementary to the B2M gene sequence upstream of the insertion site, and a 3' sequence complementary to the B2M gene sequence downstream of the insertion site. In some embodiments, the 5' and 3' sequences have the same length. In some embodiments, the 5' and 3' sequences are at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, and at least about 1000 nucleotides in length. In some embodiments, the bicistronic polynucleotide is selected from the group consisting of all donor 1, all donor 2, all donor 3, all donor 4, all donor 5, all donor 6, all donor 7, or all donor 8.

[0013] In some embodiments, a bicistronic polynucleotide is inserted into a B2M gene, and this insertion inactivates the gene. In some embodiments, the insertion into the B2M gene is mediated by a nuclease. In some embodiments, the insertion into the B2M gene is mediated by a CRISPR / Cas nuclease. In some embodiments, the nuclease is CRISPR / Cas9.

[0014] In some embodiments, the insertion site of the B2M gene is located in an intron. In some embodiments, the insertion site of the B2M gene is located at an intron-exon junction. In some embodiments, the insertion site of the B2M gene is located at an exon. In some embodiments, the exon is located in exon 1. In some embodiments, the insertion site is site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1). In some embodiments, the exon is located in exon 2. In some embodiments, the insertion site is site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2) or site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3). In some embodiments, the exon is located in exon 3. In some embodiments, the insertion site is site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4). In some embodiments, the polynucleotide is a DNA molecule or an RNA molecule. In some embodiments, the CAR is an inducible CAR.

[0015] This disclosure also provides vectors comprising bicistronic polynucleotides disclosed herein operably linked to a regulatory element. In some embodiments, the vector is a viral vector, a mammalian vector, or a bacterial vector. In some embodiments, the vector is a retroviral vector. In some embodiments, the viral vector is selected from the group consisting of adenovirus vectors, lentiviruses, Sendai virus vectors, baculovirus vectors, Epstein-Barr virus vectors, papovavirus vectors, vaccinia virus vectors, herpes simplex virus vectors, hybrid vectors, and adeno-associated virus (AAV) vectors.

[0016] This disclosure also provides compositions comprising the bicistronic polynucleotides disclosed herein, or vectors comprising the bicistronic polynucleotides disclosed herein. Furthermore, kits comprising (i) the bicistronic polynucleotides disclosed herein, (ii) vectors comprising the bicistronic polynucleotides disclosed herein, or (iii) compositions comprising the bicistronic polynucleotides disclosed herein, or vectors comprising the bicistronic polynucleotides disclosed herein are also provided.

[0017] Also provided are therapeutic agents and genetically modified cells expressing ISMM, comprising (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising a bicistronic polynucleotide disclosed herein, or (iii) a composition comprising a bicistronic polynucleotide disclosed herein, or a vector comprising a bicistronic polynucleotide disclosed herein. In some embodiments, the cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, ILC cells, macrophages, or antigen-presenting cells. In some embodiments, the cells are homogeneous. In some embodiments, the genetically modified cells are part of a kit or manufactured article.

[0018] This disclosure also provides (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising a bicistronic polynucleotide disclosed herein, (iii) a composition comprising a bicistronic polynucleotide disclosed herein, or a vector comprising a bicistronic polynucleotide disclosed herein, or a composition comprising cells comprising (i), (ii), or (iii). In some embodiments, such compositions are used to treat subjects in need of therapy. In some embodiments, the therapy is CAR therapy. In some embodiments, the composition is part of a kit or product.

[0019] The present disclosure also provides a pharmaceutical composition for treating cancer in a subject that requires treatment for cancer, the pharmaceutical composition comprising cells genetically modified to express a therapeutic agent and an ISMM, and (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, or (iii) a composition comprising the bicistronic polynucleotide disclosed herein, or a vector comprising the bicistronic polynucleotide disclosed herein. In some embodiments, the pharmaceutical composition is part of a kit or an article of manufacture.

[0020] The present disclosure also provides a pharmaceutical composition for treating cancer in a subject that requires treatment for cancer, the pharmaceutical composition comprising (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide disclosed herein, (iii) a composition comprising the bicistronic polynucleotide disclosed herein, or a vector comprising the bicistronic polynucleotide disclosed herein, or (iv) a cell comprising any of (i), (ii), or (iii).

[0021] Also, (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide of (i), (iii) a composition comprising (i) or (ii), (iv) a kit comprising (i), (ii), or (iii), (v) a cell comprising any of (i), (ii), or (iii), (vi) a composition comprising (v), (vii) a pharmaceutical composition comprising (i), (ii), (iii), (v), or (vi), or (viii) a kit comprising (v), (vi), or (vii) It is also offered for use as a medicine.

[0022] Also, (i) Bicistronic polynucleotides disclosed herein, (ii) A vector containing the bicistronic polynucleotide of (i), (iii) A composition comprising (i) or (ii), (iv) Kits including (i), (ii), or (iii), (v) Cells containing any of (i), (ii), or (iii), (vi)(v) compositions, (vii) A pharmaceutical composition comprising (i), (ii), (iii), (v), or (vi), or (viii) Kits including (v), (vi), or (vii) It is also offered for use as a drug to treat cancer or inflammatory diseases or conditions in those who need it.

[0023] Also, (i) Bicistronic polynucleotides disclosed herein, (ii) A vector containing the bicistronic polynucleotide of (i), (iii) A composition comprising (i) or (ii), (iv) Kits including (i), (ii), or (iii), (v) Cells containing any of (i), (ii), or (iii), (vi)(v) compositions, (vii) A pharmaceutical composition comprising (i), (ii), (iii), (v), or (vi), or (viii) Kits including (v), (vi), or (vii) It is also provided for use in the manufacture of pharmaceuticals to treat cancer or inflammatory diseases or conditions in those who require it.

[0024] This disclosure also provides a method for stimulating a T cell-mediated immune response against a target cell population or tissue in a subject, the method comprising administering an effective amount of cells containing the bicistronic polynucleotides disclosed herein to the subject. Furthermore, a method is provided for providing antitumor immunity to a subject in need thereof, the method comprising administering an effective amount of cells containing the bicistronic polynucleotides disclosed herein to the subject. This disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering an effective amount of cells containing the bicistronic polynucleotides disclosed herein to the subject.

[0025] This disclosure provides a method for preparing a cell population for therapy, comprising transducing a cell population isolated from a subject with a bicistronic polynucleotide, vector, or composition disclosed herein. In some embodiments, the transduction includes culturing the cells under appropriate conditions. In some embodiments, the therapy is allogeneic cell therapy.

[0026] This disclosure provides a method for generating a persistent population of genetically modified cells in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject cells genetically modified to express the bicistronic polynucleotides disclosed herein. It also provides a method for growing a population of genetically modified cells in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject cells genetically modified to express the bicistronic polynucleotides disclosed herein. In some embodiments, the cells are T cells. In some embodiments, the T cells are allogeneic T cells. In some embodiments, the subject is a human subject.

[0027] This disclosure also provides a method for generating allogeneic cells for gene therapy, comprising inserting a bicistronic construct into the B2M gene, the bicistronic construct comprising a nucleic acid encoding a therapeutic agent and a nucleic acid encoding ISMM, the insertion of the bicistronic construct inactivating the B2M gene. In some embodiments, the nucleic acid encoding ISMM comprises a nucleic acid encoding an HLA selected from HLA-E or HLA-G, or a functional variant thereof. In some embodiments, the gene therapy is a CAR-T therapy. In some embodiments, the insertion site in the B2M gene is selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3); or site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4). In some embodiments, the insertion site includes a sequence located approximately 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, or 100 nucleotides upstream or downstream of site 1, site 2, site 3, or the 5' or 3' end of site 3. In some embodiments, the insertion site is an insertion site that overlaps with site 1, site 2, site 3, or site 4. In some embodiments, the insertion site is located at a corresponding position on an antiparallel strand.

[0028] This disclosure provides allogeneic CAR-T cells containing a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding HLA-E is replaced with a nucleic acid sequence encoding HLA-G. In some embodiments, this disclosure provides allogeneic CAR-T cells containing a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding a B2M fragment is replaced with a nucleic acid sequence encoding a TRAC fragment, and the bicistronic construct is inserted into the TRAC gene. In some embodiments, the Disclosure provides allogeneic CAR-T cells containing a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding a fragment of B2M is replaced with a nucleic acid sequence encoding a fragment of CD52, and the bicistronic construct is inserted into the CD52 gene.

[0029] This disclosure provides a kit containing gRNAs for CRISPR / Cas9-mediated insertion in B2M, the gRNAs being selected from site 1 gRNA (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1), site 2 gRNA (AGTCACATGGTTCACACGGC; SEQ ID NO: 2), site 3 gRNA (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3), and site 4 gRNA (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4). [Brief explanation of the drawing]

[0030] [Figure 1] Figure 1 shows the sequences of the four B2M insertion sites disclosed herein, and a schematic diagram showing the location of each insertion site on the B2M gene. [Figure 2]Figures 2A-2E show density plots of flow cytometry assays performed to measure cell surface expression levels of B2M and HLA-A / B / C. Figure 2A: Control cell (Mock) with intact endogenous B2M locus. Figure 2B: Destruction of endogenous B2M locus using a CRISPR reagent targeting site 1 (SEQ ID NO: 1). Figure 2C: Destruction of endogenous B2M locus using a CRISPR reagent targeting site 2 (SEQ ID NO: 2). Figure 2D: Destruction of endogenous B2M locus using a CRISPR reagent targeting site 3 (SEQ ID NO: 3). Figure 2E: Destruction of endogenous B2M locus using a CRISPR reagent targeting site 4 (SEQ ID NO: 4). [Figure 3]Figures 3A and 3B show schematic diagrams of the CAR and HLA-E elements used to design the bicistronic construct. Figure 3A is a schematic diagram of the anti-GD2scFv+CD8aH+CD28™ / IC+4-1BBAD+CD3 zeta AD chimeric antigen receptor (anti-GD2 CAR, SEQ ID NO: 5) component of the bicistronic construct. From the N-terminus to the C-terminus, the CAR component (labeled CAR) contains operably linked elements, followed by a signal peptide, (1) anti-GD2 scFv derived from dinutuximab, (2) CD8 alpha hinge, (3) CD28 transmembrane domain (TM) and CD28 intracellular domain co-labeled as CD28, (4) 4-1BB activating domain, and (5) CD3 zeta activating domain. Figure 3A is a schematic diagram of the B2M+HLA-E immunosurveillance masking molecule (ISMM) (SEQ ID NO: 6) component of the bicistronic construct. The ISMM component (labeled with HLA-E) contains, from N-terminus to C-terminus, a non-functional fragment of the beta-2 microglobulin gene (B2M), a 4-repeat Gly4-Ser linker (i.e., (Gly4Ser)4), and mature human leukocyte antigen-E (HLA-E). Figure 3C is a schematic diagram illustrating the strategy generally used to insert a bicistronic construct containing the ISMM and CAR elements, isolated by either the P2A element or IRES, into a specific position of the B2M gene in donor cells using CRISPR / Cas and homologous recombination. The result is donor cells (allogeneic cells) with an inactivated B2M gene that could be used in CAR T-cell therapy, which would have HLA-E expression that reduces the allogeneic response but protects the cells from allogeneic natural killer (NK) cell-mediated lysis. [Figure 4] Figures 4A and 4B show schematic diagrams of bicistronic structures for insertion into B2M site 1. Figure 4A corresponds to bicistronic structure 1 (BC1) having a 2A (P2A) element between the ISMM and CAR components of the structure. Figure 4B corresponds to bicistronic structure 2 (BC2) having an IRES element between the ISMM and CAR components of the structure. [Figure 5]Figures 5A and 5B show schematic diagrams of bicistronic structures for insertion in B2M site 2 or 3. Figure 5A corresponds to bicistronic structure 3 (BC3) when inserted in site 2, or bicistronic structure 5 (BC5) when inserted in site 3, and has a 2A (P2A) element between the ISMM and CAR components of the structure. Figure 5B corresponds to bicistronic structure 4 (BC4) when inserted in site 2, or bicistronic structure 5 (BC6) when inserted in site 3, and has an IRES element between the ISMM and CAR components of the structure. [Figure 6] Figures 6A and 6B show schematic diagrams of bicistronic structures for insertion into B2M site 4. Figure 6A corresponds to bicistronic structure 7 (BC7) having a 2A (P2A) element between the ISMM and CAR components of the structure. Figure 6B corresponds to bicistronic structure 8 (BC8) having an IRES element between the ISMM and CAR components of the structure. [Figure 7] Figures 7A and 7B show schematic diagrams of the total donor generated from BC1 and BC2 (named total donor 1 (FD1) and total donor 2 (FD2), respectively) by adding a 1,000 bp B2M gene (500 bp on each side) adjacent to CRISPR site 1 to create homology arms to drive site-directed recombination within the frame. [Figure 8] Figures 8A and 8B show schematic diagrams of the total donors generated from BC3, BC4, BC5, and BC6 (named total donor 3 (FD3), total donor 4 (FD4), total donor 5 (FD5), and total donor 6 (FD6), respectively) by adding a 1,000 bp B2M gene (500 bp on each side) adjacent to CRISPR site 2 or site 3 to create homology arms to drive site-directed recombination within the frame. [Figure 9]Figures 9A and 9B show schematic diagrams of the total donor generated from BC7 and BC8 (named total donor 7 (FD7) and total donor 8 (FD8), respectively) by adding a 1,000 bp B2M gene (500 bp on each side) adjacent to CRISPR site 4 to create homology arms to drive site-directed recombination within the frame. [Figure 10] Figures 10A–10D show density plots of flow cytometry assays performed to measure cell surface expression levels of HLA-A / B / C and HLA-E. Figure 10A: Untreated control cells (Mock). Figure 10B: Insertion of FD2 at site 1 of the B2M gene. Figure 10C: Insertion of FD6 at site 3 of the B2M gene. Figure 10D: Insertion of FD8 at site 4 of the B2M gene. [Figure 11] Figures 11A–11D show density plots of flow cytometry assays performed to measure cell surface expression levels of HLA-A / B / C and HLA-E. Figure 11A: Untreated control cells (Mock). Figure 11B: Insertion of FD1 at site 1 of the B2M gene. Figure 11C: Insertion of FD5 at site 3 of the B2M gene. Figure 11D: Insertion of FD6 at site 3 of the B2M gene. [Figure 12] Figure 12 shows plots representing the percentage change (%) between transformed T cells and CHP-134 neuroblastoma cells present in co-culture at different ratios (1:1, 2:1, 4:1, or 10:1) from the start of co-culture to 24 hours later. All transformed T cells used in the experiment contained a bicistronic construct targeting the B2M insertion site 1, which has a 2A element (P2A), i.e., the CAR and ISMM portions of the construct connected by bicistronic construct 1 (Figure 4A). [Figure 13]Figure 13 shows plots representing the percentage change (%) between transformed T cells and CHP-134 neuroblastoma cells present in co-culture at different ratios (1:1, 2:1, 4:1, or 10:1) from the start of co-culture to 24 hours later. All transformed T cells used in the experiment contained a bicistronic construct targeting the B2M insertion site 3, which has a 2A element (P2A), a CAR portion of the construct connected by a bicistronic construct 5, and an ISMM portion of the construct (see Figure 5A). [Figure 14] Figure 14 shows plots representing the percentage change (%) in CHP-134 neuroblastoma present in co-cultures with transformed T cells at different ratios (1:1, 2:1, 4:1, or 10:1) from the start of co-culture to 24 hours later. All transformed T cells used in the experiment contained a bicistronic construct targeting the B2M insertion site 3, which has the CAR and ISMM portions of the construct connected by the IRES, bicistronic construct 6 (see Figure 5B). [Modes for carrying out the invention]

[0031] This disclosure provides (i) therapeutic agents and (ii) bicistronic polynucleotides encoding immunosurveillance masking molecules (ISMMs), the ISMMs comprising non-functional beta-2-microglobulin (B2M) polypeptides and human leukocyte antigens (HLAs). As used herein, the terms “immunosurveillance masking molecule” and “ISMM” refer to polynucleotide constructs and their polypeptide products, e.g., constructs encoding B2M non-functional polypeptides (e.g., non-functional fragments or non-functional variants thereof), and HLA polypeptides or functional fragments or functional variants thereof, the expression of which reduces immunogenicity.

[0032] Beta-2 microglobulin (abbreviated as "B2M") is a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of virtually all nucleated cells. Inactivation of the B2M gene can prevent allogeneic antigen presentation by injected T cells. The absence of functional B2M impedes the recognition of recipient T cells by allogeneic CAR T cells via HLA / MHC interactions. Nevertheless, the absence of functional B2M expression in engineered T cells can still be recognized as exogenous cells and thus may trigger an immune response. For this reason, the bicistronic constructs of this disclosure include a polynucleotide sequence encoding HLA-E (or alternatively HLA-G) in addition to inactivating B2M via their insertion into the B2M gene.

[0033] The HLA class I histocompatibility antigen, alpha chain E, is also known as MHC class I antigen E (abbreviated as "HLA-E"), and is a protein encoded by the HLA-E gene in humans. Human HLA-E is a non-classical MHC class I molecule, characterized by more limited polymorphism and lower cell surface expression than its classical paralog, and is common to all humans.

[0034] The expression of a partially but inactive B2M-coding construct fused in-frame with the HLA-E molecule allows the immune system to sense that genetically modified cells, while lacking B2M expression, are human and not dangerous. CAR-T cells expressing the HLA-E molecule are not perceived as exogenous despite the lack of functional B2M expression; therefore, they do not trigger an immune response, and certain NK cell fractories are not induced via "deficient cell" lysis.

[0035] The insertion of the bicistronic polynucleotides of this disclosure at specific insertion sites in the B2M gene accomplishes two important tasks. First, the insertion of bicistronic polynucleotides inactivates the B2M gene and thus generates cells that can be used for allogeneic therapy, such as CAR-T gene therapy or gene replacement therapy. For example, inserting a CAR into the B2M gene for a particular type of cancer, or inserting a functional copy of a gene to compensate for the presence of a defective gene (e.g., a blood clotting factor, enzyme, or hormone). Second, the generation of allogeneic cells for gene therapy is simplified because B2M inactivation and therapeutic gene insertion are performed in the same operation. Furthermore, by inserting bicistronic polynucleotides into the existing B2M gene, an expression process controlled by the endogenous B2M promoter is created, eliminating the need to provide an exogenous promoter. The result of using the B2M promoter is that the regulatory signals that control B2M expression and homeostasis can equally regulate the expression of the manipulated bicistronic constructs of this disclosure, which may not be expressed at excessively high or excessively low levels, as the expression of the bicistronic constructs may be under the control of an exogenous promoter.

[0036] Notably, the use of 2A elements (e.g., P2A) to separate the therapeutic agents (e.g., the CAR portion of the construct) and the ISMM portion of the bicistronic polynucleotides disclosed herein has been found to have a significant positive effect on expression with respect to the use of IRES.

[0037] The cell engineering approach for generating allogeneic cells presented herein can be extended beyond B2M. Using this approach, for example, bicistronic polypeptides similar to alternative or additional genes that can be knocked out to generate allogeneic cells can be inserted. For example, the bicistronic constructs of this disclosure can be inserted into the T cell receptor alpha constant gene (TRAC), the programmed cell death protein 1 gene (also known as PDCD1, PD-1, or CD279), the CD52 gene, the SAG gene (S-arrestin), or any combination thereof. Therefore, in some embodiments, one or more bicistronic polynucleotides may be inserted at one or more positions in the B2M, TRAC, PDCD1, SAG, or CD52 gene, or combinations thereof, using the method disclosed herein. This approach can also be used to insert bicistronic polypeptides similar to additional genes that are generally knocked out, for example, to increase the potency of allogeneic cells, such as CD5. Therefore, in some embodiments, one or more bicistronic polynucleotides can be inserted at one or more positions within the CD5 gene using the methods disclosed herein.

[0038] Similarly, the cell manipulation approaches for generating allogeneic cells expressing the disclosed CARs can be extended to other therapeutic proteins, such as antibodies, enzymes, coagulation factors, and the like. Likewise, the cell manipulation methods disclosed herein can be applied to generate allogeneic cells containing polycistronic polynucleotides, including one or more ISMMs (e.g., an ISMM containing HLA-E and a second ISMM containing HLA-G) and one or more therapeutic proteins (e.g., the heavy and light chains of an antibody, or multiple subunits of a therapeutic protein).

[0039] Before describing this disclosure in detail, it should be understood that this disclosure is not limited to the specific compositions or process steps described, and such compositions or process steps may vary. As will become apparent to those skilled in the art by reading this disclosure, each of the individual embodiments described and illustrated herein has separate components and features that can be readily separated from or combined with features of any of several other embodiments without departing from the scope or spirit of this disclosure. Any of the enumerated methods may be carried out in the order of the enumerated events, or in any other logically possible order.

[0040] The headings provided herein are not limitations on the various aspects of this disclosure that may be defined by referring to this disclosure as a whole. Since the scope of this disclosure is limited only by the appended claims, it should also be understood that the terms used herein are intended to describe only specific aspects, and not to limit them.

[0041] Therefore, terms defined hereafter are more fully defined by referring to this specification in their entirety.

[0042] I. Definition To facilitate understanding of this specification, certain terms are defined first. Additional definitions are provided throughout the detailed explanation.

[0043] It should be noted that the term “one (a)” or “one (an)” entity refers to one or more of those entities; for example, “a nucleotide sequence” is understood to represent one or more nucleotide sequences. Thus, the terms “one (a)” (or “one (an)”), “one or more,” and “at least one” can be used interchangeably herein. Furthermore, it should be noted that claims may be drafted to exclude any optional element. Thus, this statement is intended to serve as a priori basis for limitation for the use of exclusive terms such as “only,” “this only,” and similar terms in connection with the enumeration of elements of a claim or the use of negative limitations.

[0044] Furthermore, as used herein, “and / or” is taken as a specific disclosure having one or not having the other of each of the two identified features or components. Therefore, as used herein in phrases such as “A and / or B,” the term “and / or” is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Similarly, as used in phrases such as “A, B, and / or C,” the term “and / or” is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0045] Whenever an aspect is described herein with the word “comprising,” it is understood that similar aspects are also provided, described in other ways in terms of “consisting of” and / or “consisting essentially of.”

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure relates. For example, *Concise Dictionary of Biomedicine and Molecular Biology*, Juo, Pei-Show, 2nd ed., 2002, CRC Press, *The Dictionary of Cell and Molecular Biology*, 3rd ed., 1999, Academic Press, and *Oxford Dictionary of Biochemistry and Molecular Biology*, Revised, 2000, Oxford University Press provide general dictionaries for many of the terms used herein to those skilled in the art.

[0047] Units, prefixes, and symbols are shown in the Systeme International de Unites (SI) approved form. Numerical ranges include both ends of the numerical value defining the range. When ranges of values ​​are enumerated, it is understood that each intervening integer value between the upper and lower limits of the enumerated range, and each segment thereof, is also specifically disclosed along with each subrange between such values. The upper and lower limits of any range may be independently included in or excluded from a range, and each range that includes either one of the limits, neither, or both is also included in this disclosure. Therefore, ranges enumerated herein are understood to be abbreviations for all values ​​within the range, including the enumerated endpoints. For example, the range 1 to 10 is understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0048] Where values ​​are explicitly enumerated, it is understood that values ​​that are substantially the same quantity or amount as the enumerated values ​​are also within the scope of this disclosure. Where combinations are disclosed, each subcombination of the elements of that combination is also specifically disclosed and is also within the scope of this disclosure. Conversely, where different elements or groups of elements are disclosed individually, their combinations are also disclosed. Where any element of this disclosure is disclosed as having multiple substitutes, examples of this disclosure in which each substitute is excluded, either alone or in any combination with other substitutes are also disclosed herein, and two or more elements of this disclosure may have such exclusions, and all combinations of elements having such exclusions are disclosed herein.

[0049] Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleotide sequences are written from left to right in a 5' to 3' orientation. Nucleotides are referred herein by their commonly known single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Thus, "a" represents adenine, "c" represents cytosine, "g" represents guanine, "t" represents thymine, and "u" represents uracil.

[0050] Content: The term "approximately" is used herein to mean roughly, roughly, approximately, or within a certain range. When the term "approximately" is used in conjunction with a numerical range, it modifies that range by extending the boundary above and below the stated number. Generally, the term "approximately" can modify a number above and below the stated value by, for example, 10 percent above or below (higher or lower).

[0051] Administration: As used herein, the terms "administer", "administering", and their grammatical variants refer to introducing a composition comprising a bicistronic polynucleotide, such as a polynucleotide, vector, or cell, disclosed herein, into a subject via a pharmaceutically acceptable route. Introduction of the composition into the subject can be by any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intrathecal, intratumoral, periorbital, or topical. Administration includes self-administration and administration by another person. The appropriate route of administration enables the composition or agent to perform its intended function. For example, if the appropriate route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject. In some embodiments, cells are administered. In some embodiments, the cells can be transplanted.

[0052] Antibody: As used herein, the term "antibody" (Ab) should include, but is not limited to, a glycoprotein immunoglobulin that specifically binds to an antigen and comprises at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen-binding portion thereof. Each H chain comprises a heavy chain variable region (abbreviated herein as V H1 and a heavy chain constant region. The heavy chain constant region comprises three constant domains, C H1 C H2 and C H3 Each light chain comprises a light chain variable region (abbreviated herein as V L [ and a light chain constant region. The light chain constant region comprises one constant domain, C L The V H region and the V L region can be further subdivided into hypervariable regions called complementarity determining regions (CDRs) interspersed with more conserved regions called framework regions (FRs). Each V<00,00009>and V LIt comprises three CDRs and four FRs arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. Thus, for example, the term “anti-GD2 antibody” includes a complete antibody having two heavy chains and two light chains that specifically bind to the antigen-binding moiety of GD2 and the complete antibody. Non-limiting examples of antigen-binding moieties are shown elsewhere in this specification. In certain aspects of this disclosure, the anti-GD2 antibody is dinutuximab (UNITUXIN®) or its antigen-binding moiety.

[0053] In recent years, a wide variety of recombinant antibody forms have been developed, such as trivalent or tetravalent bispecific antibodies. Examples include the IgG antibody format and single-chain domain fusion (for other formats, see, for example, Coloma, MJ, et al, Nature Biotech 15 (1997), 159-163, WO 2001 / 077342, Morrison, SL, Nature Biotech 25 (2007), 1233-1234, Holliger. P. et Al., Nature Biotech. 23 (2005), 1 126-1 136, Fischer, N., and Leger, O., Pathobiology 74 (2007), 3-14, Shen, J., et. al, J. Immunol. Methods 318 (2007), 65-74, Wu, C, et al., Nature Biotech. 25 (2007), 1290-1297). Bispecific antibodies include trivalent or tetravalent bispecific antibodies produced according to the methods disclosed in WO2009 / 080251, WO2009 / 080252, WO2009 / 080253, WO2009 / 080254, WO2010 / 112193, WO2010 / 115589, WO2010 / 136172, WO2010 / 145792, WO2010 / 145793, and WO2011 / 117330, all of which are incorporated herein by reference in their entirety. Those skilled in the art will understand that higher valencies may also be used.

[0054] Antigen: The term "antigen" refers to a molecule that triggers an immune response. This immune response may involve either antibody production or activation of certain immunologically capable cells, or both. Those skilled in the art will understand that virtually any macromolecule, including proteins or peptides, can act as an antigen. Furthermore, antigens can originate from recombinant DNA or genomic DNA.

[0055] Antigen-binding portion: The "antigen-binding portion" of an antibody (also called the "antigen-binding fragment") refers to one or more fragments of the antibody that possess the ability to specifically bind to the antigen to which the entire antibody binds. It has been shown that the antigen-binding function of an antibody can be performed by fragments of the full-length antibody. Examples of binding fragments included in the term "antigen-binding portion" of an antibody, for example, in the case of an anti-GD2 antibody, (i)V L , V H (ii) a Fab fragment (fragment from papain cleavage) or a similar monovalent fragment consisting of LC and CH1 domains, (ii) a F(ab')2 fragment (fragment from pepsin cleavage) or a similar divalent fragment containing two Fab fragments linked by disulfide bridges in the hinge region, (iii) V H Fd fragment consisting of domain and CH1 domain, (iv) single arm of antibody V L Domain and V H The Fv fragment and (v)dAb fragment, consisting of domains (Ward et al., (1989) Nature 341:544-546), are V H (vi) an isolated complementarity-determining region (CDR) consisting of domains, and (vii) a combination of two or more isolated CDRs that can be optionally joined by a synthetic linker. Furthermore, the two domains of the Fv fragment V L and V H These are encoded by separate genes, but they can be synthesized using recombination methods. L and V HThese can be linked by synthetic linkers, which allow the regions to be paired and constructed as a single protein chain forming a monovalent molecule (also known as single-stranded Fv (scFv); see, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single-stranded antibodies are also intended to be encompassed within the term "antigen-binding portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility in the same manner as intact antibodies. Antigen-binding portions can be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact immunoglobulins.

[0056] Approximately: As used herein, the term “approximately” means, when applied to one or more reference values, a value similar to the given reference value. In certain embodiments, unless otherwise stated or otherwise evident from the context, the term “approximately” means a range of values ​​that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the given reference value (unless such numbers would exceed 100% of the possible value).

[0057] CAR: The term "chimeric antigen receptor," or alternatively "CAR," typically refers to a pair of two polypeptides in their simplest form, which, when present in an immune effector cell, provides the cell with specificity to target cells, typically cancer cells, and provides intracellular signaling. In some embodiments, a CAR includes at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also called the "intracellular signaling domain"), comprising a functional signaling domain derived from a stimulating and / or co-stimulating molecule as defined below. In some embodiments, the set of polypeptides are on the same polypeptide chain, e.g., a chimeric fusion protein. In some embodiments, the set of polypeptides are not contiguous with each other, e.g., on different polypeptide chains. In some embodiments, the set of polypeptides includes a dimerizing switch that can link the polypeptides together in the presence of a dimerizing molecule, e.g., a dimerizing switch that can link the antigen-binding domain to the intracellular signaling domain. In some embodiments, the stimulating molecule of the CAR is a zeta chain associated with the T cell receptor complex (CD3 zeta). In some embodiments, the cytoplasmic signaling domain includes a primary signaling domain (e.g., the primary signaling domain of CD3 zeta). In some embodiments, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In some embodiments, the co-stimulatory molecule is selected from the co-stimulatory molecules described herein, e.g., 4-1BB, CD27, and / or CD28.

[0058] In some embodiments, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulating molecule, wherein the antigen-binding domain and the transmembrane domain are linked by a CAR spacer. In some embodiments, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain linked to the transmembrane domain via a CAR spacer, and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulator and a functional signaling domain derived from a stimulator. In some embodiments, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain linked to the transmembrane domain via a CAR spacer, and an intracellular signaling domain comprising two functional signaling domains derived from one or more co-stimulators and a functional signaling domain derived from a stimulator. In some embodiments, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain linked to the transmembrane domain via a CAR spacer, and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more co-stimulators and a functional signaling domain derived from a stimulator. In some embodiments, the CAR comprises an optional leader sequence at the amino terminus (N terminus) of the CAR. In some embodiments, the CAR further includes a leader sequence at the N-terminus of the antigen-binding domain, which is optionally cleaved from the antigen-binding domain (e.g., scFv) during cell processing and localization of the CAR to the cell membrane.

[0059] CDR: As used herein, the term “complementarity-determining region” or “CDR” refers to the sequence of amino acids within the antibody variable region that confers antigen specificity and binding affinity. For example, there are generally three CDRs within each heavy chain variable region (e.g., HCDR1, HCDR2, and HCDR3) and three CDRs within each light chain variable region (LCDR1, LCDR2, and LCDR3). The precise amino acid sequence boundaries of a given CDR can be determined using any of the many well-known schemes, including those described in Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (“Kabat” numbering scheme), Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme), or combinations thereof. Under the Kabat numbering scheme, in some embodiments, CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3), and CDR amino acid residues in the light chain variable domain (VL) are numbered 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3). Under the Chothia numbering scheme, in some embodiments, CDR amino acids in the VH are numbered 26-32 (HCDR1), 52-56 (HCDR2), and 95-102 (HCDR3), and CDR amino acid residues in the VL are numbered 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3). In a combination of Kabat and Chothia numbering schemes, in some embodiments, a CDR corresponds to an amino acid residue that is part of a Kabat CDR, a Chothia CDR, or both.For example, in some embodiments, CDR corresponds to amino acid residues 26-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3) in VH, e.g., mammalian VH, e.g., human VH, and amino acid residues 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) in VL, e.g., mammalian VL, e.g., human VL.

[0060] Complement: As used herein, the term “complement” refers to a sequence that is complementary to a reference sequence. Complementarity is a property shared between two DNA or RNA sequences, and is therefore a fundamental principle of DNA replication and transcription. It is well known that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequence become complementary, just as one would look in a mirror and see the opposite of the other. Thus, for example, the complement of the sequence 5'“ATGC”3' may be described as 3'“TACG”5' or 5'“GCAT”3'. As used herein, the terms “reverse complement,” “reverse complement,” and “reverse complementarity” are interchangeable with the terms “complement,” “complementary,” and “complementarity.” In some embodiments, the term “complementary” refers to 100% match or complementarity (i.e., perfectly complementary) to a continuous nucleic acid sequence. In some embodiments, the term “complementary” refers to a match or complementarity of at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% to a continuous nucleic acid sequence.

[0061] Complementary: The terms “complementary” and “complementarity” refer to two or more polynucleotides (i.e., each containing a nucleic acid base sequence) that are related to each other by the Watson-Crick base pairing rules. For example, the nucleic acid base sequence “TGA(5'→3')” is complementary to the nucleic acid base sequence “ACT(3'→5')”. Complementarity may be “partial” in that less than all of the nucleic acid bases of a given polynucleotide sequence match those of the other polynucleotide sequence according to the base pairing rules. For example, in some embodiments, the complementarity between a given polynucleotide sequence and another polynucleotide sequence may be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. On the other hand, to continue the examples, there may be “complete” or “perfect” (100%) complementarity between a given polynucleotide sequence and another polynucleotide sequence. The degree of complementarity between polynucleotide sequences has a significant effect on the efficiency and intensity of hybridization between sequences.

[0062] Conservation: As used herein, the term “conserved” refers to a nucleotide in a polynucleotide sequence that occurs unchanged at the same position in two or more sequences being compared. Relatively conserved nucleotides are those that are conserved between related sequences more than any other nucleotides in the sequence.

[0063] Correspondence: When referring to two distinct nucleic acid sequences or nucleotide sequences, the terms “corresponding” and “corresponding” may be used to clarify regions of sequences that correspond to or are similar to each other based on homology and / or functionality, although the nucleotides of particular sequences may be numbered differently. In addition, it is recognized that different numbering systems may be employed when characterizing nucleic acids or nucleotide sequences. Furthermore, it is recognized that the nucleotide sequences of nucleic acid sequences, or different variants of nucleic acids, may be different. However, as used herein, regions of variants of nucleic acids or nucleotide sequences that share homology and / or functionality are considered to “correspond” to each other.

[0064] Derivation: As used herein, the terms “derived” or “derivative” refer to components isolated from a particular molecule or constructed using a particular molecule or information from a particular molecule (e.g., nucleic acid sequences). For example, a polynucleotide sequence derived from another polynucleotide sequence may contain polynucleotide sequences identical or substantially similar to the polynucleotide sequence from which it is derived. In the case of polynucleotides, the species from which they are derived can be obtained, for example, by spontaneous mutagenesis, artificial directional mutagenesis, or artificial random mutagenesis. Mutagenesis used to induce polynucleotides can be intentionally oriented, intentionally random, or a mixture of each. Mutagenesis of a polynucleotide to produce a different polynucleotide derived from a first polynucleotide can be a random event (e.g., caused by polymerase infidelity), and the identification of the polynucleotide from which it is derived can be done by appropriate screening methods known in the art.In some embodiments, the polynucleotide sequence derived from the first polynucleotide sequence is at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, The derived polynucleotide sequence has sequence identity of at least approximately 77%, at least approximately 78%, at least approximately 79%, at least approximately 80%, at least approximately 81%, at least approximately 82%, at least approximately 83%, at least approximately 84%, at least approximately 85%, at least approximately 86%, at least approximately 87%, at least approximately 88%, at least approximately 89%, at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or at least 100% identity to each of the first polynucleotide sequences, and the derived polynucleotide sequence retains the biological activity of the original polynucleotide.

[0065] Downstream / Upstream: The term "downstream" refers to a nucleotide sequence located 3' relative to a reference nucleotide sequence. In certain embodiments, downstream nucleotide sequences relate to sequences that follow the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site. The term "upstream" refers to a nucleotide sequence located 5' relative to a reference nucleotide sequence.

[0066] Encoding: The term "encoding" refers to the inherent properties of a particular sequence of nucleotides within a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in a biological process that have either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties derived therefrom. Thus, a gene, cDNA, or RNA codes for a protein if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for the transcription of the gene or cDNA, can be said to code for a protein or other product of that gene or cDNA.

[0067] Unless otherwise specified, the nucleotide sequences encoding CARs in this disclosure, for example, nucleotide sequences encoding polynucleotides, are degenerate versions of each other and include all nucleotide sequences encoding the same amino acid sequence.

[0068] Epitope: As used herein, the term “epitope” refers to a portion of an antigen that specifically interacts with an antibody molecule. These portions, referred herein as epitope determinants, typically include or are part of elements such as amino acid side chains or sugar side chains. Epitope determinants can be defined, for example, by methods known in the art, such as crystallography or hydrogen-deuterium exchange. At least one or part of the portions on the antibody molecule that specifically interact with an epitope determinant is generally located within the CDR. Generally, epitopes have specific three-dimensional structural properties. Generally, epitopes have specific charge properties. Some epitopes are linear epitopes, while others are conformational epitopes.

[0069] Expression: As used herein, the term “expression” refers to the process by which a polynucleotide produces a gene product, such as RNA or polypeptide. This includes, but is not limited to, the transcription of a polynucleotide into messenger RNA (mRNA) and the translation of mRNA into polypeptide. Expression produces a “gene product.” As used herein, a gene product can be either a nucleic acid, such as messenger RNA produced by the transcription of a gene, or a polypeptide translated from the transcript. In some embodiments, the terms “expression” or “expression” are used to refer to the transcription and translation that occur within a cell. The level of expression of a product gene within a host cell can be determined based on either the amount of corresponding mRNA present in the cell, or the amount of protein encoded by the product gene produced by the cell, or both.

[0070] Fragment: As used herein, the term “fragment,” for example, a B2M fragment, refers to a polynucleotide or polypeptide sequence that is shorter than a naturally occurring gene or protein. For example, in a polynucleotide fragment, portions of the polynucleotide sequence are deleted compared to a naturally occurring polynucleotide. Similarly, in a polypeptide fragment, portions of the polypeptide sequence are deleted compared to a naturally occurring polypeptide.

[0071] Functional / Non-functional Fragments: As used herein, the term “functional fragment” refers to a polynucleotide fragment or a polypeptide encoded by such a polynucleotide fragment, e.g., a fragment of a B2M gene, or a fragment of a B2M protein that retains at least partially the functionality of an intact gene or protein. Thus, in some embodiments, functional fragments of B2M proteins disclosed herein retain the ability to associate with major histocompatibility complex (MHC) class I heavy chains. Conversely, “non-functional fragments” will lack one or more of the functional properties of the parent molecule.

[0072] Whether the B2M promoter fragments disclosed herein are functional or non-functional fragments can be evaluated by methods known in any art without excessive experimentation. In some embodiments, functional fragments retain, for example, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the intact B2M protein to associate with major histocompatibility complex (MHC) class I heavy chains. In some embodiments, non-functional fragments retain, for example, less than about 20%, less than about 10%, less than about 5%, or completely lack the ability of the intact B2M protein to associate with major histocompatibility complex (MHC) class I heavy chains.

[0073] Functional Variants / Non-Functional Variants: As used herein, the term “functional variant” refers to a polynucleotide variant or polypeptide (i.e., a mutant molecule having one or more substitutions, deletions, or insertions) encoded by such polynucleotide variants, e.g., variants of the B2M gene, or variants of the B2M protein that retain at least partially the functionality of the intact gene or protein. Thus, in some embodiments, functional variants of the B2M protein disclosed herein retain the ability to associate with major histocompatibility complex (MHC) class I heavy chains. Conversely, a “non-functional variant” will lack one or more functional properties of the parent molecule. Whether a variant of the B2M promoter disclosed herein is a functional or non-functional variant can be assessed by methods known in any art without excessive experimentation. In some embodiments, functional variants retain, for example, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the intact B2M protein to associate with major histocompatibility complex (MHC) class I heavy chains. In some embodiments, non-functional variants lack, for example, less than about 20%, less than about 10%, less than about 5%, or the ability of the intact B2M protein to associate with major histocompatibility complex (MHC) class I heavy chains at all.

[0074] Gene: The terms “gene,” “coding sequence,” and “coding nucleic acid,” and their grammatical variants, are used interchangeably within this disclosure and generally refer to nucleic acids (RNA or DNA molecules) containing a nucleotide sequence that codes for a gene of interest, such as a protein, for example, a therapeutic protein such as an antibody or CAR. The coding sequence may further include start and termination signals operably ligated to a promoter and a polyadenylation signal, which have the ability to direct expression within the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may be codon-optimized.

[0075] Identical: In some embodiments, two or more sequences are said to be “completely conserved” or “identical” if they are 100% identical to each other. In some embodiments, two or more sequences are said to be “highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to each other. In some embodiments, two or more sequences are said to be “conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be “conserved” if they are approximately 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to one another. Sequence conservation may apply to the entire length of a polynucleotide or polypeptide, or to a portion, region, or feature thereof.

[0076] Identity: As used herein, the term “identity” refers to the overall monomeric conservation between macromolecules, such as polypeptide molecules or polynucleotide molecules (e.g., DNA molecules and / or RNA molecules). The term “identical” without any additional modifiers, for example, “protein A is identical to protein B,” implies that the sequences are 100% identical (100% sequence identity). Describing two sequences as, for example, “70% identical” is equivalent to describing them as having, for example, “70% sequence identity.”

[0077] The percentage of identity between two polypeptide or polynucleotide sequences can be calculated, for example, by aligning the two sequences for optimal comparison purposes (for example, gaps can be introduced in one or both of the first and second polypeptide or polynucleotide sequences for optimal alignment, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the length of the sequences aligned for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence. Then, the amino acids, or bases in the case of polynucleotides, at the corresponding amino acid positions are compared.

[0078] If a position in a first sequence is occupied by the same amino acid as a corresponding position in a second sequence, then the molecules are identical at that position. The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. Sequence comparison and determination of the percentage of identity between two sequences can be achieved using mathematical algorithms.

[0079] Appropriate software programs are available from various sources and can be used for both protein and nucleotide sequence alignment. One suitable program for determining sequence identity percentage is bl2seq, which is part of the BLAST suite of programs available from the BLAST website of the U.S. National Center for Biotechnology Information (blast.ncbi.nlm.nih.gov). Bl2seq performs comparisons between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs include Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS bioinformatics program suite and are available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa. In one particular aspect, sequence identity corresponds to a global pairwise alignment sequence identity ratio, determined using a program that runs the Needleman-Wunsch algorithm (e.g., Needle, available at ebi.ac.uk / Tools / psa / emboss_needle / ).

[0080] Sequence alignment can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, Clustal X, or Clustal Omega), MUSCLE, etc.

[0081] Different regions within a single polynucleotide or polypeptide target sequence that align with a polynucleotide or polypeptide reference sequence can each have their own sequence identity percentage. Note that the sequence identity percentage is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. Also note that length values ​​are always integers.

[0082] In certain embodiments, the percentage of identity (%ID) or the percentage of identity (%ID) of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 × (Y / Z), where Y is the number of amino acid residues (or nucleic acid bases) scored as perfect matches in the alignment of the first and second sequences (as aligned by visual inspection or a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is longer than the second sequence, the percentage of identity of the first sequence to the second sequence is higher than the percentage of identity of the second sequence to the first sequence.

[0083] Those skilled in the art will understand that the generation of sequence alignments for calculating sequence identity percentages is not limited to binary sequence-to-sequence comparisons driven exclusively by primary sequence data. It will also be understood that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., mutation sites), or phylogenetic data. Suitable programs for integrating heterogeneous data to generate multiple sequence alignments include T-Coffee, available at tcoffee.org, and alternatively, EBI, for example. It will also be understood that the final alignments used to calculate sequence identity percentages can be supervised either automatically or manually.

[0084] Intracellular signaling domain: As used herein, “intracellular signaling domain” refers to the intracellular portion of a molecule. Intracellular signaling domains can generate signals that promote the immune effector function of CAR-containing cells, such as CAR T cells. Examples of immune effector function in CAR T cells include helper activities, such as cytolytic activity and cytokine secretion. In some embodiments, the intracellular signaling domain is a portion of a protein that transduces effector function signals and directs the cell to perform a specific function. The entire intracellular signaling domain can be used, but often it is not necessary to use the entire chain. To the extent that a cleaved portion of the intracellular signaling domain is used, such a cleaved portion can be used in place of the intact chain, as long as it transmits the effector function signal. Therefore, the term intracellular signaling domain means that it includes any cleaved portion of an intracellular signaling domain sufficient to transduce an effector function signal.

[0085] In one embodiment, the intracellular signaling domain may include a primary intracellular signaling domain. An exemplary primary intracellular signaling domain may originate from a primary stimulus or a molecule involved in antigen-dependent simulation. In one embodiment, the intracellular signaling domain may include a co-stimulatory intracellular domain. An exemplary co-stimulatory intracellular signaling domain may originate from a co-stimulatory signal or a molecule involved in antigen-independent stimulation. For example, in the case of CAR T cells, the primary intracellular signaling domain may include the cytoplasmic sequence of the T cell receptor, and the co-stimulatory intracellular signaling domain may include the cytoplasmic sequence from the co-receptor or co-stimulatory molecule.

[0086] The primary intracellular signaling domain may contain signaling motifs known as immune receptor tyrosine-based activation motifs or ITAMs. Examples of ITAM-containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3 zeta, FcR gamma, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc epsilon rib), CD3 gamma, CD3 delta, CD3 epsilon, CD22, CD79a, CD79b, CD278 (ICOS), FcεRI, CD66d, CD32, DAP10, and DAP12.

[0087] Mismatch: The term “mismatch” refers to one or more nucleic acid bases (whether consecutive or separated) in the oligomeric nucleic acid sequence that do not match the target premRNA according to the base pairing rules. While perfect complementarity is often desirable, some embodiments may include one or more, but preferably six, five, four, three, two, or one, mismatches with respect to the target premRNA. This includes deformation at any location within the oligomer. In certain embodiments, the antisense oligomers of this disclosure include deformation in the nucleic acid sequence near the terminals, deformation within the sequence, and, if present, typically within about six, five, four, three, two, or one subunit at the 5' and / or 3' ends. In certain embodiments, one, two, or three nucleic acid bases may be removed while still providing on-target binding.

[0088] Nucleic acid: The terms “nucleic acid,” “nucleic acid molecule,” “nucleotide sequence,” and “polynucleotide,” and their grammatical variations, are used interchangeably and refer to either single-stranded or double-helixed phosphate ester polymers of ribonucleosides (adenosine, guanosine, uridine, or cytidine; “RNA molecule”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecule”), or any phosphate ester analogue thereof (phosphorothioates and thioesters, etc.). Single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The terms nucleic acid molecule, and especially DNA molecule or RNA molecule, refer only to the primary and secondary structures of the molecule and are not limited to any specific tertiary form. Therefore, this term includes, among other things, linear or circular DNA molecules (e.g., restriction fragments), plasmids, superhelical DNA, and double-stranded DNA found within chromosomes. When considering the structure of a particular double-stranded DNA molecule, the sequence may be described herein in accordance with the usual convention of giving only the sequence in the 5'-3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to mRNA). A “recombinant DNA molecule” is a DNA molecule that has undergone molecular biological manipulation. Examples of DNA include, but are not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. A “nucleic acid composition” in this disclosure comprises one or more nucleic acids described herein.

[0089] Nucleic acid sequence: The terms "nucleic acid sequence" and "nucleotide sequence" are used interchangeably and refer to a continuous sequence of nucleic acids. The sequence can be either single-stranded or double-stranded DNA or RNA, for example, gRNA.

[0090] Operationally linked: “Operationally linked” refers to a juxtaposition in which the components described in this way are in a relationship that allows them to function in the manner intended. For example, a promoter is operationally linked to a coding sequence if it affects its transcription or expression. For example, different components in a CAR are operationally linked. Similarly, different components in a bicistronic polynucleotide or whole donor construct disclosed herein are operationally linked.

[0091] Pharmacopoeia: The terms “pharmacopoeia acceptable carrier” and “pharmacopoeia acceptable excipient,” and their grammatical variations, encompass not only any agents approved by U.S. federal regulatory authorities for use in animals, including humans, or listed in the United States Pharmacopeia, but also any carrier or diluent that does not interfere with the administration of a composition to a subject and produce undesirable physiological effects to the extent that it does not impair the biological activity and properties of the administered compound. This term includes excipients and carriers that are useful in the preparation of pharmaceutical compositions and are generally safe, non-toxic, and desirable.

[0092] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" means one or more compounds mixed with or blended with a therapeutic composition (e.g., cells), or suspended in one or more other chemical components such as pharmaceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate the administration of a drug preparation to a target.

[0093] Polynucleotide: As used herein, the term “polynucleotide” refers to a polymer of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, their analogues, or mixtures thereof. This term refers to the primary structure of the molecule. Therefore, this term includes not only triple-stranded, double-stranded, and single-stranded deoxyribonucleic acid (DNA), but also triple-stranded, double-stranded, and single-stranded ribonucleic acid (RNA).

[0094] More specifically, the term “polynucleotide” includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced ​​or unspliced, any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base, as well as other polymers containing a non-nucleotide backbone, such as polyamides (e.g., peptide nucleic acids “PNA”) and polymorpholinopolymers, and other synthetic sequence-specific nucleic acid polymers, provided that the polymer contains nucleic acid bases in a configuration that allows for base pairing and stacking, such as those found in DNA and RNA. In some aspects of this disclosure, polynucleotides may be, for example, RNA, for example, mRNA, or DNA.

[0095] Polypeptides: The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. Polymers may include modified amino acids. The term also encompasses amino acid polymers modified naturally or by intervention, including any other operations or modifications such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or conjugation with labeling components. Polypeptides containing not only one or more analogues of amino acids (including non-natural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), but also other modifications known in the art, are also included in the definition. As used herein, the term “polypeptide” refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, natural polypeptides, synthetic polypeptides, homologs, orthologues, paralogs, fragments, and other equivalents, variants, and analogues mentioned above. Polypeptides may be single polypeptides or multimolecular complexes such as dimers, trimers, or tetramers. These can also include single-chain or polychain polypeptides. Most commonly, disulfide bonds are found in polychain polypeptides. The term polypeptide can also be applied to amino acid polymers, in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. In some embodiments, a “peptide” may be 50 amino acid lengths or less, for example, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acid lengths.

[0096] Prevention: As used herein, the terms “prevention,” “prevent,” and their variants mean to partially or completely delay the onset of a disease, disorder, and / or condition; to partially or completely delay the onset of one or more symptoms, features, or clinical signs of a particular disease, disorder, and / or condition; to partially or completely delay the onset of one or more symptoms, features, or signs of a particular disease, disorder, and / or condition; to partially or completely delay the progression from a particular disease, disorder, and / or condition; and / or reduce the risk of progression of a pathology associated with a disease, disorder, and / or condition. In some embodiments, prevention of outcome is achieved by preventive treatment. As used herein, “preventive” means a therapeutic action or course of action used to prevent the onset of a disease or condition, or to prevent or delay symptoms associated with a disease or condition. As used herein, “prevention” means measures taken to maintain health and to prevent or delay the onset of a disease or condition, or to prevent or delay symptoms associated with a disease or condition.

[0097] scFv: The term "scFv" refers to a fusion protein comprising at least one antibody moiety containing a light chain variable region and at least one antibody moiety containing a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are contiguously linked, for example via a synthetic linker, for example, a short mobile polypeptide linker, and can be expressed as a single-chain polypeptide, and the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, the scFv may have VL and VH variable regions in either order with respect to the N-terminus and C-terminus of the polypeptide, for example, and the scFv may contain a VL linker-VH or a VH linker-VL.

[0098] Similarity: As used herein, the term “similarity” refers to the overall relationship between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules), and / or between polypeptide molecules. The calculation of the percentage of similarity between polymer molecules can be carried out in the same manner as the calculation of the percentage of identity, except that the calculation of the similarity percentage takes into account conservative substitutions as understood in the art. It is understood that the percentage of similarity depends on the comparison scale used, i.e., whether amino acids are compared according to, for example, their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aroma, isoelectric point, antigenicity, or a combination thereof.

[0099] Subject: In this specification, the terms “subject,” “patient,” “individual,” and “host,” and their variants, are used interchangeably and refer to any mammalian subject, including but not limited to domesticated animals (e.g., dogs, cats, and similar), livestock (e.g., cattle, sheep, pigs, horses, and similar), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, and similar), to which diagnosis, treatment, or therapy is desired, and particularly to humans. The methods described herein are applicable to both human therapeutic and veterinary uses. Where used herein, the phrase “subject requiring it” includes subjects such as mammalian subjects that would benefit from the therapeutic agent containing the bicistronic polynucleotides of this disclosure, for example, the administration of CAR-T cells.

[0100] Subsequence: As used herein, the term “subsequence” refers to a subset of consecutive nucleotides or amino acids within a sequence (either a physical sequence or its symbolic representation).

[0101] Therapeutic dose: As used herein, the term “therapeutic dose” refers to a quantity of cells, such as allogeneic T cells, or a pharmaceutical composition containing enough cells to produce the desired therapeutic, pharmacological, and / or physiological effect on a target requiring it. Since prevention can be considered a therapy, the therapeutic dose may also be a “preventive dose.”

[0102] Treatment: As used herein, the terms “treatment,” “treatment,” or “to treat” mean, for example, reducing the severity of a disease or condition, reducing the duration of the disease course, improving or eliminating one or more symptoms associated with the disease or condition, or providing a beneficial effect to an object having the disease or condition without necessarily curing the disease or condition. The term also includes the prevention or mitigation of a disease or condition or its symptoms. In one embodiment, the term “to treat” or “to treat” means inducing an immune response in an object to an antigen.

[0103] Modulation: As used herein, the terms “modulation,” “modification,” and their grammatical variations generally refer to the ability to alter a particular concentration, level, expression, function, or behavior, for example, by directly or indirectly promoting / stimulating / upregulating or inhibiting / downregulating, such as in order to act as an antagonist or agonist. In some cases, a modifier may increase and / or decrease a particular concentration, level, activity, or function relative to a control, or to an average level of activity that would generally be expected, or to a control level of activity.

[0104] Site: The terms “target site” and “insertion site” refer to a region of cellular chromosomal DNA containing a recognition sequence for a nuclease, such as CRISPR. As used herein, the term “recognition sequence” refers to the DNA sequence that is bound and cleaved by an endonuclease. In the case of CRISPR, the recognition sequence is the sequence to which the guide RNA directly binds to the Cas9 cleavage, typically 16–24 base pairs.

[0105] Vector: The terms “vector,” “expression vector,” and “plasmid,” and their grammatical variants, are used interchangeably within this disclosure and refer to an exogenous polynucleotide to the host cell genome that is inserted into a specific location within the genome of a host cell (e.g., a T cell). Generally, a plasmid comprises several elements, such as recombination sites (e.g., homologous recombination sites and / or site-specific recombination sites), markers (e.g., detection markers and / or selection markers), one or more expression cassettes, or any combination thereof. In some embodiments, a plasmid may be a linear plasmid. In other embodiments, a plasmid may be a round plasmid, such as an intact round plasmid.

[0106] II. Bicistronic Polynucleotides This disclosure provides (i) a therapeutic agent (e.g., CAR), and (ii) a bicistronic polynucleotide encoding an immunosurveillance masking molecule (ISMM), the ISMM comprising non-functional beta-2-microglobulin (B2M), e.g., a non-functional fragment or variant of B2M, and human leukocyte antigen (HLA), e.g., HLA-E, HLA-G, or a functional fragment or variant thereof. In some embodiments, the ISMM comprises a polynucleotide encoding a non-functional fragment of a B2M polypeptide and an HLA-E polypeptide or a functional fragment or variant thereof.

[0107] As used herein, terms such as “beta-2 microglobulin gene,” “B2M gene,” and “B2M” are used interchangeably and refer to the human gene identified by NCBI Gene ID NO. 567 (accession number NG_012920.1), as well as native variants of the human beta-2 microglobulin gene encoding a functional B2M polypeptide, and its functional fragments and variants.

[0108] As used herein, “bicistronic” polynucleotide refers to a polynucleotide that comprises two coding sequences (i.e., cistrons) and produces a single messenger RNA (mRNA) at transcription that codes for two or more products, e.g., two proteins. As used herein, “polycistronic” polynucleotide refers to a polynucleotide that comprises three or more coding sequences (i.e., cistrons) and produces a single messenger RNA (mRNA) at transcription that codes for three or more products, e.g., a single messenger RNA (mRNA) at transcription that codes for a protein. Bicistronic mRNA or polycistronic mRNA may include any elements known in the art that enable the translation of two or more genes from the same mRNA molecule, including but not limited to IRES elements, T2A elements, P2A elements, E2A elements, and F2A elements.

[0109] In some embodiments, the therapeutic agent may include an antibody or its antigen-binding moiety, an enzyme, a receptor, a receptor ligand, a protein antibiotic, a fusion protein, a structural protein, a regulatory protein, a vaccine, a growth factor, a hormone, or a cytokine. In some embodiments, the therapeutic agent may include one or more heterogeneous moieties, for example, a moiety that extends the plasma half-life of a biologic (e.g., a non-structural polypeptide such as XTEN), a moiety that facilitates transport across the membrane or blood-brain barrier, a moiety that increases or decreases the clearance rate, or a moiety that directs the therapeutic agent to a specific cell type or tissue type (i.e., a target moiety).

[0110] In some embodiments, the therapeutic agent is an antibody or its antigen-binding portion. In some embodiments, the antibody or its antigen-binding fragment specifically binds to an epitope on a tumor antigen. In some embodiments, tumor antigens include ROR1, HER2, AFP, TRAC, TCRβ, BCMA, CLL-1, CS1, CD38, CD19, TSHR, CD123, CD22, CD30, CD70, CD171, CD33, EGFRvIII, GD2, GD3, TnAg, PSMA, ROR2, GPC1, GPC2, FLT3, FAP, TAG72, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, mesothelin, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-beta, SSEA-4, CD20, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, EGFR, NCAM, prostase, and PAP. ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WTl, NY-ESO-1, LAGE-la, MAGE-Al, Regmine, HPV E6, E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, prostain, survivor and telomerase, PCTA-1 / galectin 8, MelanA / MARTl, Ras mutant, hTERT, sarcoma translocation breakpoint, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxylesterase, mutThis includes hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, CD2, CD3ε, CD4, CD5, CD7, the extracellular components of APRIL proteins, and any combination thereof.

[0111] In some embodiments, the therapeutic agent is a CAR comprising an antigen-binding domain that specifically binds to a tumor antigen on a target cell, for example, an epitope on the antigen disclosed above. In some embodiments, the antigen-binding domain comprises an antibody or its antigen-binding portion. In some embodiments, the tumor antigen is disialoganglioside GD2.

[0112] GD2 is a disiarogangioside that is overexpressed on many tumors. Antibody therapy targeting disiarogangioside GD2 (dinutuximab, UNITUXIN®) is approved for pediatric neuroblastoma. However, the antibody must be administered with several other expensive components. Dinutuximab is administered in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-2 (IL-2), and 13-cis-retinoic acid (RA). Morphine is administered before, during, and 2 hours after the infusion of dinutuximab to manage the severe pain caused by this drug. Antihistamines and anti-inflammatory agents are also administered before, during, and after the infusion to manage the infusion reaction. These problems can be avoided by generating anti-GD2 CAR T cells using the dinutuximab antibody GD2-binding domain in a manner that allows any donor T cells to be used in any patient, as disclosed herein; that is, anti-GD2 therapy will be possible using ready-made allogeneic CAR T cells.

[0113] Accordingly, in some embodiments, the polycistronic polypeptide of the present disclosure comprises a polynucleotide sequence encoding a CAR derived from dinutuximab. In some embodiments, the antibody is a single-stranded variable fragment (scFv) comprising a variable region of the heavy chain (VH) and a variable region of the light chain (VL) of the antibody, e.g., dinutuximab, UNITUXIN®.

[0114] In some embodiments, the therapeutic agent is a CAR comprising dinutuximab scFv containing the protein sequence described in SEQ ID NO: 22. In some embodiments, the antigen-binding domain cross-competes with dinutuximab. In some embodiments, the antigen-binding domain binds to the same epitope as dinutuximab. In some embodiments, the antigen-binding domain comprises VH CDR3 of dinutuximab. In some embodiments, the antigen-binding domain further comprises VH CDR1 and VH CDR2. In some embodiments, VH CDR1 comprises VH CDR1 of dinutuximab, and / or VH CDR2 comprises VH CDR2 of dinutuximab. In some embodiments, the antigen-binding domain further comprises VL CDR1, VL CDR2, and / or VL CDR3. In some embodiments, VL CDR1 comprises VL CDR1 of dinutuximab, VL CDR2 comprises VL CDR2 of dinutuximab, and / or VL CDR3 comprises VL CDR3 of dinutuximab.

[0115] In some embodiments, the antigen-binding domain is (i) VH CDR1 of SEQ ID NO: 59, VH CDR2 of SEQ ID NO: 63, and VH CDR3 of SEQ ID NO: 67, and / or VL CDR1 of SEQ ID NO: 71, VL CDR2 of SEQ ID NO: 75, and VL CDR3 of SEQ ID NO: 79, or (ii) VH CDR1 of SEQ ID NO: 60, VH CDR2 of SEQ ID NO: 64, and VH CDR3 of SEQ ID NO: 68, and / or VL CDR1 of SEQ ID NO: 72, VL CDR2 of SEQ ID NO: 76, and VL CDR3 of SEQ ID NO: 80, or (iii) VH CDR1 of SEQ ID NO: 61, VH CDR2 of SEQ ID NO: 65, and VH CDR3 of SEQ ID NO: 69, and / or VL CDR1 of SEQ ID NO: 73, VL CDR2 of SEQ ID NO: 77, and VL CDR3 of SEQ ID NO: 81, or (iv) VH CDR1 of SEQ ID NO: 62, VH CDR2 of SEQ ID NO: 66, and VH CDR3 of SEQ ID NO: 70, and / or VL CDR1 of SEQ ID NO: 74, VL CDR2 of SEQ ID NO: 78, and VL CDR3 of SEQ ID NO: 82, or (v) including VH CDR1 of SEQ ID NO: 53, VH CDR2 of SEQ ID NO: 54, and VH CDR3 of SEQ ID NO: 55, and / or VL CDR1 of SEQ ID NO: 56, VL CDR2 of SEQ ID NO: 57, and VL CDR3 of SEQ ID NO: 58.

[0116] In some embodiments, the antigen-binding domain comprises VH and VL, where VH comprises the protein sequence described in SEQ ID NO: 44 and VL comprises the protein sequence described in SEQ ID NO: 46. In some embodiments, the antigen-binding domain comprises VH containing the protein sequence described in SEQ ID NO: 44 and VL containing the protein sequence described in SEQ ID NO: 46. In some embodiments, VH and VL are bound via a linker. In some embodiments, VH and VL are bound in a VH-linker-VL or VL-linker-VH configuration. In some embodiments, the linker is located in a Gly4-Ser linker. In some embodiments, the Gly4-Ser linker contains the sequence described in SEQ ID NO: 84.

[0117] In some embodiments, CAR structures are designed as standard CARs, segmented CARs, off-switched CARs, on-switched CARs, first-generation CARs, second-generation CARs, third-generation CARs, or fourth-generation CARs.

[0118] In some embodiments, the antigen-binding domain is an 1g NAR, Fab, Fab', F(ab)'2, F(ab)'3, Fv, single-strand variable fragment (scFv), bis-scFv, (scFv)2, minibody, diabody, triabody, tetrabody, intrabody, disulfide-stabilized Fv protein (dsFv), unibody, nanobody, afibody, DARPin, monobody, adonectin, alphabody, or a designed binder.

[0119] In some embodiments, the CAR construct further includes a transmembrane domain, an intracellular domain, and a spacer located between the antigen-binding domain and the transmembrane domain.

[0120] In some embodiments, the intracellular domain of the CAR construct is a signaling domain derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD66d, or CD28. In some embodiments, the intracellular domain of the CAR construct is derived from CD28. In some embodiments, the transmembrane domain of the CAR construct is derived from CD28. In some embodiments, the transmembrane domain is linked to the intracellular domain by a linker. In some embodiments, the intracellular and transmembrane domains of the CAR construct are derived from the same molecule, e.g., CD28, and therefore, in some embodiments, the transmembrane and intracellular domains are derived from CD28.

[0121] In some embodiments, the transmembrane domain of the CAR is a transmembrane domain from a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. In some embodiments, the transmembrane domains include, for example, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7R α, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD CD11d, ITGAE CD103, ITGAL CD11a, LFA-1, ITGAM CD11b, ITGAX It may include the transmembrane region of CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​PAG / Cbp, NKG2D, NKG2C, or CD19.

[0122] In some embodiments, the spacer of the CAR construct is a CD8 alpha hinge. In some embodiments, the spacer is derived from a hinge region of human immunoglobulin. In some embodiments, the human immunoglobulin hinge region is derived from IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, or IgM.

[0123] In some embodiments, the CAR construct further includes a co-stimulatory domain or a combination thereof. In some embodiments, the co-stimulatory domain is derived from 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, CD3 zeta, and combinations thereof. In some embodiments, the co-stimulatory domain includes a 4-1BB activating domain. In some embodiments, the co-stimulatory domain includes a CD3 zeta activating domain. In some embodiments, the co-stimulatory domain includes a 4-1BB activating domain and a CD3 zeta activating domain. In some embodiments, the co-stimulatory domain includes a functional signaling domain of a protein selected from the group consisting of OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), and 4-1BB (CD137).In some embodiments, the co-stimulatory domain includes a functional signaling domain of a protein selected from the group consisting of MHC class I molecules, such as a TNF receptor protein, immunoglobulin-like protein, cytokine receptor, or integrin. Activation of signal transduction lymphocyte activating molecules (SLAM proteins), NK cell receptors, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD CD11d, ITGAE CD103, ITGAL CD11a, LFA-1, ITGAM CD11b, ITGAX CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL It contains ligands that specifically bind to DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and CD83.

[0124] In some embodiments, the CAR of the Disclosure further comprises a leader sequence. In some embodiments, the CAR of the Disclosure is a bispecific CAR. Thus, in some embodiments, the polynucleotide encoding the CAR of the Disclosure encodes at least one polypeptide of a bispecific CAR (e.g., a CAR targeting a primary antigen and a secondary antigen).

[0125] In some embodiments, the CAR construct comprises the nucleic acid sequence described in SEQ ID NO: 19. In some embodiments, the CAR construct encodes the protein described in SEQ ID NO: 20.

[0126] In some embodiments, the B2M nonfunctional polypeptide is a B2M fragment, e.g., a nonfunctional fragment. In some embodiments, the B2M nonfunctional polypeptide is a B2M variant, e.g., a nonfunctional variant. In some embodiments, the human leukocyte antigen (HLA) is HLA-E or HLA-G.

[0127] As used herein, “HLA-E” refers to the polynucleotide encoding the α-heavy chain, alpha-E, of the HLA class I histocompatibility antigen, also known as MHC class I antigen E. HLA-E is a heterodimer consisting of an α-heavy chain and a light chain (β-2 microglobulin). The α-heavy chain is approximately 45 kDa and is fixed within the membrane. The HLA-E gene contains eight exons. Exon 1 encodes the signal peptide, exons 2 and 3 encode the α1 and α2 domains (both of which bind peptides), exon 4 encodes the α3 domain, exon 5 encodes the transmembrane domain, and exons 6 and 7 encode the cytoplasmic tail. See Uniprot registry number P13747, Entrez registry number 3133, and RefSeq (mRNA) and (protein) registry numbers NM_005516 and NP_005507. They are incorporated herein by reference in their entirety.

[0128] As used herein, "HLA-G" refers to the polynucleotide encoding the α-heavy chain, class I, G of the HLA-G histocompatibility antigen, also known as human leukocyte antigen G. HLA-G is a heterodimer consisting of an α-heavy chain and a light chain (beta-2 microglobulin). The α-heavy chain is fixed within the membrane. HLA-G is encoded by 88 alleles. The heavy chain is approximately 45 kDa, and its gene contains eight exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the alpha-1 and alpha-2 domains (both of which bind peptides), exon 4 encodes the alpha-3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. Exons 7 and 8 are not translated due to the stop codon located within exon 6. HLA-G can be expressed under at least seven isoforms via alternative splicing, referred to as HLA-G1, HLA-G2, HLA-G3, HLA-G4, HLA-G5, HLA-G6, and HLA-G7. The protein can be both membrane-bound and soluble. Thus, HLA-G1 to G4 are membrane-bound, and in some embodiments, the bicistronic polynucleotides of this disclosure include nucleic acids encoding HLA-G1, HLA-G2, HLA-G3, HLA-G4, HLA-G5, HLA-G6, their functional variants, or their functional fragments. See Uniprot registry number P17693, Entrez registry number 3135, and RefSeq (mRNA) and (protein) registry numbers NM_002127, NM_001363567, NM_001384280, NM_001384290, NP_002118, and NP_001350496. They are incorporated herein by reference in their entirety.

[0129] In some embodiments, HLA-E or HLA-G in a bicistronic polynucleotide can encode a functional variant or functional fragment of their corresponding wild-type form. In some embodiments, HLA-E in a bicistronic polynucleotide can encode a functional variant or functional fragment of the HLA-E portion of SEQ ID NO: 6.

[0130] In some embodiments, the beta-2-microglobulin (B2M) polypeptide and human leukocyte antigen (HLA) are linked by a linker, such as a flexible linker. In some embodiments, the linker is a Gly4-Ser linker (GSSS; SEQ ID NO: 83). In some embodiments, the Gly4-Ser linker contains the sequence described in SEQ ID NO: 84 (GSSSGSSSGSSSGSSS).

[0131] In some embodiments of the bicistronic polynucleotides of this disclosure, (i) the nucleic acid sequence encoding a therapeutic agent and the nucleic acid sequence encoding an immunosurveillance masking molecule (ISMM) are 2A element (e.g., P2A element) sequences, or (ii) the nucleic acid sequence encoding a therapeutic agent and the nucleic acid sequence encoding an immunosurveillance masking molecule (ISMM) are linked by an internal ribosome entry site (IRES element). Thus, in some embodiments, the cistron is linked via an IRES element. An IRES element is an RNA region that recruits a 40S ribosomal subunit via a cap-independent mechanism. IRES elements often employ complex RNA structures that function as ribosome anchoring sites induced by RNA-RNA and / or RNA-protein interactions.

[0132] In other embodiments, cistrons are linked via 2A elements. 2A self-cleaving peptides, or 2A peptides, are a class of 18-22aa long peptides that can induce ribosome skipping during protein translation in cells. Due to their small size and high cleavage efficiency between upstream and downstream genes, 2A elements are good candidates to replace IRESs. In some embodiments, the 2A element is a P2A element (porcine tesiovirus-1 2A). In other embodiments, the 2A element is an F2A element (foot-and-mouth disease virus), an E2A element (equine rhinosinus pneumonia A virus), or a T2A element (zosea assignavirus 2A). In some embodiments, the 2A element portion of a bicistronic polynucleotide contains two or more 2A elements in series, and the 2A elements are selected from P2A, E2A, F2A, E2A, and T2A. In some embodiments, the 2A element is P2A-T2A. In some embodiments, the 2A element is 2A-T2A-E2A.

[0133] In some embodiments, the nucleic acid sequence encoding the therapeutic agent includes the sequence described in SEQ ID NO: 5. In some embodiments, the nucleic acid sequence encoding ISMM includes the sequence described in SEQ ID NO: 6. In some embodiments, the nucleic acid sequence encoding the therapeutic agent includes the sequence described in SEQ ID NO: 5, and the nucleic acid sequence encoding ISMM includes the sequence described in SEQ ID NO: 6. In some embodiments, the bicistronic polynucleotide is selected from the group consisting of bicistronic construct 1 (BC1; SEQ ID NO: 7), bicistronic construct 2 (BC2; SEQ ID NO: 8), bicistronic construct 3 (BC3; SEQ ID NO: 9), bicistronic construct 4 (BC4; SEQ ID NO: 10), bicistronic construct 5 (BC5; SEQ ID NO: 9), bicistronic construct 6 (BC6; SEQ ID NO: 10), bicistronic construct 7 (BC7; SEQ ID NO: 11), or bicistronic construct 8 (BC8; SEQ ID NO: 12).

[0134] In some embodiments, the bicistronic polynucleotide further comprises a 5' sequence complementary to the B2M gene sequence upstream of the insertion site and a 3' sequence complementary to the B2M gene sequence downstream of the insertion site. In some embodiments, the 5' and 3' sequences are of the same length. In some embodiments, the 5' and 3' sequences are at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides in length.

[0135] In some embodiments, the bicistronic polynucleotide is selected from the group consisting of all donor 1 (FD1; SEQ ID NO: 13), all donor 2 (FD2; SEQ ID NO: 14), all donor 3 (FD3; SEQ ID NO: 15), all donor 4 (FD4; SEQ ID NO: 16), all donor 5 (FD5; SEQ ID NO: 15), all donor 6 (FD6; SEQ ID NO: 16), all donor 7 (FD7; SEQ ID NO: 17), or all donor 8 (FD8; SEQ ID NO: 18).

[0136] In some embodiments, a bicistronic polynucleotide is inserted into a site within the B2M gene, and the insertion of the bicistronic polynucleotide in the B2M gene inactivates the B2M gene (partially or completely). In some embodiments, the insertion of the bicistronic polynucleotide in the B2M gene is mediated by a nuclease. In some embodiments, the insertion of the bicistronic polynucleotide in the B2M gene is mediated by a CRISPR / Cas nuclease. In some embodiments, the nuclease is CRISPR / Cas9. CRISPR and other genome editing alternatives that may be used in the methods of this disclosure, e.g., zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases (MNs), are discussed in more detail below.

[0137] In some embodiments, the insertion site of the B2M gene is located in an intron. In some embodiments, the insertion site of the B2M gene is located at an intron-exon junction. In some embodiments, the insertion site of the B2M gene is located at an exon. In some embodiments, the exon location is exon 1. In some embodiments, the insertion site is site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1). In some embodiments, the exon location is exon 2. In some embodiments, the insertion site is site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2) or site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3). In some embodiments, the exon location is exon 3. In some embodiments, the insertion site is site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4).

[0138] III. Vectors This disclosure also provides vectors comprising a regulatory element, for example, a bicistronic polynucleotide disclosed herein, operably linked to a promoter. In some embodiments, the promoter is a natural promoter, for example, a natural B2M gene promoter.

[0139] In some embodiments, the vector is a transfer vector. The term “transfer vector” refers to a composition of substances that comprises an isolated nucleic acid (e.g., a bicistronic polynucleotide as described herein) and can be used to deliver the isolated nucleic acid into a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term “transfer vector” includes plasmids or viruses that autonomously replicate. The term should also be interpreted to further include, for example, polylysine compounds, liposomes, and other non-plasmid compounds and non-viral compounds that facilitate the transfer of nucleic acids into cells. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.

[0140] In some embodiments, the vector is an expression vector. The term “expression vector” refers to a vector comprising a recombinant polynucleotide (e.g., a bicistronic polypeptide as described herein) containing an expression regulatory sequence operably ligated to the nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression, and other elements for expression may be supplied by a host cell or in an in vitro expression system. Expression vectors include all known in the art, including cosmids, plasmids (e.g., naked or liposome-containing), and viruses incorporating recombinant polynucleotides (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0141] In some embodiments, the vector is a viral vector, a mammalian vector, or a bacterial vector. In some embodiments, the vector is a retroviral vector. In some embodiments, the viral vector is selected from the group consisting of adenovirus vectors, lentiviruses, Sendai virus vectors, baculovirus vectors, Epstein-Barr virus vectors, papovavirus vectors, vaccinia virus vectors, herpes simplex virus vectors, hybrid vectors, and adeno-associated virus (AAV) vectors.

[0142] In some embodiments, the adenovirus vector is a third-generation adenovirus vector. ADEASY® is the most popular method for constructing adenovirus vector constructs. The system consists of two types of plasmids: a shuttle (or transfer) vector and an adenovirus vector. The target transgene is cloned into the shuttle vector, validated, and linearized with the restriction enzyme PmeI. This construct is then converted into ADEASIER-1 cells, which are PADEASY® containing BJ5183 Escherichia coli (E. coli) cells. PADEASY® is an approximately 33Kb adenovirus plasmid containing the adenovirus gene necessary for virus production. The shuttle vector and adenovirus plasmid have matching left and right homology arms that facilitate homologous recombination of the transgene into the adenovirus plasmid. It is also possible to co-transform standard BJ5183 using supercoiled PADEASY® and the shuttle vector, although this method results in a higher background for the non-recombinant adenovirus plasmid. Next, the recombinant adenovirus plasmid is validated for size and appropriate restriction digestion patterns to determine that the transgene has been inserted into the adenovirus plasmid and that no other patterns of recombination have occurred. Once validated, the recombinant plasmid is linearized with PacI to produce a linear dsDNA construct adjacent to the ITR. 293 or 911 cells can be transfected with the linearized construct, and the virus can be collected approximately 7–10 days later. In addition to this method, the method disclosed herein can be carried out using other methods for producing adenovirus vector constructs that are known in the art at the time this application was filed.

[0143] In other embodiments, viral vectors are retroviral vectors, such as lentiviral vectors (e.g., third or fourth-generation lentiviral vectors). The term "lentivirus" refers to a genus of the family Retroviridae. Lentiviruses are unique among retroviruses that can infect non-dividing cells and are one of the most efficient methods of gene delivery vectors because they can deliver large amounts of genetic information to the host cell's DNA. HIV, SIV, and FIV are all examples of lentiviruses.

[0144] The term "lentiviral vector" refers to vectors derived from at least a portion of a lentiviral genome, particularly including self-inactivated lentiviral vectors as described in Milone et al., Mol. Ther. 17(8): 1453-1464 (2009). Other examples of lentiviral vectors that may be used clinically include, but are not limited to, Oxford BioMedica's LENTIVECTOR® gene delivery technology and Lentigen's LENTIMAX® vector system. Non-clinical versions of lentiviral vectors are also available and are known to those skilled in the art.

[0145] Lentiviral vectors are typically constructed within a transient transfection system in which a cell line is transfected with three separate plasmid expression systems. These include a transfer vector plasmid (the HIV provirus portion), a packaging plasmid or construct, and a plasmid containing heterologous envelope genes (env) of different viruses. The three plasmid components of the vector are placed in the packaging cell and then inserted into the HIV shell. The viral portion of the vector contains insertion sequences to prevent the virus from replicating within the cell line. Current third-generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid recombination-mediated generation of reproducible viruses. Fourth-generation lentiviral vectors further reduce the retroviral genome (see, for example, TAKARA® LENTI-X® fourth-generation packaging system).

[0146] In some embodiments, nonviral methods can be used to deliver nucleic acids comprising the bicistronic polynucleotides of the Disclosure to target cells or tissues. In some embodiments, the nonviral methods include the use of transposons. In some embodiments, the use of nonviral delivery methods enables the reprogramming of cells, e.g., T cells or NK cells, and the direct injection of cells into a target. In some embodiments, nucleic acid sequences comprising the bicistronic polynucleotides of the Disclosure can be inserted into the genome of target cells (e.g., T cells) or host cells (e.g., cells for the recombinant expression of CAR polypeptides) by using the CRISPR / Cas system, as well as genome editing alternatives such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases (MNs).

[0147] This disclosure also provides compositions comprising the bicistronic polynucleotides disclosed herein, or vectors comprising the bicistronic polynucleotides disclosed herein. Furthermore, kits comprising (i) the bicistronic polynucleotides disclosed herein, (ii) vectors comprising the bicistronic polynucleotides disclosed herein, or (iii) compositions comprising the bicistronic polynucleotides disclosed herein, or vectors comprising the bicistronic polynucleotides disclosed herein are also provided.

[0148] IV. Cells This disclosure also provides genetically modified cells expressing therapeutic agents (e.g., CARs) and ISMMs, comprising (i) bicistronic polynucleotides disclosed herein, (ii) vectors comprising bicistronic polynucleotides disclosed herein, or (iii) compositions comprising bicistronic polynucleotides disclosed herein, or vectors comprising bicistronic polynucleotides disclosed herein. In some embodiments, the cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, ILC cells, macrophages, or antigen-presenting cells. In some embodiments, the cells are homogeneous. In some embodiments, the genetically modified cells are part of a kit or manufactured article.

[0149] In some embodiments, the genetically modified cells disclosed herein are transfected with (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising a bicistronic polynucleotide disclosed herein, or (iii) a composition comprising a bicistronic polynucleotide disclosed herein, or a vector comprising a bicistronic polynucleotide disclosed herein.

[0150] The term “transfer” (or equivalent terms “transformed” and “transduced”) refers to the process by which an exogenous nucleic acid, such as a bicistronic polynucleotide or vector as disclosed herein, is moved to or introduced into the genome of a host cell, such as a T cell. A “transfected” cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid, such as a bicistronic polynucleotide or vector as disclosed herein. The terms cell or transfected cell include primary target cells and their offspring.

[0151] In some embodiments, cells (e.g., T cells) are transfected with a vector of the Disclosure, e.g., an AAV vector or lentiviral vector containing a bicistronic construct of the Disclosure. In some such embodiments, the cells can stably express a therapeutic agent encoded by a polycistronic polynucleotide (e.g., CAR) of the Disclosure. In some embodiments, the cells are immune effector cells.

[0152] As used herein, the term “immune effector cell” refers to a cell involved in promoting an immune response, such as an immune effector response. “Immune effector function” or “immune effector response” refers to a function or response of an immune effector cell that enhances or promotes an immune attack on a target cell. For example, immune effector function or response refers to a property of a T cell or NK cell that promotes the killing or proliferation or inhibition of proliferation of a target cell. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector function or response.

[0153] The term "effector function" refers to a specific function of a cell. The effector function of a T cell may be, for example, cytolytic activity, including cytokine secretion, or helper activity. The intracellular signaling domain of a CAR can generate signals that promote the immune effector function of CAR-containing cells, such as CAR-T cells. For example, examples of immune effector function in CAR-T cells include cytolytic activity and helper activity, including cytokine secretion.

[0154] In certain specific embodiments, the Disclosure provides allogeneic CAR-T cells comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding HLA-E is replaced with a nucleic acid sequence encoding HLA-G.

[0155] In some embodiments, the disclosure provides allogeneic CAR-T cells containing a specific bicistronic construct selected from the group consisting of BC1, BC2, BC3, BC4, BC5, BC6, BC7, and BC8, wherein the nucleic acid sequence encoding a non-functional B2M fragment or variant is replaced with a nucleic acid sequence encoding a non-functional TRAC fragment or variant, and the bicistronic construct is inserted into the TRAC gene.

[0156] In some embodiments, the Disclosure provides allogeneic CAR-T cells containing a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or BC8, wherein the nucleic acid sequence encoding a non-functional B2M fragment or variant is replaced with a nucleic acid sequence encoding a non-functional CD52 fragment or variant, and the bicistronic construct is inserted into the CD52 gene.

[0157] T cells can be obtained from a variety of sources, including but not limited to peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, tissue from the site of infection, ascites, pleural fluid, splenic tissue, and tumors.

[0158] V. Pharmaceutical Compositions The disclosure also provides therapeutic agents and pharmaceutical compositions comprising (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising a bicistronic polynucleotide disclosed herein, or (iii) a composition comprising a bicistronic polynucleotide disclosed herein, suitable for administration to a subject, or a vector comprising a bicistronic polynucleotide disclosed herein, and cells genetically modified to express ISMM.

[0159] This disclosure also provides pharmaceutical compositions for treating cancer in subjects requiring treatment of cancer, the pharmaceutical compositions comprising genetically modified cells and ISMMs to express a therapeutic agent, and comprising (i) a bicistronic polynucleotide as disclosed herein, (ii) a vector comprising a bicistronic polynucleotide as disclosed herein, or (iii) a composition comprising a bicistronic polynucleotide as disclosed herein, or a vector comprising a bicistronic polynucleotide as disclosed herein. In some embodiments, the pharmaceutical compositions are part of a kit or manufactured article.

[0160] This disclosure also provides pharmaceutical compositions for treating cancer in subjects that require it, and the pharmaceutical compositions are (i) Bicistronic polynucleotides disclosed herein, (ii) A vector comprising a bicistronic polynucleotide as disclosed herein, (iii) A composition comprising a bicistronic polynucleotide disclosed herein, or a vector comprising a bicistronic polynucleotide disclosed herein, or (iv) A cell comprising (i), (ii), or (iii), and

[0161] In some embodiments, the pharmaceutical composition is part of a kit or manufactured article. The pharmaceutical composition generally comprises a bicistronic polynucleotide, vector, or cell encoding a therapeutic agent (e.g., CAR) and a pharmaceutically acceptable excipient or carrier in a form suitable for administration to a subject. The pharmaceutically acceptable excipient or carrier is determined not only by the specific composition being administered, but also in part by the specific method used to administer the composition. There are a wide variety of suitable formulations of the therapeutic agents disclosed herein, e.g., pharmaceutical compositions containing CARs (e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical composition is generally sterile and formulated in full compliance with all Good Manufacturing Practice (GMP) rules of the U.S. Food and Drug Administration. In certain embodiments, the pharmaceutical composition is administered co-administered with one or more additional therapeutic agents in a pharmaceutically acceptable carrier.

[0162] Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient (e.g., animal or human) at the dose and concentration used, and include buffers (such as phosphates, citrates, and other organic acids), antioxidants (including ascorbic acid and methionine), preservatives (such as octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkylparabens (such as methyl or propylparaben), catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol), low molecular weight (less than approximately 10 residues) polypeptides, and tannins. The product contains proteins (such as serum albumin, gelatin, or immunoglobulin), hydrophilic polymers (such as polyvinylpyrrolidone), amino acids (such as glycine, glutamine, asparagine, histidine, arginine, or lysine), monosaccharides, disaccharides, carbohydrates (including glucose, mannose, or dextrin), chelating agents (such as EDTA), sugars (such as sucrose, mannitol, trehalose, or sorbitol), salt-forming counterions (such as sodium), metal complexes (e.g., Zn-protein complexes), and / or nonionic surfactants (such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG)).

[0163] Examples of carriers or diluents include, but are not limited to, water, physiological saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmaceutically active substances is well known in the art. Unless any conventional media or compound is incompatible with the compositions of this disclosure (e.g., polynucleotides, vectors, or cells), its use in the compositions is intended.

[0164] VI. Method This disclosure also provides a method for stimulating a T cell-mediated immune response against a target cell population or tissue in a subject, the method comprising administering an effective amount of cells containing the bicistronic polynucleotides disclosed herein to the subject. Furthermore, a method is provided for providing antitumor immunity to a subject in need thereof, the method comprising administering an effective amount of cells containing the bicistronic polynucleotides disclosed herein to the subject. This disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising administering an effective amount of cells containing the bicistronic polynucleotides disclosed herein to the subject. This disclosure provides a method for preparing a cell population for therapy, comprising transducing a cell population isolated from a subject with the bicistronic polynucleotides, vectors, or compositions disclosed herein. In some embodiments, the transduction comprises culturing the cells under appropriate conditions. In some embodiments, the therapy is allogeneic cell therapy.

[0165] In some embodiments of these methods, the bicistronic polynucleotide is selected from the group consisting of bicistronic construct 1, bicistronic construct 2, bicistronic construct 3, bicistronic construct 4, bicistronic construct 5, bicistronic construct 6, bicistronic construct 7, and bicistronic construct 8. In some embodiments, the bicistronic polynucleotide is selected from the group consisting of total donor 1, total donor 2, total donor 3, total donor 4, total donor 5, total donor 6, total donor 7, or total donor 8. In some embodiments, the bicistronic polynucleotide is bicistronic construct 1. In some embodiments, the bicistronic polynucleotide is bicistronic construct 2. In some embodiments, the bicistronic polynucleotide is bicistronic construct 3. In some embodiments, the bicistronic polynucleotide is bicistronic construct 4. In some embodiments, the bicistronic polynucleotide is bicistronic construct 5. In some embodiments, the bicistronic polynucleotide is bicistronic construct 6. In some embodiments, the bicistronic polynucleotide is bicistronic construct 7. In some embodiments, the bicistronic polynucleotide is bicistronic construct 8. In some embodiments, the bicistronic polynucleotide is total donor 1. In some embodiments, the bicistronic polynucleotide is total donor 2. In some embodiments, the bicistronic polynucleotide is total donor 3. In some embodiments, the bicistronic polynucleotide is total donor 4. In some embodiments, the bicistronic polynucleotide is total donor 5. In some embodiments, the bicistronic polynucleotide is total donor 6. In some embodiments, the bicistronic polynucleotide is total donor 7. In some embodiments, the bicistronic polynucleotide is total donor 8.

[0166] This disclosure provides, for example, a method for generating a sustained population of genetically engineered cells (e.g., T cells) in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject cells genetically engineered to express a bicistronic construct encoding a bicistronic polynucleotide disclosed herein, e.g., a CAR or any other therapeutic protein (e.g., an antibody). Also provided is a method for expanding a population of genetically engineered cells (e.g., T cells) in a subject diagnosed with cancer or an inflammatory disease, the method comprising administering to the subject cells genetically engineered to express a bicistronic polynucleotide disclosed herein. In some embodiments, the cells are T cells. In some embodiments, the T cells are allogeneic T cells. In some embodiments, the subject is a human subject.

[0167] This disclosure also provides a method for generating allogeneic cells for gene therapy, comprising inserting a bicistronic construct containing a nucleic acid encoding a therapeutic agent and a nucleic acid encoding an immune surveillance masking molecule (ISMM) into the beta-2-microglobulin (B2M) gene, wherein the insertion of the bicistronic construct inactivates the B2M gene. In some embodiments, the bicistronic construct gene may be inserted into other genes whose inactivation results in a reduced immune response when the genetically modified cells are administered to a subject that is not a cell donor. In some embodiments, the nucleic acid encoding ISMM includes a nucleic acid encoding a human leukocyte antigen (HLA) selected from HLA-E or HLA-G or a functional variant thereof. In some embodiments, the gene therapy is a CAR-T therapy.

[0168] In some embodiments, the insertion site in the B2M gene is selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1); site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2); site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3); or site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4).

[0169] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the 5' end of site 1, or a corresponding position in the complementary strand of the B2M gene.

[0170] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the 3' end of site 1, or a corresponding position in the complementary strand of the B2M gene.

[0171] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the 5' end of site 2, or a corresponding position in the complementary strand of the B2M gene.

[0172] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the 3' end of site 2, or a corresponding position in the complementary strand of the B2M gene.

[0173] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the 5' end of site 3, or a corresponding position in the complementary strand of the B2M gene.

[0174] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the 3' end of site 3, or a corresponding position in the complementary strand of the B2M gene.

[0175] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides upstream of the 5' end of site 4, or a corresponding position in the complementary strand of the B2M gene.

[0176] In some embodiments, the insertion site includes a sequence located approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nucleotides downstream of the 3' end of site 4, or a corresponding position in the complementary strand of the B2M gene.

[0177] In some embodiments, the insertion site is an insertion site that overlaps with site 1, site 2, site 3, or site 4. In some embodiments, the insertion site is located at a corresponding position on the complementary strand of the B2M gene.

[0178] Also provided are (i) bicistronic polynucleotides disclosed herein for use as pharmaceuticals, (ii) vectors comprising the bicistronic polynucleotide of (i), (iii) compositions comprising (i) or (ii), (iv) kits comprising (i), (ii) or (iii), (v) cells comprising any of (i), (ii) or (iii), (vi) compositions comprising (v), (vii) pharmaceutical compositions comprising (i), (ii), (iii), or (vi), or (viii) kits comprising (v), (vi), or (vii).

[0179] Also provided are (i) a bicistronic polynucleotide disclosed herein for use as a pharmaceutically acceptable agent for treating cancer or inflammatory diseases or conditions in subjects requiring it; (ii) a vector comprising the bicistronic polynucleotide of (i); (iii) a composition comprising (i) or (ii); (iv) a kit comprising (i), (ii) or (iii); (v) cells comprising any of (i), (ii) or (iii); (vi) a composition comprising (v); (vii) a pharmaceutical composition comprising (i), (ii), (iii), (v) or (vi); or (viii) a kit comprising (v), (vi) or (vii).

[0180] Also provided are the use of (i) a bicistronic polynucleotide disclosed herein, (ii) a vector comprising the bicistronic polynucleotide of (i), (iii) a composition comprising (i) or (ii), (iv) a kit comprising (i), (ii), or (iii), (v) cells comprising any of (i), (ii), or (iii), (vi) a composition comprising (v), and (vii) a pharmaceutical composition comprising (i), (ii), or (vi), or (viii) a kit comprising (v), (vi), or (vii) for manufacturing a pharmacopoeia for treating cancer or inflammatory diseases or conditions in subjects requiring such treatment.

[0181] VII. Therapeutic DrugsThe bicistronic polynucleotides disclosed herein include a target gene encoding a therapeutic agent. In some embodiments, the target gene includes one or more polynucleotide sequences encoding a biologic, e.g., a CAR, an antibody, or its antigen-binding portion. In some embodiments, the target gene includes a ligand for tumor necrosis factor (TNF), flt3 ligand (WO 94 / 28391), erythropoietin, thrombopoietin, calcitonin, IL-2, angiopoietin-2 (Maisonpierre et al. (1997), Science 277(5322): 55-60), a ligand for the receptor activator of NF-kappa B (RANKL, WO 01 / 36637), a tumor necrosis factor (TNF)-associated apoptosis-inducing ligand (TRAIL, WO 97 / 01633), thymic stromal lymphopoietin, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor (GM-CSF, Australian Patent No. 588819), mast cell growth factor, stem cell growth factor (US Patent No. 6,204,363), epidermal growth factor, keratinocyte growth factor, megakaryocyte growth factor, RANTES, human fibrinogen-like 2 protein (FGL2; NCBI Acceptance No. NM-00682; Ruegg and Pytela (1995), Gene 160:257-62), growth hormone, insulin, insulin secretagogue, insulin-like growth factor, parathyroid hormone, interferon (including α-interferon, γ-interferon, and consensus interferon) (US Patent Nos. 4,695,623 and 4,897,471), nerve growth factor, brain-derived neurotrophic factor, synaptotagmin-like protein (SLP) 1-5) A polynucleotide sequence encoding a protein that contains the same amino acid sequence as, or substantially similar to, all or part of, one of the following proteins: neurotrophin-3, glucagon, interleukin, colony-stimulating factor, lymphotoxin-β, leukemia suppressor, and oncostatin-M.For example, see Human Cytokines: Handbook for Basic and Clinical Research (complete series) (Aggarwal and Gutterman, eds. Blackwell Sciences, Cambridge, Mass., 1998); Growth Factors: A Practical Approach (McKay and Leigh, eds., Oxford University Press Inc., New York, 1993), and The Cytokine Handbook, Vols. 1 and 2 (Thompson and Lotze eds., Academic Press, San Diego, Calif., 2003). These are incorporated herein by reference in their entirety.

[0182] In some embodiments, the gene in question includes a polynucleotide sequence encoding all or part of the amino acid sequence of a receptor for any of the aforementioned proteins, an antagonist for such receptor, or a protein (e.g., a chimeric protein or fusion protein) that includes any of the aforementioned proteins and / or a protein substantially similar to such receptor or antagonist. These receptors and antagonists include both forms of tumor necrosis factor receptors (TNFR, referred to as p55 and p75, U.S. Patent Nos. 5,395,760 and 5,610,279), interleukin-1 (IL-1) receptors (type I and type II, EP Patent Nos. 0460846, 4,968,607 and 5,767,064), IL-1 receptor antagonists (U.S. Patent No. 6,337,072), IL-1 antagonists or inhibitors (U.S. Patents Nos. 5,981,713, 6,096,728 and 5,075,222), IL-2 receptors, and IL-4 receptors (EP Patent No. 0367 This includes receptors containing a death domain, such as U.S. Patent No. 566 and U.S. Patent No. 5,856,296, IL-15 receptor, IL-17 receptor, IL-18 receptor, Fc receptor, granulocyte-macrophage colony-stimulating factor receptor, granulocyte colony-stimulating factor receptor, oncostatin-M and leukemia suppressor receptor receptors, NF-kappa B receptor activator (RANK, WO 01 / 36637 and U.S. Patent No. 6,271,349), osteoprotegerin (U.S. Patent No. 6,015,938), TRAIL receptors (including TRAIL receptors 1, 2, 3, and 4), and Fas or apoptosis-inducing receptor (AIR).

[0183] In some embodiments, the gene of interest comprises a polynucleotide sequence encoding a protein containing all or part of the amino acid sequence of a differentiation antigen (referred to as the CD protein), or a ligand or protein substantially similar to either of these. Examples of such antigens include CD22, CD27, CD30, CD39, CD40, and their ligands (e.g., CD27 ligand, CD30 ligand). Some CD antigens are members of the TNF receptor family, including 41BB and OX40. The ligands are often members of the TNF family, as are the 41BB ligand and OX40 ligand.

[0184] In some embodiments, the gene of interest may contain a polynucleotide sequence encoding an enzymatically active protein, or its ligand may also be generated using the present invention. Therefore, in some embodiments, the biscistronic constructs of the present disclosure can be used for gene replacement therapy, for example, to replace a defective copy of a gene encoding an enzyme (e.g., a coagulation factor) with a fully functional copy of the gene. In this regard, the biscistronic construct may be inserted into the B2M gene or into the locus of the defective gene. Examples of enzymatically active proteins include one or their ligands, or all or some proteins substantially similar to one of these, such as disintegrin and metalloproteinase domain family members (including TNF-alpha converting enzyme), kinases, glucocerebrosidase, superoxide dismutase, tissue plasminogen activator, factor VIII, factor IX, apolipoprotein E, apolipoprotein AI, globin, IL-2 antagonist, alpha-1 antitrypsin, ligands for any of the enzymes mentioned above, and any other enzymes and their ligands.

[0185] In some embodiments, the gene of interest includes a polynucleotide sequence encoding an antibody or its antigen-binding portion. Examples of antibodies include the proteins and / or antigens listed above: namely CD2, CD3, CD4, CD8, CD11a, CD14, CD18, CD20, CD22, CD23, CD25, CD33, CD40, CD44, CD52, CD80 (B7.1), CD86 (B7.2), CD147, IL-1α, IL-1β, IL-2, IL-3, IL-7, IL-4, IL-5, IL-8, IL-10, IL-2 receptor, IL-4 receptor, IL-6 receptor, IL-13 Receptors, IL-18 receptor subunits, FGL2, PDGF-β, and their analogues (see U.S. Patents No. 5,272,064 and 5,149,792), VEGF, TGF, TGF-β2, TGF-β1, EGF receptor (see U.S. Patent No. 6,235,883), VEGF receptor, hepatocyte growth factor, bone protective factor ligands, interferon gamma, B lymphocyte-stimulating factor (BlyS, also known as BAFF, THANK, TALL-1, and zTNF4; Do and Chen-Kiang (2002), Cytokine Growth Factor Rev.See 13(1): 19-25), C5 complement, IgE, tumor antigen CA125, tumor antigen MUC1, PEM antigen, LCG (a gene product expressed in relation to lung cancer), HER-2, HER-3, RAS (e.g., K-RAS), tumor-associated glycoprotein TAG-72, SK-1 antigen, tumor-associated epitopes present at elevated levels in the serum of patients with colon cancer and / or pancreatic cancer, cancer-associated epitopes or proteins expressed on breast cancer cells, colon cancer cells, squamous epithelial cells, prostate cancer cells, pancreatic cancer cells, lung cancer cells, and / or kidney cancer cells, and / or melanoma cells, glioma cells, or neuroblastoma cells, tumor necrotic core, integrin alpha 4 beta 7, integrin VLA-4, B2 integrin, TRAIL receptor 1, 2, 3, and 4, RANK, RANK ligand, TNF-α, adhesion molecule VAP-1, epithelial cell adhesion molecule (EpCAM), intercellular adhesion molecule-3 (ICAM-3), leukocyte adhesion, platelet glycoprotein gp IIb / IIIa, cardiac myosin heavy chain, parathyroid hormone, rNAPc2 (an inhibitor of factor VIIa tissue factor), MHC This includes antibodies that recognize any one or combination of proteins, including, but not limited to, carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), tumor necrosis factor (TNF), CTLA-4 (a cytotoxic T lymphocyte-associated antigen), Fc-γ-1 receptor, HLA-DR 10 beta, HLA-DR antigen, sclerostin, L-selectin, respiratory syncytial virus, human immunodeficiency virus (HIV), hepatitis B virus (HBV), Streptococcus mutans, and Staphylococcus aureus.

[0186] Specific examples of known antibodies or their antigen-binding moieties that can be produced using the method of the present invention include adalimumab, atezolizumab, bevacizumab, infliximab, absiximab, alemtuzumab, avelumab, bapineuzumab, basiliximab, belimumab, BMS-986156, briakinumab, canakinumab, semiprimab, certolizumab pegol, cetuximab, conatumumab, CX-072, denosumab, durvalumab, eculizumab, gemtuzumab ozogamicin, golimumab, ibritumomab tiuxetan, INCAGN01876, ipilimumab, rabetsuzumab LY300054, mapatumumab, matsuzumab, and mepolizumab. This includes, but is not limited to, motabizumab, muromonab-CD3, natalizumab, nimotuzumab, nivolumab, ofatumumab, omalizumab, olegobomab, palivizumab, panitumumab, PDR001, oxerumab, pembrolizumab, pemtumomab, pertuzumab, ranibizumab, cintilimab, rituximab, loberizumab, tislerizumab, tocilizumab, tositumomab, tremelimumab, trastuzumab, TRX518, ustekinumab, vedolizomab, voplaterimab, XmAb23104, zaltumumab, and zanorimumab.

[0187] In some embodiments, bicistronic polynucleotides may encode anti-GITR such as TRX518, INCAGN01876, or BMS-986156. In some embodiments, bicistronic polynucleotides may encode anti-OX40 such as oxelumab. In some embodiments, bicistronic polynucleotides may encode anti-ICOS (CD278) such as voplaterimab or XmAb23104 (anti-PD-1 / anti-ICOS). In some embodiments, bicistronic polynucleotides may encode anti-4-1BB (CD137) such as urelumab, utomirumab, INBRX-105 (anti-PD-L1 / anti-4-1BB), or MCL A-145 (anti-PD-L1 / anti-4-1BB). In some embodiments, bicistronic polynucleotides include, for example, nivolumab, pembrolizumab, semiprimab, PDR001, CBT-501, CX-188, TSR-042, XmAb20717 (anti-PD-1 / anti-CTLA-4), cetrerimab (JNJ-63723283), Gilvetmab (for veterinary use in dogs), cintilimab (IBI308), tislerizumab, pizilizumab, and prorugolimab (BCD 100) may encode anti-PD-1 such as camrelizumab (SHR-1210), XmAb23104 (anti-PD-1 / anti-ICOS), AK104 (anti-PD-1 / anti-CTLA-4), MGD019 (anti-PD-1 / anti-CTLA-4), XmAb20717 (anti-PD-1 / anti-CTLA-4), MEDI5752 (anti-PD-1 / anti-CTLA-4), MGD013 (anti-PD-1 / anti-LAG3), RO7121661 (RG7769) (anti-PD-1 / anti-TIM3), or IBI318 (anti-PD-1 / undisclosed TAA). In some embodiments, bicistronic polynucleotides may encode anti-PD-L2 such as AMP-224. In some embodiments, bicistronic polynucleotides may encode anti-CTLA4 such as ipilimumab, XmAb20717 (anti-PD-1 / anti-CTLA-4), tremelimumab, AK104 (anti-PD-1 / anti-CTLA-4), MGD019 (anti-PD-1 / anti-CTLA-4), XmAb20717 (anti-PD-1 / anti-CTLA-4), MEDI5752 (anti-PD-1 / anti-CTLA-4), or KN046 (anti-PD-L1 / anti-CTLA4).In some embodiments, bicistronic polynucleotides may encode anti-VEGF such as valisakumab, bevacizumab, nabixixizumab (OMP-305B83) (anti-DLL4 / anti-VEGF), ABL101 (NOV1501) (anti-DLL4 / anti-VEGF), ranibizumab, falisimab (anti-Ang2 / anti-VEGFA), vanucizumab (anti-Ang2 / anti-VEGF), BI836880 (anti-Ang2 / anti-VEGFA), or ABT165 (anti-DLL4 / anti-VEGF). In some embodiments, bicistronic polynucleotides may encode anti-VEGFR1 such as iclucumab (IMC-18F1). In some embodiments, bicistronic polynucleotides may encode anti-VEGFR2 such as ramucirumab, aracizumab, or 33C3. In some embodiments, the bicistronic polynucleotide may encode IMM-3, axicaptagen siloleucel, AUTO, Immunotox, sparX / ARC-T therapy, or CAR-T therapy such as BCMA CAR-T. In some embodiments, the bicistronic polynucleotide may encode angiopoietin 2 (Ang2) inhibitors such as vanucizumab (anti-Ang2 / anti-VEGF), falisimab (anti-Ang2 / anti-VEGFA), nesbakumab, or BI836880 (anti-Ang2 / anti-VEGFA). In some embodiments, the bicistronic polynucleotide may encode anti-FGFR1 such as BFKB8488A(RG7992)(anti-FGFR1 / anti-KLB). In some embodiments, the bicistronic polynucleotide may encode anti-FGFR2 such as bemarituzumab (FPA144) or apluzumab (BAY 1179470). In some embodiments, bicistronic polynucleotides can encode anti-DLL4 / anti-VEGF compounds such as nabixixizumab (anti-DLL4 / anti-VEGF), ABL101 (NOV1501) (anti-DLL4 / anti-VEGF), or ABT165 (anti-DLL4 / anti-VEGF). In some embodiments, bicistronic polynucleotides can encode anti-Notch compounds such as bronchictuzumab or tarexuzumab.In some embodiments, bicistronic polynucleotides may encode anti-DLL4 agents such as nabixixizumab (anti-DLL4 / anti-VEGF), ABL101 (NOV1501) (anti-DLL4 / anti-VEGF), ABT165 (anti-DLL4 / anti-VEGF), or demcizumab.

[0188] In some embodiments, the gene of interest comprises a polynucleotide sequence encoding a recombinant fusion protein that includes, for example, one of the aforementioned proteins or a functional fragment thereof (e.g., an enzyme-active portion or an antigen-binding portion). For example, a recombinant fusion protein comprising one of the aforementioned proteins or a functional portion thereof, in addition to a multimerizing domain such as a leucine zipper, a multicoil, an Fc portion of an immunoglobulin, or a substantially similar protein, can be generated using the method of the present invention. See, for example, WO94 / 10308, Lovejoy et al. (1993), Science 259:1288-1293, Harbury et al. (1993), Science 262:1401-05, Harbury et al. (1994), Nature 371:80-83, and Hakansson et al. (1999), Structure 7:255-64.

[0189] Specifically, such recombinant fusion proteins include proteins in which a portion of the receptor is fused to the Fc portion of an antibody such as etanercept (p75 TNFR:Fc), abatacept, or beratacept (CTLA4:Fc). In some embodiments, the gene of interest includes a polynucleotide sequence encoding a marker, such as a screenable marker like GFP or luciferase.

[0190] VIII. Adaptation In some embodiments, compositions disclosed herein, such as bicistronic polynucleotides, vectors containing bicistronic polynucleotides, or cells containing them, can be used to prevent or treat diseases or conditions, such as proliferative disorders like cancer or malignant tumors, or precancerous conditions like myelodysplasia, myelodysplastic syndromes, or preleukemia.

[0191] "Cancer" refers to a broad group of proliferative disorders characterized by the uncontrolled growth of abnormal cells within the body. Uncontrolled cell division and proliferation result in the formation of malignant tumors that can invade adjacent tissues and metastasize to distant parts of the body through the lymphatic system or bloodstream. As used herein, the term "proliferative" disorder or disorder refers to the undesirable cell proliferation of one or more subsets of cells in a multicellular organism that causes harm to the multicellular organism (i.e., discomfort or reduced life expectancy). For example, as used herein, proliferative disorder or disorder includes neoplastic disorders and other proliferative disorders. "Neoplasm," as used herein, refers to any form of dysregulation or dysregulation of cell proliferation, whether malignant or benign, resulting in abnormal tissue growth. Thus, "neoplastic cells" include malignant and benign cells having dysregulation or dysregulation of cell proliferation. In some embodiments, cancer is a tumor. "Tumor," as used herein, refers to the proliferation and growth of all neoplastic cells, whether malignant or benign, as well as all precancerous and cancerous cells and tissues.

[0192] In some embodiments, the disease is a solid tumor or a liquid tumor. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the disease is a blood cancer. In some embodiments, the blood cancer is leukemia. In some embodiments, the cancer is selected from the group consisting of one or more acute leukemias, including but not limited to B-cell acute lymphoblastic leukemia (BALL), T-cell acute lymphoblastic leukemia (TALL), small lymphocytic leukemia (SLL), acute lymphoblastic leukemia (ALL) (e.g., relapsed and refractory ALL), chronic myeloid leukemia (CML), and chronic lymphocytic leukemia (CLL). Additional hematological malignancies or conditions include, but are not limited to, mantle cell lymphoma (MCL), B-cell prelymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell follicular lymphoma or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenström macroglobulinemia, and preleukemia. Preleukemia encompasses a diverse collection of hematological conditions linked by ineffective production (or dysplasia) of bone marrow blood cells. In some embodiments, indications are atypical and / or nonclassical cancers, malignancies, precancerous conditions or proliferative disorders, and any combination thereof.

[0193] In some embodiments, the disease is a lymphoma, e.g., MCL or Hodgkin lymphoma. In some embodiments, the disease is a leukemia, e.g., SLL, CLL, and / or ALL. In some embodiments, the tumor antigen, e.g., the disease associated with the tumor antigen described herein is selected from proliferative disorders such as cancer or malignant tumors, or precancerous conditions such as myelodysplasia, myelodysplastic syndromes, or preleukemia, or is a non-cancer-related indicator associated with the expression of the tumor antigen described herein. In some embodiments, the disease associated with the tumor antigen described herein is a solid tumor, e.g., a solid tumor described herein, e.g., prostate cancer, colorectal cancer, pancreatic cancer, cervical cancer, gastric cancer, ovarian cancer, head cancer, or lung cancer.

[0194] In some embodiments, cancer is selected from AML, ALL, B-ALL, T-ALL, B-cell prelymphocytic leukemia, chronic lymphocytic leukemia, CML, hairy cell leukemia, Hodgkin lymphoma, mast cell disorder, myelodysplastic syndrome, myeloproliferative neoplasm, plasmacytomyeloma, plasmacytoid dendritic cell neoplasm, or a combination thereof.

[0195] In some embodiments, the compositions disclosed herein (e.g., polynucleotides encoding the CARs of the Disclosure, vectors comprising polynucleotides encoding the CARs of the Disclosure, the CARs of the Disclosure, or cells expressing the CARs of the Disclosure, e.g., CAR-T cells) are used to reduce or decrease tumor size or inhibit tumor growth in subjects requiring it. In some embodiments, the tumor is a carcinoma (i.e., an epithelial cancer). In some embodiments, tumors are selected from the group consisting of, for example, gastric cancer, gastroesophageal junction (GEJ) cancer, esophageal cancer, colorectal cancer, liver cancer (hepatocellular carcinoma, HCC), ovarian cancer, breast cancer, NSCLC, bladder cancer, lung cancer, pancreatic cancer, head and neck cancer, lymphoma, uterine cancer, kidney cancer or renal cancer, biliary tract cancer, prostate cancer, testicular cancer, urethral cancer, penile cancer, thoracic cancer, rectal cancer, brain cancer (glioma and glioblastoma), cervical cancer, parotid gland cancer, laryngeal cancer, thyroid cancer, adenocarcinoma, neuroblastoma, melanoma, and Merkel cell carcinoma.

[0196] "Cancer" or "cancer tissue" can include tumors at various stages. In certain embodiments, cancer or tumor is, for example, Stage 0, where the cancer or tumor is very early in development and has not metastasized. In some embodiments, cancer or tumor is, for example, Stage I, where the cancer or tumor is relatively small in size, has not spread to nearby tissues, and has not metastasized. In other embodiments, cancer or tumor is, for example, Stage II or Stage III, where the cancer or tumor is larger than Stage 0 or Stage I, has grown into adjacent tissues but has not metastasized except for the potential for lymph node metastasis. In other embodiments, cancer or tumor is, for example, Stage IV, where the cancer or tumor has metastasized. Stage IV may also be called advanced cancer or metastatic cancer.

[0197] In some aspects, cancer includes adrenocortical carcinoma, advanced cancer, anal cancer, aplastic anemia, cholangiocarcinoma, bladder cancer, bone cancer, bone metastases, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of unknown primary origin, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophageal cancer, Ewing family tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin's disease, Kaposi's sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancers, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia, liver cancer, non-small cell lung cancer, small cell lung cancer, and pulmonary carcinoid tumors. This may include, but is not limited to, tumors, lymphomas of the skin, malignant mesothelioma, multiple myeloma, myelodysplastic syndromes, nasal and paranasal sinus cancers, nasopharyngeal cancers, neuroblastomas, non-Hodgkin lymphomas, oral and oropharyngeal cancers, osteosarcomas, ovarian cancers, pancreatic cancers, penile cancers, pituitary tumors, prostate cancers, retinoblastomas, rhabdomyosarcomas, salivary gland cancers, sarcomas of adult soft tissues, basal and squamous cell carcinomas, melanomas, small intestine cancers, gastric cancers, testicular cancers, pharyngeal cancers, thymic cancers, thyroid cancers, uterine sarcomas, vaginal cancers, vulvar cancers, Waldenström macroglobulinemia, Wilms tumors and secondary cancers caused by cancer treatment.

[0198] In some aspects, a tumor is a solid tumor. “Solid tumor” includes, but is not limited to, sarcomas, melanomas, carcinomas, or other solid tumor carcinomas. “Sarcoma” refers to a tumor consisting of densely packed cells embedded in a fibrous or homogeneous material, typically made of a substance such as embryonic connective tissue. Sarcomas include chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abernesi's sarcoma, liposarcoma, liposarcoma, hydatidiform soft tissue sarcoma, ameloblast sarcoma, staphyloid sarcoma, chlormasarcoma, choriocarcinoma, embryonic sarcoma, Wilms tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fasciosarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, and more. This includes, but is not limited to, diginsarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, B-cell immunoblastoma sarcoma, lymphoma, T-cell immunoblastoma sarcoma, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukemosarcoma, malignant soft tissue sarcoma, paraosteal osteosarcoma, reticular erythrocyte sarcoma, Rous sarcoma, serous cystic sarcoma, synovial sarcoma, or peripheral telangiectatic sarcoma.

[0199] The term "melanoma" refers to tumors arising from the melanocyte system of the skin and other organs. Melanomas include, for example, acrolescent melanoma, achromatic melanoma, benign juvenile melanoma, Cloudmann melanoma, S91 melanoma, Harding-Passie melanoma, juvenile melanoma, lentigo malignant melanoma, malignant melanoma, metastatic melanoma, nodular melanoma, subungual melanoma, or superficial spreading melanoma.

[0200] The term "carcinoma" refers to a malignant neoplasm composed of epithelial cells that tend to invade surrounding tissues and metastasize. Examples of carcinomas include, for example, acinar carcinoma, acinous carcinoma, adenoid cystic carcinoma, adenoid cystic carcinoma, adenocarcinoma, adrenocortical carcinoma, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma. basocellulare), basaloid cell carcinoma, basal squamous cell carcinoma, bronchioloalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, encephaloid carcinoma, cholangiocarcinoma, choriocarcinoma, colloid carcinoma, comedocarcinoma, endometrial carcinoma, phloem carcinoid carcinoma, skin cancer, columnar cell carcinoma, columnar cell carcinoma, tubular carcinoma, hard carcinoma, embryonal carcinoma, encephaloid carcinoma, epidermoid carcinoma, adenoid carcinoma, exophytic carcinoma, ulcer carcinoma, fibrous carcinoma, gelatiniform carcinoma carcinoma), gelatinous carcinoma Carcinoma, giant cell carcinoma, giant cell carcinoma, adenocarcinoma, granulosa cell carcinoma, piloma carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hürthle cell carcinoma, hyaline carcinoma, adrenal carcinoma, fetal carcinoma, carcinoma in situ, carcinoma in epidermis, carcinoma in situ, chrompecher carcinoma, Kruticky cell carcinoma, large cell carcinoma, lenticular carcinoma, carcinoma lenticulare, fatty carcinoma, lymphoepithelial carcinoma, medullary carcinoma, medullary carcinoma Carcinoma, including black carcinoma, soft carcinoma, mucinous carcinoma, mucosal carcinoma, mucinous cell carcinoma, mucoepidermoid carcinoma, mucin-producing carcinoma, mucinous carcinoma, myxomatous carcinoma, nasopharyngeal carcinoma, oat cell carcinoma, ossifying carcinoma, osteoid carcinoma, papillary carcinoma, periportal carcinoma, pre-invasive carcinoma, squamous cell carcinoma, atherosclerotic carcinoma, renal cell carcinoma, preliminary cell carcinoma, sarcomatoid carcinoma, Schneiderian carcinoma, scirrhous carcinoma, scrotal carcinoma, signet ring cell carcinoma, simple carcinoma, small cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, spongy carcinoma, squamous cell carcinoma, squamous cell carcinoma, string carcinoma, telangiectatic carcinoma, telangiectatic carcinoma, transitional cell carcinoma, nodular carcinoma, tubular adenocarcinoma, verrucous carcinoma, or bladder carcinoma.

[0201] The compositions disclosed herein (e.g., polynucleotides encoding the CARs of this disclosure, vectors comprising polynucleotides encoding the CARs of this disclosure, the CARs of this disclosure, or cells expressing the CARs of this disclosure, such as CAR-T cells) include, for example, leukemia, Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, primary thrombocythemia, primary macroglobulinemia, small cell lung cancer, primary brain tumor, gastric cancer, colon cancer, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, papillary thyroid cancer, neuroblastoma, neuroendocrine cancer, esophageal cancer, genitourinary cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenocortical cancer, prostate cancer, Müllerian duct cancer, ovarian cancer, peritoneal cancer, ductal fallopian carcinoma, or papillary serous carcinoma of the uterus.

[0202] Other diseases, disorders, and conditions that can be treated with the compositions disclosed herein include, for example, inflammatory diseases or conditions, neurodegenerative disorders, enzyme deficiencies, hormone deficiencies, coagulation disorders, or infections.

[0203] IX. Nuclease The bicistronic polypeptides of this disclosure can be inserted into specific sites (regions) of a target gene using any method known in the art. In some embodiments, the bicistronic polypeptides of this disclosure are inserted into a gene using a nuclease. As used herein, the term “nuclease” refers to an enzyme having catalytic activity for DNA cleavage. In some embodiments, the nuclease can facilitate homologous recombination between the bicistronic constructs (BC1-BC8) or whole donor constructs (FD1-FD8) disclosed herein and a gene, e.g., the B2M gene. In some embodiments, the bicistronic constructs integrated into the genome of a host cell line (e.g., T cells) contain homologous regions adjacent to sequences (e.g., sites 1-4) targeted by a nuclease, e.g., a CRISPR / Cas nuclease.

[0204] The size of the recognition sites of nucleases that mediate homologous recombination can vary, for example, at least about 4, at least about 6, at least about 8, at least about 10, at least about 12, at least about 14, at least about 16, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, and fewer. Approximately 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, and fewer At least approximately 57, at least approximately 58, at least approximately 59, at least approximately 60, at least approximately 61, at least approximately 62, at least approximately 63, at least approximately 64, at least approximately 65, at least approximately 66, at least approximately 67, at least approximately 68, at least approximately 69, at least approximately 70, at least approximately 80, at least approximately 90, at least approximately 100, at least approximately 110, at least approximately 120, at least approximately 130, at least approximately 140, at least approximately 150, at least approximately 160, at least approximately 170, at least Approximately 180 each, at least approximately 190, at least approximately 200, at least approximately 210, at least approximately 220, at least approximately 230, at least approximately 240, at least approximately 250, at least approximately 260, at least approximately 270, at least approximately 280, at least approximately 290, at least approximately 300, at least approximately 310, at least approximately 320, at least approximately 330, at least approximately 340, at least approximately 350, at least approximately 360, at least approximately 370, at least approximately 380, at least approximately 390, at least approximately 400,At least approximately 410, at least approximately 420, at least approximately 430, at least approximately 440, at least approximately 450, at least approximately 460, at least approximately 470, at least approximately 480, at least approximately 490, at least approximately 500, at least approximately 510, at least approximately 520, at least approximately 530, at least approximately 540, at least approximately 550, at least approximately 560, at least approximately 570, at least approximately 580, at least approximately 590, at least approximately 600, at least approximately 610, at least approximately 620, at least approximately 630, at least approximately 640, at least approximately 650, at least approximately 660, at least approximately 670, at least approximately 680, at least approximately 690, at least approximately 700, at least approximately 710 It contains recognition sites with a nucleotide length of at least approximately 720, at least approximately 730, at least approximately 740, at least approximately 750, at least approximately 760, at least approximately 770, at least approximately 780, at least approximately 790, at least approximately 800, at least approximately 810, at least approximately 820, at least approximately 830, at least approximately 840, at least approximately 850, at least approximately 860, at least approximately 870, at least approximately 880, at least approximately 890, at least approximately 900, at least approximately 910, at least approximately 920, at least approximately 930, at least approximately 940, at least approximately 950, at least approximately 960, at least approximately 970, at least approximately 980, at least approximately 990, and at least approximately 1000 or more.

[0205] The size of the recognition sites of nucleases that mediate homologous recombination can vary. For example, the recognition sites may number approximately 4, 6, 8, 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48. , about 49 pieces, about 50 pieces, about 51 pieces, about 52 pieces, about 53 pieces, about 54 pieces, about 55 pieces, about 56 pieces, about 57 pieces, about 58 pieces, about 59 pieces, about 60 pieces, about 61 pieces, about 62 pieces, about 63 pieces, about 64 pieces, about 65 pieces, about 66 pieces, about 67 pieces, about 68 pieces, about 69 pieces, about 70 pieces, about 80 pieces , about 90 pieces, about 100 pieces, about 110 pieces, about 120 pieces, about 130 pieces, about 140 pieces, about 150 pieces, about 160 pieces, about 170 pieces, about 180 pieces, about 190 pieces, about 200 pieces, about 210 pieces, about 220 pieces, about 230 pieces, about 240 pieces, about 250 pieces, about 260 pieces, about 270 pieces, about 2 80 pieces, about 290 pieces, about 300 pieces, about 310 pieces, about 320 pieces, about 330 pieces, about 340 pieces, about 350 pieces, about 360 pieces, about 370 pieces, about 380 pieces, about 390 pieces, about 400 pieces, about 410 pieces, about 420 pieces, about 430 pieces, about 440 pieces, about 450 pieces, about 460 pieces, about 47 0 pieces, about 480 pieces, about 490 pieces, about 500 pieces, about 510 pieces, about 520 pieces, about 530 pieces, about 540 pieces, about 550 pieces, about 560 pieces, about 570 pieces, about 580 pieces, about 590 pieces, about 600 pieces, about 610 pieces, about 620 pieces, about 630 pieces, about 640 pieces, about 650 pieces, about 660 pieces , containing recognition sites with a nucleotide length of approximately 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 or more.

[0206] In one embodiment, each monomer of the nuclease recognizes a recognition site of at least nine nucleotides. In another embodiment, the recognition site is of a length of about 9 to about 12 nucleotides, about 12 to about 15 nucleotides, about 15 to about 18 nucleotides, or about 18 to about 21 nucleotides, and any combination of such subranges (e.g., 9 to 18 nucleotides).

[0207] The recognition site may be recurrent, meaning that a sequence on one strand reads the same sequence in the opposite direction on the complementary strand. It is recognized that a given nuclease can bind to the recognition site and cleave that binding site, or alternatively, the nuclease can bind to a sequence different from the recognition site. Furthermore, the term recognition site includes both the nuclease binding site and the nick / cleavage site, regardless of whether the nick / cleavage site is inside or outside the nuclease binding site. In another variation, cleavage by the nuclease may occur at nucleotide positions directly opposite each other, resulting in a blunt-end cleavage, or in other cases, the cleavage may be alternatingly offset, producing a single-strand overhang, also called a "sticky end," which may be either a 5' overhang or a 3' overhang.

[0208] Any nuclease agent that induces a nick or double-strand break at a desired recognition site can be used in the methods and compositions disclosed herein. Natural nuclease agents or natural nuclease agents can be used insofar as they induce a nick or double-strand break at the desired recognition site. Alternatively, modified or engineered nuclease agents can be used. "Engineered nuclease agent" includes a nuclease that has been engineered (modified or induced) from its natural form to specifically recognize and induce a nick or double-strand break at a desired recognition site. Therefore, engineered nuclease agents may be derived from natural nuclease agents or may be artificially produced or synthesized. Modification of the nuclease agent may be as minimal as one amino acid in the protein cleavage agent or one nucleotide in the nucleic acid cleavage agent. In some embodiments, the engineered nuclease induces a nick or double-strand break at a recognition site that is not the sequence that would have been recognized by a natural (unengineered or unmodified) nuclease agent. The generation of nicks or double-strand breaks at a recognition site or other DNA may be referred to as "cutting" or "cleaving" of the recognition site or other DNA in this specification.

[0209] Nuclease agents may be introduced into cells by any means known in the art. Polypeptides encoding nuclease agents may be introduced directly into cells. Alternatively, polynucleotides encoding nuclease agents can be introduced into cells. When polynucleotides encoding nuclease agents are introduced into cells, the nuclease agent may be expressed transiently, conditionally, or constitutively within the cell. Therefore, polynucleotides encoding nuclease agents may be contained in an expression cassette and operably linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters are discussed in more detail elsewhere in this specification. Alternatively, nuclease agents may be introduced into cells as mRNA encoding or containing a nuclease agent.

[0210] Active variants and fragments of nucleases (i.e., engineered nucleases) are also provided. Such active variants may contain at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the natural nuclease, and the active variants retain the ability to cleave at a desired recognition site and thus retain nick or double-strand break-inducing activity. For example, any of the nucleases described herein may be modified from a natural endonuclease sequence and designed to recognize and induce nicks or double-strand breaks at a recognition site not recognized by the natural nuclease. Thus, in some embodiments, the engineered nuclease has specificity to induce nicks or double-strand breaks at a recognition site different from the corresponding natural nuclease recognition site. Assays for nicks or double-strand break-inducing activity are well-known and commonly measure the overall activity and specificity of endonucleases on DNA substrates containing recognition sites.

[0211] When a nuclease agent is delivered to a cell via the introduction of a polynucleotide encoding the nuclease agent, the polynucleotide encoding the nuclease agent may be modified to substitute codons that are more frequently used in the target cell compared to the native polynucleotide sequence encoding the nuclease agent. For example, the polynucleotide encoding the nuclease agent may be modified to substitute codons that are more frequently used in a given target prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, non-rat eukaryotic cells, mammalian cells, rodent cells, non-rat rodent cells, mouse cells, rat cells, hamster cells, or any other target host cell, compared to the native polynucleotide sequence.

[0212] In certain aspects of this disclosure, homologous recombination is mediated by a CRISPR / Cas system, a TALEN system, a ZFN system, a meganuclease, or a restricted endonuclease.

[0213] CRISPR / CAS In some embodiments, the nuclease agents used in the various methods and compositions disclosed herein may include a CRISPR / Cas system. Such systems may, for example, utilize a Cas9 nuclease, which in some examples is codon-optimized for the desired cell type in which it is expressed. Such systems may also employ a guide RNA (gRNA) comprising two distinct molecules. An exemplary two-molecule gRNA comprises a crRNA-like molecule ("CRISPR RNA" or "targeter-RNA" or "crRNA" or "crRNA repeater") and a corresponding tracrRNA-like molecule ("trans-acting CRISPR RNA" or "activator-RNA" or "tracrRNA" or "scaffold").

[0214] crRNA contains both the DNA targeting segment (single-stranded) of the gRNA and the nucleotide sequence that forms half of the double-stranded RNA (dsRNA) double helix of the protein-binding segment of the gRNA. The corresponding tracrRNA (activator-RNA) contains the nucleotide sequence that forms the other half of the dsRNA double helix of the protein-binding segment of the gRNA. Therefore, the nucleotide stretch of the crRNA is complementary to the nucleotide stretch of the tracrRNA, and they hybridize to form the dsRNA double helix of the protein-binding domain of the gRNA. Thus, each crRNA can be considered to have a corresponding tracrRNA. The crRNA further provides the single-stranded DNA targeting segment. Therefore, the gRNA contains the sequence that hybridizes to the target sequence, and the tracrRNA. Thus, the crRNA and tracrRNA hybridize (as a corresponding pair) to form the gRNA. When used for intracellular modification, the exact sequence and / or length of a given crRNA or tracrRNA molecule may be designed to be species-specific to the RNA molecule in which it is used.

[0215] The native genes encoding the three elements (Cas9, tracrRNA, and crRNA) are generally organized into an operon. Naturally occurring CRISPR RNA, while varying depending on the Cas9 system and organism, often contains a targeting segment 21–72 nucleotides long, flanked by two direct repeats (DRs) 21–46 nucleotides long (see, e.g., WO2014 / 131833). In S. pyogenes, the DRs are 36 nucleotides long, and the targeting segment is 30 nucleotides long. The DR located at 3' is complementary to the corresponding tracrRNA, hybridizes, and then binds to the Cas9 protein.

[0216] Alternatively, the system further employs a fusion crRNA-tracrRNA construct (i.e., a single transcript) that functions with codon-optimized Cas9. This single RNA is often called a guide RNA or gRNA. Within the gRNA, the crRNA portion is identified as the target sequence for a given recognition site, and the tracrRNA is often called the scaffold. Briefly, a short DNA fragment containing the target sequence is inserted into a guide RNA expression plasmid. The gRNA expression plasmid contains the target sequence (in some embodiments, about 20 nucleotides), the morphology (scaffold) of the tracrRNA sequence, as well as a suitable promoter that is active in cells, and elements necessary for proper processing in eukaryotic cells. Many systems rely on custom complementary oligonucleotides that are annealed to form double-stranded DNA and then cloned into the gRNA expression plasmid.

[0217] Next, gRNA expression cassettes and Cas9 expression cassettes are introduced into the cells. See, for example, Mali P et al. (2013) Science 2013 Feb. 15;339(6121):823-6, Jinek M et al. Science 2012 Aug. 17;337(6096):816-21, Hwang WY et al. Nat Biotechnol 2013 March;31(3):227-9, Jiang W et al. Nat Biotechnol 2013 March;31(3):233-9, and Cong L et al. Science 2013 Feb. 15;339(6121):819-23. Each of these is incorporated herein by reference. See also, for example, WO / 2013 / 176772A1, WO / 2014 / 065596A1, WO / 2014 / 089290A1, WO / 2014 / 093622A2, WO / 2014 / 099750A2, and WO / 2013142578A1, each of which is incorporated herein by reference.

[0218] In some embodiments, the Cas9 nuclease may be provided in the form of a protein. In some embodiments, the Cas9 protein may be provided in the form of a complex with gRNA. In other embodiments, the Cas9 nuclease may be provided in the form of a nucleic acid encoding a protein. The nucleic acid encoding the Cas9 nuclease may be RNA (e.g., messenger RNA (mRNA)) or DNA. In some embodiments, the gRNA may be provided in the form of RNA. In other embodiments, the gRNA may be provided in the form of DNA encoding RNA. In some embodiments, the gRNA may be provided in the form of separate crRNA and tracrRNA molecules, or separate DNA molecules encoding crRNA and tracrRNA, respectively.

[0219] In some embodiments, the gRNA includes a third nucleic acid sequence encoding CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA (crRNA) and transactivated CRISPR RNA (tracrRNA). In one embodiment, the Cas protein is a type I Cas protein. In one embodiment, the Cas protein is a type II Cas protein. In one embodiment, the type II Cas protein is Cas9. In one embodiment, the type II Cas, for example Cas9, is a human codon-optimized Cas.

[0220] In certain embodiments, Cas proteins are “nickases” capable of generating single-strand breaks (i.e., “nicks”) at a target site without cleaving both strands of double-stranded DNA (dsDNA). Cas9, for example, comprises two nuclease domains, namely a RuvC-like nuclease domain and an HNH-like nuclease domain, which are involved in cleaving opposing DNA strands. Mutations in either of these domains can generate nickases. Examples of nickase-generating mutations can be found, for example, in WO / 2013 / 176772A1 and WO / 2013 / 142578A1, each incorporated herein by reference.

[0221] In certain embodiments, two distinct Cas proteins (e.g., nickases) specific to target sites on each strand of dsDNA can generate an overhang sequence on another nucleic acid, or an overhang sequence complementary to a distinct region on the same nucleic acid. The overhang ends produced by contacting the nucleic acid with two nickases specific to target sites on both strands of dsDNA may be either 5' or 3' overhang ends. For example, a first nickase may produce a single-strand break on the first strand of dsDNA, while a second nickase may produce a single-strand break on the second strand of dsDNA so that an overhang sequence is produced. The target sites of each nickase that produce a single-strand break may be selected such that the resulting overhang end sequence is complementary to an overhang end sequence on a different nucleic acid molecule. Complementary overhang ends of two different nucleic acid molecules can be annealed by the methods disclosed herein. In some embodiments, the target sites of nickase on the first chain are different from the target sites of nickase on the second chain.

[0222] In some embodiments, the first nucleic acid comprises a mutation that disrupts at least one amino acid residue in the nuclease active site of the Cas protein, the mutant Cas protein produces a cleavage in only one strand of the target DNA region, and the mutation reduces non-homologous recombination in the target DNA region. In one embodiment, the first nucleic acid encoding the Cas protein further comprises a nuclear localization signal (NLS). In one embodiment, the nuclear localization signal is an SV40 nuclear localization signal.

[0223] TALEN In some embodiments, the nuclease agents used in the various methods and compositions disclosed herein may comprise a TALEN system. Therefore, in one embodiment, the nuclease agent is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to produce double-strand breaks at specific target sequences in the genomes of prokaryotes or eukaryotes. TAL effector nucleases are produced by fusing a native or engineered transcription activator-like (TAL) effector or a functional portion thereof to the catalytic domain of an endonuclease, such as FokI.

[0224] The unique modular TAL effector DNA-binding domain allows for the design of proteins with potentially arbitrary given DNA recognition specificity. Therefore, the DNA-binding domain of a TAL effector nuclease can be engineered to recognize a specific DNA target site and thus can be used to create double-strand breaks at a desired target sequence. See WO 2010 / 079430, Morbitzer et al. (2010) PNAS 10.1073 / pnas.1013133107, Scholze & Boch (2010) Virulence 1:428-432, Christian et al. Genetics (2010) 186:757-761, Li et al. (2010) Nuc. Acids Res. (2010) doi:10.1093 / nar / gkq704, and Miller et al. (2011) Nature Biotechnology 29:143-148. All of these are incorporated herein by reference.

[0225] Examples of suitable TAL nucleases and methods for preparing suitable TAL nucleases are disclosed, for example, in U.S. Patent Applications Nos. 2011 / 0239315 A1, 2011 / 0269234 A1, 2011 / 0145940 A1, 2003 / 0232410 A1, 2005 / 0208489 A1, 2005 / 0026157 A1, 2005 / 0064474 A1, 2006 / 0188987 A1, and 2006 / 0063231 A1 (each incorporated herein by reference).

[0226] In various embodiments, the TAL effector nuclease is engineered, for example, to cleave a target nucleic acid sequence or its vicinity at a target genomic locus, where the target nucleic acid sequence is the sequence or its vicinity that is modified by the targeting vector. Suitable TAL nucleases for use in the various methods and compositions provided herein include those specifically designed to bind to a target nucleic acid sequence or its vicinity that is modified by the targeting vector described herein.

[0227] In one embodiment, each monomer of TALEN contains 12 to 25 TAL repeat sequences, and each TAL repeat sequence binds to a 1 bp subsite. In one embodiment, the nuclease agent is a chimeric protein containing a TAL repeat-based DNA-binding domain operably linked to an independent nuclease. In one embodiment, the independent nuclease is a FokI endonuclease. In one embodiment, the nuclease agent contains a first TAL-repeat-based DNA-binding domain and a second TAL-repeat-based DNA-binding domain, each of which is operably linked to a FokI nuclease, and the first and second TAL-repeat-based DNA-binding domains recognize two consecutive target DNA sequences on each strand of a target DNA sequence separated by a cleavage site of approximately 6 bp to approximately 40 bp, causing the FokI nuclease to dimerize and perform a double-strand break at the target sequence.

[0228] In one embodiment, the nuclease agent comprises a first TAL-repeat-based DNA-binding domain and a second TAL-repeat-based DNA-binding domain, each of which is operably ligated to a FokI nuclease, and the first and second TAL-repeat-based DNA-binding domains recognize two consecutive target DNA sequences on each strand of a target DNA sequence separated by a 5 bp or 6 bp cleavage site, causing the FokI nuclease to dimerize and perform a double-strand break.

[0229] Zinc finger nuclease (ZFN) In some embodiments, the nuclease agents used in the various methods and compositions disclosed herein may comprise a zinc finger nuclease (ZFN) system. In one embodiment, each monomer of the ZFN comprises three or more zinc finger-based DNA-binding domains, each zinc finger-based DNA-binding domain binding to a 3 bp subsite. In other embodiments, the ZFN is a chimeric protein comprising zinc finger-based DNA-binding domains operably linked to an independent nuclease. In one embodiment, the independent endonuclease is a FokI endonuclease. In one embodiment, the nuclease agent comprises a first ZFN and a second ZFN, each of which is operably linked to a FokI nuclease, and the first and second ZFNs recognize two consecutive target DNA sequences on each strand of a target DNA sequence separated by a cleavage site of about 6 bp to about 40 bp or a cleavage site of about 5 bp to about 6 bp, and the FokI nuclease dimerizes to perform a double-strand break. See, for example, US20060246567;US20080182332;US20020081614;US20030021776, WO / 2002 / 057308A2, US20130123484;US20100291048, and WO / 2011 / 017293A2, each of which is incorporated herein by reference.

[0230] Meganuclease In some embodiments, the nuclease agents used in the various methods and compositions disclosed herein may include meganuclease systems. Meganucleases (or homing endonucleases or HEases) are classified into four families based on conserved sequence motifs: the "LAGLIDADG," "GIY-YIG," "HNH," and "His-Cys box" families. These motifs are involved in the coordination of metal ions and the hydrolysis of phosphodiester bonds.

[0231] HEases are noteworthy for their long recognition sites and their tolerance to several sequence polymorphisms in their DNA substrates. The meganuclease domains, structure, and function are publicly known; see, for example, Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199-248, Lucas et al., (2001) Nucleic Acids Res 29:960-9, Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304-26, Stoddard, (2006) Q Rev Biophys 38:49-95, and Moure et al., (2002) Nat Struct Biol 9:764.

[0232] In some embodiments, natural variants and / or manipulated derivative meganucleases are used. Methods for modifying dynamics, cofactor interactions, expression, optimal conditions, and / or recognition site specificity, and activity screening are discussed, for example, in Epinat et al., (2003) Nucleic Acids Res 31:2952-62, Chevalier et al., (2002) Mol Cell 10:895-905, Gimble et al., (2003) Mol Biol 334:993-1008, Seligman et al., (2002) Nucleic Acids Res 30:3870-9, Sussman et al., (2004) J Mol Biol 342:31-41, Rosen et al., (2006) Nucleic Acids Res 34:4791-800, Chames et al., (2005) Nucleic Acids Res 33:e178, Smith et al., See (2006) Nucleic Acids Res 34:e149, Gruen et al., (2002) Nucleic Acids Res 30:e29, Chen and Zhao, (2005) Nucleic Acids Res 33:e154, WO2005105989, WO2003078619, WO2006097854, WO2006097853, WO2006097784, and WO2004031346.

[0233] Any meganuclease can be used in this specification, including I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SecVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII, or any active variant or fragment thereof.

[0234] In one embodiment, the meganuclease recognizes a double-stranded DNA sequence of 12–40 base pairs. In one embodiment, the meganuclease recognizes a perfectly matched target sequence in one of the heterologous plasmids described herein. In one embodiment, the meganuclease is a homing nuclease. In one embodiment, the homing nuclease is the "LAGLIDADG" family of homing nucleases. In one embodiment, the "LAGLIDADG" family of homing nucleases is selected from I-SceI, I-CreI, and I-Dmol.

[0235] Restricted Endonuclease In some embodiments, the nuclease agents used in homologous recombination in the various methods and compositions disclosed herein may include restriction endonucleases, including type I, type II, type III, and type IV endonucleases. Type I and type III restriction endonucleases recognize specific recognition sites, but generally cleave at variable positions from the nuclease binding site, and can be several hundred base pairs away from the cleavage site (recognition site). In the type II system, restriction activity is independent of any methylase activity, and cleavage typically occurs at a specific site within or near the binding site. Most type II enzymes cleave palindromic sequences, but type IIa enzymes recognize non-palindromic recognition sites and cleave outside the recognition site, type IIb enzymes cleave the sequence twice at both sites outside the recognition site, and type IIs enzymes recognize asymmetric recognition sites and cleave at a fixed distance of about 1 to 20 nucleotides from the recognition site. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and classified in, for example, the REBASE database (web pages at rebase.neb.com, Roberts et al., (2003) Nucleic Acids Res 31:418-20), Roberts et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761-783, Eds. Craigie et al. (ASM Press, Washington, DC).

[0236] X. Kits and manufactured articles This disclosure also includes, for example, (i) Bicistronic polynucleotides of the present disclosure, (ii) A vector comprising the bicistronic polynucleotide of the present disclosure, (iii) Cells containing the bicistronic polynucleotides of the present disclosure, and optionally, (iv) Provide kits and manufactured products including instructions for use.

[0237] In certain embodiments, the Disclosure provides kits and products comprising cells, or pharmaceutical compositions comprising cells, which are genetically modified cells for expressing the CARs (i.e., cells) of the Disclosure, and which comprise one or more polynucleotides encoding the CARs of the Disclosure, or one or more vectors encoding the CARs of the Disclosure (e.g., T cells, natural killer (NK) cells, natural killer T (NKT) cells, or ILC cells), and optionally provides instructions for use.

[0238] In some embodiments, the Disclosure provides kits and products comprising oligonucleotides for nuclease-mediated insertion in a B2M gene selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1), site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2), site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3), and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4).

[0239] In some embodiments, the Disclosure provides kits and products comprising oligonucleotides for nuclease-mediated insertion in the B2M gene, wherein the oligonucleotides are hybridized under strict conditions with any of the oligonucleotides selected from site 1 (ACTCTCTCTTTCTGGCCTGG, SEQ ID NO: 1), site 2 (AGTCACATGGTTCACACGGC, SEQ ID NO: 2), site 3 (CACAGCCCAAGATAGTTAAG, SEQ ID NO: 3), and site 4 (GAGACATGTAAGCAGCATCA, SEQ ID NO: 4), and their complementary sequences.

[0240] In some embodiments, the Disclosure provides kits and products comprising gRNAs for CRISPR / Cas9-mediated insertion in B2M, wherein the gRNAs are selected from any of the following: site 1 gRNA (ACTCTCTCTTTCTGGCCTGG, SEQ ID NO: 1), site 2 gRNA (AGTCACATGGTTCACACGGC, SEQ ID NO: 2), site 3 gRNA (CACAGCCCAAGATAGTTAAG, SEQ ID NO: 3), site 4 gRNA (GAGACATGTAAGCAGCATCA, SEQ ID NO: 4), and their complementary sequences.

[0241] In some embodiments, a kit or product includes, at a minimum, a bicistronic polynucleotide encoding the CARs of the Disclosure, a vector containing a bicistronic polynucleotide code encoding the CARs of the Disclosure, cells genetically modified to express the CARs encoded by the bicistronic polynucleotides of the Disclosure, a composition (a pharmaceutical composition including the bicistronic polynucleotides, vectors, or cells disclosed herein), or an oligonucleotide for nuclease-mediated insertion, in one or more containers.

[0242] In some embodiments, the kit or product includes at least a bicistronic polynucleotide encoding the CARs of the Disclosure, a vector containing a bicistronic polynucleotide code encoding the CARs of the Disclosure, cells genetically modified to express the CARs encoded by the bicistronic polynucleotides of the Disclosure, a composition (a pharmaceutical composition including the bicistronic polynucleotides, vectors, or cells disclosed herein), or an oligonucleotide for nuclease-mediated insertion, and optionally, instructions for use.

[0243] In some embodiments, the kit or product comprises at least a bicistronic polynucleotide encoding the CARs of the Disclosure, a vector containing a bicistronic polynucleotide code encoding the CARs of the Disclosure, cells genetically modified to express the CARs encoded by the bicistronic polynucleotides of the Disclosure, a composition (a pharmaceutical composition comprising the bicistronic polynucleotides, vectors, or cells disclosed herein), or an oligonucleotide for nuclease-mediated insertion, and optionally, at least a vial containing a solvent or reagent.

[0244] In some embodiments, the kit or product comprises, for example, a vector comprising a bicistronic polynucleotide or a bicistronic polypeptide of the Disclosure in at least one container and another or more containers containing a transfection reagent.

[0245] In some embodiments, the kit or product comprises gRNA oligonucleotides selected from site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1), site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2), site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3), and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4), their respective complementary sequences in at least one container, and another container for nuclease-mediated insertion (e.g., a CRISPR-Cas reagent).

[0246] Those skilled in the art will readily recognize and readily incorporate into one of the well-established kit formats known in the art any bicistronic polynucleotide encoding the CAR of the Disclosure, a vector containing the bicistronic polynucleotide encoding (e.g., encoding the CAR), a cell genetically modified to express the CAR encoded by the bicistronic polynucleotide of the Disclosure, a composition (a pharmaceutical composition including the bicistronic polynucleotide, vector, or cell disclosed herein), or an oligonucleotide for nuclease-mediated insertion, or a combination thereof.

[0247] array Sequence information: [Table 1] TIFF2026511056000002.tif107162 [Table 2] TIFF2026511056000004.tif160169 [Table 3] TIFF2026511056000006.tif29169*CDR numbering is IMGT [Table 4] CDR locations identified using Abysis key annotation version 3.4.1 are available at abysis.org. [Examples]

[0248] Example 1 CRISPR-mediated disruption of B2M reduced the cell surface expression of B2M and HLA-A / B / C.

[0249] Immune rejection of heterologous CAR-T cells is primarily due to HLA-I, which presents donor cells as "non-self" to the host immune system. HLA class I molecules (including HLA-A / B / C) on activated T cells are expressed as heterodimers containing the beta-2-microglobulin (B2M) subunit. Removal of B2M, which is necessary for HLA expression on the cell surface, via nucleases such as CRISPR / Cas, eliminates the ability of cells to be recognized as non-self due to HLA mismatch.

[0250] Four CRISPR reagents, which are guide RNAs or gRNAs, were designed to specifically target the Cas9 nuclease activity at the four insertion sites of the B2M gene: site 1 (ACTCTCTCTTTCTGGCCTGG; SEQ ID NO: 1), site 2 (AGTCACATGGTTCACACGGC; SEQ ID NO: 2), site 3 (CACAGCCCAAGATAGTTAAG; SEQ ID NO: 3), and site 4 (GAGACATGTAAGCAGCATCA; SEQ ID NO: 4).

[0251] All four insertion sites are located within the exon of the B2M locus of CD4+ T cells. Sites 1, 3, and 4 were on the sense strand, while site 2 was on the antisense strand (Figure 1). Flow cytometry analysis showed that disruption of the B2M locus using the CRISPR reagent decreased the expression levels of B2M and HLA-A / B / C from the cell surface (Figure 2A-E). All disruptions decreased B2M expression on the cell surface, but the observed effects were site-dependent. In order of progressive B2M disruption, the four sites disclosed herein can be ranked as follows. Site 3 > Site 1 - Site 2 > Site 4

[0252] Example 2 Genetically engineered T-CAR cells.

[0253] The gene cassette was introduced into CRISPR cleavage / insertion sites 1, 2, 3, or 4 of the B2M gene described above. The DNA inactivated the endogenous B2M gene and allowed for the introduction of the bicistronic gene cassette of the present disclosure under the control of the native B2M promoter. The bicistronic construct included a sequence encoding a non-functional portion of the B2M gene fused in-frame with a polynucleotide encoding a human leukocyte antigen E (HLA-E) molecule. The bicistronic construct also included a polynucleotide sequence encoding a specific CAR molecule containing a scFv derived from the anti-GD2 antibody dinutuximab (UNITUXIN®).

[0254] The absence of functional B2M expression in engineered T cells can sometimes trigger an immune response. Therefore, the bicistronic construct of this disclosure contained a polynucleotide sequence encoding HLA-E. HLA-E is nearly non-polymorphic and common to all humans. Expression of a partially inactive B2M-encoding construct fused in-frame with the HLA-E molecule allowed the immune system to perceive that the genetically engineered cells, while lacking B2M expression, were human and not dangerous. CAR-T cells expressing the HLA-E molecule did not appear exogenous despite the absence of functional B2M expression and therefore did not trigger an immune response to the therapeutic cells. These cells would therefore be suitable for allotherapy.

[0255] Example 3 Design of Chimeric Antigen Receptors (CARs) and B2M-HLA-E (ISMM) Elements

[0256] The bicistronic polynucleotide constructs of this disclosure used in these experiments included chimeric antigen receptors (CARs) and immune surveillance masking molecules (ISMMs). The CAR genetic elements contained polynucleotides encoding the following operablely linked elements from the N-terminus to the C-terminus.

[0257] (1) Anti-GD2 scFv derived from dinutuximab, (2) CD8 alpha hinge (also called CD8a hinge here), (3) CD28 transmembrane domain (TM or CD28TM) and CD28 intracellular domain (CD28IC) (collectively referred to as CD28TM / IC), (4) 4-1BB activation domain (4-1BBAD), and (5) CD3 zeta activation domain (CD3 zeta AD).

[0258] The structure of the CAR element of the bicistronic structure, anti-GD2scFv+CD8aH+CD28TM / IC+4-1BBAD+CD3 zetaAD (Sequence ID 5), is shown in Figure 3A.

[0259] >CAR(Sequence ID 5)

[0260] The ISMM genetic element of the bicistronic construct of this disclosure comprises a polynucleotide encoding a B2M inactive fragment fused in frame with a polypeptide encoding a mature human leukocyte antigen-E molecule (HLE-E), and a 4X glycine linker (Gly4Ser)4 interposed between the B2M and HLA-E portions of the molecule. The structure of the ISMM element of the bicistronic construct, B2M + Gly-linker + HLA-E (SEQ ID NO: 6), is shown in Figure 3B.

[0261] >ISMM B2M-HLA-E (Sequence ID 6)

[0262] Example 4 CAR-ISMM Bi-Cistronic Structure and All Donor Structure Design.

[0263] Bicistronic constructs were designed for insertion at the four B2M insertion sites described above. Two different strategies were used to construct the bicistronic constructs. In the first strategy, a P2A cassette was introduced within the frame between the CAR and ISMM components. The P2A element allowed for the separation of the CAR and ISMM proteins during translation from a single mRNA. In the second strategy, an internal ribosome entry site (IRES) was introduced within the frame between the CAR and ISMM components. The IRES element allowed for the independent translation of the two fusion proteins from a single mRNA. Therefore, in the first strategy, a single ribosome translated the entire bicistronic construct. In the second strategy, the first ribosome translated the CAR component, and the second ribosome translated the ISMM component. In both cases, a polyadenylation site (SV40 early polyadenylation signal) was introduced downstream from the 3' end of the bicistronic construct to ensure transcription termination.

[0264] To avoid recognition and cleavage of the donor DNA sequence encoding the B2M gene by CRISPR reagents, silent mutations (dashed boxes in the schematic representation of the bicistronic construct) were introduced into the donor B2M sequence. Silent mutations were introduced into the B2M coding regions of constructs inserted at sites 1, 2, and 3. No CRISPR-protected silent mutations were introduced into the B2M coding region of the construct inserted at site 4.

[0265] To achieve site-specific integration of bicistronic donor sequences in CRISPR reagent-induced DNA cleavage, homology arms were constructed using a 1000 bp B2M gene adjacent to the CRISPR site (500 bp on each side of the CRISPR site) to generate a whole donor construct that drives site-specific recombination (homologous repair, or HDR) within the frame. The whole donor constructs corresponding to the bicistronic constructs in Figures 4A to 6B are shown individually in Figures 7A to 9B.

[0266] Table 1 summarizes the bicistronic structures and all donor structures tested in the following examples.

[0267] Table 1: Biscistronic structures and donor structures. "2A" indicates the presence of P2A between the CAR and ISMM components of the bicistronic structure. "IRES" indicates the presence of IRES between the CAR and ISMM components of the bicistronic structure. BC diagrams and BC diagrams show diagrams presenting specific schematics for each of the structures.

[0268] [Table 5]

[0269] >BC1 (Sequence ID 7)

[0270] >B2(Array number 8)

[0271] >BC3 / 5 (Sequence ID 9)

[0272] >BC4 / 6 (Sequence ID 10)

[0273] >BC7 (Sequence ID 11)

[0274] >BC8 (Sequence ID 12)

[0275] >FD1 (Sequence ID 13)

[0276] >FD2 (Sequence ID 14)

[0277] >FD3 / 5 (Sequence ID 15)

[0278] >FD4 / 6 (Sequence ID 16)

[0279] >FD7 (Sequence ID 17)

[0280] >FD8 (Sequence ID 18)

[0281] Example 5 HLA-E expression on cells lacking HLA-A / B / C

[0282] To determine HLA-E expression induced by bicistronic constructs containing CAR and ISMM components linked by IRES, primary isolated CD4+ T cells were electroporated one day prior to electroporation using a P3 solution containing a whole donor construct targeting sites 1, 3, or 4 on B2M, and purified Cas 9 protein preloaded with Amaxa 4D nucleofector and CRISPR guide RNA targeting sites 1, 3, or 4. Each cell was loaded with HLA-E. (1 × 10⁶ cells) 6 Transduction was performed using individual AAV6 genomes. Expression was determined using flow cytometry to analyze the loss of HLA-A / B / C expression while preserving HLA-E expression. The constructs tested were from all donor 2 (Figure 7B), all donor 6 (Figure 8B), and all donor 8 (Figure 9B). The highest levels of HLA-E expression were observed in bicistronic constructs targeting site 1 and site 3. See Figures 10A–10D.

[0283] Similarly, we studied HLA-E expression induced by bicistronic constructs containing ISMM components linked by CAR and 2A elements. T cells were electroporated one day prior to electroporation using a P3 solution containing a whole donor construct targeting site 1 or 3 on B2M, and purified Cas 9 protein preloaded with an Amaxa 4D nucleofector and CRISPR guide RNA targeting site 1 or 3 of SEQ ID NO: 1 × 10⁶ cells per cell, carrying HLA-E. 6Transduction was performed using individual AAV6 genomes. Expression was determined using flow cytometry to analyze the loss of HLA-A / B / C expression while preserving HLA-E expression. The constructs tested were all-donor 1 (Figure 7A), all-donor 5 (Figure 8A), and all-donor 6 (Figure 8B). Bi-cistronic constructs with CAR and ISMM components linked by a 2A element (P2A) consistently showed the highest levels of HLA-E expression compared to results obtained when the two components were linked via an IRES element. See Figures 11A–11D.

[0284] Example 6 Antitumor efficacy of anti-GD2 CAR-engineered cells.

[0285] To address the killing efficacy of engineered CAR-T cells expressing a bicistronic construct containing an anti-GD2 CAR with scFv derived from UNITUXIN® and an ISMM containing cleaved B2M and HLA-E, engineered T cells were co-cultured with GD2+ CHP134 neuroblastoma cells expressing the mKate2 fluorescent cell tracker in different ratios (1:1, 2:1, 4:1, 10:1). The population of mKate2+ cells was determined over a 24-hour time course using images acquired hourly in a Sartorius Incucyte S3 live cell imaging system. Cell counts were normalized to the number of mKate2+ cells at baseline.

[0286] The following different bicistronic structures were used: "Site 1 2A CAR-HLAE" (corresponding to bicistronic structure 1 in Figure 4A and all donor 1 in Figure 7A), "Site 3 2A CAR-HLAE" (corresponding to bicistronic structure 5 in Figure 5A and all donor 5 in Figure 8A), and "Site 3 IRES CAR-HLAE" (corresponding to bicistronic structure 6 in Figure 5B and all donor 6 in Figure 8B).

[0287] Co-culture of neuroblastoma cells with engineered CAR-T cells expressing the site 3 IRES CAR-HLAE bicistronic construct showed negligible effects, except for the highest CAR-T cell to neuroblastoma cell ratio (10:1). See Figure 14. Significantly better results were obtained when the bicistronic construct included a P2A element between the CAR and ISMM elements. See Figures 12 and 13.

[0288] A reduction in neuroblastoma cells compared to control conditions was observed at ratios of 2:1, 4:1, and 10:1 when using the site 1 2A CAR-HLAE bicistronic construct. However, despite the reduction in cell proliferation compared to control conditions, the reduction in total cell number relative to the initial cell number was achieved only at the highest ratio (10:1). See Figure 12.

[0289] When the site 3 2A CAR-HLAE bicistronic construct was used, a reduction in neuroblastoma cell count compared to the control condition was observed at ratios of 2:1, 4:1, and 10:1. A reduction in the total number of cells relative to the initial cell count was observed at ratios of 4:1 and 10:1. At the 4:1 ratio, the observed effect was similar to that observed at the 10:1 ratio for the site 1 2A CAR-HLAE bicistronic construct. At the 10:1 ratio, the reduction in cell proliferation observed with site 3 2A CAR-HLAE was higher than that with site 1 2A CAR-HLAE at the same ratio. See Figure 13.

[0290] In summary, the most significant effects were observed in structures that included a P2A element between the CAR and ISMM components of the bicistronic structure instead of an IRES element, and bicistronic structures with a P2A element targeting insertion site 3 of the B2M were more effective than those targeting site 1.

[0291] It should be understood that the section on embodiments for carrying out the invention is intended to be used for interpreting the claims, rather than the section on the summary and abstract of the invention. The section on the summary and abstract of the invention may describe one or more exemplary embodiments of the invention as contemplated by the inventor, but not all, and is therefore not intended to limit the invention and the appended claims in any way.

[0292] The present invention has been described above with the help of functional configuration blocks illustrating the implementation of the specified functions and their relationships. The boundaries of these functional configuration blocks are arbitrarily defined herein for the sake of convenience of description. Alternative boundaries can be defined, provided that the specified functions and their relationships are adequately implemented.

[0293] The foregoing descriptions of specific embodiments so fully reveal the general nature of the invention that others can readily modify and / or adapt such specific embodiments for various uses without departing from the general concept of the invention, without requiring any experimentation beyond what is necessary, by applying knowledge within the scope of the art of the art. Therefore, such adaptations and modifications are intended to be within the meaning and scope of equivalents of the disclosed embodiments, based on the teachings and guidance presented herein. It is understood that the language or terminology used herein is for descriptive purposes and not for restrictive purposes, and thereby the language or terminology used herein should be interpreted by those skilled in the art in light of the teachings and guidance.

[0294] The breadth and scope of the present invention should not be limited by any of the exemplary embodiments described above, but rather should be defined solely by the following claims and their equivalents.

[0295] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. Similar or equivalent methods and materials may be used in the practice or testing of the present invention, but preferred methods and materials are described herein.

[0296] All publications, patent applications, patents, and other reference materials described herein are incorporated in their entirety by reference. Database entries and electronic publications disclosed in this disclosure are incorporated in their entirety by reference. The versions of database entries or electronic publications incorporated by reference in this application are the most recent versions of the database entries or electronic publications that were publicly available at the time this application was filed. Database entries corresponding to gene or protein identifiers disclosed in this application (e.g., genes or proteins identified by accession numbers or database identifiers in public databases such as Genbank, Refseq, or Uniprot) are incorporated in their entirety by reference. The incorporated gene or protein-related information is not limited to the sequence data contained within the database entry. The incorporated information includes the entire contents of the database entry in the most recent version of the database that was publicly available at the time this application was filed. In case of any inconsistency, this specification, including definitions, shall prevail. In addition, materials, methods, and examples are illustrative and not intended to limit the scope of this application.

Claims

1. (i) a therapeutic agent and (ii) a bicistronic polynucleotide encoding an immune surveillance masking molecule (ISMM), wherein the ISMM comprises a non-functional beta-2-microglobulin (B2M) polypeptide and a human leukocyte antigen (HLA).

2. The bicistronic polynucleotide according to claim 1, wherein the therapeutic agent is a chimeric antigen receptor (CAR) comprising an antigen-binding domain that specifically binds to an epitope on a tumor antigen on a target cell.

3. The bicistronic polynucleotide according to claim 2, wherein the antigen-binding domain includes an antibody or its antigen-binding portion.

4. The bicistronic polynucleotide according to claim 2, wherein the tumor antigen is disialoganglioside GD2.

5. The bicistronic polynucleotide according to claim 3, wherein the antibody is dinutuximab or its antigen-binding moiety.

6. The bicistronic polynucleotide according to claim 5, wherein the antibody is a single-stranded variable fragment (scFv) comprising a variable region of the heavy chain (VH) and a variable region of the light chain (VL) of dinutuximab.

7. The bicistronic polynucleotide according to claim 6, wherein the dinutuximab scFv comprises the protein sequence described in Sequence ID No.

22.

8. The bicistronic polynucleotide according to claim 2, wherein the antigen-binding domain cross-competes with dinutuximab.

9. The bicistronic polynucleotide according to claim 2, wherein the antigen-binding domain binds to the same epitope as dinutuximab.

10. The bicistronic polynucleotide according to claim 2, wherein the antigen-binding domain comprises the VH CDR3 of dinutuximab.

11. The bicistronic polynucleotide according to claim 10, wherein the antigen-binding domain further comprises VH CDR1 and VH CDR2.

12. The bicistronic polynucleotide according to claim 11, wherein the VH CDR1 comprises the VH CDR1 of dinutuximab, and / or the VH CDR2 comprises the VH CDR2 of dinutuximab.

13. The bicistronic polynucleotide according to claims 10 to 12, wherein the antigen-binding domain further comprises VL CDR1, VL CDR2, and / or VL CDR3.

14. The bicistronic polynucleotide according to claim 13, wherein VLCDR1 comprises the VLCDR1 of dinutuximab, VLCDR2 comprises the VLCDR2 of dinutuximab, and / or VLCDR3 comprises the VLCDR3 of dinutuximab.

15. The antigen-binding domain, (i) VH CDR1 of SEQ ID NO: 59, VH CDR2 of SEQ ID NO: 63, and VH CDR3 of SEQ ID NO: 67, and / or VL CDR1 of SEQ ID NO: 71, VL CDR2 of SEQ ID NO: 75, and VL CDR3 of SEQ ID NO: 79, or (ii) VH CDR1 of SEQ ID NO: 60, VH CDR2 of SEQ ID NO: 64, and VH CDR3 of SEQ ID NO: 68, and / or VL CDR1 of SEQ ID NO: 72, VL CDR2 of SEQ ID NO: 76, and VL CDR3 of SEQ ID NO: 80, or (iii) VH CDR1 of SEQ ID NO: 61, VH CDR2 of SEQ ID NO: 65, and VH CDR3 of SEQ ID NO: 69, and / or VL CDR1 of SEQ ID NO: 73, VL CDR2 of SEQ ID NO: 77, and VL CDR3 of SEQ ID NO: 81, or (iv) VH CDR1 of SEQ ID NO: 62, VH CDR2 of SEQ ID NO: 66, and VH CDR3 of SEQ ID NO: 70, and / or VL CDR1 of SEQ ID NO: 74, VL CDR2 of SEQ ID NO: 78, and VL CDR3 of SEQ ID NO: 82, or (v) VH CDR1 of SEQ ID NO: 53, VH CDR2 of SEQ ID NO: 54, and VH CDR3 of SEQ ID NO: 55, and / or VL CDR1 of SEQ ID NO: 56, VL CDR2 of SEQ ID NO: 57, and VL CDR3 of SEQ ID NO: 58, according to claim 2.

16. The bicistronic polynucleotide according to claim 2, wherein the antigen-binding domain comprises VH and VL, and VH comprises the protein sequence described in SEQ ID NO: 44, or VL comprises the protein sequence described in SEQ ID NO:

46.

17. The bicistronic polynucleotide according to claim 2, wherein the antigen-binding domain comprises VH containing the protein sequence described in SEQ ID NO: 44 and VL containing the protein sequence described in SEQ ID NO:

46.

18. The bicistronic polynucleotide according to claim 17, wherein the VH and VL are linked via a linker.

19. The bicistronic polynucleotide according to claim 18, wherein VH and VL are linked in a VH-linker-VL or VL-linker-VH stereoconfiguration.

20. The linker is Gly 4 - A bicistronic polynucleotide according to claim 18, wherein the linker is a Ser linker.

21. The aforementioned Gly 4 - The bicistronic polynucleotide according to claim 18, wherein the Ser linker comprises the sequence described in SEQ ID NO:

84.

22. The bicistronic polynucleotide according to any one of claims 2 to 21, wherein the CAR construct is designed as a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR.

23. The bicistronic polynucleotide according to any one of claims 2 to 20, wherein the antigen-binding domain is 1g NAR, Fab, Fab', F(ab)'2, F(ab)'3, Fv, single-strand variable fragment (scFv), bis-scFv, (scFv)2, minibody, diabody, triabody, tetrabody, intrabody, disulfide-stabilized Fv protein (dsFv), unibody, nanobody, aphibody, DARPin, monobody, adonectin, alphabody, or a designed binder.

24. The bicistronic polynucleotide according to any one of claims 2 to 21, wherein the CAR construct further comprises a transmembrane domain, an intracellular domain, and a spacer located between the antigen-binding domain and the transmembrane domain.

25. The bicistronic polynucleotide according to claim 24, wherein the intracellular domain of the CAR construct is a signal transduction domain derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD66d, or CD28.

26. The bicistronic polynucleotide according to claim 25, wherein the intracellular domain of the CAR construct is derived from CD28.

27. The bicistronic polynucleotide according to claim 24, wherein the transmembrane domain of the CAR construct is derived from CD28.

28. The bicistronic polynucleotide according to claim 27, wherein the transmembrane domain is linked to the intracellular domain by a linker.

29. The bicistronic polynucleotide according to claim 24, wherein the intracellular domain and transmembrane domain of the CAR construct are derived from the same molecule.

30. The bicistronic polynucleotide according to claim 29, wherein the transmembrane domain and intracellular domain are derived from CD28.

31. The bicistronic polynucleotide according to claim 24, wherein the spacer of the CAR structure is a CD8 alpha hinge.

32. The bicistronic polynucleotide according to any one of claims 2 to 31, wherein the CAR construct further comprises a co-stimulatory domain or a combination thereof.

33. The bicistronic polynucleotide according to claim 32, wherein the co-stimulatory domain is derived from 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, CD3 zeta, and combinations thereof.

34. The bicistronic polynucleotide according to claim 32, wherein the co-stimulatory domain includes a 4-1BB activation domain.

35. The bicistronic polynucleotide according to claim 32, wherein the co-stimulatory domain includes a CD3 zeta-activating domain.

36. The bicistronic polynucleotide according to claim 32, wherein the co-stimulatory domain comprises a 4-1BB activating domain and a CD3 zeta activating domain.

37. The bicistronic polynucleotide according to any one of claims 2 to 36, wherein the CAR construct comprises the nucleic acid sequence described in Sequence ID No.

19.

38. The bicistronic polynucleotide according to any one of claims 2 to 36, wherein the CAR construct encodes the protein described in Sequence ID No.

20.

39. The biscistronic polynucleotide according to claim 1, wherein the therapeutic agent comprises an antibody or its antigen-binding portion, an enzyme, a receptor, a cytokine, a coagulation factor, or a hormone.

40. The bicistronic polynucleotide according to claim 1, wherein the beta-2-microglobulin (B2M) nonfunctional polypeptide is a B2M nonfunctional fragment.

41. The bicistronic polynucleotide according to claim 40, wherein the beta-2-microglobulin (B2M) nonfunctional polypeptide is a B2M nonfunctional variant.

42. The bicistronic polynucleotide according to claim 1, wherein the human leukocyte antigen (HLA) is HLA-E or HLA-G.

43. The bicistronic polynucleotide according to claim 1, wherein the beta-2-microglobulin (B2M) polypeptide and the human leukocyte antigen (HLA) are linked by a linker.

44. The bicistronic polynucleotide according to claim 43, wherein the linker is a Gly4-Ser linker.

45. The bicistronic polynucleotide according to claim 44, wherein the Gly4-Ser linker comprises the sequence described in Sequence ID No.

84.

46. (i) The nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the immune surveillance masking molecule (ISMM) are linked by a 2A element, (ii) The bicistronic polynucleotide according to any one of claims 1 to 45, wherein the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the immune surveillance masking molecule (ISMM) are linked by an internal ribosome entry site (IRES).

47. The bicistronic polynucleotide according to any one of claims 1 to 46, wherein the nucleic acid sequence encoding the therapeutic agent includes the sequence described in Sequence ID No.

5.

48. The bicistronic polynucleotide according to any one of claims 1 to 47, wherein the nucleic acid sequence encoding the ISMM includes the sequence described in Sequence ID No.

6.

49. The bicistronic polynucleotide according to any one of claims 1 to 48, wherein the nucleic acid sequence encoding the therapeutic agent includes the sequence described in SEQ ID NO: 5, and the nucleic acid sequence encoding the ISMM includes the sequence described in SEQ ID NO:

6.

50. The bicistronic polynucleotide according to claim 49, wherein the bicistronic polynucleotide is selected from the group consisting of bicistronic construct 1, bicistronic construct 2, bicistronic construct 3, bicistronic construct 4, bicistronic construct 5, bicistronic construct 6, bicistronic construct 7, and bicistronic construct 8.

51. The bicistronic polynucleotide according to claim 50, further comprising a 5' sequence complementary to the B2M gene sequence upstream of the insertion site, and a 3' sequence complementary to the B2M gene sequence downstream of the insertion site.

52. The bicistronic polynucleotide according to claim 51, wherein the 5' sequence and the 3' sequence have the same length.

53. The bicistronic polynucleotide according to claim 52, wherein the 5' sequence and the 3' sequence have lengths of at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, and at least about 1000 nucleotides.

54. The bicistronic polynucleotide according to claim 53, wherein the bicistronic polynucleotide is selected from the group consisting of all donor 1, all donor 2, all donor 3, all donor 4, all donor 5, all donor 6, all donor 7, and all donor 8.

55. The bicistronic polynucleotide according to claim 54, wherein the bicistronic polynucleotide is inserted into the beta-2-microglobulin (B2M) gene, and the insertion into the B2M gene inactivates the gene.

56. The bicistronic polynucleotide according to claim 55, wherein the insertion into the beta-2-microglobulin (B2M) gene is mediated by a nuclease.

57. The bicistronic polynucleotide according to claim 55, wherein the nuclease is a CRISPR / Cas nuclease.

58. The bicistronic polynucleotide according to claim 57, wherein the CRISPR / Cas nuclease is CRISPR / Cas9.

59. The bicistronic polynucleotide according to claim 58, wherein the insertion site in the beta-2-microglobulin (B2M) gene is located at an intron position.

60. The bicistronic polynucleotide according to claim 58, wherein the insertion site within the beta-2-microglobulin (B2M) gene is located at an intron-exon junction.

61. The bicistronic polynucleotide according to claim 58, wherein the insertion site in the beta-2-microglobulin (B2M) gene is located at an exon position.

62. The bicistronic polynucleotide according to claim 61, wherein the exon position is located at exon 1.

63. The bicistronic polynucleotide according to claim 62, wherein the insertion site is site 1 (ACTCTTCTCTTTTTGGCCTGG; SEQ ID NO: 1).

64. The bicistronic polynucleotide according to claim 61, wherein the exon position is located at exon 2.

65. The bicistronic polynucleotide according to claim 64, wherein the insertion site is site 2 (AGTCACATGGTTCAACAGGC; SEQ ID NO: 2) or site 3 (CACAGCCCCAAGATAGTTAAG; SEQ ID NO: 3).

66. The bicistronic polynucleotide according to claim 61, wherein the exon position is located at exon 3.

67. The bicistronic polynucleotide according to claim 66, wherein the insertion site is site 4 (GAGACATGTTAAGCAGCATCA; SEQ ID NO: 4).

68. The bicistronic polynucleotide according to any one of claims 1 to 67, wherein the polynucleotide is a DNA molecule or an RNA molecule.

69. The bicistronic polynucleotide according to any one of claims 2 to 68, wherein the CAR is an inducible CAR.

70. A vector comprising a bicistronic polynucleotide according to any one of claims 1 to 69, operably coupled to a regulatory element.

71. The vector according to claim 70, which is a viral vector, a mammalian vector, or a bacterial vector.

72. The vector according to claim 70 or 71, which is a retroviral vector.

73. A vector according to any one of claims 70 to 72, selected from the group consisting of adenovirus vectors, lentiviruses, Sendai virus vectors, baculovirus vectors, Epstein-Barr virus vectors, papovavirus vectors, vaccinia virus vectors, herpes simplex virus vectors, hybrid vectors, and adeno-associated virus (AAV) vectors.

74. A composition comprising a bicistronic polynucleotide according to any one of claims 1 to 69 or a vector according to any one of claims 70 to 73.

75. A kit comprising a bicistronic polynucleotide according to any one of claims 1 to 69, a vector according to any one of claims 70 to 73, or a composition according to claim 74.

76. A therapeutic agent and cells genetically modified to express ISMM, comprising a bicistronic polynucleotide according to any one of claims 1 to 70, a vector according to any one of claims 70 to 73, or the composition according to claim 74.

77. The cell according to claim 76, wherein the cell is a T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, an ILC cell, a macrophage, or an antigen-presenting cell.

78. The cells according to claim 76 or 77, wherein the aforementioned cells are of the same species.

79. A composition comprising a bicistronic polynucleotide according to any one of claims 1 to 70, a vector according to any one of claims 70 to 73, a composition according to claim 74, or a cell according to any one of claims 76 to 78.

80. The composition according to claim 79 for treating a subject in need of therapy.

81. The composition according to claim 79, wherein the aforementioned therapy is CAR therapy.

82. A pharmaceutical composition comprising cells according to any one of claims 76 to 78, or the composition according to claim 79 or 81, for treating cancer in a subject that requires such treatment.

83. A kit comprising the cells according to any one of claims 76 to 78, the composition according to claims 79 to 81, or the pharmaceutical composition according to claim 82.

84. Use as a pharmaceutical agent of a bicistronic polynucleotide according to any one of claims 1 to 70, a vector according to any one of claims 70 to 73, a composition according to claim 74, a kit according to claim 75, cells according to any one of claims 76 to 78, a composition according to any one of claims 79 to 81, a pharmaceutical composition according to claim 82, or a kit according to claim 83.

85. Use of a bicistronic polynucleotide according to any one of claims 1 to 70, a vector according to any one of claims 70 to 73, a composition according to claim 74, a kit according to claim 75, cells according to any one of claims 76 to 78, a composition according to any one of claims 79 to 81, a pharmaceutical composition according to claim 82, or a kit according to claim 83 as an agent for treating cancer or inflammatory diseases or conditions in subjects requiring it.

86. Use of a bicistronic polynucleotide according to any one of claims 1 to 70, a vector according to any one of claims 70 to 73, a composition according to claim 74, a kit according to claim 75, cells according to any one of claims 76 to 78, a composition according to any one of claims 79 to 81, a pharmaceutical composition according to claim 82, or a kit according to claim 83 for the manufacture of a drug for treating cancer or inflammatory diseases or conditions in subjects that require it.

87. A method for stimulating a T cell-mediated immune response against a target cell population or tissue in a subject, comprising administering an effective amount of the cells described in any one of claims 76 to 78 to the subject.

88. A method for providing antitumor immunity to a subject in need thereof, comprising administering an effective amount of the cells described in any one of claims 76 to 78 to the subject.

89. A method for treating cancer in a subject in need, comprising administering to the subject an effective amount of cells according to any one of claims 76 to 78.

90. A method for preparing a cell population for therapy, comprising transducing a cell population isolated from a subject with a bicistronic polynucleotide according to any one of claims 1 to 70, a vector according to any one of claims 70 to 73, or a composition according to claim 74.

91. The method according to claim 90, wherein the transduction comprises culturing the cells under appropriate conditions.

92. The method according to claim 91, wherein the therapy is allogeneic cell therapy.

93. A method for generating a persistent population of genetically modified cells in a subject diagnosed with cancer or an inflammatory disease, comprising administering to the subject cells genetically modified to express a bicistronic polynucleotide according to any one of claims 1 to 69.

94. A method for expanding a population of genetically modified cells in a subject diagnosed with cancer or an inflammatory disease, comprising administering to the subject cells genetically modified to express a bicistronic polynucleotide according to any one of claims 1 to 69.

95. The method according to any one of claims 93 and 94, wherein the cell is a T cell.

96. The method according to claim 95, wherein the T cells are allogeneic T cells.

97. The method according to any one of claims 85 to 96, wherein the subject is a human subject.

98. A method for generating allogeneic cells for gene therapy, comprising inserting a bicistronic construct containing a nucleic acid encoding a therapeutic agent and a nucleic acid encoding an immune surveillance masking molecule (ISMM) into the beta-2-microglobulin (B2M) gene, wherein the insertion of the bicistronic construct inactivates the B2M gene.

99. The method according to claim 98, wherein the nucleic acid encoding the ISMM comprises a nucleic acid encoding a human leukocyte antigen (HLA) selected from HLA-E or HLA-G.

100. The method according to claim 98, wherein the gene therapy is CAR-T therapy.

101. The method according to claim 98, wherein the insertion site in the B2M gene is selected from site 1 (ACTCTCTCTTTCTGGGCCTGG; SEQ ID NO: 1); site 2 (AGTCACATGGTTCAACAGGC; SEQ ID NO: 2); site 3 (CACAGCCCCAAGATAGTTTAAG; SEQ ID NO: 3); or site 4 (GAGAACATGTTAAGCAGCATCA; SEQ ID NO: 4).

102. Allogeneic CAR-T cells comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or B7, wherein the nucleic acid sequence encoding HLA-E is replaced with a nucleic acid sequence encoding HLA-G.

103. Allogeneic CAR-T cells comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or B7, wherein the nucleic acid sequence encoding a fragment of B2M is replaced with a nucleic acid sequence encoding a fragment of TRAC, and the bicistronic construct is inserted into the TRAC gene.

104. Allogeneic CAR-T cells comprising a specific bicistronic construct selected from bicistronic constructs BC1, BC2, BC3, BC4, BC5, BC6, BC7, or B7, wherein the nucleic acid sequence encoding a fragment of B2M is replaced with a nucleic acid sequence encoding a fragment of CD52, and the bicistronic construct is inserted into the CD52 gene.

105. A kit comprising gRNA for CRISPR / Cas9-mediated insertion in B2M, wherein the gRNA is selected from site 1 gRNA (ACTCTCTCTTTCTGGGCCTGG, SEQ ID NO: 1), site 2 gRNA (AGTCACATGGTTCAACAGGC, SEQ ID NO: 2), site 3 gRNA (CACAGCCCCAAGATAGTTTAAG, SEQ ID NO: 3), and site 4 gRNA (GAGAACATGTTAAGCAGCATCA, SEQ ID NO: 4).