CRISPR-related methods and compositions targeting CD70 expression

Modified Cas12a proteins and guide RNAs form RNP complexes to precisely edit the CD70 gene, addressing inefficiencies in CRISPR systems and enhancing T cell potency for immunotherapy.

JP2026518356APending Publication Date: 2026-06-05EDITAS MEDICINE INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
EDITAS MEDICINE INC
Filing Date
2024-05-24
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Current methods for targeting and modulating CD70 gene expression are limited in efficiency and specificity, particularly in the context of CRISPR systems, which can affect the therapeutic potential of genetically engineered T cells.

Method used

The use of modified Cas12a proteins, such as AsCas12a, with enhanced activity and nuclear localization sequences, combined with guide RNAs, forms RNP complexes that induce precise editing of the CD70 gene, including knockout and insertion/deletion (indel) within target sequences, enhancing the potency of T cells for immunotherapy.

Benefits of technology

This approach enables the precise regulation of CD70 expression in T cells, leading to enhanced therapeutic efficacy by manipulating T cell function and overcoming limitations of existing CRISPR systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026518356000001_ABST
    Figure 2026518356000001_ABST
Patent Text Reader

Abstract

This disclosure relates to CRISPR-related systems and components for targeting, editing, and / or regulating CD70 (differentiation cluster 70) gene expression. This disclosure also relates to methods and applications relating to genetically modified cells, including T cells or T cell progenitor cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 504,671, filed May 26, 2023, the entire content of which is incorporated herein by reference.

[0002] This disclosure relates to CRISPR-related systems and components for targeting, editing, and / or modulating CD70 (Cluster of Differentiation 70) CD70 gene expression. The disclosure also relates to methods and their applications related to diseases, including, for example, genetically engineered cells including T cells or T cell precursors.

Background Art

[0003] CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) evolved in bacteria and archaea as an adaptive immune system to defend against viral attacks. Upon exposure to a virus, short segments of viral DNA are incorporated into the CRISPR locus. RNA is transcribed from a part of the CRISPR locus containing the viral sequence. The RNA contains a sequence complementary to the viral genome and mediates the targeting of the Cas protein to the target sequence within the viral genome. Subsequently, the Cas protein cleaves the viral target, thereby halting viral activity. Naturally occurring CRISPR systems are evolutionarily organized into two classes and five types. Cas12a (also known as Cpf1) is a class 2, type V CRISPR / Cas system that is adapted for genome editing in eukaryotic cells. By introducing a site-specific double-strand break (DSB) into the target sequence, genes can be knocked out, for example, by the formation of indels via endogenous DNA repair mechanisms such as non-homologous end joining (NHEJ). The introduction of a site-specific DSB into the target sequence can promote gene conversion or gene correction through the incorporation of exogenous or endogenous homologous sequences using a repair template such as homologous directed repair (HDR).

[0004] The human CD70 gene is located on chromosome 19. The CD70 transcript (ENST00000245903) consists of three exons that encode the CD70 (differentiation cluster 70) protein. CD70 is a cell membrane-bound antigen that interacts with its receptor, CD27. CD70 is a member of the TNF superfamily and plays a role in T cell activation and proliferation. The CD70 protein is transiently expressed on the surface of activated immune cells, including T cells and B cells, but is also overexpressed in various types of tumors. [Overview of the project]

[0005] The currently disclosed subject matter relates to RNA-induced nuclease-related methods, genome editing systems, and compositions, such as CRISPR / Cas-related methods, for targeting, editing, or regulating the expression of CD70 nucleic acid sequences, as well as their applications related to CD70. The currently disclosed subject matter also provides genome editing systems, compositions, vectors, and methods for editing targeted CD70 genes and human T cells using CRISPR / Cas-related components.

[0006] Provided herein are genome editing systems, RNA-inducing nucleases, Cas12a (also known as Cpf1) proteins, including modified Cas12a proteins (Cas12a mutants), guide RNAs, and ribonucleoprotein (RNP) complexes for regulating CD70 expression. In certain embodiments, the RNP complex may include a guide RNA (gRNA) complexed with wild-type Cas12a or a modified Cas12a RNA-inducing nuclease (modified Cas12a protein). In certain embodiments, the modified Cas12a protein may be an activity-enhancing AsCas12a protein having a nuclear localization sequence (NLS). In certain embodiments, the AsCas12a protein may include amino acid changes to enhance activity and / or inactivate RNAase activity. In certain embodiments, the AsCas12a protein may include a C-terminal linker and a nuclear localization sequence. In certain embodiments, the RNP complex may include a guide RNA (gRNA) molecule that targets the sequence of the CD70 gene. In certain embodiments, the RNP complex is transfused into target cells to induce editing, resulting in the formation of an indel within or near the target sequence of the CD70 gene. In certain embodiments, the editing results in the knockout of the CD70 gene.

[0007] In some embodiments, the target cells provided herein are genetically modified cells comprising one or more genome edits. In some embodiments, the target cells provided herein are immunocompetent cells such as T cells, CD8+ T cells (e.g., CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, α / β T cells, γ / δ T cells, natural killer T cells (NKT cells), regulatory T cells (Treg), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), or dendritic cells. In some embodiments, the target cells further comprise chimeric antigen receptors (CARs). In some embodiments, the target cells are T cells, and one or more edits enhance their potency in an immunotherapeutic approach. For example, in some embodiments, T cells are provided that comprise one or more edits resulting in loss of function of a gene or protein associated with inhibition of T cell function in a therapeutic context, and / or expression of an exogenous nucleic acid or protein associated with enhanced T cell function in a therapeutic context. In some embodiments, the target cells provided herein comprise one or more genome edits, such as indels or insertions of exogenous nucleic acid constructs resulting from, for example, cleaving genomic loci with RNA-induced nucleases. The use of RNA-induced nuclease technology in the context of generating modified T cells enables the manipulation of complex modifications with enhanced properties relevant to clinical applications.

[0008] The accompanying drawings are intended to provide illustrative and schematic examples, not comprehensive examples of any particular aspect or embodiment of the present disclosure. The drawings are not intended to limit or be bound by any particular theory or model, and are not necessarily to scale. Without limiting them, nucleic acids and polypeptides may be depicted as linear sequences or as schematic two- or three-dimensional structures; these depictions are intended to be illustrative, and are not intended to limit or be bound by any particular model or theory relating to their structures. [Brief explanation of the drawing]

[0009] [Figure 1] This diagram depicts the screening results of CD70-targeted RNPs containing different guide RNAs in CD4+ and CD8+ T cells. Edit rate (Y-axis) was measured by next-generation sequencing. The maximum dose of RNP was 8,000 nM, titrated at 1:3.16 as shown on the X-axis. Replication data points were obtained from two separate nucleic acid transductions. [Figure 2] This shows RNP4 concentration response data across three different donors in both CD4+ and CD8+ cell populations. The maximum dose of RNP was 8,000 nM, titrated at 1:3.16 as shown on the X axis. The edit rate on the Y axis in the upper panel is the percentage of NGS reads containing the expected cleavage site ±15 bases indel. The CD70 percentage on the Y axis in the lower panel is the percentage of CD4 or CD8 cell populations positive for cell surface CD70. Replication data points were obtained from two separate nucleic acid transductions. [Modes for carrying out the invention]

[0010] Definitions and Abbreviations Unless otherwise specified, the following terms have the meanings associated with them in this section.

[0011] The indefinite articles "a" and "an" refer to at least one of the nouns they relate to and are used synonymously with the terms "at least one" and "one or more." For example, "module" means at least one module, or one or more modules.

[0012] The terms “about” or “approximately” mean within a range of tolerance for a particular value as determined by those skilled in the art, which depends to some extent on the limitations of the method by which the value is measured or determined, i.e., the measuring system. For example, “about” may mean within or greater than three standard deviations, according to practice in the art. Alternatively, “about” may mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and still more preferably up to 1% of a given value. Or, particularly with respect to biological systems or processes, the term may mean within one order of magnitude of the value, preferably up to five times, and more preferably up to two times.

[0013] The conjunctions "or" and "and / or" are interchangeable as non-exclusive separable conjunctions.

[0014] The phrase "essentially consisting of" means that the listed species are dominant, but other species may be present in trace amounts or in amounts that do not affect the structure, function, or behavior of the composition in question. For example, a composition that is essentially consisting of a particular species generally contains 90%, 95%, 96% or more of that species.

[0015] The term "domain" is used to describe a segment of a protein or nucleic acid. Unless otherwise indicated, a domain does not need to possess any specific functional properties.

[0016] An "indel" is an insertion and / or deletion in a nucleic acid sequence. Indels may be products of DNA double-strand break repair, such as double-strand breaks formed by the genome editing systems of this disclosure. Indels are most commonly formed when breaks are repaired by "erroneous" repair pathways, such as the NHEJ pathway, described below.

[0017] "Genetic transformation" refers to the modification of a DNA sequence by incorporating endogenous homologous sequences (e.g., homologous sequences within a gene array). "Genetic modification" refers to the modification of a DNA sequence by incorporating exogenous homologous sequences, such as exogenous single-stranded or double-stranded donor template DNA. Genetic transformation and genetic modification are products of DNA double-strand break repair via the HDR pathway, as described below.

[0018] The results of indels, gene transformations, gene modifications, and other genome editing are typically evaluated by sequencing (Sanger sequencing may also be used, but most commonly "next-generation" or "synthetic sequencing") and quantified by the relative frequency of numerical changes (e.g., ±1, ±2 or more bases) at the target site between all sequence reads. DNA samples for sequencing can be prepared by a variety of methods known in the art, and may involve amplification of the target site by polymerase chain reaction (PCR), capture of DNA ends generated by double-strand breaks, such as the GUIDEseq process described in Tsai et al. (Nat. Biotechnol. 34(5):483 (2016), incorporated herein by reference), or other means known in the art. The results of genome editing can also be evaluated by in-situ hybridization methods, such as the FiberComb® system commercially available from Genomic Vision (Bagneux, France), and by other suitable methods known in the art.

[0019] "Alt-HDR," "alternative homology-directed repair," or "alternative HDR" are used interchangeably and refer to a process that repairs DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences such as sister chromatids, or exogenous nucleic acids such as template nucleic acids). Alt-HDR differs from standard HDR in that its process utilizes a different pathway and can be inhibited by standard HDR mediators, RAD51 and BRCA2. Alt-HDR is also distinguished by the involvement of single-stranded or nicked homologous nucleic acid templates, whereas standard HDR generally involves double-stranded homologous templates.

[0020] "Standard HDR", "standard homology-directed repair", or "cHDR" refers to the process of using homologous nucleic acids (e.g., endogenous homologous sequences such as sister chromatids, or exogenous nucleic acids such as template nucleic acids) to repair DNA damage. Standard HDR typically acts when significant resection occurs at a double-strand break and at least a single-stranded portion of DNA is formed. In normal cells, cHDR typically involves a series of steps such as recognition of the break, stabilization of the break, resection, stabilization of single-stranded DNA, formation of DNA crossover intermediates, resolution of crossover intermediates, and ligation. This process requires RAD51 and BRCA2, and the homologous nucleic acids are typically double-stranded.

[0021] Unless otherwise indicated, the term "HDR" as used herein encompasses both canonical HDR and alt-HDR.

[0022] "Non-homologous end joining" or "NHEJ" refers to ligation-mediated repair and / or non-template-mediated repair, including canonical NHEJ (cNHEJ) and alternative NHEJ (altNHEJ), and includes microhomology-mediated end joining (MMEJ), single-strand annealing (SSA), and synthesis-dependent microhomology-mediated end joining (SD-MMEJ).

[0023] "Substitution" or "substituted", when used in connection with the modification of a molecule (e.g., a nucleic acid or protein), does not require process limitations and merely indicates the presence of a substitution entity.

[0024] "Knock-out" or "knockout" refers to an inactivating mutation of a target gene, and the product of the target gene comprises a loss of function.

[0025] "Gene product" refers to the biochemical product resulting from the expression of a gene, including RNA or protein encoded by the gene.

[0026] "Target site" refers to the exact genomic sequence or locus within a target gene that is designed to be targeted by a guide RNA. "Off-target site" refers to a genomic sequence or locus that does not exist within the target gene but has been found to be edited by an RNA-guided nuclease.

[0027] "Subject" means a human or non-human animal. A human subject can be of any age (e.g., infant, child, young adult, or adult), can be suffering from a disease, and may require genetic modification. Alternatively, the subject can be an animal including, but not limited to, mammals, birds, fish, reptiles, amphibians, particularly non-human primates, rodents (such as mice, rats, hamsters, etc.), rabbits, guinea pigs, dogs, cats, etc. In certain embodiments of the present disclosure, the subject is a livestock animal such as, for example, cows, horses, sheep, or goats. In certain embodiments, the subject is a poultry.

[0028] "α / β T cell" refers to a T lymphocyte that expresses an αβ T cell receptor (TCR), in contrast to a "γ / δ T cell" that expresses a γδ type TCR.

[0029] As used herein, "therapeutically effective amount" refers to an amount of cells and / or composition that is sufficient to have a beneficial effect on the treatment of a disease when administered to a subject for treating the disease.

[0030] "Treat", "treating", and "treatment" mean the treatment of a disease in a subject (e.g., a human subject) including, but not limited to, suppressing the disease, i.e., preventing or precluding its onset or progression; alleviating the disease, i.e., causing regression of the disease state; alleviating one or more symptoms of the disease; and curing the disease.

[0031] "Prevent," "preventing," and "prevention" refer to the prevention of disease in mammals such as humans, including, for example, (a) avoidance or prevention of disease, (b) influence on predisposition to disease, or (c) prevention or delay of the onset of at least one symptom of disease.

[0032] A “kit” refers to an assembly of two or more components that constitute a functional unit that can be used for a particular purpose. Exemplary (but not limited to), one kit according to this disclosure may include a guide RNA complexed with or capable of complexing with an RNA-inducing nuclease, accompanied by a pharmaceutically acceptable carrier (e.g., suspended or capable of being suspended in a pharmaceutically acceptable carrier). The kit may be used, for example, to introduce the complex into cells or subjects and to induce a desired genomic modification in such cells or subjects. The components of the kit may be packaged together or individually. The kits according to this disclosure may also optionally include instructions for use (DFU) describing, for example, the use of the kit by the method of this disclosure. The DFU may be physically included with the kit or made available to the user of the kit by electronic means, for example.

[0033] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “oligonucleotide” refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA, and mean any chain of two or more nucleotides. Polynucleotides, nucleotide sequences, nucleic acids, etc., refer to compositions that may be single-stranded or double-stranded chimeric mixtures or derivatives or modified forms thereof. These can also be modified, for example, in the base moieties, sugar moieties, or phosphate backbone to improve molecular stability, their hybridization parameters, etc. Nucleic acid sequences typically carry genetic information, including, but not limited to, information used by cellular mechanisms to produce proteins and enzymes. These terms include double-stranded or single-stranded genomic DNA, RNA, any synthetic and genetically engineered polynucleotides, and both sense and antisense polynucleotides. These terms also include nucleic acids containing modified bases.

[0034] As shown in Table 1 below, the conventional IUPAC notation is used in the nucleotide sequences presented herein (see also Cornish-Bowden A, Nucleic Acids Res. 1985 May 10;13(9):3021-30, which is incorporated herein by reference). However, it should be noted that if the sequence is encoded by either DNA or RNA, for example in gRNA, for example in a gRNA targeting domain, “T” indicates “thymine or uracil”.

[0035] [Table 1]

[0036] The terms “protein,” “peptide,” and “polypeptide” are used synonymously and refer to a continuous chain of amino acids linked together via peptide bonds. This term includes individual proteins, groups or complexes of proteins linked together, and fragments or parts, variants, derivatives, and analogues of such proteins. Peptide sequences are presented herein using conventional notation, starting from the amino or N-terminus on the left and progressing to the carboxyl or C-terminus on the right. Standard one- or three-letter abbreviations may be used.

[0037] A "mutant" refers to an entity, such as a polypeptide, polynucleotide, or small molecule, that exhibits significant structural identity with a reference entity but structurally differs from the reference entity in the presence or level of one or more chemical moieties. In many embodiments, a mutant is also functionally different from its reference entity. Generally, whether a particular entity is appropriately considered a "mutant" of a reference depends on the degree of its structural identity with that reference entity.

[0038] In the context of this specification, the term “promoter” refers to a region of the genome (i.e., a DNA sequence) that initiates the transcription of a gene.

[0039] In the context of nucleic acids (e.g., genes, genomic regions that encode proteins, promoters), the term “endogenous” as used herein refers to native nucleic acids or proteins that are in their natural location, such as within the genome of a cell. In contrast, in the context of nucleic acids such as expression constructs, cDNAs, indels, and nucleic acid vectors, the term “exogenous” as used herein refers to nucleic acids that have been artificially introduced into the genome of a cell using gene editing or genetic engineering techniques, such as CRISPR-based editing techniques.

[0040] The terms “RNA-induced nuclease” and “RNA-induced nuclease molecule” are used synonymously herein. In some embodiments, the RNA-induced nuclease is an RNA-induced DNA endonuclease enzyme. In some embodiments, the RNA-induced nuclease is a CRISPR nuclease. Non-limiting examples of RNA-induced nucleases are listed in Table 2 below, and the methods and compositions disclosed herein may use any combination of RNA-induced nucleases disclosed herein or known to those skilled in the art. Those skilled in the art will be aware of additional nucleases and nuclease variants suitable for use in the context of this disclosure, and it will be understood that this disclosure is not limited in this respect.

[0041] [Table 2]

[0042] [Table 3]

[0043] For example, additional suitable RNA-inducing nucleases, such as Cas9 and Cas12 nucleases, will be apparent to those skilled in the art in view of this disclosure, and this disclosure is not limited to the exemplary suitable nucleases provided herein. In some embodiments, the suitable nuclease is Cas9 or Cas12a(Cpf1) nuclease. In some embodiments, this disclosure also encompasses nuclease mutants, such as Cas9 or Cas12a nuclease mutants. A nuclease mutant refers to a nuclease comprising an amino acid sequence characterized by the substitution, deletion, or addition of one or more amino acids compared to the wild-type amino acid sequence of the nuclease. Suitable nucleases and nuclease mutants may also include a purified tag (e.g., a polyhistidine tag) and a signaling peptide comprising, for example, a nuclear localization signal sequence. Some non-exclusive examples of appropriate nucleases and nuclease variants are described in more detail elsewhere in this Specification, including those described in PCT application PCT / US2019 / 22374, filed on 14 March 2019, entitled “Systems and Methods for the Treatment of Hemoglobinopathies,” which is incorporated herein by reference in its entirety.

[0044] In some embodiments, the RNA-inducing nuclease is the Acidaminococcus species Cas12a Cpf1 (Cpf1) mutant (also known as AsCas12a or AsCpf1). Suitable Cas12a (Cpf1) nuclease mutants, including suitable AsCas12a mutants, are known or obvious to those skilled in the art based on this disclosure and include, but are not limited to, AsCas12a variants disclosed herein or known in the art. For example, in some embodiments, the RNA-inducing nuclease is the Acidaminococcus species Cas12aRR mutant (AsCas12-RR). In another embodiment, the RNA-inducing nuclease is the AsCas12RVR mutant. For example, suitable AsCas12 variants include those having the M537R substitution, the H800A substitution, and / or the F870L substitution, or any combination thereof (the numbering scheme follows the AsCas12 wild-type sequence). Further non-limiting examples of suitable Cas12a variants are described in PCT application PCT / US 2018 / 065032, filed on 11 December 2018, the entire contents of which are incorporated herein by reference.

[0045] As used herein, the term "hematopoietic stem cell" refers to CD34+ stem cells capable of giving rise to both mature myeloid and lymphoid cell types, including T cells, natural killer cells, and B cells.

[0046] genome editing system Various genome editing systems known in the art may be used for the methods disclosed herein. Genome editing systems that may be used with the currently disclosed subject matter include, but are not limited to, CRISPR systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, meganuclease (MN) systems, MegaTAL systems, other targeted endonuclease systems, and other chimeric endonucleases.

[0047] In certain embodiments, the genome editing system has RNA-induced DNA editing activity. In certain embodiments, the genome editing system comprises at least two components adapted from a naturally occurring CRISPR system, namely, a guide RNA (gRNA) and an RNA-induced nuclease. These two components form a complex that binds to a specific nucleic acid sequence and can selectively edit DNA within or around that nucleic acid sequence by creating one or more, for example, single-strand breaks (SSBs or nicks), double-strand breaks (DSBs), and / or point mutations.

[0048] Naturally occurring CRISPR systems are evolutionarily organized into two classes and five types (Makarova et al. Nat Rev Microbiol. 2011 Jun;9(6):467-477 (Makarova), incorporated herein by reference), and while the genome editing systems of this disclosure may be adapted from components of any type or class of naturally occurring CRISPR system, the embodiments presented herein are generally adapted from Class 2 and Type II or V CRISPR systems. Class 2 systems, encompassing Types II and V, are characterized by a relatively large multidomain RNA-induced nuclease protein (e.g., Cas9 or Cas12a) and one or more guide RNAs (e.g., crRNA, optionally tracrRNA) that form a ribonucleoprotein (RNP) complex that associates with (targets) and cleaves a specific locus complementary to the target (or spacer) sequence of the crRNA. The genome editing systems described herein target and selectively edit cellular DNA sequences in a similar manner, but differ significantly from naturally occurring CRISPR systems. For example, the single-molecule guide RNA described herein does not exist in nature, and both the guide RNA and RNA-inducing nuclease described herein may incorporate any number of modifications that do not exist in nature.

[0049] The genome editing systems disclosed herein may be delivered to cells by electroporation. Other nonviral approaches may also be employed for gene editing of target cells as disclosed herein. For example, nucleic acid molecules can be administered in the presence of lipofection (Feigner et al., Proc.Natl.Acad.Sci.USA84:7413,1987; Ono et al., Neuroscience Letters 17:259,1990; Brigham et al., Am.J.Med.Sci.298:278,1989; Staubinger et al., Methods in Enzymology 101:512,1983), asialorosomucoid-polylysine binding (Wu et al., Journal of Biological Chemistry 263:14621,1988; Wu et al., Journal of Biological Chemistry 264:16985,1989), or microinjection under surgical conditions (Wolff et al., Science Genes can be introduced into cells / targets by means of (247:1465, 1990). Other nonviral means for gene transfer include in vitro translocation using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Lipid nanoparticles (LNPs) or liposomes have also been intended for the delivery of nucleic acid molecules into cells.

[0050] The genome editing systems disclosed herein may be delivered to a target or cell using a viral vector, such as a retroviral vector, e.g., a γ0001 retroviral vector, or a lentiviral vector. The combination of a retroviral vector and an appropriate packaging strain is suitable when the capsid protein functions to infect human cells. Various amphitropic virus-producing cell lines are known, including, but not limited to, PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6:2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). Non-amphitropic options are also suitable, such as pseudotyped particles with VSVG, RD114, or GALV envelopes, and other particles known in the art. Possible transduction methods also include, for example, directly co-culturing cells and production cells by the method of Bregni, et al. (1992) Blood 80:1418-1422, or culturing the viral supernatant alone or with concentrated vector storage with or without appropriate growth factors and polycations by, for example, Xu, et al. (1994) Exp. Hemat. 22:223-230 and Hughes, et al. (1992) J. Clin. Invest. 89:1817.

[0051] Genome editing systems can be implemented in various ways (e.g., they can be administered or delivered to cells or subjects), and different implementations may be suitable for different applications. For example, in certain embodiments, a genome editing system may be implemented as a protein / RNA complex (ribonucleoprotein, or RNP), which may be included in a pharmaceutical composition optionally comprising a pharmaceutically acceptable carrier and / or encapsulant such as lipid or polymer microparticles or nanoparticles, micelles, or liposomes. In certain embodiments, a genome editing system may be implemented as one or more nucleic acids (optionally together with one or more additional components) encoding the RNA-inducing nuclease and guide RNA components described above. In certain embodiments, a genome editing system may be implemented as one or more vectors comprising such nucleic acids, such as a viral vector such as an adeno-associated virus. In certain embodiments, a genome editing system may be implemented as any combination of the foregoing. Additional or modified implementations operating in accordance with the principles described herein will be apparent to those skilled in the art and are within the scope of this disclosure.

[0052] It should be noted that the genome editing systems of this disclosure may or may target a single specific nucleotide sequence, and that by using two or more guide RNAs, two or more specific nucleotide sequences can be edited in parallel. The use of multiple gRNAs is referred to as “multiplexing” throughout this disclosure and may be used to target multiple unrelated target sequences of interest, or to form multiple SSBs or DSBs within a single target domain, and possibly to perform specific edits within such a target domain. For example, Maeder et al. (Maeder), International Publication No. 2015 / 138510, incorporated herein by reference, describes a genome editing system for correcting a point mutation in the human CEP290 gene (C.2991+1655A to G) that results in the generation of a potential splice site, thereby reducing or eliminating gene function. Maeder’s genome editing system uses two guide RNAs that target sequences on both sides (i.e., flanking) the point mutation to form a DSB located on the mutated side. This then promotes the deletion of the intervening sequence containing the mutation, thereby removing the potential splice site and restoring normal gene function.

[0053] Genome editing systems may, in some cases, create double-strand breaks that are repaired by cellular DNA double-strand break mechanisms such as NHEJ or HDR. These mechanisms have been described in various publications, for example, Davis & Maizels, PNAS, 111(10):E924-932, March 11, 2014 (Davis) (described on Alt-HDR); Frit et al., DNA Repair 17(2014)81-97 (Frit) (described on Alt-NHEJ); and Iyama and Wilson III, DNA Repair (Amst.) 2013-Aug;12(8):620-636 (Iyama) (general description of standard HDR and NHEJ pathways).

[0054] When a genome editing system functions by forming double-strand breaks (DSBs), such a system may optionally include one or more components that promote or facilitate a particular type of double-strand break repair or a specific repair outcome. For example, Cotta-Ramusino also describes a genome editing system in which a single-strand oligonucleotide "donor template" is attached; the donor template can be incorporated into a target region of cellular DNA cleaved by the genome editing system, resulting in a change in the target sequence.

[0055] In certain embodiments, genome editing systems modify a target sequence or alter the expression of a gene within or near a target sequence by, for example, causing a single-strand break, or by not causing a break (i.e., without strand breaks), without causing a double-strand break. For example, a genome editing system may include an RNA-inducible nuclease fused to a functional domain that acts on DNA and thereby modifies a target sequence or its expression. As an example, an RNA-inducible nuclease may be ligated (e.g., fused) to a cytidine deaminase functional domain and act by generating a targeted C-to-A substitution. The RNA-inducible nuclease may also be ligated (e.g., fused) to an adenosine deaminase functional domain, for example. Exemplary nuclease / deaminase fusions are described in their entirety in Komor et al., Nature 533, 420-424 (19 May 2016) and Kantor et al., Int. J. Mol. Sci. 21(17) 6240 (2020), which are incorporated herein by reference. Further non-limiting examples of suitable base editors, their variants, and strategies for preparing RNA-inducing nucleases comprising them are described in PCT / US No. 2020 / 016664 filed on 4 February 2020, PCT / US No. 2020 / 018192 filed on 13 February 2020, PCT / US No. 2020 / 049975 filed on 9 September 2020, PCT / US No. 2022 / 012054 filed on 11 January 2022, and PCT / US No. 2022 / 078655 filed on 25 October 2022, each of which is incorporated herein by reference in its entirety. Alternatively, genome editing systems may operate by utilizing deactivated (i.e., "dead") nucleases, such as dead Cas9 (dCas9), to form stable complexes on one or more target regions of cellular DNA, thereby mobilizing other functional domains and / or interfering with functions involved in the target region, including but not limited to mRNA transcription and chromatin repair.

[0056] In certain embodiments, the RNA-inducing nuclease of this disclosure may comprise a polymerase domain (e.g., a reverse transcriptase domain). In certain embodiments, the RNA-inducing nuclease may utilize a gRNA having a primer-binding sequence and / or a polymerase domain template.

[0057] In certain embodiments, the RNA-inducing nuclease may be a prime editor (PE), where PE is an RNA-inducing nuclease having nickase activity fused to a reverse transcriptase domain. In certain embodiments, the PE may be a primer-editing gRNA (pegRNA), where pegRNA is a gRNA having a primer-binding sequence (PBS) and a donor template attached to one of its ends, such as the 3' end. In certain embodiments, the PE:pegRNA complex binds to the target DNA, and the nickase domain of the prime editor nicks only one strand, creating a flap. The PBS located on the pegRNA binds to the DNA flap, and the edited RNA sequence is reverse-transcribed using the reverse transcriptase domain of the prime editor. The edited strand is incorporated into the DNA at the end of the nicked flap, and the target DNA is repaired with the newly reverse-transcribed DNA. The original DNA segment is removed by cellular endonucleases. Additional methods for template-mediated gene editing using RNA-induced nucleases and polymerases are described in International Publication Nos. 2020 / 191233, 2020 / 191248, 2021226558, 2023283246, 2023 / 235501, and 2023 / 076898, each of which is incorporated by reference for all purposes herein.

[0058] Guide RNA (gRNA) molecule The terms “guide molecule,” “guide RNA,” and “gRNA” refer to any nucleic acid that facilitates the specific binding (or “targeting”) of RNA-induced nucleases, such as Cas9 or Cas12a (Cpf1), to target sequences within a cell, such as genomic or episomal sequences. gRNAs can be monomolecules (consisting of a single RNA molecule, also called a chimera) or modular (consisting of two or more, typically two separate RNA molecules, such as crRNA and tracrRNA, which usually bind to each other by duplication). gRNAs and their components are described in literature such as Briner et al. (Molecular Cell 56(2), 333-339, October 23, 2014 (Briner), as referenced) and Cotta-Ramusino. Guide molecules can be RNA molecules. The guide molecule may also consist of one or more nucleotides other than RNA nucleotides; for example, the guide molecule may be a DNA / RNA hybrid molecule, and / or the guide molecule may consist of one or more modified nucleotides (including, but not limited to, one or more modified DNA or RNA nucleotides).

[0059] In bacteria and archaea, the type II CRISPR system generally comprises an RNA-inducing nuclease protein such as Cas9; a CRISPR RNA (crRNA) containing a 5' region complementary to an exogenous sequence; and a transactivating crRNA (tracrRNA) containing a 5' region complementary to the 3' region of the crRNA and forming a double helix with it. This double helix can promote the formation of the Cas9 / gRNA complex, which is necessary for its activity. While adapting the type II CRISPR system for use in gene editing, in one non-limiting example, it was discovered that crRNA and tracrRNA can be linked to a single monomolecule or chimeric guide RNA by a 4-nucleotide (e.g., GAAA) "tetraloop" or "linker" sequence that bridges the complementary regions of crRNA (its 3' end) and tracrRNA (its 5' end). (All of these are incorporated herein by reference: Mali et al. Science. 2013 Feb 15;339(6121):823-826 ("Mali"); Jiang et al. Nat Biotechnol. 2013 Mar;31(3):233-239 ("Jiang"); and Jinek et al., 2012 Science Aug. 17;337(6096):816-821 ("Jinek")).

[0060] Guide RNA, whether monolithic or modular, contains a “targeting domain” that is fully or partially complementary to the target domain in the target sequence, such as a DNA sequence in the genome of the cell to be edited. The targeting domain is referred to by various names in the literature, including, but is not limited to, “guide sequence” (Hsu et al., Nat Biotechnol. 2013 Sep;31(9):827-832, ("Hsu"), incorporated herein by reference), “complementary region” (Cotta-Ramusino), “spacer” (Briner), and comprehensively “crRNA” (Jiang). Regardless of the names given to them, the targeting domain is typically 10–30 nucleotides long, and in certain embodiments 16–24 nucleotides long (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides long), located at or near the 5' end in Cas9 gRNA, and at or near the 3' end in Cas12a gRNA.

[0061] In addition to the targeting domain, gRNA typically (but not necessarily, as discussed below) contains multiple domains that may influence the formation or activity of the gRNA / Cas complex. For example, as described above, the double-stranded structure formed by the first and second complementary domains of gRNA (also referred to as repeat:anti-repeat double helix) can interact with the Cas9 recognition (REC) lobe to mediate the formation of the Cas9 / gRNA complex. (Nishimasu et al., Cell 156, 935-949, February 27, 2014 (Nishimasu 2014) and Nishimasu et al., Cell 162, 1113-1126, August 27, 2015 (Nishimasu 2015), both incorporated herein by reference). It should be noted that the first and / or second complementary domains may contain one or more poly(A) strands that can be recognized as termination signals by RNA polymerase. Therefore, the sequences of the first and second complementary domains are selectively modified, for example, through the use of an AG swap or an AU swap as described by Briner, to remove these regions and facilitate complete in vitro transcription of the RNA. These and other similar modifications to the first and second complementary domains are within the scope of this disclosure.

[0062] Along with the first and second complementary domains, Cas9 gRNA typically contains two or more additional double-stranded regions that are involved in nuclease activity in vivo but not necessarily in vitro (Nishimasu 2015). The first stem-loop 1, located near the 3' portion of the second complementary domain, is variously referred to as the "proximal domain" (Cotta-Ramusino), "stem-loop 1" (Nishimasu 2014 and 2015), and "nexus" (Briner). One or more additional stem-loop structures are generally located near the 3' end of the gRNA, and their number varies by species; S. pyogenes gRNA typically contains two 3' stem-loops (a total of four stem-loop structures including repeat / anti-repeat double-strands), while S. aureus and other species have only one (a total of three stem-loop structures). A description of the conserved stem-loop structure (and more generally, the gRNA structure) for each species is provided by Briner.

[0063] While the above explanation has focused on gRNAs for use with Cas9, it should be understood that other RNA-inducible nucleases have been discovered or invented (or may be discovered in the future) that utilize gRNAs that differ in some respects from those described so far. For example, Cas12a (also known as Cpf1; CRISPR derived from "Prevotella and Franciscella 1") is an RNA-inducible nuclease that does not require tracrRNA to function. (Zetsche et al., 2015, Cell 163, 759-771 October 22, 2015 (Zetsche I), incorporated herein by reference). gRNAs for use in the Cas12a genome editing system generally contain a targeting domain and a complementary domain (alternately referred to as "handles"). It should also be noted that in gRNAs intended for use with Cas12a, the targeting domain is usually located at or near the 3' end rather than the 5' end, as described above for Cas9 gRNA (the handle is at or near the 5' end of Cas12a gRNA).

[0064] Those skilled in the art will understand that while structural differences may exist between gRNAs derived from different prokaryotic species, or between Cas12a and Cas9 gRNAs, the principle of action of gRNAs is generally consistent. For this consistency of action, gRNAs can be defined in a broad sense by their targeting domain sequences, and those skilled in the art will understand that a given targeting domain sequence can be incorporated into any suitable gRNA, including monomolecular or chimeric gRNAs, or gRNAs containing one or more chemical and / or sequence modifications (substitutions, additional nucleotides, cleavage, etc.). Therefore, for the economy of presentation in this disclosure, gRNAs may be described solely in terms of their targeting domain sequences.

[0065] More generally, those skilled in the art will understand that some aspects of this disclosure relate to systems, methods, and compositions that can be implemented using multiple RNA-inducing nucleases. For this reason, unless otherwise specified, the term gRNA should be understood to encompass not only gRNAs compatible with specific species of RNA-inducing nucleases, such as Cas9 or Cas12a, but also any suitable gRNAs that can be used with any RNA-inducing nuclease. For example, in certain embodiments, the term gRNA may include gRNAs for use with, or derived from, or adapted from, any RNA-inducing nuclease present in, or any class 2 CRISPR system such as type II or type V, or any RNA-inducing nuclease present in, or any RNA-inducing nuclease adapted therefrom.

[0066] In some embodiments, the guide RNA used includes modifications compared to a standard gRNA scaffold. Such modifications may include, for example, chemical modifications to parts of the gRNA, such as nucleic acid bases or the main chain portion. In some embodiments, such modifications may also include the presence of DNA nucleotides within the gRNA, for example, inside or outside the targeting domain. In some embodiments, the modifications may include elongation of the gRNA scaffold by adding 1 to 100 nucleotides, including RNA and / or DNA nucleotides, to the distal end of the targeting domain, for example, to the 3' or 5' end of the guide RNA.

[0067] In certain embodiments, the unmodified or modified gRNA complexed with the Cas12a protein may be modified to enhance the editing efficiency of the target nucleic acid. In certain embodiments, the modified gRNA may include one or more modifications, including phosphorothioate (PS2) ligation modifications, 2'-O-methyl modifications, one or more or a sequence of deoxyribonucleic acid (DNA) bases (also referred herein as "DNA elongation"), or combinations thereof.

[0068] In some embodiments, the gRNAs disclosed herein include one or more or a sequence of deoxyribonucleic acid (DNA) bases, also referred herein as “DNA elongation.” In some embodiments, the gRNAs disclosed herein include DNA elongation at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the DNA elongation is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 5 The DNA base length may be 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100. For example, in certain embodiments, the DNA elongation may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA base lengths. In certain embodiments, the DNA elongation may consist of one or more DNA bases selected from adenine (A), guanine (G), cytosine (C), or thymine (T). In certain embodiments, DNA elongation includes the same DNA base. For example, DNA elongation may include a sequence of adenine (A) bases. In certain embodiments, DNA elongation may include a sequence of thymine (T) bases. In certain embodiments, DNA elongation includes a combination of different DNA bases. In certain embodiments, DNA elongation may include, or be derived from, the sequences listed in Table 3. In certain embodiments, the gRNA disclosed herein includes DNA elongation, as well as one or more phosphorothioate-binding modifications, one or more phosphorodithioate (PS2)-binding modifications, one or more 2'-O-methyl modifications, or a combination thereof. In certain embodiments, one or more modifications may be at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof.In certain embodiments, the gRNA containing DNA elongation may include sequences listed in Table 3 that contain DNA elongation. While theoretical constraints are undesirable, it is intended that any DNA elongation may be used herein, as long as it does not hybridize to the target nucleic acid targeted by the gRNA. In some embodiments, DNA elongation further exhibits increased editing efficiency, for example, through alterations in gRNA stability, uptake, and / or activity at the target nucleic acid site compared to gRNA without such DNA elongation.

[0069] In some embodiments, the gRNAs disclosed herein include one or more or a sequence of ribonucleic acid (RNA) bases, also referred herein as “RNA elongation.” In some embodiments, the gRNAs disclosed herein include RNA elongation at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, RNA elongation is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 5 The RNA elongation may be 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 RNA base lengths. For example, in certain embodiments, the RNA elongation may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA base lengths. In certain embodiments, the RNA elongation may comprise one or more RNA bases selected from adenine (rA), guanine (rG), cytosine (rC), or uracil (rU), where "r" represents RNA, 2'-hydroxyl. In certain embodiments, the RNA elongation may comprise the same RNA base. For example, the RNA elongation may comprise a sequence of adenine (rA) bases. In certain embodiments, the RNA elongation may comprise a combination of different RNA bases. In certain embodiments, the RNA elongation may comprise, or be derived from, the sequences listed in Table 3. In certain embodiments, the gRNA disclosed herein comprises the RNA elongation, as well as one or more phosphorothioate-binding modifications, one or more phosphorodithioate (PS2)-binding modifications, one or more 2'-O-methyl modifications, or a combination thereof. In certain embodiments, one or more modifications may be located at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof.In certain embodiments, a gRNA containing RNA elongation may include the sequences shown in Table 3 that contain RNA elongation. A gRNA containing RNA elongation at its 5' end may include the sequences disclosed herein. A gRNA containing RNA elongation at its 3' end may include the sequences disclosed herein.

[0070] The gRNAs disclosed herein may also include RNA elongation and DNA elongation. In certain embodiments, both RNA elongation and DNA elongation may be located at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, RNA elongation is at the 5' end of the gRNA and DNA elongation is at the 3' end of the gRNA. In certain embodiments, RNA elongation is at the 3' end of the gRNA and DNA elongation is at the 5' end of the gRNA.

[0071] In some embodiments, gRNAs that have modifications such as 5' end DNA elongation form complexes with RNA-inducing nucleases, such as AsCas12a nuclease, to form RNPs, which are then used to edit target cells, such as T cells. Examples of appropriate 5' elongation of guide RNA, such as Cas12a guide RNA, are shown in the table below.

[0072] [Table 4]

[0073] [Table 5]

[0074] Additional appropriate gRNA modifications will be apparent to those skilled in the art based on this disclosure. Examples of appropriate gRNA modifications include, for example, PCT application PCT / US2018 / 054027, filed 2 October 2018, titled “MODIFIED CPF1GUIDERNA”; PCT application PCT / US2015 / 000143, filed 3 December 2015, titled “GUIDE RNA WITH CHEMICALMODIFICATI”; PCT application PCT / US2016 / 026028, filed 5 April 2016, titled “CHEMICALLY MODIFIED GUIDE RNAS FOR CRISPR / CAS-MEDIATED GENE REGULATION”; and “NUCLEASE-MEDIATED GENOME EDITING OF PRIMARY CELLS AND ENRICHMENT” (each of which is incorporated herein by reference in its entirety). This includes the specification described in PCT application PCT / US2016 / 053344, filed on September 23, 2016, and titled “THEREOF”.

[0075] gRNA design Methods for selecting and validating target sequences, as well as for off-target analysis, are described, for example, in Mali;Hsu;Fu et al., 2014 Nat biotechnol 32(3):279-84; Heigwer et al., 2014 Nat methods 11(2):122-3; Bae et al. (2014) Bioinformatics 30(10):1473-5; and Xiao A et al. (2014) Bioinformatics 30(8):1180-1182. Each of these references is incorporated herein by reference. In certain non-limiting embodiments, gRNA design may involve the use of software tools to optimize the selection of potential target sequences corresponding to the user's target sequence, for example, to minimize total off-target activity across the entire genome. Methods for selecting these and other guides are detailed in Maeder and Cotta-Ramusino.

[0076] In certain embodiments, one, more, or all nucleotides in the gRNA are modified. Strategies for modifying the gRNA are described in International Publication No. 2019 / 152519, published on August 8, 2019, the contents of which are expressly incorporated herein by reference.

[0077] Non-limiting examples of guide RNAs suitable for specific embodiments included in this disclosure are provided herein, for example, in the following table. Those skilled in the art will be able to foresee from the disclosure of targeting domain sequences as either DNA or RNA sequences suitable guide RNA sequences for specific nucleases, such as Cas9 or Cas12a nucleases. For example, a guide RNA comprising a target sequence consisting of RNA nucleotides will include an RNA sequence corresponding to the target domain sequence provided as a DNA sequence, and therefore will include uracil instead of thymidine nucleotides. For example, a guide RNA comprising an RNA nucleotide and a targeting domain sequence described by the DNA sequence TTCCAGTGGGACGTAGCTGAG (SEQ ID NO: 27) will have a targeting domain of the corresponding RNA sequence rUrUrCrCrArGrUrGrGrGrArCrGrUrArGrCrUrGrArG (SEQ ID NO: 31). As will be apparent to those skilled in the art, such targeting sequences will be ligated to a suitable guide RNA scaffold, such as a crRNA scaffold sequence or a chimeric crRNA / tracrRNA scaffold sequence. Suitable gRNA scaffold sequences are known to those skilled in the art. For example, in the case of AsCas12a, a suitable scaffold sequence comprises the sequence rUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArU (SEQ ID NO: 36) appended to the 5' end of the targeting domain. Those skilled in the art will further understand how such guide RNAs can be modified. For example, the addition of a 25-mer DNA extension (SEQ ID NO: 7) results in a guide RNA of, for example, the sequence ATGTGTTTTTGTCAAAAGACCTTTTrUrArUrUrUrCrUrArCrUr

[0078] In some embodiments, the gRNA for use in this disclosure is a gRNA that targets CD70 (CD70 gRNA). In some embodiments, the target sequence of the CD70 gene comprises or consists of a nucleotide sequence having a length of at least 10, at least 16, at least 17, at least 18, at least 20, or at least 21 nucleotides. In certain embodiments, the target sequence or target locus of the CD70 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequences described in SEQ ID NOs. 24-52. In some embodiments, the target sequence or target locus of the CD70 gene has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations with respect to the nucleotide sequences described in SEQ ID NOs. 24-52. In some embodiments, the target sequence of the CD70 gene has 2, 3, 4, 5, 6, 7, 8, 9, or fewer than 10 mutations with respect to the nucleotide sequences described in SEQ ID NOs. 24-52. In some embodiments, the target sequence of the CD70 gene comprises or consists of the nucleotide sequences described in SEQ ID NOs: 24-27. In some embodiments, the target locus of the CD70 gene comprises the nucleic acid sequences described in SEQ ID NOs: 24-27.

[0079] In certain embodiments, the target sequence or target locus of the CD70 gene is located in exon 2 of CD70. In certain embodiments, the target sequence of the CD70 gene comprises or consists of a nucleotide sequence having a length of at least 10, at least 16, at least 17, at least 18, at least 20, or at least 21 nucleotides. In certain embodiments, the target sequence of the CD70 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequence described in Sequence ID No. 55. Sequence ID No. 55 is shown below. tttctggtcttttcttccagTGGGACGTAGCTGAGCTGCAGCTGAATCACACAGgtaacacgggggacgtggag[Sequence No. 55]

[0080] In certain embodiments, the target sequence of the CD70 gene comprises or consists of the nucleotides described in SEQ ID NO: 26 or SEQ ID NO: 27.

[0081] In certain embodiments, the targeting domain of the gRNA may be complementary to any strand or locus of the target sequence of the CD70 gene. In some embodiments, the targeting domain of the gRNA molecule has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the nucleotide sequences described in SEQ ID NOs. 28-31. In some embodiments, the targeting domain of the gRNA molecule has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations with respect to the nucleotide sequences described in SEQ ID NOs. 28-31. In some embodiments, the targeting domain of the gRNA molecule has 2, 3, 4, 5, 6, 7, 8, 9, or fewer than 10 mutations with respect to the nucleotide sequences described in SEQ ID NOs. 28-31. In some embodiments, the targeting domain of the gRNA molecule comprises or consists of the nucleotide sequences described in SEQ ID NOs. 28-31. In certain embodiments, the targeting domain of the gRNA that targets the CD70 gene is SEQ ID NO. 31. In some embodiments, the gRNA molecule targeting the CD70 gene comprises the nucleotide sequences described in SEQ ID NOs. 32-35. In certain embodiments, the gRNA molecule targeting the CD70 gene comprises or consists of the sequence described in SEQ ID NO. 35. Exemplary CD70 gene targeting sequences, gRNA targeting domains, scaffold sequences, and DNA elongation are shown in Table 7.

[0082] [Table 6]

[0083] [Table 7]

[0084] [Table 8]

[0085] [Table 9]

[0086] gRNA modification The activity, stability, or other properties of gRNAs can be altered by incorporating specific modifications. For example, transiently expressed or delivered nucleic acids may be susceptible to degradation by cellular nucleases, for instance. Therefore, the gRNAs described herein may contain one or more modified nucleosides or nucleotides that introduce stability against nucleases. While we do not wish to be constrained by theory, it is also thought that certain modified gRNAs described herein may, when introduced into cells, exhibit a reduction in the innate immune response. Those skilled in the art will recognize certain cellular responses commonly observed in cells, such as mammalian cells, in response to exogenous nucleic acids, particularly those derived from viruses or bacteria. Such responses may include cytokine expression and release, induction of cell death, etc., but can be mitigated or completely eliminated by the modifications presented herein.

[0087] The specific exemplary modifications described in this section may be located at any position within the gRNA sequence, including but not limited to the 5' end or its vicinity (e.g., within 1–10, 1–5, or 1–2 nucleotides from the 5' end) and / or the 3' end or its vicinity (e.g., within 1–10, 1–5, or 1–2 nucleotides from the 3' end). In some cases, the modifications are located within functional motifs such as the repeat-anti-repeat double helix of Cas9 gRNA, the stem-loop structure of Cas9 or Cas12a gRNA, and / or the targeting domain of the gRNA.

[0088] As an example, the 5' end of a gRNA may contain a eukaryotic mRNA cap structure or cap analogue (e.g., G(5')ppp(5')G cap analogue, m7G(5')ppp(5')G cap analogue, or 3'-O-Me-m7G(5')ppp(5')G anti-reverse cap analogue (ARCA)) as shown below. [ka]

[0089] The cap or cap analogue can be incorporated during either the chemical synthesis or in vitro transcription of gRNA.

[0090] Similarly, the 5' end of gRNA may lack a 5' triphosphate group. For example, the 5' triphosphate group can be removed by treating in vitro transcribed gRNA with phosphatase (e.g., using calf intestinal alkaline phosphatase).

[0091] Another modification involves the addition of multiple (e.g., 1-10, 10-20, or 25-200) adenine (A) residues, known as a poly-A sequence, to the 3' end of the gRNA. The poly-A sequence may be added to the gRNA during post-transcription chemosynthesis using polyadenosine polymerase (e.g., E. coli poly(A) polymerase) in vitro, or it may be added in vivo by a polyadenylation sequence, as described by Maeder.

[0092] It should be noted that the modifications described herein can be combined in any suitable manner, for example, gRNA, whether transcribed in vivo from a DNA vector or transcribed in vitro, may contain either a 5' cap structure or a cap analogue and a 3' polyA sequence, or both.

[0093] Guide RNA can be modified with u-ribose at its 3' end. For example, the two terminal hydroxyl groups of u-ribose can be oxidized to aldehyde groups, and the simultaneous opening of the ribose ring results in the modified nucleoside shown below: [ka] In the formula, "U" may be unmodified or modified uridine. The 3'-terminal U-ribose may be modified with a 2'3'-cyclic phosphate as shown below: [ka] In the formula, "U" may be unmodified or modified uridine.

[0094] The guide RNA may contain a 3' nucleotide that can be stabilized against degradation by incorporating, for example, one or more modified nucleotides described herein. In certain embodiments, for example, uridine may be substituted with a modified uridine such as 5-(2-amino)propyluridine and 5-bromouridine, or any of the modified uridines described herein; adenosine and guanosine may be substituted with a modified adenosine or guanosine having a modification at the 8-position, such as 8-bromoguanosine, or any of the modified adenosine and guanosine described herein.

[0095] In certain embodiments, for example, a glycosylated ribonucleotide in which the 2'OH group is substituted with a group selected from H, -OR, -R (wherein R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), halo, -SH, -SR (wherein R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), amino (wherein amino may be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or cyano(-CN) may be incorporated into the gRNA. In certain embodiments, the phosphate backbone may be modified, for example, with a phosphorothioate (PhTx) group as described herein. In certain embodiments, one or more nucleotides of the gRNA may be modified or unmodified nucleotides, each independently, including but not limited to 2'-sugar modifications such as 2'-O-methyl, 2'-O-methoxyethyl; or 2'-fluoro modifications, including, for example, 2'-F or 2'-O-methyl, adenosine (A), 2'-F or 2'-O-methyl, cytidine (C), 2'-F or 2'-O-methyl, uridine (U), 2'-F or 2'-O-methyl, thymidine (T), 2'-F or 2'-O-methyl; and guanosine (G), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.

[0096] Guide RNA may also contain "locked" nucleic acids (LNAs) in which the 2'OH group may be bonded to the 4' carbon on the same ribose sugar by, for example, a C1-6 alkylene or C1-6 heteroalkylene crosslink. To provide such crosslinks, methylene, propylene, ether, or amino crosslinks; O-amino (amino may be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy or O(CH2) n -Amino (wherein amino is, for example, NH2; which may be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and any other suitable part may be used.

[0097] In certain embodiments, gRNA may include polycyclic modified nucleotides (e.g., tricyclonucleotides; and "unlocked" forms such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, where ribose is substituted with glycol units attached to a phosphate diester bond), or threose nucleic acids (TNAs, where ribose is substituted with α-L-treophranosyl-(3'→2')).

[0098] Generally, gRNAs contain a five-membered ring of ribose sugar group containing oxygen. Exemplary modified gRNAs include, but are not limited to, substitution of oxygen in ribose (e.g., by sulfur (S), selenium (Se), or alkylenes such as methylene or ethylene); addition of a double bond (e.g., substituting ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., forming a four-membered ring of cyclobutane or oxetane); and ring expansion of ribose (e.g., forming a six- or seven-membered ring with an additional carbon or heteroatom; e.g., anhydrous hexitol, althritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino, which also has a phosphoramide backbone). Most sugar analog modifications are localized at the 2' position, but other sites, including the 4' position, are also subject to modification. In certain embodiments, gRNAs may include 4'-S, 4'-Se, or 4'-C-aminomethyl-2'-O-Me modifications.

[0099] In certain embodiments, deazanucleotides, such as 7-deaza-adenosine, may be incorporated into the gRNA. In certain embodiments, O- and N-alkylated nucleotides, such as N6-methyladenosine, may be incorporated into the gRNA. In certain embodiments, one, several, or all of the nucleotides in the gRNA are deoxynucleotides.

[0100] RNA-induced nuclease The RNA-inducing nucleases described herein include, but are not limited to, natural class II CRISPR nucleases such as Cas9 and Cas12a, and other nucleases derived from or obtained therefrom. Functionally, an RNA-inducing nuclease is defined as a nuclease that (a) interacts with gRNA (e.g., forms a complex) and (b) together with gRNA, binds to a target region of DNA containing (i) a sequence complementary to the targeting domain of gRNA and optionally (ii) an additional sequence referred to as a “protospacer adjacent motif” or “PAM,” which is described in more detail below, and optionally cleaves or modifies it. As illustrated by the following examples, RNA-inducing nucleases can be defined in a broad sense by their PAM specificity and cleavage activity, even if there is variation among individual RNA-inducing nucleases that share the same PAM specificity or cleavage activity. Those skilled in the art will understand that some aspects of this disclosure relate to systems, methods, and compositions that can be implemented using any suitable RNA-inducing nuclease having specific PAM specificity and / or cleavage activity. For this reason, unless otherwise specified, the term RNA-inducing nuclease should be understood as a general term and not limited to any particular type of RNA-inducing nuclease (e.g., CCas12a in relation to Cas9), species (e.g., S. aureus in relation to S. pyogenes), or variation (e.g., truncated or split in relation to full length; manipulated PAM specificity in relation to natural PAM specificity, etc.).

[0101] The PAM sequence derives its name from its sequence relationship with a "protospacer" sequence that is complementary to the gRNA targeting domain (or "spacer"). Together with the protospacer sequence, the PAM sequence defines a target region or sequence for a specific RNA-inducible nuclease / gRNA combination.

[0102] Various RNA-induced nucleases may require different continuity relationships between the PAM and the protospacer. For example, Cas9 nucleases recognize the PAM sequence at the 3' position of the protospacer, while Cas12a generally recognizes the PAM sequence at the 5' position of the protospacer.

[0103] In addition to recognizing the orientation of specific PAM and protospacer sequences, RNA-induced nucleases can also recognize specific PAM sequences. For example, S. aureus Cas9 recognizes the NNGRRT or NNGRRV PAM sequence, in which the N residue is adjacent to the 3' region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes the NGG PAM sequence, and F. nobicida Cas12a recognizes the TTN PAM sequence. PAM sequences have been identified for various RNA-induced nucleases, and strategies for identifying novel PAM sequences are described by Shmakov et al., 2015, Molecular Cell 60, 385-397, November 5, 2015. It should also be noted that manipulated RNA-inducible nucleases may have PAM specificity different from that of the reference molecule (for example, in the case of a manipulated RNA-inducible nuclease, the reference molecule may be a naturally occurring mutant from which the RNA-inducible nuclease originates, or a naturally occurring mutant that has maximum amino acid sequence homology with the manipulated RNA-inducible nuclease).

[0104] In addition to their PAM specificity, RNA-induced nucleases can be characterized by their DNA cleavage activity: while native RNA-induced nucleases typically form DSBs in target nucleic acids, engineered mutants have been produced that produce only SSBs or do not cleave at all (discussed above) Ran & Hsu, et al., Cell 154(6), 1380-1389, September 12, 2013 (Ran), incorporated herein by reference).

[0105] Cas9 The crystal structures of S. pyogenes Cas9 (Jinek 2014) and S. aureus Cas9, which form complexes with single-molecule guide RNA and target DNA, have been determined (Nishimasu 2014; Anders 2014; and Nishimasu 2015).

[0106] The naturally occurring Cas9 protein consists of two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe, each containing a specific structural and / or functional domain. The REC lobe comprises an arginine-rich cross-linking helix (BH) domain and at least one REC domain (e.g., the REC1 domain, optionally the REC2 domain). The REC lobe does not share structural similarities with other known proteins, suggesting it is a unique functional domain. While we do not wish to be constrained by any theory, mutational analysis suggests specific functional roles for the BH and REC domains: the BH domain appears to play a role in gRNA:DNA recognition, while the REC domain is thought to interact with the repeat:anti-repeat double helix of gRNA, mediating the formation of the Cas9 / gRNA complex.

[0107] The NUC lobe comprises a RuvC domain, an HNH domain, and a PAM interaction (PI) domain. The RuvC domain shares structural similarities with members of the retroviral integrase superfamily and cleaves the non-complementary (i.e., lower) strand of the target nucleic acid. It may be formed from two or more split RuvC motifs (such as RuvCI, RuvCII, and RuvCIII in s. pyogenes and s. aureus). The HNH domain, on the other hand, is structurally similar to the HNN endonuclease motif and cleaves the complementary (i.e., upper) strand of the target nucleic acid. As its name suggests, the PI domain contributes to PAM specificity.

[0108] While certain functions of Cas9 are linked to the specific domains mentioned above (though not necessarily entirely determined by them), these functions, and others, may be mediated or influenced by other Cas9 domains or by multiple domains on either lobe. For example, as described by Nishimasu 2014, in S. pyogenes Cas9, the repeat:antirepeat double helix of the gRNA enters the groove between the REC and NUC lobes, and the nucleotides in the double helix interact with amino acids in the BH, PI, and REC domains. Some nucleotides in the first stem-loop structure also interact with amino acids in multiple domains (PI, BH, and REC1), as do some nucleotides in the second and third stem-loops (RuvC and PI domains).

[0109] Cas12a (formerly known as Cpf1) The crystal structure of Acidaminococcus species Cas12a, which forms a complex with crRNA and double-stranded (ds)DNA targets such as the TTTN PAM sequence, has been analyzed by Yamano et al. (Cell. 2016 May 5;165(4):949-962 (Yamano), incorporated herein by reference). Similar to Cas9, Cas12a has two lobes: a REC (recognition) lobe and a NUC (nuclease) lobe. The REC lobe contains REC1 and REC2 domains, which are not similar to any known protein structure. The NUC lobe, on the other hand, contains three RuvC domains (RuvC-I, -II, and -III) and one BH domain. However, in contrast to Cas9, the Cas12a REC lobe lacks an HNH domain and is a structurally unique domain that does not resemble any known protein structure, containing three wedge (WED) domains (WED-I, -II, and -III) and a nuclease (Nuc) domain.

[0110] While Cas9 and Cas12a share structural and functional similarities, it should be understood that certain Cas12a activities are mediated by structural domains that are not similar to any Cas9 domain. For example, cleavage of the complementary strand of target DNA appears to be mediated by a Nuc domain that is sequencely and spatially distinct from the HNH domain of Cas9. Furthermore, the untargeting region (handle) of Cas12a gRNA adopts a pseudo-knot structure rather than a stem-loop structure formed by repeat:anti-repeat double helix in Cas9 gRNA.

[0111] Modification of RNA-induced nucleases While the RNA-induced nucleases described above possess activities and properties that may be useful for a variety of applications, those skilled in the art will recognize that RNA-induced nucleases can also be modified in some cases to alter their cleavage activity, PAM specificity, or other structural or functional characteristics.

[0112] First, focusing on modifications that alter cleavage activity, mutations that reduce or eliminate the activity of domains within the NUC lobe are described above. Exemplary mutations that may be generated in the RuvC domain, Cas9 HNH domain, or Cas12a Nuc domain are described by Ran and Yamano, and Cotta-Ramusino. Generally, mutations that reduce or eliminate the activity of one of two nuclease domains result in an RNA-inducible nuclease with nickase activity, but it should be noted that the type of nickase activity changes depending on which domain is inactivated. For example, inactivation of the RuvC domain or the Cas9 HNH domain results in nickase.

[0113] Modifications of PAM specificity compared to naturally occurring Cas9 reference molecules have been described by Kleinstiver et al. for both S. pyogenes (Kleinstiver et al., Nature. 2015 Jul 23;523(7561):481-5 (Kleinstiver I)) and S. aureus (Kleinstiver et al., Nat Biotechnol. 2015 Dec;33(12):1293-1298 (Kleinstiver II)). Kleinstiver et al. have also described modifications that improve the targeting fidelity of Cas9 (Nature, 2016 January 28;529,490-495 (Kleinstiver III)). Each of these references is incorporated herein by reference.

[0114] RNA-induced nucleases are divided into two or more parts, as described by Zetsche et al. (Nat Biotechnol. 2015 Feb; 33(2): 139-42 (Zetsche II), referenced) and Fine et al. (Sci Rep. 2015 Jul 1; 5: 10777 (Fine), referenced).

[0115] RNA-induced nucleases may be size-optimized or shortened in certain embodiments, for example, through one or more deletions that reduce the size of the nuclease while still maintaining gRNA binding, target and PAM recognition, and cleavage activity. In certain embodiments, RNA-induced nucleases may optionally be covalently or noncovalently bound to another polypeptide, nucleotide, or other structure by a linker. Exemplary binding nucleases and linkers are described by Guilinger et al., Nature Biotechnology 32, 577-582 (2014), which are incorporated by reference for all purposes herein.

[0116] RNA-induced nucleases also optionally include labels, including but not limited to nuclear localization signals, to facilitate the transfer of RNA-induced nuclease proteins into the nucleus. In certain embodiments, RNA-induced nucleases may incorporate nuclear localization signals at their C-terminus and / or N-terminus. Nuclear localization sequences are publicly known in the art and are described in Maeder and elsewhere.

[0117] The aforementioned list of modifications is intended to be illustrative in nature, and those skilled in the art will understand, in view of this disclosure, that other modifications may be possible or desirable in specific applications. Therefore, for the sake of brevity, the exemplary systems, methods, and compositions of this disclosure are presented with reference to specific RNA-inducing nucleases, but it should be understood that the RNA-inducing nucleases used may be modified in a manner that does not alter their operating principles. Such modifications are within the scope of this disclosure.

[0118] Examples of suitable nuclease variants include, but are not limited to, AsCas12a variants comprising M537R substitution, H800A substitution, and / or F870L substitution, or any combination thereof (the numbering scheme follows the AsCas12a wild-type sequence). Other suitable modifications of the AsCas12a amino acid sequence are known to those skilled in the art. Some non-exclusive exemplary sequences of wild-type AsCas12a and AsCas12a variants are as follows:

[0119] His-AsCas12a-sNLS-sNLS H800A amino acid sequence [ka]

[0120] Cas12a mutant, one amino acid [ka]

[0121] Cas12a mutant 2-amino acid sequence [ka]

[0122] Cas12a mutant 3-amino acid sequence [ka]

[0123] Cas12a mutant 4-amino acid sequence [ka]

[0124] Cas12a mutant 4-amino acid sequence [ka]

[0125] Cas12a mutant 5-amino acid sequence [ka]

[0126] Cas12a mutant 6-amino acid sequence [ka]

[0127] Cas12a mutant 7-amino acid sequence [ka]

[0128] Example AsCas12a wild-type amino acid sequence [ka]

[0129] In some embodiments, the RNA-inducing nuclease has at least 80%, at least 85%, at least 86%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with the wild-type RNA-inducing nuclease and / or the RNA-inducing nucleases disclosed herein (for example, RNA-inducing nucleases comprising amino acid sequences selected from the group consisting of SEQ ID NOs. 38-46 and SEQ ID NO. 56). In some embodiments, the RNA-inducing nuclease has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mutations compared to the wild-type RNA-inducing nuclease and / or the RNA-inducing nucleases disclosed herein (for example, RNA-inducing nucleases comprising amino acid sequences selected from the group consisting of SEQ ID NOs. 38-46 and SEQ ID NOs. In some embodiments, the RNA-inducing nuclease has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or fewer than 20 mutations compared to the wild-type RNA-inducing nuclease and / or the RNA-inducing nucleases disclosed herein (for example, RNA-inducing nucleases comprising amino acid sequences selected from the group consisting of SEQ ID NOs. 38-46 and SEQ ID NOs. 56).

[0130] Nucleic acids that encode RNA-inducible nucleases For example, nucleic acids encoding RNA-inducible nucleases such as Cas9 and Cas12a, or functional fragments thereof, are provided herein. Exemplary nucleic acids encoding RNA-inducible nucleases have been previously described (see, for example, Cong 2013; Wang 2013; Mali 2013; Jinek 2012).

[0131] In some cases, the nucleic acid encoding the RNA-inducing nuclease may be a synthetic nucleic acid sequence. For example, the synthetic nucleic acid molecule may be chemically modified. In certain embodiments, the nucleic acid encoding the RNA-inducing nuclease is RNA. In certain embodiments, the nucleic acid encoding the RNA-inducing nuclease is mRNA. In certain embodiments, the mRNA encoding the RNA-inducing nuclease may have one or more (e.g., all) characteristics, such as being capped, polyadenylated, and substituted with 5-methylcytidine and / or pseudouridine.

[0132] Synthetic nucleic acid sequences can also be codon-optimized, for example, by replacing at least one uncommon or less common codon with a common codon. For example, synthetic nucleic acids can induce the synthesis of optimized messenger mRNA, optimized for expression in mammalian expression systems as described herein. An example of a codon-optimized Cas9 coding sequence is presented in Cotta-Ramusino.

[0133] Furthermore, or alternatively, the nucleic acid encoding the RNA-induced nuclease may include a nucleic acid encoding a nuclear localization sequence (NLS), which is known in the art.

[0134] Functional analysis of candidate molecules Candidate RNA-induced nucleases, gRNAs, and their complexes can be evaluated by standard methods known in the art. See, for example, Cotta-Ramusino. The stability of the RNP complex may be evaluated by differential scanning fluorescence quantification as described below.

[0135] Differential scanning fluorescence (DSF) The thermal stability of ribonucleoprotein (RNP) complexes comprising gRNA and RNA-induced nucleases can be measured by DSF. DSF technology measures the thermal stability of proteins, which can be increased under favorable conditions, such as the addition of binding RNA molecules like gRNA.

[0136] DSF assays can be performed according to any suitable protocol, but are not limited to, (a) testing different conditions (e.g., different stoichiometric ratios of gRNA:RNA-induced nuclease proteins, different buffers, etc.) to identify optimal conditions for RNP formation; and (b) testing modifications of RNA-induced nucleases and / or gRNAs (e.g., chemical modifications, sequence alterations, etc.) to identify modifications that improve RNP formation or stability. One reading of a DSF assay is the change in melting temperature of the RNP complex; a relatively high change suggests that the RNP complex is more stable (and therefore may have greater activity, or more favorable formation kinetics, degradation kinetics, or other functional properties) compared to a standard RNP complex characterized by a lower change. When a DSF assay is deployed as a screening tool, a threshold melting temperature change may also be identified, thereby the result being one or more RNPs with a melting temperature change above the threshold. For example, the threshold could be 5-10°C (e.g., 5°C, 6°C, 7°C, 8°C, 9°C, 10°C) or higher, and the result could be one or more RNPs characterized by a change in melting temperature above the threshold.

[0137] Two non-limiting examples of DSF assay conditions are as follows: To determine the best solution for RNP complex formation, dispense a fixed concentration (e.g., 2 μM) of RNA-inducing nuclease (e.g., Cas9 or Cas12a) + 10 × SYPRO Orange® (Life Technologies, catalog no. S-6650) in water into a 384-well plate. Next, add equimolar amounts of gRNA diluted in solutions of various pH and salt concentrations. Incubate at room temperature for 10 minutes, then centrifuge briefly to remove any bubbles. After incubation, run a gradient from 20°C to 90°C in 1°C increments every 10 seconds using a Bio-Rad CFX384® Real-Time System C1000 Touch® Thermal Cycler with Bio-Rad CFX Manager software.

[0138] The second assay involves mixing gRNA at various concentrations with a fixed concentration (e.g., 2 μM) of RNA-inducing nuclease (e.g., Cas9 or Cas12a) in the optimal buffer from assay 1 above, and incubating it in a 384-well plate (e.g., at room temperature for 10 minutes). Equivolutes of optimal buffer + 10 × SYPRO Orange® (Life Technologies, catalog no. S-6650) are added, and the plate is sealed with Microseal® B adhesive (MSB-1001). After briefly centrifugating to remove any bubbles, a gradient is run from 20°C to 90°C in increments of 1°C every 10 seconds using a Bio-Rad CFX384® real-time system C1000 Touch® thermal cycler with Bio-Rad CFX Manager software.

[0139] Genome editing strategies Using the genome editing systems described above, editing (i.e., modification) is performed in cells or within target regions of DNA obtained from cells, in various embodiments of this disclosure. Various strategies for performing specific edits are described herein, and these strategies are generally described by the desired repair outcome, the number and location of individual edits (e.g., SSBs or DSBs), and the target sites of such edits.

[0140] Genome editing strategies involving the formation of SSBs or DSBs are characterized by repair outcomes including (a) deletion of all or part of the target region; (b) insertion or substitution within all or part of the target region; or (c) interruption of all or part of the target region. This grouping is provided solely for economics of presentation and is not intended to limit or be bound by any particular theory or model. Those skilled in the art will understand that the listed outcomes are not mutually exclusive and that some repairs may result in others. Descriptions of particular editing strategies or methods should not be understood as requiring a particular repair outcome unless otherwise specified.

[0141] Target region substitution generally involves the substitution of all or part of a sequence present within the target region by homologous sequences, through, for example, gene modification or gene conversion, which are two repair outcomes mediated by the HDR pathway. HDR is facilitated by the use of donor templates, which may be single-stranded or double-stranded, as described in more detail below. Single-stranded or double-stranded templates may be exogenous, in which case they facilitate gene modification, or they may be endogenous (e.g., homologous sequences in the cellular genome), facilitating gene conversion. Exogenous templates may have asymmetric overhangs, as described, for example, by Richardson et al. (Nature Biotechnology 34, 339-344 (2016), (Richardson), referenced) (i.e., the portion of the template complementary to the DSB site may be offset in the 3' or 5' direction rather than being centered within the template). If the template is a single strand, it can correspond to either the complementary (upper) or non-complementary (lower) strand of the target region.

[0142] As described by Ran and Cotta-Ramusino, gene transformation and gene modification are sometimes facilitated by forming one or more nicks within or around the target region. In some cases, a double nicking strategy is used to form two offset SSBs, which are then formed into a single DSB with an overhang (e.g., a 5' overhang).

[0143] Interruption and / or deletion of all or part of a target sequence can be achieved by various repair outcomes. For example, as described by Maeder for the LCA10 mutation, a sequence can be deleted by simultaneously generating two or more double-strand breaks (DSBs) flanking the target region, which are then excised when the DSBs are repaired. Alternatively, a sequence can be interrupted by the formation of a double-strand break with a single-strand overhang, followed by deletion generated by the subsequent hydrolytic processing of the nucleotide terminals of the pre-repair overhang.

[0144] One particular subset of target sequence interruptions is mediated by the formation of indels in the target sequence, in which repair outcomes are typically mediated by the NHEJ pathway (including Alt-NHEJ). NHEJ is referred to as the “error-prone” repair pathway due to its association with indel mutations. However, in some cases, DSBs are repaired by NHEJ without alteration of the surrounding sequence (so-called “perfect” or “scarless” repair); this generally requires both ends of the DSB to be completely ligated. Indels, on the other hand, are thought to arise from the enzymatic processing of free DNA ends before they are ligated, which adds and / or removes nucleotides from one or both strands of one or both free ends.

[0145] Since the enzymatic processing of free DSB ends can be inherently probabilistic, indel mutations tend to be variable, occurring along distributions and influenced by various factors, including specific target sites, cell types used, and genome editing strategies employed. Nevertheless, it is possible to generalize to a limited extent about indel formation: deletions formed by the repair of a single DSB are most commonly in the range of 1–50 bp, but can exceed 100–200 bp. Insertions formed by the repair of a single DSB tend to be shorter and often contain short duplications of sequences directly surrounding the cleavage site. However, large insertions are possible, and in these cases, the inserted sequence is often traced back to other regions of the genome or plasmid DNA present within the cell.

[0146] Indel mutations, and genome editing systems configured to generate indels, are useful for interrupting target sequences, for example, when the generation of a specific final sequence is not required and / or when frameshift mutations are tolerable. They may also be useful in situations where a particular sequence is preferred, insofar as the desired specific sequence tends to preferentially arise from the repair of SSBs or DSBs at a given site. Indel mutations are also a useful tool for evaluating or screening the activity of specific genome editing systems and their components. In these and other settings, indels may be characterized by (a) their relative and absolute frequencies in the genome of the cell in contact with the genome editing system, and (b) a distribution of numerical differences, such as ±1, ±2, ±3, relative to the unedited sequence. As an example, in a read discovery setting, multiple gRNAs may be screened to identify the gRNA that most efficiently promotes cleavage at the target site based on indel readings under controlled conditions. Guides that generate indels above a threshold frequency, or guides that generate a specific distribution of indels, may be selected for further research and development. The frequency and distribution of indels may also be useful as reads for evaluating different genome editing system implementations or formulation and delivery methods, for example, by keeping the gRNA constant while varying other specific reaction conditions or delivery methods.

[0147] Multiple strategies While the exemplary strategies described above focus on repair outcomes mediated by a single DSB, the genome editing systems of this disclosure may be used to generate two or more DSBs at either the same locus or different loci. Editing strategies involving the formation of multiple DSBs, or SSBs, are described, for example, by Cotta-Ramusino.

[0148] In certain embodiments, the Disclosure provides isolated T cells or T cell populations in which two or more endogenous genes of T cells have been modified, for example, by disruption. In certain embodiments, such modifications are introduced into the T cells or T cell populations by one or more genome editing systems described herein. In certain embodiments, the Invention relates to the use of a genome editing system for editing a targeted CD70 target nucleic acid sequence and one or more additional endogenous genes of T cells. For example, the additional endogenous genes may be selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, and any combination thereof. For example, but not limited to, multiple modifications within the T cell genome may be generated by the delivery of two or more complexes comprising RNA-induced nucleases (e.g., Cas9 and / or Cas12a) and gRNA molecules (e.g., RNP complexes) that target the CD70 gene sequence and one or more of the FAS gene sequence, BID gene sequence, CTLA4 gene sequence, PDCD1 gene sequence, CBLB gene sequence, PTPN6 gene sequence, B2M gene sequence, TRAC gene sequence, CIITA gene sequence, TRBC gene sequence, or a combination thereof. For example, but not limited to, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten complexes, e.g., RNP complexes, may be delivered, each complex targeting a different gene. In certain embodiments, the gRNA may be complementary to either strand of the targeted gene. In certain embodiments, the gRNA molecule may target a regulatory region, intron, or exon of the targeted gene. In certain embodiments, the genome editing system comprises a gRNA complementary to the CD70 target nucleic acid sequence and a gRNA complementary to the target nucleic acid sequence of one or more additional endogenous genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, and combinations thereof. In certain embodiments, the gRNA may be complementary to either strand of the additional endogenous gene. In certain embodiments, the targeting region of the additional endogenous gene is located within the coding sequence of the additional endogenous gene.In certain embodiments, the targeting region of the additional endogenous gene is located within an exon. In certain embodiments, the targeting region of the additional endogenous gene is located within an intron. In certain embodiments, the targeting region of the additional endogenous gene is located within a regulatory region of the gene. In certain embodiments, two or more sequences of the additional endogenous gene are targeted, and the targeting region of the additional endogenous gene is located within one or more exons, one or more introns, one or more regulatory regions, or within one or more exons, one or more introns and one or more regulatory regions. In certain embodiments, the sequences of one or more gRNAs that target the additional endogenous gene, or the target DNA sequences of one or more additional endogenous genes, are described in their entirety in International Publication No. 2019 / 118516 or National International Publication No. 2015 / 161276, which are incorporated herein by reference.

[0149] Donor mold design Donor template design is described in detail in literature such as Cotta-Ramusino. DNA oligomer donor templates (oligodeoxynucleotides or ODNs), which can be single-stranded (ssODN) or double-stranded (dsODN), can be used to facilitate HDR-based repair of DSBs, and are particularly useful for introducing modifications to a target DNA sequence, inserting a new sequence into the target sequence, or completely replacing the target sequence.

[0150] Whether single-stranded or double-stranded, the donor template generally includes regions homologous to the DNA region in or near the target sequence to be cleaved (e.g., lateral or adjacent). These homologous regions are referred to herein as “homology arms” and are schematically shown below. [5' homology arm]--[substitution sequence]--[3' homology arm]

[0151] Homology arms can have any appropriate length (including none if only one homology arm is used), and the 3' and 5' homology arms may have the same length or different lengths. The selection of appropriate homology arm lengths may be influenced by various factors, such as the desire to avoid homology or microhomology with specific sequences, such as Alu repeats or other elements. For example, the 5' homology arm may be shortened to avoid sequence repeats. In other embodiments, the 3' homology arm may be shortened to avoid sequence repeats. In certain embodiments, both the 5' and 3' homology arms may be shortened to avoid inclusion of specific sequence repeats. Furthermore, some homology arm designs may improve editing efficiency or increase the frequency of desired repair results. For example, Richardson et al., Nature Biotechnology 34,339-344 (2016) (Richardson), cited by reference, found that the relative asymmetry of the 3' and 5' homology arms of a single-stranded donor template affects the repair rate and / or outcome.

[0152] Substitution sequences in donor templates have been described elsewhere, including by Cotta-Ramusino et al. Substitution sequences can be of any appropriate length (including none if the desired repair outcome is a deletion) and typically involve one, two, three or more sequence modifications to the native intracellular sequence to be edited. One exemplary sequence modification involves altering the native sequence to repair mutations associated with the disease or condition to be treated. Another exemplary sequence modification involves altering one or more sequences that are complementary to or encode the PAM sequence of an RNA-induced nuclease or the targeting domain of a gRNA used to generate an SSB or DSB, thereby reducing or eliminating repeat breaks at the target site after the substitution sequence has been incorporated into the target site.

[0153] When a linear ssODN is used, it may be configured to (i) anneal to the nicked strand of the target nucleic acid, (ii) anneal to the intact target nucleic acid strand, (iii) anneal to the positive strand of the target nucleic acid, and / or (iv) anneal to the negative strand of the target nucleic acid. The ssODN may have any suitable length, such as about, at least, or 150-200 nucleotides or less (e.g., 150, 160, 170, 180, 190, or 200 nucleotides).

[0154] It should be noted that the template nucleic acid may also be a nucleic acid vector, such as a viral genome, or a circular double-stranded DNA, such as a plasmid. A nucleic acid vector comprising a donor template may contain other coding or non-coding elements. For example, the template nucleic acid may be delivered as part of a viral genome (e.g., in an AAV or lentiviral genome), containing specific genomic backbone elements (e.g., reverse terminal repeats in the case of an AAV genome) and optionally containing additional sequences encoding gRNA and / or RNA-induced nucleases. In certain embodiments, the donor template may be adjacent to or sandwiched between target sites recognized by one or more gRNAs, facilitating the formation of free DSBs at one or both ends of the donor template, which may be involved in the repair of corresponding SSBs or DSBs formed in cellular DNA using the same gRNA. Exemplary nucleic acid vectors suitable for use as donor templates are described by Cotta-Ramusino.

[0155] Regardless of the form used, the template nucleic acid may be designed to avoid undesirable sequences. In certain embodiments, one or both homology arms may be shortened to avoid overlap with certain sequence repeat elements, such as Alu repeats or LINE elements.

[0156] Quantitative measurement of on-target and off-target gene editing It should be noted that the genome editing systems described herein enable the detection and quantitative measurement of on-target and off-target gene editing results. The compositions and methods described herein may rely on the use of PCR primer sequences to amplify genomic loci comprising the expected cleavage site of an RNA-induced nuclease. In some embodiments, the primers include an adapter tail for use in a two-step PCR amplification process for preparing an amplicon library for next-generation sequencing (NGS) analysis. Table 8 shows non-limiting examples of primers and amplification sites for evaluating the on-target genome editing efficiency of the CD70 target site described in [SEQ ID NO: 27].

[0157] [Table 10]

[0158] In certain embodiments, the RNPs disclosed herein have minimal or no off-target effects. In certain embodiments, the off-target effects of the RNPs are measured by Digenome-seq analysis (Kim et al., Nature Methods (2015); 12:237-243). In certain embodiments, the off-target effects of the RNA are indicated by the number of off-targets measured by Digenome-seq analysis. In certain embodiments, the number of off-targets is measured by Digenome-seq analysis with 1000 nM of RNP. In certain embodiments, the number of off-targets is measured by Digenome-seq analysis with 100 nM of RNP.

[0159] In certain embodiments, the number of off-target RNPs disclosed herein, measured by Digenome-seq at 1000 nM, is less than about 20, less than about 19, less than about 18, less than about 17, less than about 16, less than about 15, less than about 14, less than about 13, less than about 12, less than about 11, less than about 10, less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, less than about 4, less than about 3, about 2, or less than 1. In certain embodiments, the number of off-target RNPs disclosed herein, measured by Digenome-seq at 1000 nM, is zero or nearly zero. In certain embodiments, the number of off-target RNPs disclosed herein, measured by Digenome-seq at 100 nM, is less than about 20, less than about 19, less than about 18, less than about 17, less than about 16, less than about 15, less than about 14, less than about 13, less than about 12, less than about 11, less than about 10, less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, less than about 4, less than about 3, about 2, or less than 1. In certain embodiments, the number of off-target RNPs disclosed herein, measured by Digenome-seq at 100 nM, is zero or nearly zero.

[0160] In some embodiments, quantitative methods for evaluating on-target and off-target sites involve incorporating exogenous double-stranded oligonucleotide (dsODN) tags into the genome. For example, GUIDE-Seq (whose entire contents are incorporated herein by reference, Tsai et al., 2016; Tsai et al., 2014; Tycko et., 2016) describes compositions and methods that enable quantitative analysis of off-target and on-target gene editing results by integrating dsODNs into RNA-induced nuclease (RGN)-induced double-strand breaks (DSBs). In some embodiments, the dsODN tag is a 34 bp blunt-ended, 5'-phosphorylated, phosphorothioate-linked polynucleotide that is incorporated into the double-strand break. The dsODN tag contains a priming site that enables amplification, sequencing, and discovery of the RGN-induced double-strand break. Non-limiting examples of dsODN tags and primers are shown in Table 9.

[0161] [Table 11]

[0162] Implementation of genome editing systems: delivery, formulation, and administration routes. As discussed above, the genome editing systems of this disclosure can be implemented in any suitable manner, meaning that the components of the system, including but not limited to RNA-induced nucleases, gRNAs, and any donor template nucleic acids, can be delivered, formulated, or administered in any suitable form or combination of forms that results in the transduction, expression, or introduction of the genome editing system, and / or cause the desired repair outcome in a cell, tissue, or subject. The genome editing systems of this disclosure can incorporate multiple gRNAs, multiple RNA-induced nucleases, and other components such as proteins, and various implementations will be apparent to those skilled in the art based on the principles shown in the systems of this disclosure. In some embodiments, the genome editing systems of this disclosure are delivered to cells as ribonucleoprotein (RNP) complexes. In some embodiments, one or more RNP complexes are delivered to cells sequentially or simultaneously in any order. Tables 10 and 11 show some non-exclusive implementations of the genome editing systems. However, those skilled in the art will understand that these lists are not exhaustive and that other implementations are possible. Referring particularly to Table 10, the table lists several exemplary implementations of a genome editing system comprising a single gRNA and an optional donor template. However, the genome editing system according to this disclosure may incorporate multiple gRNAs, multiple RNA-inducible nucleases, and other components such as proteins, and various implementations will be apparent to those skilled in the art based on the principles shown in the table. [N / A] in the table indicates that the genome editing system does not contain the relevant component.

[0163] [Table 12]

[0164] Table 10 summarizes the various delivery methods for the components of the genome editing systems described herein. Again, this list is intended to be illustrative and not exhaustive.

[0165] [Table 13]

[0166] [Table 14]

[0167] Delivery of nucleic acid-based genome editing systems Nucleic acids encoding various elements of the genome editing systems of this disclosure can be administered to a subject or delivered to cells by methods known in the art or as described herein. For example, RNA-induced nuclease codes and / or gRNA-encoded DNA, as well as donor template nucleic acids, can be delivered, for example, by vectors (e.g., viral vectors or non-viral vectors), non-vector-based methods (e.g., using naked DNA or DNA complexes), or a combination thereof. In some embodiments, the genome editing systems of this disclosure are delivered by AAV.

[0168] The nucleic acids encoding the genome editing system or its components may be delivered directly to cells as naked DNA or RNA by means such as translocation or electroporation, or they may be conjugated to molecules that promote uptake by target cells (e.g., erythrocytes, HSCs, T cells) (e.g., N-acetylgalactosamine). Nucleic acid vectors, such as those summarized in Table 11, may also be used. In some embodiments, the genome editing system of this disclosure is delivered into cells by electroporation.

[0169] One approach to the cell therapy process involves the direct delivery of active proteins into human cells. Feldan Shuttle, a protein delivery agent, is a protein-based delivery agent designed for cell therapy (Del'Guidice et al., PLoSOne. 2018 Apr 4; 13(4):e0195558; the entire article is incorporated herein by reference). In some embodiments, the genome editing systems of this disclosure are delivered into cells by Feldan Shuttle.

[0170] A nucleic acid vector may comprise one or more sequences encoding genome editing system components such as RNA-induced nucleases, gRNAs, and / or donor templates. The vector may also comprise sequences encoding signal peptides (e.g., nuclear, nucleolar, or mitochondrial localization) associated with (e.g., inserted or fused to) protein-coding sequences. As an example, a nucleic acid vector may comprise an RNA-induced nuclease (e.g., Cas9 or Cas12a) encoding sequence containing one or more nuclear localization sequences (e.g., nuclear localization sequences from SV40).

[0171] Nucleic acid vectors may also contain a suitable number of regulatory elements, such as promoters, enhancers, introns, polyadenylation signals, Kozak consensus sequences, or internal ribosome entry sites (IRESs). These elements are publicly known in the art and have been described by Cotta-Ramusino.

[0172] Nucleic acid vectors as provided in this disclosure include recombinant viral vectors. Exemplary viral vectors are shown in Table 11, and additional suitable viral vectors and their use and generation are described in Cotta-Ramusino. Other viral vectors known in the art may also be used. Furthermore, viral particles may be used to deliver components of genome editing systems in the form of nucleic acids and / or peptides. For example, “empty” viral particles may be assembled to contain any suitable cargo. Viral vectors and viral particles may also be manipulated to incorporate targeted ligands in order to alter target tissue specificity.

[0173] In addition to viral vectors, nonviral vectors may also be used to deliver nucleic acids encoding genome editing systems in accordance with this disclosure. One important category of nonviral nucleic acid vectors is nanoparticles, which may be organic or inorganic nanoparticles. Nanoparticles are well known in the art and summarized by Cotta-Ramusino. Using any suitable nanoparticle design, genome editing system components or nucleic acids encoding such components may be delivered. For example, organic (e.g., lipids and / or polymers) nanoparticles may be suitable for use as delivery vehicles in certain embodiments of this disclosure. Exemplary lipids used in nanoparticle formulations and / or gene transfer are shown in Table 12, and exemplary polymers used in gene transfer and / or nanoparticle formulations are listed in Table 13.

[0174] [Table 15]

[0175] [Table 16]

[0176] [Table 17]

[0177] [Table 18]

[0178] [Table 19]

[0179] Nonviral vectors optionally contain targeted modifications to improve uptake and / or selectively target specific cell types. These targeted modifications include, for example, cell-specific antigens, monoclonal antibodies, single-chain antibodies, aptamers, polymers, sugars (e.g., N-acetylgalactosamine (GalNAc)), and cell-permeable peptides. Such vectors may also optionally utilize fusion-inducible and endosomal destabilizing peptides / polymers that undergo acid-induced structural changes (e.g., to accelerate endosomal leakage of cargo) and / or incorporate stimulus-cleavable polymers for release in cellular compartments. For example, disulfide-based cationic polymers cleaved in a reducing cellular environment may be used.

[0180] In certain embodiments, one or more nucleic acid molecules (e.g., DNA molecules) other than the genome editing system components, such as the RNA-induced nuclease components and / or gRNA components described herein, are delivered. In certain embodiments, the nucleic acid molecules are delivered simultaneously with one or more components of the genome editing system. In certain embodiments, the nucleic acid molecules are delivered before or after one or more components of the genome editing system are delivered (e.g., about 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 9 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 2 weeks, or less than 4 weeks). In certain embodiments, the nucleic acid molecules are delivered by means different from those used to deliver one or more components of the genome editing system, such as the RNA-induced nuclease components and / or gRNA components. The nucleic acid molecules may be delivered by any of the delivery methods described herein. For example, nucleic acid molecules may be delivered by viral vectors such as integration-deficient lentiviruses, and RNA-induced nuclease molecular components and / or gRNA components may be delivered, for example, by electroporation, thereby reducing the toxicity caused by nucleic acids (e.g., DNA). In certain embodiments, the nucleic acid molecule encodes a therapeutic protein, such as the protein described herein. In certain embodiments, the nucleic acid molecule encodes an RNA molecule, such as the RNA molecule described herein.

[0181] Delivery of RNPs and / or RNAs that encode genome editing system components. RNPs (complexes of gRNA and RNA-inducing nucleases) and / or RNA-inducing nucleases and / or RNA encoding gRNAs may be delivered to cells or administered to subjects by methods known in the art, as described by Cotta-Ramusino. In vitro, RNA-inducing nuclease-encoding RNAs and / or gRNA-encoding RNAs may be delivered, for example, by microinjection, electroporation, transient cell compression, or squeezing (see, e.g., Lee 2012). Lipid-mediated translocation, peptide-mediated delivery, GalNAc or other conjugate-mediated delivery, and combinations thereof may also be used for delivery in vitro and in vivo.

[0182] In vitro electroporation delivery involves mixing cells with RNA-inducing nucleases and / or gRNA-encoding RNA, with or without donor template nucleic acid molecules, in a cartridge, chamber, or cuvette, and applying one or more electrical impulses of a specified length and amplitude. Electroporation systems and protocols are known in the art, and any suitable electroporation tools and / or protocols may be used in connection with various embodiments of this disclosure.

[0183] In certain embodiments, the ribonucleoprotein (RNP) complex comprises a guide RNA and a Cas12a protein, including a modified Cas12a protein (AsCas12a mutant). Non-limiting examples of Cas12a proteins are described in SEQ ID NOs. 38-46 and SEQ ID NOs. 56. In certain embodiments, the RNP complex may also comprise a guide RNA (gRNA) complexed with a Cas12a protein or a modified Cas12a protein. In certain embodiments, the gRNA may comprise the sequences described in SEQ ID NOs. 28-31 or SEQ ID NOs. 32-35. In certain embodiments, the RNP complex may comprise the RNP complexes listed in Table 14. For example, the RNP complex may comprise a gRNA comprising the sequence described in SEQ ID NOs. 31 or 35, a modified Cas12a protein described in SEQ ID NOs. 42 or 56, and may target the CD70 gene with the sequence described in SEQ ID NOs. 27 or 55.

[0184] [Table 20]

[0185] target cell The genome editing systems described herein may be used to manipulate or modify target cells, for example, to edit or modify target nucleic acids. The manipulation may be performed in vivo or in vitro in various embodiments.

[0186] In certain embodiments, the target cells include editing of the target sequence of the CD70 gene. In certain embodiments, the target cells include an indel in the target sequence of the CD70 gene. In certain embodiments, the target cells include deletion of all or part of the target sequence of the CD70 gene. In certain embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% of the target cells that have come into contact with the genome editing system include an indel in the CD70 gene. The indel may be detected by any method known in the art, such as Illumina amplicon-based sequencing as described in Example 1 of this specification.

[0187] In certain embodiments, the proportion of target cells containing indels increases in a concentration-dependent manner in response to an increase in the concentration of the RNP complex.

[0188] In certain embodiments, the RNP complex induces indels in or near the target site of the CD70 gene at EC50 values ​​of less than approximately 20 nM, less than approximately 25 nM, less than approximately 30 nM, less than approximately 35 nM, less than approximately 40 nM, less than approximately 45 nM, less than approximately 50 nM, less than approximately 55 nM, less than approximately 60 nM, less than approximately 65 nM, less than approximately 70 nM, less than approximately 75 nM, less than approximately 80 nM, less than approximately 85 nM, less than approximately 90 nM, less than approximately 95 nM, and less than approximately 100 nM.

[0189] In certain embodiments, the level of the CD70 gene product in target cells is reduced compared to cells not in contact with the genome editing system. In certain embodiments, the CD70 gene product is mRNA. In certain embodiments, the CD70 gene product is a protein. In certain embodiments, the CD70 protein is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 100% in target cells that have been in contact with the genome editing system compared to cells that have not been in contact with the genome editing system. The amount of CD70 protein may be measured by any method known in the art, such as FACS as described in Example 1 herein.

[0190] In certain embodiments, the relative CD70 gene product decreases in a concentration-dependent manner as the concentration of the RNP complex increases. In certain embodiments, the level of the CD70 gene product decreases relative to the concentration of the RNP complex having an EC50 value of less than about 20 nM, less than about 25 nM, less than about 30 nM, less than about 35 nM, less than about 40 nM, less than about 45 nM, less than about 50 nM, less than about 55 nM, less than about 60 nM, less than about 65 nM, less than about 70 nM, less than about 75 nM, less than about 80 nM, less than about 85 nM, less than about 90 nM, less than about 95 nM, and less than about 100 nM.

[0191] In certain embodiments, target cells are immune cells such as T cells, CD8+ T cells (e.g., CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, α / β T cells, γ / δ T cells, natural killer T cells (NKT cells), regulatory T cells (Treg), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), or dendritic cells. In certain embodiments, target cells are iPS cells, or cells derived from iPS cells, such as induced pluripotent stem cells, which are generated from a subject, manipulated and modified (e.g., mutated), or whose expression of one or more target genes is manipulated, and which are differentiated into T cells such as CD8+ T cells (e.g., CD8+ unsensitized T cells, central memory T cells, or effector memory T cells), CD4+ T cells, stem cell memory T cells, lymphoid progenitor cells, or hematopoietic stem cells.

[0192] In certain embodiments, target cells are modified to contain specific T cell receptor (TCR) genes (e.g., TRAC and TRBC genes). In other embodiments, the TCR has binding specificity to tumor-associated antigens. In certain embodiments, the TCR is a genetically modified TCR.

[0193] In certain embodiments, the target cells are modified to contain a specific chimeric antigen receptor (CAR). In one embodiment, the CAR has binding specificity to a tumor-associated antigen.

[0194] In another embodiment, target cells are modified, for example, by a TCR or CAR to bind to a tumor antigen.

[0195] In certain embodiments, the target cells are subjected to genome editing that results in loss of CD70 function. While we do not wish to be constrained by any particular theory, CD70 is expressed in multiple tumor cell types and is known to be a therapeutic target for anti-CD70 CAR-T therapy. CD70 is expressed on activated T cells, and it is also known that unintended friendly fire can occur in T cells manipulated to express anti-CD70-based immunotherapy. Therefore, it is thought that inactivating CD70 in T cells containing anti-CD70 CAR or TCR would result in resistance to friendly fire in the T cells containing anti-CD70 CAR or TCR.

[0196] In some embodiments, the target cells are intended for use in treating diseases, disorders, or medical conditions such as tumors and / or cancer.

[0197] Provided herein are methods for administering the cells and compositions described herein; and the use of such cells and compositions for treating or preventing diseases, conditions, and disorders, including cancer. In some embodiments, the cells and compositions are administered to subjects or patients having a particular disease or condition, which is treated through adoptive cell therapy, such as adoptive T cell therapy. In some embodiments, following incubation and / or other processing steps, the cells and compositions prepared by the methods provided, such as the engineered compositions and final product compositions, are administered in therapeutically effective doses to subjects, such as subjects having or at risk of a disease or condition. In some embodiments, the methods thereby treat, for example, by reducing the tumor burden in cancer expressing an antigen recognized by the engineered T cells, or by relieving one or more symptoms of a disease or condition.

[0198] In some embodiments, cell therapies, such as adoptive T-cell therapy, are carried out by autologous transfer, in which cells are isolated from or prepared in another manner from a subject receiving cell therapy. Thus, in some embodiments, the cells originate from a subject in need of treatment, such as a patient, and the cells are administered to the same subject following isolation and processing.

[0199] In some embodiments, cell therapy, such as adoptive T-cell therapy, is carried out by allogeneic transfer, in which cells are isolated from and / or prepared in another manner from a subject other than the subject receiving or ultimately receiving the cell therapy, such as a first subject. In such embodiments, the cells are then administered to a different subject, such as a second subject of the same species. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0200] The diseases, conditions, and disorders treated by the compositions, cells, methods, and uses provided include tumors such as solid tumors, hematological malignancies, and melanoma; infectious diseases such as infections caused by viruses or other pathogens such as HIV, HCV, HBV, CMV; and parasitic diseases. In some embodiments, the disease or condition is a tumor, cancer, malignant tumor, neoplasm, or other proliferative disorder or disorder. Such diseases include, but are not limited to, leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, low-grade B-cell lymphoma, B-cell malignancies, colorectal cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer, and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing's sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma, and / or mesothelioma.

[0201] Cells may be administered, for example, by bolus injection, by injection such as intravenous or subcutaneous injection, intraocular injection, periorbital injection, subretinal injection, intravitreous injection, transseptal injection, subscleral injection, choroidal injection, anterior chamber injection, subconjunctival injection, subconjunctival injection, subtenon's capsule injection, retrobulbar injection, peribulbar injection, or by any suitable means such as delivery near the posterior sclera. In some embodiments, they are administered parenterally, intrapulmonaryly, intranasally, and, if desired, by local treatment, intralesional administration. Parenteral administrations include intramuscular, intravenous, intra-arterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus of cells. In some embodiments, it is administered, for example, by multiple bolus administrations of cells over a period of three days or less, or by continuous infusion of cells.

[0202] Exemplary Embodiments A1. The subject matter currently disclosed provides a genome editing system comprising (a) a gRNA molecule comprising a targeting domain that targets a target sequence of the CD70 gene, and (b) an RNA-induced nuclease, or a nucleic acid encoding an RNA-induced nuclease.

[0203] A2. A genome editing system described in A1, in which the target sequence of the CD70 gene is located in exon 2 of CD70.

[0204] A3. The genome editing system according to A1, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs. 24 to 27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs. 28 to 31.

[0205] A4. The genome editing system according to A2, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 and SEQ ID NO: 27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO: 31.

[0206] A5. A genome editing system according to any one of A1 to A4, wherein (a) the target sequence of the CD70 gene comprises the nucleotide sequence described in SEQ ID NO: 27; and / or (b) the targeting domain comprises the nucleotide sequence described in SEQ ID NO: 31.

[0207] A6. A genome editing system described in any one of A1 to A5, wherein the RNA-induced nuclease is selected from the group consisting of Cas9 (e.g., SpCas9, SaCas9, (KKH)SaCas9, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, evoCas9, SpCas9-NG, VRQR, VRR, NmeCas9, CjCas9), Cas12, Cas12a (also known as Cpf1; e.g., AsCas12a, LbCas12a), Cas12b (e.g., AaCas12b, BhCas12b, BhCas12b V4), Cas12cl, Cas12c2, Cas12hl, Cas12il, CasX, CasY, and CasΦ.

[0208] A7. A genome editing system described in any one of A1-A6, wherein the RNA-induced nuclease is the Cas12a protein.

[0209] A8. A genome editing system described in any one of A1-A7, wherein the Cas12a protein is a modified Cas12a protein.

[0210] A9. A genome editing system described in any one of A1-A8, in which the modified Cas12a protein is an activity-enhancing Cas12a protein.

[0211] A10. A genome editing system according to any one of A1 to A9, wherein the RNA-inducing nuclease comprises an amino acid sequence selected from the group consisting of SEQ ID NOs. 38-46 and SEQ ID NO. 56.

[0212] A11. A genome editing system according to any one of A1 to A10, wherein the RNA-induced nuclease comprises the amino acid sequence described in SEQ ID NO: 42 or SEQ ID NO: 56.

[0213] A12. A genome editing system described in any one of A1 to A11, wherein the gRNA molecule further contains a Cas12a stem-loop.

[0214] A13. A genome editing system according to any one of A1 to A12, wherein the gRNA molecule further contains nucleotide elongations, the nucleotide elongations being 5' elongations, 3' elongations, or a combination thereof.

[0215] A14. A genome editing system according to any one of A1 to A13, wherein nucleotide elongation comprises one or more RNA bases, one or more DNA bases, or a combination thereof.

[0216] A15. A genome editing system according to any one of A1 to A14, wherein the gRNA molecule contains one or more modified bases.

[0217] A16. A genome editing system according to any one of A13 to A15, wherein the nucleotide elongation is a 5' elongation comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 23.

[0218] A17. A genome editing system according to any one of A1 to A16, wherein the extension is a 5' extension comprising the nucleotide sequence described in Sequence ID No. 7.

[0219] A18. A genome editing system according to any one of A1 to A17, comprising a DNA / RNA oligonucleotide in which a gRNA molecule contains a nucleotide sequence selected from the group consisting of SEQ ID NOs. 32 to 35.

[0220] A19. A genome editing system according to any one of A1 to A18, wherein the gRNA molecule comprises the nucleotide sequence described in SEQ ID NO: 68, SEQ ID NO: 97, or SEQ ID NO: 112.

[0221] B1. The subject matter currently disclosed provides a ribonucleoprotein (RNP) complex comprising a genome editing system described in any one of A1 to A19.

[0222] C1. The subject matter currently disclosed provides a vector for delivering a genome editing system described in any one of A1 to A19, wherein the vector comprises DNA encoding a gRNA molecule and / or an RNA-induced nuclease, RNA encoding a gRNA molecule and / or an RNA-induced nuclease, or a combination thereof.

[0223] D1. The subject matter currently disclosed provides a method for editing the CD70 gene in target cells, comprising contacting the target cells with a genome editing system described in any one of A1 to A19, an RNP complex of B1, or a vector of C1.

[0224] E1. The subject matter currently disclosed provides cells comprising a genome editing system described in any one of A1 to A19, an RNP complex of B1, or a vector of C1.

[0225] E2. Cells in which the level of the CD70 gene product within the cell is reduced compared to cells lacking any of the genome editing systems described in A1-A19, the RNP complex of B1, or the vector of C1.

[0226] Cells described in any one of E1 to E2, comprising an indel in the target sequence of E3.CD70

[0227] F1. The subject matter currently disclosed provides cells comprising one or more genome edits of the CD70 gene, wherein the cells are edited by the method of D1.

[0228] F2. The cell according to F1, wherein one or more genome edits include indels within the target sequence of the CD70 gene.

[0229] F3. The cell according to F2, wherein the indel contains a deletion of all or part of the target sequence of the CD70 gene.

[0230] F4. Cells that are T cells, as described in F1-F3.

[0231] F5. T cells are α / β T cells, as described in F4.

[0232] F6. A cell described in any one of F1 to F4, further comprising a chimeric antigen receptor (CAR).

[0233] F7.CAR binds to the tumor antigen; these are the cells described in F6.

[0234] G1. The subject matter currently disclosed provides a composition comprising a population of genetically modified cells comprising an indel in the target sequence of the CD70 gene, wherein the target sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs. 24-27 and SEQ ID NO. 55.

[0235] G2. The composition according to G1, wherein the level of the CD70 gene product in the cell population is reduced compared to the non-genetically modified cell population.

[0236] G3. The composition according to G1 or G2, wherein the genetically modified cell is a T cell.

[0237] The composition described in F3, wherein the G4 T cells are α / β T cells.

[0238] H1. The presently disclosed subject matter provides a method of treating a disease or disorder, comprising administering to a subject in need thereof a genome editing system as described in any one of A1 to A19, an RNP of B1, a vector of C1, a cell as described in any one of E1 to E3, a cell as described in any one of F1 to F7, or a composition as described in any one of G1 to G4.

[0239] H2. The method according to H1, wherein the disease or disorder is a tumor, cancer, malignant tumor, neoplasm, or other proliferative disease or disorder.

[0240] H3. The method according to H1 or H2, wherein the disease or disorder is selected from the group consisting of leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, low-grade B-cell lymphoma, B-cell malignancy, colorectal cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer, and brain cancer, ovarian cancer, epithelial cancer, renal cell cancer, pancreatic cancer, Hodgkin lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma, and / or mesothelioma.

[0241] I1. The presently disclosed subject matter provides a gRNA molecule comprising a targeting domain that targets a target sequence of the CD70 gene.

[0242] I2. The gRNA molecule according to I1, wherein the target sequence of the CD70 gene is in exon 2 of CD70.

[0243] I3. (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24 to 27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 28 to 31. The gRNA molecule according to I1 or I2.

[0244] I4. The gRNA molecule according to I1, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 or SEQ ID NO: 27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 or SEQ ID NO: 31.

[0245] I5. A gRNA molecule according to any one of I1 to I4, wherein (a) the target sequence of the CD70 gene comprises the nucleotide sequence described in SEQ ID NO: 27; and / or (b) the targeting domain comprises the nucleotide sequence described in SEQ ID NO: 31. [Examples]

[0246] The following examples are for illustrative purposes only and are not intended to limit the scope or content of the present invention in any way.

[0247] Example 1: CD70-targeted RNP complex Using in-house bioinformatics tools, we identified guide RNAs (gRNAs) that target the CD70 gene located on chromosome 19. In short, we used CALITAS (CRISPR-Cas-aware Aligner for In silico off-TargetSearch; Fennell et al., 2021) to identify AsCas12a-compatible T-rich protospacer adjacency motif (PAM) sites within the CD70 gene. The program identified all 21-nucleotide target sequences with corresponding PAM sites and filtered them to include only those within exons 1-3 of the CD70 transcript (ENST00000245903). Sequences with single-nucleotide mismatches or gaps were also excluded, and selection was based on the uniqueness of genomic sites with complete single-nucleotide matches. A list of identified target regions is shown in Table 4 (N=4).

[0248] Targeting domains targeting four identified target sequences were synthesized and assembled into crisprRNA (crRNA) sequences by extending a 25-nucleotide DNA as described in [SEQ ID NO: 7] and adding a 20-nucleotide 5' stem-loop scaffold sequence as described in [SEQ ID NO: 36] from 5' to 3'. The resulting 66-nucleotide DNA and RNA oligonucleotides described in [SEQ ID NO: 32-35] were then complexed with the AsCas12a protein described in [SEQ ID NO: 42] to produce ribonucleoproteins (RNPs) shown in Table 15. The resulting ribonucleoprotein complexes (RNPs) were prepared at a gRNA to AsCas12a ratio of 2:1 at 88 μM. RNP1, RNP2, RNP2, and RNP4 were serially diluted in equal volumes of Buffer 1 (10 mM HEPES pH 7.5, 150 mM NaCl) and Buffer 2 (10 mM HEPES pH 7.5, 300 mM NaCl, 20% glycerol, 10 mM TCEP) and transfused into CD4+ and CD8+ T cells by electroporation (Lonza). The cells were incubated at 37°C and 5% CO2 for 96 hours, and genomic DNA was extracted and evaluated by next-generation sequencing (NGS) analysis. Genomic DNA was isolated using the Agencourt DNAdvance kit (Beckman Coulter, Inc.) according to the manufacturer's instructions, quantified using the fluorescence quantitative Quant-IT Pico Green dsDNA Assay Kit (ThermoFisher Scientific), and genome editing rates were determined by NGS analysis of PCR amplicons containing the expected cleavage sites. Amplicon libraries for sequencing were prepared using a two-step PCR amplification process, and the PCR primers and amplification sites are shown in Table 8. Editing, measured by Illumina amplicon-based sequencing, is shown as a function of concentration in Figure 1. The editing rate was determined using the percentage of sequence reads containing ±15 bases from the expected cleavage site indel. The EC50 values ​​of the concentration response were calculated from fitting four parametric logistic regression curves, as shown in Table 15.

[0249] [Table 21]

[0250] RNP4 was further evaluated in CD4+ and CD8+ T cells from multiple donors to determine CD70 gene editing efficiency and concentration-dependent CD70 protein knockdown. To induce endogenous CD70 expression, CD4+ and CD8+ T cells were stimulated with CD3 / CD28-binding beads and cultured with IL2, IL7, and IL15. Next, the cells were electroporated with various concentrations of RNP4 by nucleotide transduction (Lonza) and re-stimulated after 72 hours in a medium containing CD3 / CD28-binding beads. Genomic DNA was extracted 96 hours after incubation, and the RNP4 concentration-dependent genome editing rate was determined by NGS analysis of PCR amplicons containing the expected cleavage sites as described above. Editing efficiency (e.g., percentage of sequence reads with indel ± 15 bases) is shown in the upper panel of Figure 2. RNP4 concentration-dependent CD70 protein knockdown was determined by FACS analysis of CD70 surface staining (Figure 2, bottom). Table 16 shows the editing rates and EC50 values ​​for protein inhibition. The concentration-response curves shown in Figure 2 were fitted to a four-parametric logistic regression equation. These results indicate that the editing activity of RNP4 increases in a concentration-dependent manner, and that editing reduces the cell surface expression of the CD70 protein. Furthermore, this response is consistent in CD4+ T cells and CD8+ T cells from the same donor, as well as in CD4+ T cells from three different donors. Therefore, RNP4 can edit and knock out the CD70 gene in human cells.

[0251] [Table 22]

[0252] Reference All documents, patents, and patent applications referenced throughout this specification are incorporated herein by reference in their entirety, as if each individual publication, patent, or patent application were specifically and individually indicated to be invoked by reference. In the event of any conflict, this application shall prevail, including any definitions herein.

[0253] Equal portions Those skilled in the art will recognize numerous equivalents of the specific embodiments described herein, or can confirm them through routine experimentation alone. Such equivalents are intended to be covered by the following claims.

Claims

1. (a) A gRNA molecule comprising a targeting domain that targets the target sequence of the CD70 gene, and (b) RNA-induced nuclease, or nucleic acid encoding the RNA-induced nuclease A genome editing system comprising [a specific component].

2. The genome editing system according to claim 1, wherein the target sequence of the CD70 gene is located in exon 2 of CD70.

3. (a) The target sequence of the CD70 gene comprises a nucleod sequence selected from the group consisting of SEQ ID NOs: 24-27; and / or (b) The genome editing system according to claim 1, wherein the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 28 to 31.

4. (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 and SEQ ID NO: 27; and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO: 31, The genome editing system according to claim 2.

5. (a) The target sequence of the CD70 gene comprises the nucleotide sequence described in Sequence ID No. 27; and / or (b) The genome editing system according to any one of claims 1 to 4, wherein the targeting domain comprises the nucleotide sequence described in SEQ ID NO:

31.

6. The RNA-inducing nucleases include Cas9 (e.g., SpCas9, SaCas9, (KKH)SaCas9, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9), Cas12, Cas12a (also known as Cpf1; e.g., AsCas12a, LbCas12a), and Cas12b (e.g., AaCas12b, BhCas12b, BhCas12b). A genome editing system according to any one of claims 1 to 5, comprising a selected molecule from the group consisting of Cas12cl, Cas12c2, Cas12hl, Cas12il, CasX, CasY, and CasΦ.

7. The genome editing system according to any one of claims 1 to 6, wherein the RNA-induced nuclease is the Cas12a protein.

8. The genome editing system according to any one of claims 1 to 7, wherein the Cas12a protein is a modified Cas12a protein.

9. The genome editing system according to any one of claims 1 to 8, wherein the modified Cas12a protein is an activity-enhancing Cas12a protein.

10. The genome editing system according to any one of claims 1 to 9, wherein the RNA-inducing nuclease comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38 to 46 and SEQ ID NO:

56.

11. The genome editing system according to any one of claims 1 to 9, wherein the RNA-inducing nuclease comprises the amino acid sequence described in SEQ ID NO: 42 or SEQ ID NO:

56.

12. The genome editing system according to any one of claims 1 to 11, wherein the gRNA molecule further comprises a Cas12a stem loop.

13. The genome editing system according to any one of claims 1 to 12, wherein the gRNA molecule further comprises nucleotide elongations, and the nucleotide elongations are 5' elongations, 3' elongations, or a combination thereof.

14. The genome editing system according to claim 13, wherein the nucleotide elongation comprises one or more RNA bases, one or more DNA bases, or a combination thereof.

15. The genome editing system according to any one of claims 1 to 14, wherein the gRNA molecule contains one or more modified bases.

16. The genome editing system according to any one of claims 13 to 15, wherein the nucleotide elongation is a 5' elongation comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 23.

17. The genome editing system according to any one of claims 13 to 16, wherein the extension is a 5' extension comprising the nucleotide sequence described in Sequence ID No.

7.

18. The genome editing system according to any one of claims 1 to 17, wherein the gRNA molecule comprises a DNA / RNA oligonucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NOs. 32 to 35.

19. The genome editing system according to any one of claims 1 to 16, wherein the gRNA molecule comprises the nucleotide sequence described in Sequence ID No.

35.

20. A ribonucleoprotein (RNP) complex comprising the genome editing system described in any one of claims 1 to 19.

21. A vector for delivering a genome editing system according to any one of claims 1 to 19, comprising DNA encoding the gRNA molecule and / or RNA-induced nuclease, RNA encoding the gRNA molecule and / or RNA-induced nuclease, or a combination thereof.

22. A method for modifying the CD70 gene in a target cell, comprising the step of contacting the target cell with the genome editing system described in any one of claims 1 to 19, the RNP complex described in claim 20, or the vector described in claim 21.

23. A cell comprising a genome editing system according to any one of claims 1 to 19, an RNP complex according to claim 20, or a vector according to claim 21.

24. The cell according to claim 23, wherein the level of the CD70 gene product within the cell is lower compared to a cell lacking the genome editing system according to any one of claims 1 to 19, the RNP complex according to claim 20, or the vector according to claim 21.

25. The cell according to claim 23 or 24, comprising an indel in the target sequence of the CD70 gene.

26. A cell comprising one or more genome edits within the CD70 gene, edited by the method described in claim 22.

27. The cell according to claim 25, wherein the one or more genome edits include indels within the target sequence of the CD70 gene.

28. The cell according to claim 27, wherein the indel comprises a deletion of all or part of the target sequence of the CD70 gene.

29. The cell according to any one of claims 26 to 28, wherein the cell is a T cell.

30. The cell according to claim 29, wherein the T cell is an α / β T cell.

31. The cell according to claim 29 or 30, further comprising a chimeric antigen receptor (CAR).

32. The cell according to claim 31, wherein the CAR binds to the tumor antigen.

33. A composition comprising a population of genetically modified cells in which an indel is included in the target sequence of the CD70 gene, wherein the target sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24-27 and SEQ ID NO:

55.

34. The composition according to claim 33, wherein the level of the CD70 gene product in the population is reduced compared to the non-genetically modified cell population.

35. The composition according to claim 33 or 34, wherein the genetically modified cells are T cells.

36. The composition according to claim 35, wherein the T cells are α / β T cells.

37. A method for treating a disease or disorder, comprising the step of administering to a subject requiring the use of a genome editing system according to any one of claims 1 to 19, an RNP according to claim 20, a vector according to claim 21, cells according to any one of claims 23 to 25, cells according to any one of claims 26 to 32, or a composition according to any one of claims 33 to 36.

38. The method according to claim 37, wherein the disease or disorder is a tumor, cancer, malignant tumor, neoplasm, or other proliferative disorder or disorder.

39. The method according to claim 37 or 38, wherein the disease or disorder is selected from the group consisting of leukemia, lymphoma, for example, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, low-grade B-cell lymphoma, B-cell malignancies, colorectal cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer, and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing's sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma, and / or mesothelioma.

40. A gRNA molecule comprising a targeting domain that targets the target sequence of the CD70 gene.

41. The gRNA molecule according to claim 40, wherein the target sequence of the CD70 gene is located in exon 2 of CD70.

42. (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24 to 27; and / or (b) The gRNA molecule according to claim 40, wherein the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 28 to 31.

43. (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 and SEQ ID NO: 27; and / or (b) The gRNA according to claim 40 or 41, wherein the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO:

31.

44. (a) The target sequence of the CD70 gene comprises the nucleotide sequence described in Sequence ID No. 27; and / or (b) The gRNA according to any one of claims 40 to 43, wherein the targeting domain comprises the nucleotide sequence described in SEQ ID NO: 31.