Ghpdf1 gene for regulating fruit branch angle in upland cotton and application thereof

By identifying the GhPDF1 gene in upland cotton and utilizing genetic engineering and molecular marker technology, the problem of low efficiency in cotton plant type improvement in existing technologies has been solved. This has enabled early, rapid, and accurate screening of compact plant types and efficient breeding, filling the research gap in genes regulating fruit branch angle.

CN122104725APending Publication Date: 2026-05-29GANSU AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-29
Publication Date
2026-05-29

Smart Images

  • Figure CN122104725A_ABST
    Figure CN122104725A_ABST
Patent Text Reader

Abstract

This invention relates to the field of biotechnology and discloses a method for regulating the angle of fruiting branches in upland cotton. GhPDF1 Genes and their applications, the aforementioned GhPDF1 The coding region sequence of the gene is shown in SEQ ID NO:1; GhPDF1 The gene ID is GH_D04G0386.1 ;A sort of GhPDF1 The application of genes in regulating the fruiting branch angle of upland cotton, either for regulating the fruiting branch angle of upland cotton or for breeding upland cotton varieties with a compact plant type, is described. GhPDF1 Genes regulate the fruiting branch angle of upland cotton by modulating their expression levels in upland cotton cells. This invention provides a precise genetic modification pathway, demonstrating the ability to inhibit [the growth of] upland cotton fruiting branches using VIGS technology. GhPDF1 Gene expression can significantly increase the angle between cotton fruiting branches, making the plant type looser, providing a clear gene target and effective technical means for using genetic engineering technology to cultivate new cotton varieties with compact plant type.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the regulation of fruit branch angles in upland cotton. GhPDF1 Genes and their applications. Background Technology

[0002] During long-term domestication and genetic improvement, many crop plant types have evolved from loose to compact. For example, wild rice evolved into compact cultivated rice by reducing tiller angles, significantly increasing planting density and photosynthetic efficiency, thus increasing yield. Similarly, the leaf angle of maize gradually decreased during breeding, promoting the development of high-density planting patterns. Compact plant types not only contribute to high yields but also facilitate mechanized harvesting. For instance, rapeseed varieties with small branch angles are easier to harvest mechanically, and the size of branch angles in tea plants directly affects the efficiency and cost of mechanical harvesting. From a molecular perspective, key genes regulating branch angles are mostly related to the synthesis, signal transduction, and tillering regulation of plant hormones (such as auxins, cytokinins, and brassinolide), as well as factors that have been found in rice. OsARF6 and OsARF17 The regulatory role of genes on the angle.

[0003] Specifically in the cotton (upland cotton) sector, the fruiting branch angle is the most critical trait determining the compactness of the cotton plant type. Its size directly affects planting density, canopy photosynthetic efficiency, disease resistance, lodging resistance, and ultimately, cotton fiber yield. In cotton production, a smaller fruiting branch angle facilitates leaf shedding from various parts of the canopy during the boll-opening stage, effectively reducing the impurity content of machine-harvested cotton and thus significantly improving the quality of raw cotton. However, current research on the key genes controlling the cotton fruiting branch angle is still scarce, and the underlying molecular regulatory mechanisms remain unclear. Current cotton plant type improvement mainly relies on traditional hybridization breeding methods, i.e., screening for plant type traits through field phenotypic identification.

[0004] However, in the process of implementing the technical solutions in the embodiments of this application, the inventors of this application discovered that the key genes and their molecular mechanisms for regulating the fruit branch angle of upland cotton are not fully understood in the prior art, and there is a lack of gene targets that can be used to precisely improve the fruit branch angle, which limits the ability to use genetic engineering technology to cultivate new varieties with compact plant types; in addition, traditional phenotypic identification and screening methods are time-consuming, inefficient, and easily affected by environmental factors, and lack molecular markers that can be used for efficient auxiliary breeding, making it difficult to achieve early, rapid, and accurate screening of excellent compact plant type materials in the seedling stage. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method for regulating the angle of fruiting branches in upland cotton. GhPDF1Genes and their applications address the problem that existing technologies rely on traditional field phenotypic identification for cotton plant type selection, which generally lacks understanding of key gene targets that regulate fruit branch angles, and also lacks molecular marker-assisted breeding tools that can be used for early and efficient screening.

[0006] To achieve the above objectives, the present invention provides the following technical solution: a type of upland cotton. GhPDF1 Genes, the ones mentioned GhPDF1 The coding region sequence of the gene is shown in SEQ ID NO:1.

[0007] Based on the above technical solution, homology comparison and phylogenetic analysis revealed that this gene exhibits high sequence conservation among Gossypium species. Functional studies confirmed that this gene is a key gene regulating the fruiting branch angle in upland cotton; silencing this gene leads to a significant reduction in the number of parenchyma cells in the cortex of the fruiting branch, thereby decreasing the fruiting branch angle. The discovery of this gene fills a gap in the research on genes regulating the fruiting branch angle in upland cotton and provides important genetic resources for the molecular improvement of cotton plant architecture and the breeding of new varieties adapted to mechanized harvesting.

[0008] Preferably, the GhPDF1 The gene ID is GH_D04G0386.1 The specific primers include an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO: 3.

[0009] A sort of GhPDF1 The application of genes in regulating the fruiting branch angle of upland cotton, either for regulating the fruiting branch angle of upland cotton or for breeding upland cotton varieties with a compact plant type, is described. GhPDF1 Genes regulate the angle between the fruiting branches of upland cotton by controlling the number of cells at the junction of the main stem and the fruiting branches.

[0010] Based on the above technical solution: GhPDF1 Internal gene variations play a decisive role in cotton phenotypic traits. This invention... GhPDF1 A SNP locus significantly associated with the angle between fruit branches was identified within the gene coding region, and this locus has been subject to continuous artificial selection during breeding. Based on this, this invention proposes two specific application approaches: one is to overexpress this gene through genetic engineering to reduce the angle between fruit branches; the other is to screen compact plants with superior allelic variations through molecular marker-assisted breeding.

[0011] Preferably, the regulation of the fruit branch angle of upland cotton includes inhibiting the GhPDF1 The steps of gene expression include: Construct a viral gene silencing recombinant vector containing a VIGS silencing fragment; The recombinant vector was introduced into upland cotton cells, causing the... GhPDF1 Gene expression is suppressed.

[0012] Preferably, the VIGS silencing fragment is targeted at GhPDF1 The gene coding region was designed, and its nucleotide sequence is shown in SEQ ID NO: 4.

[0013] Preferably, the introduction method is Agrobacterium-mediated injection, and the introduction step includes: mixing Agrobacterium bacterial solution containing the recombinant vector with Agrobacterium bacterial solution containing an auxiliary carrier, and injecting the cotyledons of upland cotton to infect them.

[0014] Preferably, the application further includes performing cytological testing on the treated plants, the testing including: preparing paraffin sections at the junction of the fruit branches and the main stem, and observing the structure of the cortical parenchyma cells.

[0015] Preferably, the regulation of the fruit branch angle of upland cotton further includes screening plants through molecular marker-assisted breeding, the method comprising: Extracting genomic DNA from upland cotton; Regarding the GhPDF1 Genotyping is performed using G / C single nucleotide polymorphism sites in the coding region of a gene.

[0016] Preferably, the genotyping step includes: performing PCR amplification on the G / C single nucleotide polymorphism site using specific primers; sequencing the amplification product; and screening plants with the GG genotype based on the sequencing results.

[0017] Preferably, the specific primers include an upstream primer as shown in SEQ ID NO: 8 and a downstream primer as shown in SEQ ID NO: 9.

[0018] This invention provides a method for regulating the angle of fruiting branches in upland cotton. GhPDF1 Genes and their applications. They offer the following beneficial effects: This invention identifies and confirms GhPDF1 The gene is a key gene regulating the fruiting branch angle of upland cotton. Based on this discovery, this invention provides a precise genetic improvement pathway, demonstrating the ability to suppress [the angle of fruiting branches] using VIGS technology. GhPDF1 Gene expression can significantly increase the angle between cotton fruiting branches, resulting in a looser plant structure. This provides a clear gene target and effective technical means for cultivating new cotton varieties with a compact plant structure using genetic engineering. Simultaneously, this invention also provides a highly efficient breeding screening tool, specifically targeting… GhPDF1 A molecular marker-assisted breeding method based on G / C single nucleotide polymorphism sites in gene coding regions allows breeders to quickly and accurately screen for compact plant type superior materials at the seedling stage by using specific primers for PCR amplification and sequencing, and screening for GG genotypes. This eliminates reliance on field phenotypic identification, significantly improving breeding efficiency and shortening the breeding cycle. Furthermore, this invention also preliminarily reveals through paraffin section analysis... GhPDF1 Genes may regulate the angle of fruit branches by influencing the structure or development of parenchyma cells in the cortex at the base of the fruit branch, providing a theoretical basis for in-depth research on the molecular mechanisms of cotton plant architecture. Attached Figure Description

[0019] Figure 1 Phylogenetic trees and gene structure diagrams of PDF1 from different species of this invention; Figure 2 This is a conserved structural domain diagram of PDF1 from different species in this invention; Figure 3 Different species of the present invention PDF1 Analysis diagram of cis-acting elements; Figure 4 For the present invention GhPDF1 Analysis of expression levels and characteristics in extreme materials with fruit-branch angles of upland cotton; Figure 5 For the silence of this invention GhPDF1 Phenotypic analysis diagram; Figure 6 This is a histological analysis diagram of the angle between fruit branches at the same location in the control plant and the silent plant of this invention. Figure 7 For the present invention GhPDF1 Analysis and validation diagram of superior allelic variations within a gene; Figure 8 This is a graph illustrating the superior allelic variation of the present invention; Figure 9 For the present invention GhPDF1 The genetic differentiation index and nucleotide polymorphism analysis diagram. Detailed Implementation

[0020] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] During long-term domestication and genetic improvement, many crops have evolved from loose to compact plant types. For example, wild rice evolved into compact cultivated rice by reducing tiller angles, significantly increasing planting density and photosynthetic efficiency, thus increasing yield. Similarly, the leaf angle of maize has gradually decreased during breeding, promoting the development of high-density planting patterns and achieving a significant increase in maize yield per unit area. Compact plant types not only contribute to high yields but also facilitate mechanized harvesting. For example, rapeseed varieties with small branch angles are easier to harvest mechanically; in tea trees, branch angle size directly affects the efficiency and cost of mechanical harvesting. From a molecular perspective, key genes regulating branch angles are mostly related to plant hormone synthesis, signal transduction, and tillering regulators. For example, in rice... OsARF6 and OsARF17 Gene knockout leads to an increase in the flag leaf angle. Currently known genes regulating branching angle mainly involve genes that regulate the synthesis and transport of plant hormones such as auxin, cytokinin, and brassinolide, as well as several tillering angle regulatory factors.

[0022] The fruiting branch angle is the most critical trait determining the compactness of cotton plant architecture. Its size directly affects planting density, canopy photosynthetic efficiency, disease resistance, lodging resistance, and ultimately, cotton fiber yield. In cotton production, a smaller fruiting branch angle has been found to facilitate leaf shedding from various parts of the canopy during boll opening, effectively reducing the impurity content of machine-harvested cotton and thus significantly improving the quality of raw cotton. However, compared to crops such as rice and rapeseed, research on the key genes controlling the cotton fruiting branch angle is still scarce, and the underlying molecular regulatory mechanisms remain unclear.

[0023] Given the relative scarcity of systematic studies on the structure and function of the PDF1 protein, particularly the insufficient identification of its conserved sequences, this invention employs homology alignment to systematically identify the gene's phylogenetic relationships and conserved motifs across different species. The analysis results show that PDF1 exhibits high sequence conservation among four Gossypium species (see appendix). Figure 1 -Phylogeny tree of PDF1 in different species at point A). Further phylogenetic analysis showed that the differentiation time of the PDF1 gene in cotton is closer to that of plants in the Hibiscus and Rosaceae families, and relatively more distant from that of plants in the Poaceae and Brassicaceae families.

[0024] This finding aligns with previous research. For example, Deng Fenglin et al., through amino acid sequence alignment and evolutionary analysis, also pointed out that PDF1 in various plants within the Brassicaceae family is closely related, while the origin of cotton PDF1 may be closer to the homologous genes in Clementine and Valencia orange. Analysis of conserved domains further reveals similar evolutionary patterns: the closer the phylogenetic relationship between species, the higher the similarity of their conserved domains; during evolution, some domains have been lost. For example, motif 4 is completely absent in grasses, while motif 6 shows instability in species evolution, being absent in sweet oranges, soybeans, corn, and wheat, but present in grapes, soybeans, and rice (see appendix). Figure 2 In terms of gene structure, PDF1 exists in two main types: one without introns and the other containing two introns (see Appendix). Figure 1 -B shows the gene structure of PDF1 in different species. This is consistent with the findings of Deng Fenglin et al. in cotton, who discovered three structural types of PDF1 genes in both sea island cotton and upland cotton: the first type has no introns (such as GbPDF1.1 and GhPDF1.1); the second type contains one intron (only GbPDF1.2, which was not amplified in upland cotton TM-1); and the third type contains two introns (such as GbPDF1.3 and GhPDF1.3).

[0025] The PDF1 gene was initially cloned from Arabidopsis thaliana and found to be concentrated in the L1 cell layer of the vegetative, inflorescence, and floral meristems, as well as in the epidermal protocells of organ primordia. Currently, functional studies of the PDF1 gene are very limited; apart from Arabidopsis, in-depth research has only been conducted in upland cotton, where silencing it has been found to lead to delayed fiber initiation, shorter fibers, and reduced water content. This invention is the first to systematically analyze the function of the PDF1 gene in upland cotton, revealing its role in regulating the angle between fruiting branches. Gene silencing experiments confirmed that silencing the PDF1 gene in upland cotton leads to a significant reduction in the number of parenchyma cells in the cortex of fruiting branches (see appendix). Figure 6 -B), thus affecting the angle of the fruit branch (see appendix). Figure 5 This discovery not only reveals a new function of the PDF1 gene in regulating cotton plant architecture, filling a gap in the study of this gene's function in upland cotton, but also provides important genetic resources and a theoretical basis for the molecular improvement of cotton plant architecture, the application of rational dense planting models, and the breeding of new cotton varieties adapted to mechanized harvesting.

[0026] With the rapid development of whole-genome resequencing technology, a large number of variant sites have been identified. Among them, those sites that directly affect gene function and lead to differences in traits among varieties, although they are a minority, have become the core basic variables for crop genetic improvement, germplasm resource identification, variety identification, and seed quality testing.

[0027] This invention focuses on the key gene GhPDF1 for fruit branch angle in upland cotton, and identifies a SNP locus within its coding region that is significantly associated with fruit branch angle; sequencing analysis shows that this locus exhibits polymorphism in varieties with extreme fruit branch angles (see appendix). Figure 7 It is noteworthy that other key genes also exhibit genetic variations significantly associated with important agronomic traits. For example, Wang et al. identified SNP sites in the GhAP1-D3 gene region that are significantly associated with flowering time in upland cotton; Han et al. revealed the superior haplotype hap in the GhDRR1 and GhDRT1 genes. 3-79 The cotton exhibits a significant advantage in drought resistance. These findings collectively confirm the decisive role of internal variations in key genes in important phenotypic traits of cotton. Throughout evolutionary history, specific regions of the genome undergo adaptive changes to adapt to external environments and the pressures of artificial selection. Previous studies have identified several genes that have been selected during evolution through genome comparisons among different cotton species.

[0028] Furthermore, Fang et al. systematically evaluated the modern upland cotton improvement process by performing whole-genome resequencing on 318 local varieties and improved lines of upland cotton, and found that the superior allelic variations in the population mainly originated from three local lines.

[0029] In this study, analysis of superior allelic variants within the GhPDF1 gene showed that their frequency distribution exhibited a clear temporal characteristic, with the highest frequency in recent times (see appendix). Figure 8 This distribution pattern aligns with the temporal selection objective for this trait of compact fruit branch angle during breeding. Furthermore, significant artificial selection signals were detected in this gene region (see appendix). Figure 9 This further strongly confirms that GhPDF1 has been subjected to continuous artificial selection pressure in cotton breeding practices.

[0030] This invention provides a GhPDF1 gene for upland cotton, the coding region sequence of which is shown in SEQ ID NO:1. The gene ID of the GhPDF1 gene is GH_D04G0386.1.

[0031] An application of the GhPDF1 gene in regulating the fruiting branch angle of upland cotton is described. This application aims to control the fruiting branch angle of upland cotton or to cultivate upland cotton varieties with a compact plant type. The GhPDF1 gene regulates the fruiting branch angle of upland cotton by adjusting its expression level in upland cotton cells. Regulating the fruiting branch angle of upland cotton involves the step of inhibiting GhPDF1 gene expression. The steps include: constructing a virus-induced gene silencing recombinant vector containing a VIGS silencing fragment; and introducing the recombinant vector into upland cotton cells to inhibit GhPDF1 gene expression. The VIGS silencing fragment is designed targeting the coding region of the GhPDF1 gene, and its nucleotide sequence is shown in SEQ ID NO: 4.

[0032] The method of introduction is Agrobacterium-mediated injection. The introduction steps include: mixing Agrobacterium bacterial suspension containing recombinant vector with Agrobacterium bacterial suspension containing auxiliary vector, and injecting the mixture into the cotyledons of upland cotton to infect them.

[0033] This also includes cytological testing of the treated plants, including preparing paraffin sections at the junction of the fruiting branches and the main stem, and observing the structure of the cortical parenchyma cells. Regulating the angle between fruiting branches in upland cotton also involves screening plants using molecular marker-assisted breeding methods, including: extracting genomic DNA from upland cotton; and genotyping the G / C single nucleotide polymorphism sites in the coding region of the GhPDF1 gene.

[0034] The genotyping steps include: PCR amplification of G / C single nucleotide polymorphism sites using specific primers; sequencing of the amplification products; and screening for plants with the GG genotype based on the sequencing results. The nucleotide sequence is shown in SEQ ID NO:7.

[0035] The following is a further description with reference to specific embodiments: All upland cotton seeds used in the experiment were provided and preserved by our laboratory. Nutrient soil and vermiculite were mixed in a 1:1 ratio and filled 9×14 cm culture pots to 2 / 3 full. The pots were then soaked in water until the surface was moist. Plump seeds were selected and placed about 1 cm below the surface of the nutrient soil in the culture pots. The pots were covered with soil, covered with plastic film, and placed in a 25℃ light incubator. Once the seeds germinated and the cotyledons unfolded, the plants were transplanted into 18×20 cm flowerpots and cultured at a rate of 20 plants / m². 2 The plants were grown at a controlled planting density, under light intensity of 8000 LX, a photoperiod of 16 h light / 8 h darkness, and a temperature of 25℃. Tissue samples were collected from the junction of the fourth, fifth, and sixth fruiting branches and the main stem during the peak flowering period. These samples were immediately placed in liquid nitrogen for rapid freezing and then stored in an ultra-low temperature freezer at -80℃ for later use.

[0036] VIGS silencing primers, qRT-PCR and SNP site verification primers for the GhPDF1 gene were designed using the NCBI Primer-BLAST online software. The specific primer sequences are shown in Table 1.

[0037] Table 1: Primer Sequence Listing

[0038] Note: gactagt represents the protective base g+Spe I restriction sequence; aggcgcgcc represents the protective base a+AscI restriction sequence.

[0039] To obtain PDF1 nucleic acid and protein sequence information from different species, the known PDF1 protein sequences of *Cotton spp.* and *Arabidopsis thaliana* were used as seed sequences. Homology comparisons were performed in the *Cotton spp.* database (http: / / cotton.zju.edu.cn / index.htm) and NCBI (https: / / www.ncbi.nlm.nih.gov / ) to obtain PDF1 sequences from 25 species, including *Cotton spp.*.

[0040] A phylogenetic tree of PDF1 in 25 species was constructed using the Neighbor Joining (NJ) method with MEGA 11.0 software, with 1000 bootstrap replicates. The phylogenetic tree of the PDF1 protein was visualized using iTOL. The coding sequence (CDS) and genome sequences of the PDF1 gene from the 25 species were analyzed on the Gene Structure Display Server (https: / / gsds.gao-lab.org / ) to identify exons and introns. Conserved motifs of the protein sequence were identified using the MEME database (https: / / meme-suite.org / meme / doc / meme.html), with the output parameters set to 7 motifs. The gene structure and conserved motif diagrams were visualized using the gene structure visualization tool in TBtools.

[0041] A 2,000 bp promoter sequence upstream of the CDS of the PDF1 gene was extracted from 25 species. Cis-acting elements were predicted on the PlantCARE website (PlantCARE, a database of plant promoters and their cis-acting regulatory elements). The predicted cis-acting elements were visualized and analyzed using the biological sequence viewing tool in TBtools.

[0042] DNA and total RNA were extracted from collected plant tissue samples using a nucleic acid extraction kit suitable for polysaccharide and polyphenol plant materials (Beijing, Tiangen), and their quality and concentration were determined. The qualified total RNA was reverse transcribed into cDNA using the UnionScript First-strand cDNA Synthesis Mix for qPCR kit (Beijing, Jinsha), and its quality and concentration were determined and diluted to a final concentration of 100 ng / μL. -1 qRT-PCR was performed using the 2X Universal SYBR Green Fast qPCRMix kit (Wuhan, Aibotek), with GhACTIN selected as the internal control gene. -ΔΔCt Calculate the relative expression levels of genes.

[0043] GhPDF1 gene expression characterization analysis: Based on the fruit branch angle phenotypic identification, materials with large fruit branch angles (Shaanxi 689, 70-24, Nandanlihu cotton, Xinluzao 7, and Zhongmian Institute 125) and materials with small fruit branch angles (Jimian 8, Xinluzao 26, Xinluzao 38, Xinluzao 47, and Xinluzhong 14) were screened. RNA was extracted from the second true leaf of each material during the seedling stage. The expression level of GhPDF1 in each material was detected by qRT-PCR, and the expression level was further analyzed by 2- ΔCt The expression level of GhPDF1 in each material was calculated. To clarify the tissue expression characteristics of GhPDF1, the tissue expression characteristics of this gene were preliminarily predicted using the Zhejiang University Cotton Genome Database (http: / / cotton.zju.edu.cn / 10.rnasearch.html). Roots, stems, and leaves of plants aged 12–15 days, and stamens, pistils, petals, receptacles, and sepals of plants aged 8–11 weeks were collected. RNA was extracted, reverse transcribed, and the expression level of the target gene in different tissues was detected by qRT-PCR.

[0044] Virus-induced silencing (VIGS) and phenotypic identification of cotton fruit branch angle: Using cDNA extracted from total RNA reverse transcribed from the small-fruited branch cultivar Jimian 8 as a template, a conserved region sequence (400 bp) within the open reading frame of GhPDF1 was cloned and constructed into the VIGS vector pCLCrVA. The recombinant CLCrV:GhPDF1 plasmid was then transformed into Agrobacterium GV3101. Using the leaf syringe infiltration method, negative control CLCrV:00, positive control CLCrVA:GhchlI, and experimental group CLCrV:GhPDF1 (all with OD values ​​approximately 1.8) were mixed with the helper bacterium CLCrVB at a 1:1 ratio and then infected the newly unfolded cotyledons of the small-fruited branch cultivar Jimian 8.

[0045] Two weeks after infection, the positive control CLCrVA:GhCLA showed a yellowing phenotype in its leaves. Once the second true leaf had fully expanded, qRT-PCR was used to detect the transcriptional level of GhPDF1 in CLCrV:GhPDF1-silenced plants, using CLCrV:00 plants as a control. Plants with a silencing efficiency below 0.5 were used for subsequent experiments. The angle between the first and sixth fruiting branches of CLCrV:00 control plants and CLCrV:GhPDF1-silenced plants was measured to clarify the function of GhPDF1 in regulating the angle of fruiting branches in upland cotton.

[0046] After collecting phenotypic data during the full bloom period, tissue samples were collected from the junction of the 3rd to 5th fruiting branches and the main stem of both control and silent plants at this stage. The samples were then immersed in FAA fixative (70% alcohol: formaldehyde: acetic acid = 18:1:1). After fixation, the samples were rinsed three times with 70% alcohol and dehydrated using a gradient series of alcohols (30%, 50%, 70%, 85%, 95%, and 100% alcohol). After clearing with alcohol and xylene, the process of paraffin embedding, sectioning, safranin-fast green staining, mounting, and microscopic observation of cell morphology began.

[0047] Evolutionary analysis of superior allelic variations of the GhPDF1 gene in varieties from different breeding eras: Based on the different breeding years of the experimental materials, 418 upland cotton cultivars in the laboratory were divided into three periods: early (before 1979), mid (1980-1999), and late (after 2000). Based on the whole-genome resequencing data of the 418 upland cotton germplasms, significant variation sites within the GhPDF1 gene region were extracted. The frequency distribution of different allelic variations within the GhPDF1 gene in different breeding years was calculated and analyzed. Statistical analysis of phenotypic data corresponding to different allelic variations was performed, and the t-test method was used to assess the significant differences in the phenotypic values ​​of different allelic variations at the fruiting branch angle. Population differentiation index (FST) and nucleotide diversity (π) were calculated for different allelic variations within the GhPDF1 gene between materials with extreme fruiting branch angles, with a window of 10 kb and a step size of 10 kb.

[0048] The data were organized using Excel 2016, t-tests were performed using SPSS 24.0, charts were generated using Origin 2022, and cell counts were calculated using ImageJ.

[0049] Phylogenetic trees and gene structure identification of PDF1 in different species: To investigate the evolutionary characteristics and gene structural diversity of the PDF1 protein, this invention constructed a phylogenetic tree and gene structure map using PDF1 sequences obtained from 25 species. Phylogenetic analysis showed that the PDF1 protein of upland cotton is most closely related to plants in the Malvaceae family, and relatively distant from plants in the Poaceae family (see appendix). Figure 1 Phylogenetic tree of different species of PDF1 in A).

[0050] From the phylogenetic branching structure, upland cotton clusters into an independent branch with the other three gossypium species, indicating that the GhPDF1 protein is highly conserved within the gossypium genus. This result suggests that the function of the GhPDF1 protein may have undergone an evolutionary process from conservation to differentiation from the gossypium genus to the Malvaceae family and then to a wider range of plant groups. Regarding gene structure analysis, exon and intron maps show that the PDF1 gene in different species has a similar distribution pattern. Most species have a PDF1 gene with three exons, while a few species, such as Asian cotton, hibiscus, cocoa, durian, soybean, and maize, have only one exon (see appendix). Figure 1 -B gene structures of PDF1 in different species. This diversity of gene structures provides important clues for in-depth analysis of the structural features and functional differentiation of PDF1 protein in different species, and helps to further elucidate the functional evolution mechanism of this protein in the evolutionary history of plants.

[0051] Phylogenetic analysis of the PDF1 protein based on conserved domains: Conserved motif analysis showed that PDF1 proteins from different species share similar conserved domain features (see appendix). Figure 2 Most PDF1 proteins contain seven conserved motifs, of which motifs 1, 2, 3, 5, and 7 are consistently present in all studied species, demonstrating high evolutionary conservation. Notably, some motifs have shown instability throughout evolutionary history; for example, motif 4 is completely absent in grasses, and motif 6 is absent in sweet orange, soybean, maize, and wheat.

[0052] The differentiated distribution of each conserved motif indicates that the function of the PDF1 gene has gradually diversified during evolution. Furthermore, the base sequence of the seven conserved motifs of the PDF1 protein exhibits a clear regularity, further suggesting that PDF1 proteins clustered in the same group may possess similar structural features, providing important structural biological evidence for in-depth research into their functional differentiation and conservation.

[0053] Prediction of the modulation function of PDF1 initiator cis-components: To further explore the potential biological functions of PDF1, this invention systematically analyzes the cis-regulatory elements in its promoter region. The results show that the cis-regulatory elements can be divided into four main categories. Among these, light-responsive elements are common to the PDF1 promoters of all species, and the number of light-responsive elements carried by *Gossypium glomeratum* GhPDF1 is significantly higher than in other species. The next most common category is hormone-responsive elements (see appendix). Figure 3 ).

[0054] Notably, the GhPDF1 promoter is rich in abscisic acid (ABA)-related cis-regulatory elements, including three G-boxes and four ABRE elements, showing a significant advantage in quantity compared to other species. Further analysis revealed that the GhPDF1 promoter also contains various regulatory elements related to plant growth and development: RY elements regulating seed-specific expression, O2 elements related to metabolic regulation, CAT boxes related to meristem-specific expression, and the GCN4 motif regulating endosperm development. In addition, the GhPDF1 promoter also contains LTR elements and TC-rich repetitive sequences, suggesting its potential involvement in plant responses to abiotic stresses (such as low temperature). Compared to other species, the upland cotton PDF1 promoter exhibits the highest proportions of all these cis-regulatory elements.

[0055] In summary, these results not only reveal that GhPDF1 plays a crucial role in the plant hormone (especially ABA) regulatory network, but also indicate that it may participate in plant reproductive development through a variety of development-related cis-elements, providing important clues to the regulatory mechanisms underlying the biological functions of GhPDF1.

[0056] Analysis of the regulatory effect of GhPDF1 on the angle between cotton fruiting branches and its expression characteristics: To investigate the role of GhPDF1 in the formation of fruit branch angles, qRT-PCR was used to detect the expression level of GhPDF1 in materials with large angles (Nandanlihu cotton: 62.23°, 70-24: 59.69°, Shan 689: 58.95°, Zhongmian Institute 125: 56.17°, and Xinluzao 7: 61.11°) and materials with small angles (Jimian 8: 53.03°, Xinluzao 38: 50.86°, Xinluzao 26: 50.19°, Xinluzhong 14: 48.14°, and Xinluzao 47: 50.13°).

[0057] Quantitative analysis showed that the average expression level of GhPDF1 in materials with small angles was approximately 5–7 times that in materials with large angles, and the difference was statistically significant (see appendix). Figure 4 -B, ** in the figure indicates a highly significant difference (P < 0.01). The above results indicate that the expression level of GhPDF1 is negatively correlated with the size of the fruit branch angle.

[0058] To further elucidate the expression pattern of this gene, expression heatmaps of different tissues of the same variety were constructed (see appendix). Figure 4 GhPDF1 (-A) is highly expressed in various reproductive organs (such as pistils and petals). qRT-PCR analysis of GhPDF1 expression levels in different tissues of the same variety revealed that, in addition to high expression in pistils and petals, the expression level in the stem, a vegetative organ, was significantly higher than that in the roots and leaves (see appendix). Figure 4 -C). Based on this, we hypothesize that silencing GhPDF1 in materials with small angles may cause an increase in the fruit branch angle.

[0059] Phenotypic identification and histological analysis of silencing the GhPDF1 gene in upland cotton: Please see the appendix Figure 5 In the figure, the sample size n>10; according to the t-test, asterisks indicate significant differences compared with control plants (*P<0.05, **P<0.01); based on the high expression of GhPDF1 in small-angled cotton materials, this invention utilizes VIGS technology to inhibit GhPDF1 gene expression in the small-angled cotton variety Jimian 8 and evaluates its effect on the cotton fruit branch angle. The results show that approximately 30 days after infection of cotton cotyledons, CLCrV:GhchlI positive plants exhibited significant yellowing (see appendix). Figure 5 -The phenotype of CLCrV:GhchlI positive plants at location A was analyzed, and the silencing efficiency of the silenced plants was examined. It was found that the silencing efficiency of most plants was less than or equal to 0.5 (see Appendix). Figure 5 -B location GhPDF1 silence efficiency detection).

[0060] After 80 days of continuous suppression of GhPDF1 expression, we measured and statistically analyzed the angle between the 1st to 6th fruiting branches of control plants and GhPDF1-silenced plants (see Appendix). Figure 5 -Statistical analysis of the fruit branch angle phenotype of silenced GhPDF1 plants at point C and silenced plants at point D). The results showed that, compared with the control plants, the fruit branch angle of silenced GhPDF1 plants was significantly increased by 8.2° (see Appendix). Figure 5 Phenotypic statistical analysis of plants silenced at -D. It is speculated that high expression of GhPDF1 can reduce the angle between fruit branches, thereby achieving dense planting.

[0061] To further elucidate the cellular mechanism by which GhPDF1 affects the formation of the fruiting branch angle in cotton, this study selected paraffin sections of the middle fruiting branches of control plants and GhPDF1-silenced plants for observation (see appendix). Figure 6 - Histological diagram of endodermal parenchyma cells at the angle between the fruit branches of the silent plant and the control plant (point A). Histological analysis showed that, compared with the control, the number of endodermal parenchyma cells per unit area of ​​the fruit branch tissue was significantly reduced in the silent plant. (See appendix) Figure 6 -Statistical analysis of the number of parenchyma cells in the cortex of the fruit branch angle in control and silent plants (section B). This cytological difference suggests that the GhPDF1 gene may regulate the development of the fruit branch angle by controlling cell division and subsequent swelling. This finding not only provides direct cytological evidence for elucidating the regulation of fruit branch angle formation by GhPDF1, but also offers a new perspective for understanding the functional mechanism of this gene.

[0062] Validation of functional sites within the GhPDF1 gene: This invention analyzed SNP sites in the GhPDF1 gene from 418 population samples and identified one SNP (G / C) site in its coding region (see appendix). Figure 7 -Genome structure of GhPDF1 at location A). Genotypic analysis at this locus showed that the fruit branch angle of individuals with the GhPDF1GG genotype was significantly smaller than that of individuals with the GhPDF1CC genotype (see Appendix). Figure 7 Phenotypic statistical analysis of superior allelic variation within the GhPDF1 gene at position -B indicates that GhPDF1GG may be the favorable allelic variation leading to the small fruit branch angle. The CDS region (fragment size 319 bp) of the GhPDF1 gene containing this SNP site was cloned from five varieties with small fruit branch angles (Xinluzao 26, Xinluzao 47, Xinluzao 39, Xinluzao 38, and Xinluzao 34) and five varieties with large fruit branch angles (Xinluzao 7, 70-24, Nandanlihu cotton, Zhongmian Institute 125, and Shan 689). Sanger sequencing results showed that the small fruit branch angle varieties were all GG homozygous at this site, while the large fruit branch angle varieties were all CC homozygous (see appendix). Figure 7 (SNP loci were verified in 5 samples with small and 5 samples with large angles at point C). The above results confirm the association between the variation of this SNP locus and the size of the fruit branch angle, revealing its potential impact on the function of the GhPDF1 gene, and providing an important molecular basis for further analysis of the gene's function.

[0063] GhPDF1 GG Evolutionary analysis of superior allelic variations at different breeding stages: To understand GhPDF1 GG The evolution frequency of superior allelic variations in my country was investigated. Based on the breeding year, 418 upland cotton lines were divided into three periods: Early (before 1979), Mid (1980-1999), and Late (after 2000). The variation frequency results showed that the superior allelic variation GhPDF1... GG Its proportion in each breeding stage far exceeds that of GhPDF1 CC Furthermore, with the changing breeding era, the superior allelic variant GhPDF1 GGThe proportion is increasing (see appendix) Figure 8 -The distribution of allelic variation frequencies at point A across different breeding stages). Phenotypic analysis of these two allelic variations at different breeding stages revealed that GhPDF1 GG The included angle is significantly smaller than GhPDF1 CC As the breeding era has changed, this difference has become increasingly significant (see appendix). Figure 8 -Statistical analysis of the phenotypic corresponding to the allelic variation at point B). The above results indicate the superior allelic variation GhPDF1. GG It has been subject to strong selection in the history of upland cotton breeding in my country.

[0064] Furthermore, to further investigate whether the GhPDF1 genomic region is subject to selection pressure, we calculated the interpopulation genetic differentiation index (FST) and nucleotide diversity (π) ratio for the target gene's adjacent 4 Mb segment (chromosome D04: 3.65 Mb–7.65 Mb). The results showed that this gene segment had a higher FST value and a lower π ratio among materials with extreme fruit branch angles (see Appendix). Figure 9 The genetic differentiation index (FST) of GhPDF1 (2 Mb upstream and downstream) at location A and the nucleotide diversity ratio of GhPDF1 (2 Mb upstream and downstream) at location B suggest that the GhPDF1 genomic segment underwent intense artificial selection during the improvement of fruit branch angle varieties.

[0065] Serial Number: SEQ ID NO: 1 ATGGAGAGGCAAAGAAGCAAGCAGGTTTGTTTGTTGATGTGGGTTTTGGTTGCTGCCTTTTTCTCCCACAATAGGGTCATTGCAGTGACCTCCACTGGCCTTGGTGAGCAGAAAAACTACTATCCAGCTCCTGACCCTCATGCTGGAACTCCCCCTTCAGGTTCACATGGCACACCACCATCTTCAGGAGGTGGATCACCTCCCTCTCATGGAACCCCGTCACATGGAGGTGGTTACCACCCTTCACCAACACCATCAACGCCTTCGGGTGGAAATTGTGGAACTCCCCCACATGACCCTTCAACTCCATCAACACCATCACACACTCCTCCTCATGGTACTCCACCATCATCTGGAGGTGGTAGTCCCCCATCGTATGGAGGAGGCAGTCCCCCATCGTATGGAGGAGGCAGTCCCCCATCGTATGGAGGAGGCAGTCCCCCATCATACGGAGGTGGCAGTCCCCCATCATATGGAGGTGGCAGTCCACCAACTACTCCCATTGATCCAGGAACTCCAAGCATTCCCTCACCTCCATTCTTTCCTGCTCCAACTCCACCAATTGGTGGTACATGCGATTTCTGGAGGAGTCACCCCACACTGATATGGGGTCTGCTTGGTTGGTGGGGCACTGTAGGCAACGCATTTGGCGTGACCAACGCTCCTGGACTTGGAACAAGCATGAGCTTGCCCCAAGCACTTTCAAACACACGTACTGATGGACTTGGGGCGCTTTACCGGGAAGGAACAGCCTCATTTCTCAACTCCATGGTGAATAATAGGTTCCCATTCTCGACTAAGCAAGTCAGGGAGACTTTTGTTGCAGCACTTGGTTCAAACAGCGCTGCAGCAGCTCAGGCTCGTCTCTTCAAGCTTGCCAATGAAGGCCACCTCAAGCCAAGGACCTAA SEQ ID NO: 2 GAGATGGAGAGGCAAAGAAGC SEQ ID NO: 3 TTGCTTAGGTCCTTGGCTTG SEQ ID NO: 4 GTGGCAGTCCACCAACTACTCCCATTGATCCAGGAACTCCAAGCATTCCCTCACCTCCATTCTTTCCTGCTCCAACTCCACCAATTGGTGGTACATGCGATTTCTGGAGGAGTCACCCCACACTGATATGGGGTCTGCTTGGTTGGTGGGGCACTGTAGGCAACGCATTTGGCGTGACCAACGCTCCTGGACTTGGAACAAGCATGAGCTTGCCCCAAGCACTTTCAAACACACGTACTGATGGACTTGGGGCGCTTTACCGGGAAGGAACAGCCTCATTTCTCAACTCCATGGTGAATAATAGGTTCCCATTCTCGACTAAGCAAGTCAGGGAGACTTTTGTTGCAGCACTTGGTTCAAACAGCGCTGCAGCAGCTCAGGCTCGTCTCTTCAAGCTTGC SEQ ID NO: 5 CCGCCCATGTTCCATGAGT SEQ ID NO: 6 GCAGCAACCAAAACCCACAT SEQ ID NO: 7 CCGCCCATGTTCCATGAGTTGAAGTCCTCGTTAGAAAGACCATTTCAAGTTCAGCATTGTTTCAGCAATTCAAAAGTTAATAATTAATACAAACATATAAATGCACCTGCTGTCATCAACTAACCTCATGCAGGTTCACCTGTTTCATTTACTTCACCTAGTTAGTGCTTTATATTGATCATCCCCCTCATTCTTCTCAACTCACACATCTTCCAATCTTTCATTCTTTGCTGTTGAAGTAGTAATATCTATAGCATACAGAGATGGAGAGGCAAAGAAGCAAGCAGGTTTGTTTGTTGATGTGGGTTTTGGTTGCTGC SEQ ID NO: 8 CCGCCCATGTTCCATGAGT SEQ ID NO: 9 GCAGCAACCAAAACCCACAT Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A type of upland cotton GhPDF1 Genes, characterized by, The GhPDF1 The coding region sequence of the gene is shown in SEQ ID NO:

1.

2. The upland cotton according to claim 1 GhPDF1 Genes, characterized by, The GhPDF1 The gene ID is GH_D04G0386.1 The specific primers include an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO:

3.

3. A kind GhPDF1 The application of genes in regulating the fruit branch angle of upland cotton, for use in an upland cotton product as described in claim 1. GhPDF1 Genes, characterized by, It is used to regulate the angle between fruiting branches in upland cotton, or to cultivate upland cotton varieties with a compact plant type. GhPDF1 Genes regulate the angle between fruiting branches of upland cotton by controlling the cell size at the junction of the fruiting branches and the main stem.

4. The one according to claim 3 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The regulation of the fruit branch angle of upland cotton includes inhibiting the above GhPDF1 The steps of gene expression include: Construct a viral gene silencing recombinant vector containing a VIGS silencing fragment; The recombinant vector was introduced into upland cotton cells, causing the... GhPDF1 Gene expression is suppressed.

5. The one according to claim 4 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The VIGS silencing fragment is targeted at... GhPDF1 The gene coding region was designed, and its nucleotide sequence is shown in SEQ ID NO:

4.

6. The one according to claim 4 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The method of introduction is Agrobacterium-mediated injection, and the introduction steps include: mixing Agrobacterium bacterial solution containing the recombinant vector with Agrobacterium bacterial solution containing an auxiliary vector, and injecting the mixture into the cotyledons of upland cotton to infect them.

7. The one according to claim 3 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The application also includes cytological testing of the treated plants, including preparing paraffin sections at the junction of the fruit branches and the main stem and observing the number of cortical parenchyma cells.

8. The one according to claim 3 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The regulation of the fruit branch angle of upland cotton also includes screening plants through molecular marker-assisted breeding, the method comprising: Extracting genomic DNA from upland cotton; Regarding the GhPDF1 Genotyping is performed using G / C single nucleotide polymorphism sites in the coding region of a gene.

9. The one according to claim 8 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The genotyping steps include: performing PCR amplification on the G / C single nucleotide polymorphism site using specific primers; sequencing the amplification products; and screening materials with the genotype GG based on the sequencing results; the nucleotide sequence of which is shown in SEQ ID NO:

7.

10. The method according to claim 9 GhPDF1 The application of genes in regulating the angle between fruiting branches in upland cotton is characterized by, The specific primers include an upstream primer as shown in SEQ ID NO: 8 and a downstream primer as shown in SEQ ID NO: 9.