A combination of vitamins, 2'-fucosyl lactose, and probiotics to enhance bone growth and / or bone strength.

A combination of vitamin K2, vitamin A, vitamin D, and SCFAs with synbiotics like 2'-fucosyl lactose and Bifidobacterium infantis addresses multiple micronutrient deficiencies, enhancing bone growth and strength by promoting osteoblast calcification and differentiation.

JP2026521121APending Publication Date: 2026-06-26SOCIETE DES PRODUITS NESTLE SA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
SOCIETE DES PRODUITS NESTLE SA
Filing Date
2024-05-24
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing nutritional interventions fail to effectively address multiple micronutrient deficiencies that lead to stunted growth and bone abnormalities in children, necessitating a synergistic approach to enhance bone growth and strength.

Method used

A combination of vitamin K2, vitamin A, vitamin D, and short-chain fatty acids (SCFAs) with synbiotics, including 2'-fucosyl lactose and Bifidobacterium infantis, promotes osteoblast calcification and differentiation, enhancing bone mineralization and strength.

Benefits of technology

The combination synergistically enhances bone growth and strength by promoting osteoblast activity and mineralization, particularly in children with stunted growth, through improved vitamin K2 production and osteoblast differentiation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026521121000002
    Figure 2026521121000002
  • Figure 2026521121000003
    Figure 2026521121000003
  • Figure 2026521121000004
    Figure 2026521121000004
Patent Text Reader

Abstract

The present invention provides a combination of vitamin mixtures and synbiotics for use in enhancing bone growth and / or bone strength, for example, in children suffering from and / or developmental delay.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to compositions and methods for enhancing bone growth and / or bone strength in children who have suffered from and / or are suffering from stunted growth and / or faltering growth. [Background technology]

[0002] Human skeletal growth and development require an adequate supply of a wide variety of nutritional factors. Classical nutritional deficiencies are associated with stunted growth (e.g., energy, protein, zinc), rickets (e.g., vitamin D), and other bone abnormalities (e.g., copper, zinc, vitamin C). There is evidence suggesting that maximum bone mass and subsequent fracture risk are influenced by patterns of growth and nutritional exposure during childhood. However, defining dietary reference values ​​using bone health as a criterion is difficult, and the question of which type of diet constitutes the best support for optimal bone growth and development remains unresolved (see, for example, Prentice, A., et al., 2006. Proceedings of the Nutrition Society, 65(4), pp.348-360).

[0003] To improve the intake of growth-limiting nutrients, several approaches can be taken, including administering micronutrient supplements, fortifying foods with micronutrients, or improving dietary intake. However, in populations with poor dietary quality, deficiencies in multiple micronutrients may occur simultaneously, in which case growth may be affected by two or more growth-limiting nutrients (see, for example, Rivera, JA, et al., 2003. The Journal of Nutrition, 133(11), pp. 4010S-4020S).

[0004] Therefore, new nutritional interventions are needed, for example, to enhance bone growth and / or bone strength in children suffering from stunted growth and / or developmental delay. [Overview of the Initiative]

[0005] The inventors have surprisingly discovered that a combination of vitamin K2, vitamin A, and vitamin D synergistically promotes osteoblast calcification. Furthermore, the inventors have surprisingly discovered that a combination of vitamin K2, vitamin A, and vitamin D with short-chain fatty acids (SCFAs) synergistically promotes osteoblast differentiation. SCFAs can be produced, for example, by the fermentation of oligosaccharides in the intestines by probiotic bacteria.

[0006] In one embodiment, the present invention provides a combination of a vitamin mixture and synbiotics for use in enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A and vitamin D.

[0007] In another embodiment, the present invention provides the use of a combination of a vitamin mixture and synbiotics in the manufacture of a medical food for enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A and vitamin D.

[0008] In another embodiment, the present invention provides a method for enhancing bone growth and / or bone strength in a subject, comprising the step of administering to the subject an effective amount of a combination of a vitamin mixture and a synbiotic, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A and vitamin D.

[0009] The subjects may be any suitable subjects, and in particular, the subjects may be children or young people. The subjects may be human children. For example, the subjects may be humans about 3 years of age or older and / or about 10 years of age or younger. In some embodiments, the subjects are humans about 3 to 10 years of age. Alternatively, the subjects may be young animals, for example, young pets. The subjects may have had or may have had stunted growth and / or developmental delay. The subjects may have been premature infants, low birth weight infants, and / or experienced intrauterine growth restriction.

[0010] Synbiotics may be any suitable mixture of prebiotics and probiotics. For example, a synbiotic may contain 2'-fucosyl lactose (2'FL) and one or more probiotics. For example, a synbiotic may contain 2'-fucosyl lactose 2'FL and Bifidobacterium infantis.

[0011] The synbiotics may contain an oligosaccharide mixture. The oligosaccharide mixture may be any suitable mixture of two or more oligosaccharides. For example, the oligosaccharide mixture may contain or consist of 2'-fucosyl lactose (2'FL) and at least one further oligosaccharide. Preferably, the at least one further oligosaccharide contains or consists of at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide. Preferably, the at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof. In some embodiments, at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof. In some embodiments, at least one sialyl oligosaccharide is 6'-sialyl lactose (6'-SL). Preferably, at least one fucosyl oligosaccharide is selected from the group consisting of 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), lacto-N-difucosylhexaose-I (LNDFH-1), lacto-N-neofucosylhexaose (LNnDFH), monofucosyl lacto-n-hexaose-III (MFNLH-III), difucosyl lacto-N-hexaose-a (DFLNHa), and combinations thereof. In some embodiments, at least one fucosyl oligosaccharide is difucosyl lactose (diFL).Preferably, at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, at least one N-acetyloligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, at least one N-acetyloligosaccharide is lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT). Preferably, the oligosaccharide mixture contains (a) at least one sialyl oligosaccharide in about 10 to about 35% by weight, about 10 to about 30% by weight, or about 10 to about 25% by weight relative to the total weight of the oligosaccharide mixture; (b) at least one fucosyl oligosaccharide in about 30 to about 80% by weight, about 40 to about 80% by weight, or about 50 to about 70% by weight relative to the total weight of the oligosaccharide mixture; and / or (c) at least one N-acetyl oligosaccharide in about 10 to about 35% by weight, about 15 to about 30% by weight, or about 15 to about 20% by weight relative to the total weight of the oligosaccharide mixture.

[0012] The synbiotics may contain any suitable probiotics. Preferably, one or more probiotics include or consist of Bifidobacterium infantis. In some embodiments, the synbiotics include a probiotic mixture containing B. infantis and at least one further probiotic. Preferably, at least one further probiotics include or consist of Bifidobacterium animalis and / or Lactobacillus rhamnosus.

[0013] The combination can be administered by any suitable route. Preferably, the combination is administered orally. The combination can be administered separately, simultaneously, or sequentially. In some embodiments, the combination is administered simultaneously.

[0014] The combination can be administered to the subject in any appropriate amount. Preferably, vitamin K2 is administered to the subject at a dose of about 5 μg / day to about 200 μg / day. Preferably, vitamin A is administered to the subject at a dose of about 100 μgRE / day to about 1000 μgRE / day. Preferably, vitamin D is administered to the subject at a dose of about 2.5 μg / day to about 100 μg / day. Preferably, 2'FL is administered to the subject at a dose of about 0.5 g / day to about 5 g / day. Preferably, B. infantis is administered at a dose of about 10 6 cfu / day ~ approximately 10 12 The total dose of cfu / day is administered to the target individual.

[0015] The combination may be provided in any suitable form, for example, in the form of a composition. The combination may be provided in the form of a nutritional composition. The combination may be provided in the form of a medical food for clinical nutrition. The combination may also be provided in the form of a milk formula.

[0016] The composition may contain any combination in appropriate amounts. Preferably, the composition contains vitamin K2 in an amount of about 5 μg / 100g to about 200 μg / 100g on a dry weight basis. Preferably, the composition contains vitamin A in an amount of about 100 μgRE / 100g to about 1000 μgRE / 100g on a dry weight basis. Preferably, the composition contains vitamin D in an amount of about 2.5 μg / 100g to about 20 μg / 100g, or about 5 μg / 100g to about 20 μg / 100g on a dry weight basis. Preferably, the composition contains 2'FL in an amount of about 0.5% to about 5% on a dry weight basis. Preferably, the composition contains about 10 6 cfu / 100g ~ approx. 10 12 Contains B. infantis at a cfu / 100g level.

[0017] This combination may synergistically enhance bone growth and / or bone strength. This combination may enhance bone mineralization. This combination may promote osteoblast mineralization and / or osteoblast differentiation. This combination may promote catch-up growth. Preferably, catch-up growth is measured using height velocity.

[0018] The inventors also surprisingly found that vitamin K2 production in the gastrointestinal tract (e.g., via the conversion of vitamin K1) is promoted by synbiotics.

[0019] In another aspect, the present invention provides the use of synbiotics to promote vitamin K2 production in the target intestine. The synbiotics may be any of those described herein.

[0020] In another aspect, the present invention provides a method for promoting vitamin K2 production in the intestine of a subject, comprising administering an effective amount of a synbiotic to the subject. The synbiotic may be any of those described herein. [Brief explanation of the drawing]

[0021] [Figure 1] Effects of vitamin K2, vitamin A, and vitamin D on osteoblast alkaline phosphatase (ALP) activity and osteocalcin mRNA levels in preosteoblast cell lines. (A) ALP activity 7 days after differentiation (without ascorbic acid). (B) Osteocalcin mRNA levels 21 days after differentiation (without ascorbic acid). (C) Osteocalcin mRNA levels 28 days after differentiation (with ascorbic acid). Pos = positive control; Neg = negative control; MK-7 = 3 μM menaquinone-7 added; VitD = 1 nM 1α,25-dihydroxyvitamin D3 added; VitA = 100 nM all-trans retinoic acid added. [Figure 2]Effects of vitamin K2, vitamin A, vitamin D, and short-chain fatty acids (SCFAs) on osteoblast ALP activity in pre-osteoblast cell lines. ALP activity after 7 days of differentiation (without ascorbic acid). Pos = positive control; Neg = negative control; MK-7 + A + D = 3 μM menaquinone-7, 1 nM 1α,25-dihydroxyvitamin D3, and 100 nM all-trans retinoic acid added; SCFA 20 μM = 15 μM sodium acetate, 4 μM sodium propionate, and 1 μM sodium butyrate added; SCFA 50 μM = 37.5 μM sodium acetate, 10 μM sodium propionate, and 2.5 μM sodium butyrate added; SCFA 60 μM = 45 μM sodium acetate, 12 μM sodium propionate, and 3 μM sodium butyrate added. [Figure 3-1] The effects of human milk oligosaccharides (HMOs) on vitamin K2 production in an intestinal model were evaluated. The following groups were evaluated: blank; single HMO (1.3 g / L of 2FL); HMO mix (2.5 g / L of 2FL, DiFL, LNnT, LNT, and 6SL); B. infantis (107 cfu / mL); single HMO + B. infantis; HMO mix + B. infantis. (B) The following groups were evaluated (in the milk matrix): no LPR added (no L. rhamnosus LPR added); and with LPR added (4.5 × 107 cfu / mL L. rhamnosus LPR). [Figure 3-2] The effects of human milk oligosaccharides (HMOs) on vitamin K2 production in an intestinal model were evaluated. The following groups were evaluated: blank; single HMO (1.3 g / L of 2FL); HMO mix (2.5 g / L of 2FL, DiFL, LNnT, LNT, and 6SL); B. infantis (107 cfu / mL); single HMO + B. infantis; HMO mix + B. infantis. (B) The following groups were evaluated (in the milk matrix): no LPR added (no L. rhamnosus LPR added); and with LPR added (4.5 × 107 cfu / mL L. rhamnosus LPR). [Figure 4]Design of preclinical experiments: Growth retardation group (vitamin K1 administration): The number of pups per BALB / c mother mouse was increased by 50% from D8 to D18 to induce dietary restriction. Weaning was performed on D18 in both groups (normal group and growth retardation group). Subsequently, male and female mice were given free access to food for 30 days, with nutritional supplementation once a day via pipette feeding. [Figure 5]Figures 5A and 5B show histological evaluations of the effects of the vitamin K2AD+ synbiotic [2'-fucosyl lactose+B. infantis] on tibial growth plate cartilage. The tibia was placed in individual tissue cassettes sandwiched between foam and fixed in 10% (v / v) neutral buffered formalin at room temperature for at least 48 hours, decalcified in DC2 for at least 4 hours (if necessary), and then embedded in paraffin until further tissue processing. Two sagittal sections (5 μm) were microtome-excised and stained according to the standard hematoxylin-eosin (H&E) protocol. Histological morphometric analysis was performed on the resting cell layer, proliferative cell layer, pre-hypertrophic cell layer, and hypertrophic cell layer to evaluate the overall height of the growth plate and the height of each of these four regions (Guevara-Morales JM, Frohbergh M, Castro-Abril H, et al. Growth Plate Pathology in the Mucopolysaccharidosis Type VI Rat Model - An Experimental and Computational Approach. Diagnostics. 2020;10(6).doi:10.3390 / diagnostics10060360; Wilson K, Usami Y, Hogarth D, et al. Analysis of Association between Morphometric Parameters of Growth Plate and Bone Growth of Tibia in Mice and Humans.Cartilage.2020;13(2_suppl):315S-325S.doi:10.1177 / 1947603519900800). [Figure 6]Evaluation of the effects of the vitamin K2AD+ / - synbiotic [2'-fucosyl lactose + B. infantis] on trabecular bone connection density (Conn.D) and trabecular bone number (Tb.N) using microcomputed tomography of the femur. As previously reported, the trabecular microstructure at the distal metaphysis of the femur was evaluated using microcomputed tomography (μCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) (N. Bonnet, J. Brun, J. Crosseau, L. Duong, S. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7):1432-1441). Briefly, the trabecular bone region was evaluated using isotropic 6 μm voxels. To exclude primary trabecular bone, 30 slices of bone below the distal growth plate were excluded from the analysis. Eighty slices of the underlying secondary cancellous bone were analyzed. Morphometric variables were calculated from binarized images using a direct three-dimensional technique that does not depend on prior assumptions about the underlying structure (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, CLBenhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4):1286-97). Connectivity density (Conn.D) and trabecular number (Tb.N) were evaluated. [Figure 7]Evaluation of the effect of the vitamin K2AD+ synbiotic [2'-fucosyl lactose + B. infantis] on cortical bone mineral density (Ct.BMD) using microcomputed tomography of the femur. Microcomputed tomography (μCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) was used to evaluate the trabecular microstructure in the midshaft diaphysis of the femur, as previously reported (N. Bonnet, J. Brun, J. Crosseau, L. Duong, S. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7):1432-1441). Briefly, the cortical bone region was evaluated using isotropic 6 μm voxels. The femoral cortical structure was evaluated using 60 consecutive CT slides of the midshaft of the femur. Morphometric variables were calculated from binarized images using a direct three-dimensional technique that does not depend on prior assumptions about the underlying structure (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, CLBenhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4):1286-97). Cortical bone mineral density (Ct.BMD) was evaluated. [Figure 8]Evaluation of the effect of the Vit.K2AD+ synbiotic [2'-fucosyl lactose + B. infantis] on femoral strength by axial compression of the metaphysis. Sections 1.7 mm high were cut from the femur, and the metaphysis was separated. The metaphysical slices were compressed axially, and the biomechanical properties of the femur were tested as previously reported (Turner, DBBurr, Basic biomechanical measurements of bone: a tutorial, Bone, 1993, 14(4):595-608). Load was applied in compression mode at a nominal deformation rate of 2 mm / min until fracture. The load-displacement curve was recorded and the elastic energy was calculated. [Modes for carrying out the invention]

[0022] Herein, various preferred features and embodiments of the present invention are described by non-limiting examples. Those skilled in the art will understand that all features of the present invention disclosed herein can be combined without departing from the scope of the disclosed invention.

[0023] No reference to prior art documents in this specification should be considered an acknowledgment that such prior art is well known or that it forms part of a common general understanding in the art. All publications referenced herein are incorporated herein by reference.

[0024] As used herein, the words “comprises,” “comprising,” and similar words should not be interpreted as exclusive or exhaustive. In other words, they mean “including, but not limited to.” The terms “comprises,” “comprising,” etc., also include the term “consisting of.”

[0025] Unless otherwise specified, the implementation of the present invention will employ prior art that is within the capabilities of those skilled in the art. Such art is described in the literature. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as they are commonly understood by those skilled in the art.

[0026] Numerical ranges include the numerical values ​​that define the range, and all percentages disclosed herein are weight / weight unless otherwise specified. As used herein, the term “about” means approximately, nearly, roughly, or near. When the term “about” is used with a number or range, the value or range is modified by expanding the upper and lower boundaries of the stated number(s). Generally, the terms “about” and “near” are used herein to adjust numbers by more than 10% above and less than the stated value.

[0027] combination In one embodiment, the present invention provides a combination of vitamin mixtures and synbiotics for use in enhancing bone growth and / or bone strength in a subject.

[0028] The combinations of the present invention may also be referred to as combination therapy. As used herein, “combination therapy” may refer to a therapy comprising the administration of two or more active ingredients (agents), mixtures (e.g., vitamin mixtures, oligosaccharide mixtures and / or probiotic mixtures), or compositions (e.g., vitamin mixtures, oligosaccharide mixtures and / or probiotics).

[0029] The combination may be administered in any suitable form by any suitable route. Preferably, the combination is administered orally and / or enterally. In a preferred embodiment, the combination is administered orally. The combination may be administered separately, simultaneously, or sequentially. In a preferred embodiment, the combination is administered simultaneously.

[0030] Vitamin mixture The combination of the present invention includes a vitamin mixture. As used herein, "vitamin mixture" may refer to a mixture of two or more vitamins. Vitamins are organic micronutrients required by the body to perform various normal functions, and examples of vitamins include vitamin K2, vitamin A, vitamin D, vitamin C, folic acid, vitamin B3, vitamin B6, vitamin B12, and vitamin E.

[0031] The vitamin mixture used in this invention comprises or consists of vitamin K2, vitamin A, and vitamin D. Surprisingly, the inventors have found that the combination of vitamin K2, vitamin A, and vitamin D synergistically promotes osteoblast calcification.

[0032] Vitamin K2 Vitamin K2 (menaquinone) is one of the three types of vitamin K. The other two are vitamin K1 (phylloquinone) and K3 (menadione), which may have the following general formula.

[0033] [ka]

[0034] Vitamin K2 is composed of various forms with different numbers (n) of isoprenyl units, where n can range from 4 to 13. These different forms are indicated by the suffix (-n); for example, menaquinone-7 (MK-7) has 7 isoprenyl units (n=7).

[0035] Preferably, vitamin K2 comprises or consists of menaquinone-4 (MK-4), menaquinone-5 (MK-5), menaquinone-6 (MK-6), menaquinone-7 (MK-7), menaquinone-8 (MK-8), and menaquinone-9 (MK-9). Preferably, vitamin K2 comprises or consists of menaquinone-7 (MK-7), menaquinone-8 (MK-8), and menaquinone-9 (MK-9). In some embodiments, vitamin K2 comprises or consists of menaquinone-7 (MK-7). In some embodiments, vitamin K2 consists of menaquinone-7 (MK-7).

[0036] Surprisingly, the inventors have discovered that vitamin K2 production in the gastrointestinal tract (e.g., via the conversion of vitamin K1) is promoted by synbiotics.

[0037] In one embodiment, the present invention provides the use of synbiotics to promote vitamin K2 production in the target intestine.

[0038] In one embodiment, the present invention provides a method for promoting vitamin K2 production in the intestines of a subject, comprising administering an effective amount of synbiotics to the subject.

[0039] The synbiotics may be any of those described herein. In some embodiments, the synbiotics comprises one or more oligosaccharides and one or more probiotics. For example, the synbiotics may comprise 2'-fucosyl lactose (2'FL) and one or more probiotics. For example, the synbiotics may comprise 2'-fucosyl lactose (2'FL) and Bifidobacterium infantis.

[0040] In some embodiments, the synbiotics promote de nobomenaquinone-7 production in the target gut (e.g., by the gut microbiota). In some embodiments, the synbiotics promote the bioconversion of phylloquinone to menaquinone-4 in the target gut (e.g., by the gut microbiota).

[0041] Vitamin A Vitamin A comprises a family of molecules containing 20 carbon atoms, comprising a methyl-substituted cyclohexenyl ring (beta-ionone ring) and a tetraene side chain having a hydroxyl group (retinol), an aldehyde group (retinal), a carboxylic acid group (retinoic acid), or an ester group (retinyl ester) at the 15th carbon atom. The term vitamin A may also include provitamin A carotenoids, which are food-derived precursors of retinol. Of the many carotenoids found in nature, several, including α-carotene, β-carotene, and β-cryptoxanthin, possess provitamin A nutritional activity.

[0042] The amount of vitamin A may be referred to in terms of retinol equivalents (RE) or retinol activity equivalents (RAE). For the food-derived provitamin A carotenoids β-carotene, α-carotene, and β-cryptoxanthin, the REs are set at 6 μg, 12 μg, and 12 μg, respectively. Using μgRAE, the vitamin A activity of provitamin A carotenoids is estimated to be half the vitamin A activity when μgRE is used. For the food-derived provitamin A carotenoids β-carotene, α-carotene, and β-cryptoxanthin, the RAEs are set at 12 μg, 24 μg, and 24 μg, respectively. (For example, see Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc. Washington (DC): National Academies Press (US); April 2001, Vitamin A.)

[0043] Vitamin D Vitamin D is a group of lipid-soluble secosteroids, including vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Calcitriol (also known as 1,25-dihydroxyvitamin D) is the active form of vitamin D. Preferably, vitamin D includes or consists of vitamin D2 and vitamin D3. Preferably, vitamin D includes or consists of calcitriol.

[0044] Administration of vitamin K2, vitamin A, and vitamin D Subjects may be administered any appropriate amount of vitamin K2, vitamin A, and vitamin D in any appropriate form and via any appropriate route of administration (e.g., via any form and route described herein).

[0045] The appropriate dosage of vitamin K2 is described, for example, in Koziol-Kozakowska, A. and Maresz, K., 2022. Children, 9(1), p.78 and European Food Safety Authority (EFSA), 2008. EFSA Journal, 6(11), p.822. The appropriate dosage of vitamin A is described, for example, in Ross, AC and Moran, NE, 2020. Current Developments in Nutrition, 4(10), p.nzaa096 and EFSA Panel on Dietetic Products, Nutrition, and Allergies (NDA), 2015. EFSA Journal, 13(3), p.4028. The appropriate dosage of vitamin D is described, for example, in Greer, FR, 2004. The American Journal of Clinical Nutrition, 80(6), pp. 1759S-1762S and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2016. EFSA Journal, 14(10), p. e04547.

[0046] Preferably, vitamin K2 is administered to the subject in amounts of at least about 0.5 μg / kg / day, at least about 1 μg / kg / day, or at least about 2 μg / kg / day. Preferably, vitamin K2 is administered to the subject in amounts of about 10 μg / kg / day or less, about 7.5 μg / kg / day or less, or about 5 μg / kg / day or less. Preferably, vitamin K2 is administered to the subject in amounts of about 0.5 μg / kg / day to about 10 μg / kg / day, about 1 μg / kg / day to about 7.5 μg / kg / day, or about 2 μg / kg / day to about 5 μg / kg / day.

[0047] Preferably, vitamin K2 is administered to the subject in amounts of at least about 5 μg / day, at least about 10 μg / day, at least about 15 μg / day, at least about 20 μg / day, at least about 25 μg / day, or at least about 30 μg / day. Preferably, vitamin K2 is administered to the subject in amounts of about 200 μg / day or less, about 100 μg / day or less, about 90 μg / day or less, about 80 μg / day or less, about 70 μg / day or less, or about 60 μg / day or less. Preferably, vitamin K2 is administered to the subject in amounts of approximately 5 μg / day to approximately 200 μg / day, approximately 10 μg / day to approximately 100 μg / day, approximately 15 μg / day to approximately 90 μg / day, approximately 20 μg / day to approximately 80 μg / day, approximately 25 μg / day to approximately 70 μg / day, or approximately 30 μg / day to approximately 60 μg / day.

[0048] Preferably, vitamin A is administered to the subject in amounts of at least about 100 μgRE / day, at least about 200 μgRE / day, or at least about 300 μgRE / day. Preferably, vitamin A is administered to the subject in amounts of about 1000 μgRE / day or less, about 800 μgRE / day or less, about 600 μgRE / day or less, or about 400 μgRE / day or less. Preferably, vitamin A is administered to the subject in amounts of about 100 μgRE / day to about 1000 μgRE / day, about 200 μgRE / day to about 800 μgRE / day, about 300 μgRE / day to about 600 μgRE / day, or about 300 μgRE / day to about 400 μgRE / day.

[0049] Preferably, vitamin A is administered to the subject in amounts of at least about 100 μgRE / day, at least about 200 μgRAE / day, or at least about 300 μgRAE / day. Preferably, vitamin A is administered to the subject in amounts of about 1000 μgRAE / day or less, about 800 μgRAE / day or less, about 600 μgRAE / day or less, or about 400 μgRAE / day or less. Preferably, vitamin A is administered to the subject in amounts of about 100 μgRAE / day to about 1000 μgRAE / day, about 200 μgRAE / day to about 800 μgRAE / day, about 300 μgRAE / day to about 600 μgRAE / day, or about 300 μgRAE / day to about 400 μgRAE / day.

[0050] Preferably, vitamin D is administered to the subject in amounts of at least about 2.5 μg / day, at least about 5 μg / day, at least about 10 μg / day, or at least about 15 μg / day. Preferably, vitamin D is administered to the subject in amounts of about 100 μg / day or less, about 75 μg / day or less, or about 50 μg / day or less. Preferably, vitamin D is administered to the subject in amounts of about 2.5 μg / day to about 100 μg / day, about 5 μg / day to about 100 μg / day, about 10 μg / day to about 75 μg / day, or about 15 μg / day to about 50 μg / day. Preferably, vitamin D is administered to the subject in amounts of about 15 μg / day.

[0051] Preferably, vitamin K2 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A is administered at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, and vitamin D is administered at a dose of approximately 2.5 μg / day to approximately 100 μg / day.

[0052] Synbiotics The combinations of the present invention include synbiotics. As used herein, the term “synbiotics” may refer to ingredients that contain both probiotics and prebiotics (see, for example, Swanson, KS, et al., 2020. Nature Reviews Gastroenterology & Hepatology, 17(11), pp. 687–701).

[0053] In a preferred embodiment, the synbiotic comprises or consists of 2'-fucosyl lactose (2'FL) and one or more probiotics. In another preferred embodiment, the synbiotic comprises or consists of an oligosaccharide mixture and one or more probiotics.

[0054] Prebiotics The synbiotics used in the combination of the present invention may include one or more prebiotics. As used herein, the term “prebiotics” can refer to non-digestible components that benefit a target by selectively stimulating the growth of one or more microbial communities. Examples of prebiotics include human milk oligosaccharides. Examples of prebiotic oligosaccharides include galactooligosaccharides (GOS), fructooligosaccharides (FOS), 2'-fucosyl lactose, lacto-N-neo-tetraose, and inulin.

[0055] In some embodiments, the synbiotics include one or more oligosaccharides. Oligosaccharides are sugar polymers containing a small number (typically 2 to 10) monosaccharides and are one of the best-known prebiotics. Short-chain fatty acids (SCFAs), such as acetic acid, butyric acid, and propionic acid, can be produced by the fermentation of oligosaccharides in the intestines. In some embodiments, the synbiotics include an oligosaccharide mixture. As used herein, “oligosaccharide mixture” may refer to a mixture of two or more oligosaccharides.

[0056] The one or more oligosaccharides used in the present invention include or may consist of human milk oligosaccharides (HMOs). Many different types of HMOs are found in human milk and are typically based on combinations of glucose, galactose, sialic acid (N-acetylneuraminic acid), fucose and / or N-acetylglucosamine, and many different bonds between them. Almost all HMOs have a lactose moiety at the reducing end, and the non-reducing end portion is occupied by sialic acid and / or fucose (if present). HMOs can be acidic (e.g., charged sialic acid-containing oligosaccharides) or neutral (e.g., fucosyl oligosaccharides).

[0057] Preferably, one or more oligosaccharides may include at least one fucosyl oligosaccharide, at least one sialyl oligosaccharide, and / or at least one N-acetyl oligosaccharide. In some embodiments, one or more oligosaccharides include or consist of at least one fucosyl oligosaccharide, at least one sialyl oligosaccharide, and at least one N-acetyl oligosaccharide. In some embodiments, one or more oligosaccharides include or consist of 2'-fucosyl lactose (2'FL), difucosyl lactose (diFL), 6'-sialyl lactose (6'-SL), lacto-N-tetraose (LNT), and lacto-N-neotetraose (LNnT). In some embodiments, the oligosaccharide comprises or consists of 2'-fucosyl lactose (2'FL), difucosyl lactose (diFL), 6'-sialyl lactose (6'-SL), 3'-sialyl lactose (3'-SL), lacto-N-tetraose (LNT), and lacto-N-neotetraose (LNnT).

[0058] In some embodiments, one or more oligosaccharides include at least one fucosyl oligosaccharide in about 30 to about 80% by weight, about 40 to about 80% by weight, or about 50 to about 70% by weight, relative to the total weight of the oligosaccharides. In some embodiments, one or more oligosaccharides include at least one sialyl oligosaccharide in about 10 to about 35% by weight, about 10 to about 30% by weight, or about 10 to about 25% by weight, relative to the total weight of the oligosaccharides. In some embodiments, one or more oligosaccharides include at least one N-acetyl oligosaccharide in about 10 to about 35% by weight, about 15 to about 30% by weight, or about 15 to about 20% by weight, relative to the total weight of the oligosaccharides.

[0059] In some embodiments, the oligosaccharide comprises or consists of at least one fucosyl oligosaccharide in an amount of about 30 to about 80% by weight, about 40 to about 80% by weight, or about 50 to about 70% by weight relative to the total weight of the oligosaccharide, and at least one N-acetyl oligosaccharide in an amount of about 10 to about 35% by weight, about 15 to about 30% by weight, or about 15 to about 20% by weight relative to the total weight of the oligosaccharide.

[0060] In some embodiments, the oligosaccharide comprises or consists of one or more oligosaccharides, in an amount of about 30 to about 80% by weight, about 40 to about 80% by weight, or about 50 to about 70% by weight, relative to the total weight of the oligosaccharides, at least one fucosyl oligosaccharide in an amount of about 10 to about 35% by weight, about 10 to about 30% by weight, or about 10 to about 25% by weight, relative to the total weight of the oligosaccharides, and at least one N-acetyl oligosaccharide in an amount of about 10 to about 35% by weight, about 15 to about 30% by weight, or about 15 to about 20% by weight, relative to the total weight of the oligosaccharides.

[0061] Oligosaccharides can be obtained by any suitable method. Suitable methods for synthesizing oligosaccharides are well known to those skilled in the art. For example, processes for producing oligosaccharides have been developed by microbial fermentation, enzymatic processes, chemical synthesis, or combinations thereof (see, for example, Zeuner et al., 2019. Molecules, 24(11), p.2033).

[0062] Fucosyl oligosaccharide In some embodiments, the oligosaccharide comprises or consists of at least one fucosyl oligosaccharide.

[0063] Non-limiting examples of fucosyl oligosaccharides include 2'-fucosyl lactose (2'FL), 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose, e.g., lacto-N-fucopentaose I (LNFP-I), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III) or lacto-N-fucopentaose V (LNFP-V), lacto-N-fucohexaose, lacto-N-difucohexaose I, lacto-neofucopentaose V (LNnFP-V), lacto-N-difucosylhexaose-I (LNDFH-1), lacto-N-neodifucosylhexaose Examples include ose (LNnDFH), fucosyllacto-N-hexaose, fucosyllacto-N-neohexaose (e.g., fucosyllacto-N-neohexaose I, fucosyllacto-N-neohexaose II), monofucosyllacto-n-hexaose-III (MFNLH-III), difucosyllacto-N-hexaose I, difucolact-N-neohexaose, difucosyllacto-N-neohexaose I, difucosyllacto-N-neohexaose II, difucosyllacto-N-hexaose-a (DFLNHa), fucosyl-para-lacto-N-hexaose, tri-fucopara-lacto-N-hexaose I, and combinations thereof.

[0064] In a preferred embodiment, at least one fucosyl oligosaccharide comprises or consists of 2'-fucosyl lactose (2'FL), which is typically the most common HMO naturally occurring in human breast milk.

[0065] In some embodiments, at least one fucosyl oligosaccharide is selected from the group consisting of 2'-fucosyl lactose (2'FL), difucosyl lactose (diFL), and combinations thereof. In some embodiments, at least one fucosyl oligosaccharide comprises or consists of 2'-fucosyl lactose (2'FL) and difucosyl lactose (diFL).

[0066] Fucosyl oligosaccharides can be obtained by any suitable method. For example, 2'FL can be produced by biotechnological methods using specific fucosyltransferases and / or fucosidases, either by using enzyme-based fermentation techniques (recombinant or natural enzymes) or microbial fermentation techniques. In the latter case, microorganisms can be manipulated to express or produce their respective natural enzymes and substrates. Alternatively, 2'FL can be produced by chemical synthesis from lactose and free fucose. diFL can be synthesized by enzymatic, biotechnological, and / or chemical processes.

[0067] sialyl oligosaccharide In some embodiments, one or more oligosaccharides include at least one sialyl oligosaccharide.

[0068] Non-exclusive examples of sialyl oligosaccharides include 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof.

[0069] In some embodiments, at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof. In some embodiments, at least one sialyl oligosaccharide includes or consists of 6'-sialyl lactose (6'-SL). In some embodiments, at least one sialyl oligosaccharide includes or consists of 6'-sialyl lactose (6'-SL) and 3'-sialyl lactose (3'-SL).

[0070] Sialyl oligosaccharides can be obtained by any preferred method. For example, 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL) can be isolated from natural sources such as animal milk by chromatography or filtration techniques. Alternatively, 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL) can be produced by biotechnological methods using specific sialyltransferases or sialidases, neuraminidases, either by enzyme-based fermentation techniques (recombinant or natural enzymes), chemical synthesis, or microbial fermentation techniques. In the latter case, microorganisms can be manipulated to express or produce their respective natural enzymes and substrates. Single-microbial cultures or mixed cultures can be used. The formation of sialyl oligosaccharides can be initiated from acceptor substrates of any degree of polymerization (DP), DP=1 or greater. Alternatively, sialyl lactose can be produced by chemical synthesis from lactose and free N'-acetylneuraminic acid (sialic acid). Sialyl lactose is also commercially available, for example, from Kyowa Hakko Kogyo (Japan) or GeneChem (Korea).

[0071] If one or more oligosaccharides include 3'-sialyl lactose (3'-SL) and 6'-sialyl lactose (6'-SL), it may be particularly beneficial if such 3'-sialyl lactose (3'-SL) and 6'-sialyl lactose (6'-SL) are included in the nutritional composition in a weight ratio of approximately 10:1 to approximately 1:10, for example, approximately 10:1 to approximately 2:1, approximately 8:1 to approximately 3:1, approximately 6:1 to approximately 3:1, approximately 5:1 to approximately 3:1, approximately 5:1 to approximately 4:1, or approximately 1:2 to approximately 1.5:1.

[0072] N-acetyloligosaccharide In some embodiments, one or more oligosaccharides include at least one N-acetyloligosaccharide.

[0073] Preferably, at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, and combinations thereof. Non-limiting examples of N-acetyloligosaccharides include LNT (lacto-N-tetraose), para-lacto-N-neohexaose (para-LNnH), LNnT (lacto-N-neotetraose), and any combination thereof. Other examples include lacto-N-hexaose, lacto-N-neohexaose, para-lacto-N-hexaose, para-lacto-N-neohexaose, lacto-N-octaose, lacto-N-neooctaose, isolact-N-octaose, para-lacto-N-octaose, and lacto-N-decaose.

[0074] In some embodiments, at least one N-acetyloligosaccharide is selected from the group consisting of lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, at least one N-acetyloligosaccharide comprises or consists of lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT).

[0075] N-acetyloligosaccharides can be obtained by any preferred method. For example, LNnT can be chemically synthesized by enzymatic transfer of sugar units from the donor to the acceptor using glycosyltransferase. Alternatively, LNnT can be prepared by chemically converting free or oligosaccharide-bound ketohexoses (e.g., fructose) to N-acetylhexosamine or N-acetylhexosamine-containing oligosaccharides. LNT can be synthesized by enzymatic, biotechnological, and / or chemical processes.

[0076] Administration of oligosaccharides Subjects may be administered any appropriate amount of oligosaccharides in any appropriate form and via any appropriate route of administration (e.g., via any form and route described herein).

[0077] Appropriate doses of human oligosaccharides are described, for example, in EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2015. EFSA Journal, 13(11), p.4299; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(6), p.e05717; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2020. EFSA Journal, 18(5), p.e06097; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2022. EFSA Journal, 20(5), p.e07331; and EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(12), p.e05907.

[0078] Preferably, one or more oligosaccharides are administered to the subject in amounts of at least approximately 0.5 g / day, at least approximately 1 g / day, or at least approximately 2 g / day. Preferably, one or more oligosaccharides are administered to the subject in amounts of approximately 10 g / day or less, approximately 8 g / day or less, or approximately 5 g / day or less. Preferably, one or more oligosaccharides are administered to the subject in amounts of approximately 0.5 g / day to approximately 10 g / day, approximately 1 g / day to approximately 8 g / day, or approximately 2 g / day to approximately 5 g / day.

[0079] Preferably, 2'FL is administered to the subject in amounts of at least about 0.5 g / day, at least about 0.8 g / day, or at least about 1 g / day. Preferably, 2'FL is administered to the subject in amounts of about 5 g / day or less, about 4 g / day or less, or about 3 g / day or less. Preferably, 2'FL is administered to the subject in amounts of about 0.5 g / day to about 5 g / day, about 0.8 g / day to about 4 g / day, or about 1 g / day to about 3 g / day.

[0080] Preferably, diFL is administered to the subject in amounts of at least about 0.1 g / day, at least about 0.15 g / day, or at least about 0.2 g / day. Preferably, diFL is administered to the subject in amounts of about 1 g / day or less, about 0.8 g / day or less, or about 0.6 g / day or less. Preferably, diFL is administered to the subject in amounts of about 0.1 g / day to about 1 g / day, about 0.15 g / day to about 0.8 g / day, or about 0.2 g / day to about 0.6 g / day.

[0081] Preferably, 6'-SL is administered to the subject in amounts of at least approximately 0.1 g / day, at least approximately 0.15 g / day, or at least approximately 0.2 g / day. Preferably, 6'-SL is administered to the subject in amounts of approximately 1 g / day or less, approximately 0.8 g / day or less, or approximately 0.6 g / day or less. Preferably, 6'-SL is administered to the subject in amounts of approximately 0.1 g / day to approximately 1 g / day, approximately 0.15 g / day to approximately 0.8 g / day, or approximately 0.2 g / day to approximately 0.6 g / day.

[0082] Preferably, 3'-SL is administered to the subject in amounts of at least approximately 0.1 g / day, at least approximately 0.15 g / day, or at least approximately 0.2 g / day. Preferably, 3'-SL is administered to the subject in amounts of approximately 1 g / day or less, approximately 0.8 g / day or less, or approximately 0.6 g / day or less. Preferably, 3'-SL is administered to the subject in amounts of approximately 0.1 g / day to approximately 1 g / day, approximately 0.15 g / day to approximately 0.8 g / day, or approximately 0.2 g / day to approximately 0.6 g / day.

[0083] Preferably, LNT is administered to the subject in amounts of at least approximately 0.2 g / day, at least approximately 0.3 g / day, or at least approximately 0.4 g / day. Preferably, LNT is administered to the subject in amounts of approximately 2.5 g / day or less, approximately 2 g / day or less, or approximately 1.5 g / day or less. Preferably, LNT is administered to the subject in amounts of approximately 0.2 g / day to approximately 2.5 g / day, approximately 0.3 g / day to approximately 2 g / day, or approximately 0.4 g / day to approximately 1.5 g / day.

[0084] Preferably, LNnT is administered to the subject in amounts of at least approximately 0.2 g / day, at least approximately 0.3 g / day, or at least approximately 0.4 g / day. Preferably, LNnT is administered to the subject in amounts of approximately 2.5 g / day or less, approximately 2 g / day or less, or approximately 1.5 g / day or less. Preferably, LNnT is administered to the subject in amounts of approximately 0.2 g / day to approximately 2.5 g / day, approximately 0.3 g / day to approximately 2 g / day, or approximately 0.4 g / day to approximately 1.5 g / day.

[0085] Preferably, vitamin K2 is administered to the subject at a rate of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a rate of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a rate of approximately 2.5 μg / day to approximately 100 μg / day, and one or more oligosaccharides are administered to the subject in a total amount of approximately 0.5 g / day to approximately 10 g / day. Preferably, 2'FL is administered to the subject at a rate of approximately 0.5 g / day to approximately 5 g / day. diFL is administered to the subject at a rate of approximately 0.1 g / day to approximately 1 g / day; 6'-SL is administered to the subject at a rate of approximately 0.1 g / day to approximately 1 g / day; 3'-SL is administered to the subject at a rate of approximately 0.1 g / day to approximately 1 g / day; and LNT is administered to the subject at a rate of approximately 0.2 g / day to approximately 2.5 g / day. And / or LNnT is administered to the subject at a dose of approximately 0.2 g / day to approximately 2.5 g / day.

[0086] Preferably, vitamin K2 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, and 2'FL at a dose of approximately 0.5 g / day to approximately 5 g / day.

[0087] Probiotics The synbiotics used in the combination of the present invention comprises one or more probiotics. As used herein, the term “probiotics” may refer to a component containing a sufficient number of viable microorganisms to alter the target gut microbiota (see, for example, Hill, C., et al., 2014. Nature reviews Gastroenterology & hepatology, 11(8), p. 506). Preferably, the one or more probiotics comprises one or more commercially available probiotic strains and / or strains that have been shown to have health benefits (see, for example, Fijan, S., 2014. International journal of environmental research and public health, 11(5), pp. 4745-4767). Examples of probiotic microorganisms include Bifidobacterium, Lactobacillus, Limosilactobacillus, Lacticaseibacillus, Saccharomyces, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, and Escherichia coli. In some embodiments, synbiotics include a probiotic mixture. As used herein, “probiotic mixture” may refer to a mixture of two or more probiotics.

[0088] In some embodiments, one or more probiotics include or consist of Bifidobacterium, Lactobacillus, Limosilactobacillus, and / or Lacticaseibacillus.

[0089] In some embodiments, one or more probiotics include or consist of Bifidobacterium longum, Bifidobacterium animalis and / or Lactobacillus rhamnosus. In some embodiments, one or more probiotics include or consist of Bifidobacterium longum and / or Bifidobacterium animalis. In some embodiments, one or more probiotics include or consist of Bifidobacterium longum and / or Bifidobacterium animalis.

[0090] Bifidobacterium longum In a preferred embodiment, one or more probiotics include or consist of Bifidobacterium longum.

[0091] Bifidobacterium longum is a bacterium found in the human digestive tract. In 2002, three previously considered separate species of Bifidobacterium—B. infantis, B. longum, and B. suis—were merged into a single species named B. longum, encompassing the respective biotypes of infantis, longum, and suis (Sakata, S., et al., 2002. International Journal of Systematic and Evolutionary Microbiology, 52(6), pp.1945-1951).

[0092] In some embodiments, one or more probiotics include or consist of Bifidobacterium longum ssp. infantis (also known as Bifidobacterium infantis), Bifidobacterium longum ssp. suis (also known as Bifidobacterium suis), and / or Bifidobacterium longum ssp. longum (also known as Bifidobacterium longum).

[0093] In preferred embodiments, one or more probiotics include or consist of Bifidobacterium infantis. In some embodiments, one or more probiotics include or consist of Bifidobacterium infantis LMG 11588 or its derivatives (e.g., R0033, which is reported to the U.S. Food and Drug Administration as generally recognized as safe (GRAS)) (see, for example, Duboux, S., et al., 2022. Microorganisms, 10(2), p.203). B. Infantis may promote the endogenous production of vitamin K2 through the production of precursors.

[0094] Bifidobacterium animalis In some embodiments, one or more probiotics include or consist of Bifidobacterium animalis.

[0095] Bifidobacterium animalis is a bacterium of the genus Bifidobacterium that can be found in the large intestine of most mammals, including humans. Bifidobacterium animalis and Bifidobacterium lactis were previously described as two separate species. Currently, both are considered to be B. animalis, including the subspecies Bifidobacterium animalis subspecies animalis and Bifidobacterium animalis subspecies lactis (see Masco, L., et al, 2004. International Journal of Systematic and Evolutionary Microbiology, 54(4), pp.1137-1143).

[0096] In some embodiments, one or more probiotics include or consist of Bifidobacterium animalis ssp. lactis (also known as Bifidobacterium lactis). For example, the bacterium Bifidobacterium lactis HN019 has been studied for various traits important to its ability to function as a probiotic (see, e.g., Sanders, ME, 2006. Journal of Clinical Gastroenterology, 40(9), pp. 776-783).

[0097] Lactobacillus rhamnosus In some embodiments, one or more probiotics include or consist of Lactobacillus rhamnosus.

[0098] Lacticaseibacillus rhamnosus (also known as Lactobacillus rhamnosus) is a Gram-positive short rod bacterium, a homofermentative facultative anaerobe, does not form spores, and is often observed in chains. Lactobacillus rhamnosus GG (LGG) is one of the most widely used probiotic strains. Various effects on health have been well demonstrated (see, for example, Segers, M.E. and Lebeer, S., 2014. Microbial cell factories, 13(1), pp. 1-16). L. rhamnosus can promote the endogenous production of vitamin K2 through the production of precursors.

[0099] In some embodiments, the one or more probiotics comprise or consist of Lactobacillus rhamnosus LPR.

[0100] Administration of Probiotics The subject can be administered any suitable amount of the probiotic in any suitable form via any suitable route of administration (e.g., via any form and any route described herein).

[0101] Preferably, the one or more probiotics are at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day or at least about 10 10 cfu / day and are administered to the subject in a total amount. Preferably, the one or more probiotics are about 10 12 cfu / day or less, about 10 11 cfu / day or less or about 10 10 cfu / day or less and are administered to the subject in a total amount. Preferably, the one or more probiotics are about 10 6 cfu / day to about 10 12 cfu / day, about 10 7 cfu / day to about 1011 cfu / day or approximately 10 8 cfu / day ~ approximately 10 10 The total dose of cfu / day is administered to the target individual.

[0102] Preferably, Bifidobacterium longum (e.g., B. infantis) is present at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 The subject is administered a dose of cfu / day. Preferably, Bifidobacterium longum (e.g., B. infantis) is administered at a dose of approximately 10 12 cfu / day or less, approximately 10 11 Less than cfu / day, or about 10 10 The target is administered a dose of less than cfu / day. Preferably, Bifidobacterium longum (e.g., B. infantis) is administered at a dose of approximately 10 6 cfu / day ~ approximately 10 12 cfu / day, approximately 10 7 cfu / day ~ approximately 10 11 cfu / day or approximately 10 8 cfu / day ~ approximately 10 10 The patient is administered cfu / day.

[0103] Preferably, Bifidobacterium animalis (e.g., B. lactis) is present at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 The subject is administered a dose of cfu / day. Preferably, Bifidobacterium animalis (e.g., B. lactis) is administered at a dose of approximately 10 12 cfu / day or less, approximately 10 11 Less than cfu / day, or about 10 10The target is administered a dose of cfu / day or less. Preferably, Bifidobacterium animalis (e.g., B. lactis) is administered at a dose of approximately 10 6 cfu / day ~ approximately 10 12 cfu / day, approximately 10 7 cfu / day ~ approximately 10 11 cfu / day or approximately 10 8 cfu / day ~ approximately 10 10 The patient is administered cfu / day.

[0104] Preferably, Lactobacillus rhamnosus is present in at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 The subject is administered a dose of cfu / day. Preferably, Lactobacillus rhamnosus is administered at a dose of approximately 10 12 cfu / day or less, approximately 10 11 Less than or equal to 10 cfu / day 10 The target is administered a dose of less than cfu / day. Preferably, Lactobacillus rhamnosus is administered at approximately 10 6 cfu / day ~ approximately 10 12 cfu / day, approximately 10 7 cfu / day ~ approximately 10 11 cfu / day or approximately 10 8 cfu / day ~ approximately 10 10 The patient is administered cfu / day.

[0105] Preferably, vitamin K2 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, one or more types of oligosaccharides at a total dose of approximately 0.5 g / day to approximately 10 g / day, and one or more types of probiotics at a dose of approximately 10 6 cfu / day ~ approximately 10 12 The total dose of cfu / day is administered to the target individual.

[0106] Preferably, vitamin K2 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day, vitamin A at a dose of approximately 100 μgRE / day to approximately 1000 μgRE / day, vitamin D at a dose of approximately 2.5 μg / day to approximately 100 μg / day, 2'FL at a dose of approximately 0.5 g / day to approximately 5 g / day, and B. infantis at approximately 10 6 cfu / day ~ approximately 10 12 The total dose of cfu / day is administered to the target individual.

[0107] composition Preferably, the combination is in the form of a composition. The composition may contain the combination in any therapeutically effective amount.

[0108] The composition may be any type of composition that can incorporate the combination, for example, a food or beverage product, an animal feed product, a composition in the form of a nutritional supplement for humans or animals, or a pharmaceutical composition. The composition may be in the form of a solid (e.g., powder), a liquid, or a semi-liquid. This combination may be in the form of a food composition, a pet food composition, a beverage, a nutritional formula, a nutritional supplement, or nutraceuticals.

[0109] Food and beverage products include all products intended for oral intake by humans for the purpose of providing nutrition and / or pleasure. Such products may be nutritional compositions, for example, pediatric nutritional compositions. Examples of food and beverage products include dairy products, such as milk products or yogurt, soups, sauces, sweets and savory snacks, powdered beverages, and cereal products.

[0110] In some embodiments, the combination may take the form of a nutritional composition, a medical food for clinical nutrition, a milk formula, or a supplement.

[0111] In some embodiments, the combination takes the form of a nutritional composition. As used herein, “nutritional composition” may mean a composition that provides nutrition to a subject. This nutritional composition is usually administered orally or intravenously and typically comprises a lipid source or fat source and a protein source.

[0112] In some embodiments, the combination is in the form of a medical food for clinical nutrition. As used herein, “medical food for clinical nutrition” is also known as “Foods for Special Medical Purposes (FSMPs)” and refers to special foods designed to help satisfy the nutritional or dietary needs of persons living with a disease, disability, or medical condition that prevents them from achieving adequate nutritional intake temporarily or permanently from or through changes in their regular diet.

[0113] In preferred embodiments, the combination is in the form of a milk formula. As used herein, the term “milk formula” may also refer to, for example, a food intended for childhood nutrition, such a food that can provide, for example, a sole source of nutrition or supplemental nutrition for children aged about three years or older. In some embodiments, the milk formula is Glow Milk.

[0114] In some embodiments, the composition (e.g., milk formula) is in powder form and is reconstituted with an aqueous medium (e.g., water) before administration. In other embodiments, the composition (e.g., milk formula) is in a ready-to-administer liquid form (e.g., ready-to-feed formula).

[0115] In another embodiment, the combination is in the form of a supplement. As used herein, “supplement” or “dietary supplement” may be used to complement the nutrition of a subject (typically so, but a dietary supplement may also be added to any type of composition intended to be ingested by the subject). If the composition is a supplement, such composition may be provided in the form of a unit dose. Supplements typically exist in the form of a liquid, gel, powder, or tablet or capsule. Powdered supplements typically include supplements that will be dissolved in water or milk, or sprinkled on food or beverages. Such supplements are intended to provide additional nutrition and / or health benefits to the subject ingesting the supplement. Supplements may be used to provide nutrition and / or health benefits to humans and animals.

[0116] In another embodiment, the combination is in the form of a strengthening agent. The strengthening agent may be a milk formula strengthening agent.

[0117] In another embodiment, the combination is in the form of a pharmaceutical product. Examples of pharmaceutical products include drops, syrups, powders, tablets, or capsules intended to treat or prevent an adverse medical condition in a person in need.

[0118] The combination may also be in the form of animal food or animal nutritional supplement. Preferably, the animal is a mammal. Examples of animals include primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, and birds.

[0119] The nutritional compositions of the present invention, particularly milk formulas, generally contain a protein source, a carbohydrate source, and a lipid source. However, in some embodiments, particularly when the nutritional compositions of the present invention are supplements or fortifiers, only lipids (or lipid sources) may be present.

[0120] The nutritional composition of the present invention may contain approximately 100 kcal / 100g to approximately 1000 kcal / 100g, approximately 200 kcal / 100g to approximately 800 kcal / 100g, or approximately 400 kcal / 100g to approximately 600 kcal / 100g on a dry weight basis.

[0121] Vitamin mixture The nutritional composition according to the present invention (for example, milk formula) may contain any appropriate amount of vitamin K2, vitamin A, and vitamin D.

[0122] Preferably, the nutritional composition contains vitamin K2 in an amount of at least about 5 μg / 100g, at least about 10 μg / 100g, at least about 15 μg / 100g, at least about 20 μg / 100g, at least about 25 μg / 100g, or at least about 30 μg / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin K2 in an amount of about 2100 μg / 100g or less, about 100 μg / 100g or less, about 90 μg / 100g or less, about 80 μg / 100g or less, about 70 μg / 100g or less, or about 60 μg / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin K2 in amounts of approximately 5 μg / 100g to approximately 200 μg / 100g, approximately 10 μg / 100g to approximately 100 μg / 100g, approximately 15 μg / 100g to approximately 90 μg / 100g, approximately 20 μg / 100g to approximately 80 μg / 100g, approximately 25 μg / 100g to approximately 70 μg / 100g, or approximately 30 μg / 100g to approximately 60 μg / 100g.

[0123] Preferably, the nutritional composition contains vitamin A in an amount of at least about 100 μgRE / 100g, at least about 200 μgRE / 100g, or at least about 300 μgRE / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin A in an amount of about 1000 μgRE / 100g or less, about 800 μgRE / 100g or less, about 600 μgRE / 100g or less, or about 400 μgRE / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin A in amounts of approximately 100 μgRE / 100g to approximately 1000 μgRE / 100g, approximately 200 μgRE / 100g to approximately 800 μgRE / 100g, approximately 300 μgRE / 100g to approximately 600 μgRE / 100g, or approximately 300 μgRE / 100g to approximately 400 μgRE / 100g on a dry weight basis.

[0124] Preferably, the nutritional composition contains vitamin A in an amount of at least about 100 μg RAE / 100g, at least about 200 μg RAE / 100g, or at least about 300 μg RAE / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin A in an amount of about 1000 μg RAE / 100g or less, about 800 μg RAE / 100g or less, about 600 μg RAE / 100g or less, or about 400 μg RAE / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin A in amounts of approximately 100 μg RAE / 100g to approximately 1000 μg RAE / 100g, approximately 200 μg RAE / 100g to approximately 800 μg RAE / 100g, approximately 300 μg RAE / 100g to approximately 600 μg RAE / 100g, or approximately 300 μg RAE / 100g to approximately 400 μg RAE / 100g on a dry weight basis.

[0125] Preferably, the nutritional composition contains vitamin D in an amount of at least about 2.5 μg / 100g, at least about 5 μg / 100g, at least about 10 μg / 100g, or at least about 15 μg / 100g on a dry weight basis. Preferably, the nutritional composition contains vitamin D in an amount of about 100 μg / 100g or less, about 75 μg / 100g or less, or about 50 μg / 100g or less on a dry weight basis. Preferably, the nutritional composition contains vitamin D in an amount of about 2.5 μg / 100g to about 100 μg / 100g, about 5 μg / 100g to about 100 μg / 100g, about 10 μg / 100g to about 75 μg / 100g, or about 15 μg / 100g to about 50 μg / 100g on a dry weight basis.

[0126] Oligosaccharides The nutritional composition according to the present invention (for example, milk formula) may contain any appropriate amount of oligosaccharides.

[0127] Preferably, the nutritional composition contains one or more oligosaccharides in a total amount of at least about 0.5% by weight, at least about 1% by weight, or at least about 2% by weight on a dry weight basis. Preferably, the nutritional composition contains one or more oligosaccharides in a total amount of about 10% by weight or less, about 8% by weight or less, or about 5% by weight or less on a dry weight basis. Preferably, the nutritional composition contains one or more oligosaccharides in a total amount of about 0.5% to about 10% by weight, about 1% to about 8% by weight, or about 2% to about 5% by weight on a dry weight basis.

[0128] Preferably, the nutritional composition contains at least one fucosyl oligosaccharide in an amount of about 0.05% to about 3% by weight, about 0.1% to about 2% by weight, or about 0.2% to about 1.5% by weight on a dry weight basis. Preferably, the nutritional composition contains at least one sialyl oligosaccharide in an amount of about 0.01% to about 2% by weight, about 0.05% to about 1.5% by weight, or about 0.07% to about 1% by weight on a dry weight basis. Preferably, the nutritional composition contains at least one N-acetyl oligosaccharide in an amount of about 0.01% to about 1% by weight, about 0.03% to about 0.6% by weight, or about 0.05% to about 0.5% by weight on a dry weight basis.

[0129] Preferably, the nutritional composition contains 2'FL in an amount of at least about 0.5% by weight, at least about 0.8% by weight, or at least about 1% by weight on a dry weight basis. Preferably, the nutritional composition contains 2'FL in an amount of about 5% by weight or less, about 4% by weight or less, or about 3% by weight or less on a dry weight basis. Preferably, the nutritional composition contains 2'FL in an amount of about 0.5% to about 5% by weight, about 0.8% to about 4% by weight, or about 1% to about 3% by weight on a dry weight basis.

[0130] Preferably, the nutritional composition contains diFL in an amount of at least about 0.1% by weight, at least about 0.15% by weight, or at least about 0.2% by weight on a dry weight basis. Preferably, the nutritional composition contains diFL in an amount of about 1% by weight or less, about 0.8% by weight or less, or about 0.6% by weight or less on a dry weight basis. Preferably, the nutritional composition contains diFL in an amount of about 0.1% to about 1% by weight, about 0.15% to about 0.8% by weight, or about 0.2% to about 0.6% by weight on a dry weight basis.

[0131] Preferably, the nutritional composition contains 6'-SL in an amount of at least about 0.1% by weight, at least about 0.15% by weight, or at least about 0.2% by weight on a dry weight basis. Preferably, the nutritional composition contains 6'-SL in an amount of about 1% by weight or less, about 0.8% by weight or less, or about 0.6% by weight or less on a dry weight basis. Preferably, the nutritional composition contains 6'-SL in an amount of about 0.1% to about 1% by weight, about 0.15% to about 0.8% by weight, or about 0.2% to about 0.6% by weight on a dry weight basis.

[0132] Preferably, the nutritional composition contains 3'-SL in an amount of at least about 0.1% by weight, at least about 0.15% by weight, or at least about 0.2% by weight on a dry weight basis. Preferably, the nutritional composition contains 3'-SL in an amount of about 1% by weight or less, about 0.8% by weight or less, or about 0.6% by weight or less on a dry weight basis. Preferably, the nutritional composition contains 3'-SL in an amount of about 0.1% to about 1% by weight, about 0.15% to about 0.8% by weight, or about 0.2% to about 0.6% by weight on a dry weight basis.

[0133] Preferably, the nutritional composition contains LNT in an amount of at least about 0.2% by weight, at least about 0.3% by weight, or at least about 0.4% by weight on a dry weight basis. Preferably, the nutritional composition contains LNT in an amount of about 2.5% by weight or less, about 2% by weight or less, or about 1.5% by weight or less on a dry weight basis. Preferably, the nutritional composition contains LNT in an amount of about 0.2% to about 2.5% by weight, about 0.3% to about 2% by weight, or about 0.4% to about 1.5% by weight on a dry weight basis.

[0134] Preferably, the nutritional composition contains LNnT in an amount of at least about 0.2% by weight, at least about 0.3% by weight, or at least about 0.4% by weight on a dry weight basis. Preferably, the nutritional composition contains LNnT in an amount of about 2.5% by weight or less, about 2% by weight or less, or about 1.5% by weight or less on a dry weight basis. Preferably, the nutritional composition contains LNnT in an amount of about 0.2% to about 2.5% by weight, about 0.3% to about 2% by weight, or about 0.4% to about 1.5% by weight on a dry weight basis.

[0135] Preferably, the nutritional composition contains 2'FL in a total amount of about 0.05 g / L to about 2 g / L, about 0.1 g / L to about 1 g / L, about 0.15 g / L to about 0.8 g / L, about 0.2 g / L to about 0.7 g / L, or about 0.25 g / L to about 0.6 g / L (the concentration may refer to the concentration after the composition has been reconstituted, for example, with water).

[0136] Preferably, the nutritional composition contains fucosyl oligosaccharides (e.g., 2'FL and / or diFL) in total amounts of about 0.1 g / L to about 4 g / L, about 0.1 g / L to about 3.5 g / L, about 0.15 g / L to about 3 g / L, about 0.2 g / L to about 2.5 g / L, about 0.3 g / L to about 2 g / L, about 0.4 g / L to about 2 g / L, or about 0.5 g / L to about 2 g / L (concentrations may refer to the concentration after the composition has been reconstituted with, for example, water). In certain embodiments, the nutritional composition contains total fucosyl oligosaccharides of about 0.2 g / L to about 1.8 g / L.

[0137] Preferably, the nutritional composition contains sialyl oligosaccharides (e.g., 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL)) in a total amount of about 0.05 g / L to about 0.75 g / L, about 0.05 g / L to about 0.5 g / L, about 0.1 g / L to about 0.3 g / L, or about 0.1 g / L to about 0.4 g / L (the concentration may refer to the concentration after the composition has been reconstituted with, for example, water). In a particular embodiment, the nutritional composition contains a total of about 0.12 g / L to about 0.4 g / L of sialyl oligosaccharides.

[0138] Preferably, the nutritional composition contains N-acetyloligosaccharides (e.g., LNT and / or LNnT) in a total amount of about 0.05 g / L to about 0.5 g / L, about 0.1 g / L to about 0.5 g / L, about 0.2 g / L to about 0.4 g / L, or about 0.3 g / L (the concentration may refer to the concentration after the composition has been reconstituted with, for example, water).

[0139] Preferably, the nutritional composition is At least one sialyl oligosaccharide in a total amount of approximately 0.05 g / L to approximately 0.75 g / L, approximately 0.05 g / L to approximately 0.5 g / L, approximately 0.1 g / L to approximately 0.3 g / L, or approximately 0.1 g / L to approximately 0.4 g / L; At least one fucosyl oligosaccharide in a total amount of approximately 0.1 g / L to 4 g / L, approximately 0.1 g / L to 3.5 g / L, approximately 0.15 g / L to 3 g / L, approximately 0.2 g / L to 2.5 g / L, approximately 0.3 g / L to 2 g / L, approximately 0.4 g / L to 2 g / L, or approximately 0.5 g / L to 2 g / L; and / or It contains at least one N-acetyloligosaccharide in a total amount of approximately 0.05 g / L to approximately 0.5 g / L, approximately 0.1 g / L to approximately 0.5 g / L, or approximately 0.2 g / L to approximately 0.4 g / L.

[0140] Probiotics The nutritional composition according to the present invention (e.g., milk formula) may contain any appropriate amount of probiotics.

[0141] Preferably, the nutritional composition contains one or more probiotics, at least about 10% on a dry weight basis. 5cfu / 100 g, at least about 10 6 cfu / 100 g, at least about 10 7 cfu / 100 g, or at least about 10 8 cfu / 100 g, at least about 10 9 cfu / 100 g, or at least about 10 10 cfu / 100 g in a total amount. Preferably, the nutritional composition is about 10 12 cfu / 100 g or less, about 10 11 cfu / 100 g or less, about 10 10 cfu / 100 g or less in a total amount and contains one or more probiotics. Preferably, the nutritional composition is about 10 6 cfu / 100 g to about 10 12 cfu / 100 g, about 10 7 cfu / 100 g to about 10 11 cfu / 100 g, or about 10 8 cfu / 100 g to about 10 10 cfu / 100 g in a total amount and contains one or more probiotics.

[0142] Preferably, the nutritional composition contains at least about 10 5 cfu / 100 g, at least about 10 6 cfu / 100 g, at least about 10 7 cfu / 100 g, or at least about 10 8 cfu / 100 g, at least about 10 9 cfu / 100 g, or at least about 10 10 cfu / 100 g amount of Bifidobacterium longum (e.g., B. infantis). Preferably, the nutritional composition is about 10 12 cfu / 100 g or less, about 10 11 cfu / 100 g or less, about 10 10 cfu / 100 g or less amount and contains Bifidobacterium longum (e.g., B. infantis). Preferably, the nutritional composition is about 10 6 cfu / 100 g to about 10 12 cfu / 100 g, about 10 7 cfu / 100 g to about 1011 cfu / 100 g, or about 10 8 cfu / 100 g to about 10 10 contains Bifidobacterium longum (e.g., B. infantis) in an amount of cfu / 100 g.

[0143] Preferably, the nutritional composition contains at least about 10 5 cfu / 100 g, at least about 10 6 cfu / 100 g, at least about 10 7 cfu / 100 g, or at least about 10 8 cfu / 100 g, at least about 10 9 cfu / 100 g, or at least about 10 10 contains Bifidobacterium animalis (e.g., B. lactis) in an amount of cfu / 100 g. Preferably, the nutritional composition contains about 10 12 cfu / 100 g or less, about 10 11 cfu / 100 g or less, about 10 10 contains Bifidobacterium animalis (e.g., B. lactis) in an amount of cfu / 100 g or less. Preferably, the nutritional composition contains about 10 6 cfu / 100 g to about 10 12 cfu / 100 g, about 10 7 cfu / 100 g to about 10 11 cfu / 100 g, or about 10 8 cfu / 100 g to about 10 10 contains Bifidobacterium animalis (e.g., B. lactis) in an amount of cfu / 100 g.

[0144] Preferably, the nutritional composition contains, on a dry weight basis, at least about 10 5 cfu / 100 g, at least about 10 6 cfu / 100 g, at least about 10 7 cfu / 100 g, or at least about 10 8 cfu / 100 g, at least about 10 9 cfu / 100 g, or at least about 10 10Contains Lactobacillus rhamnosus at a cfu / 100g. Preferably, the nutritional composition is about 10 by dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 Contains Lactobacillus rhamnosus in amounts of less than cfu / 100g. Preferably, the nutritional composition is about 10 by dry weight. 6 cfu / 100g ~ approx. 10 12 cfu / 100g, approx. 10 7 cfu / 100g ~ approx. 10 11 cfu / 100g, or approximately 10 8 cfu / 100g ~ approx. 10 10 Contains Lactobacillus rhamnosus at a cfu / 100g level.

[0145] protein The nutritional composition according to the present invention (for example, a milk formula) may contain a protein source. The inclusion of a protein source is particularly preferable when the nutritional composition of the present invention is a milk formula. The amount of protein may be about 1 g to about 4 g per 100 kcal, or about 1.5 g to about 3 g per 100 kcal.

[0146] For example, protein sources based on whey, casein, and mixtures thereof can be used in the same way as, for example, soy-based plant protein sources. With respect to whey protein, the protein source may be based on acidic whey, sweet whey, or mixtures thereof, and may contain α-lactalbumin and β-lactoglobulin in any desired proportion. In some embodiments, the primary protein source is whey (i.e., more than 50%, for example more than 60% or more than 70% of the protein is derived from whey protein). The protein may be in an intact state, a hydrolyzed state, or a mixture of intact and hydrolyzed proteins. The term "intact" means that the main part of the protein is intact, i.e., the molecular structure has not changed, for example, at least 80% of the protein has not changed, for example at least 85% of the protein has not changed, preferably at least 90% of the protein has not changed, and more preferably at least 95% of the protein has not changed, for example at least 98% of the protein has not changed. In certain embodiments, the protein remains completely unchanged.

[0147] In the context of this invention, the term "hydrolyzed" means that a protein has been hydrolyzed, or broken down into its constituent amino acids.

[0148] The protein may be either completely hydrolyzed or partially hydrolyzed. If a hydrolyzed protein is required, the hydrolysis process may be carried out as desired, as is known in the art. For example, a hydrolyzed whey protein can be prepared by enzymatically hydrolyzing a whey fraction in one or more steps. It has been found that if the whey fraction used as the raw material is substantially lactose-free, the lysine blackage that the protein undergoes during the hydrolysis process is significantly reduced. This can reduce the degree of lysine blackage from about 15% by weight of the total lysine to less than 10% by weight of the total lysine, and for example, about 7% by weight of lysine significantly improves the nutritional value of the protein source.

[0149] In a particular embodiment, the protein of the composition is hydrolyzed, completely hydrolyzed, or partially hydrolyzed. The degree of hydrolysis (DH) of the protein may be 2 to 20, or 8 to 40, or 20 to 60, or 20 to 80, or greater than 10, greater than 20, greater than 40, greater than 60, greater than 80, or greater than 90.

[0150] At least 70%, 80%, 85%, 90%, 95%, or 97% of the protein may be hydrolyzed. In certain embodiments, 100% of the protein is hydrolyzed.

[0151] In one particular embodiment, the protein of the composition is a plant protein.

[0152] carbohydrates The nutritional composition according to the present invention (for example, a milk formula) may contain a carbohydrate source. The inclusion of a carbohydrate source is particularly preferable when the nutritional composition of the present invention is a milk formula. The amount of carbohydrates may be about 5g to about 20g per 100kcal, or about 10g to about 15g per 100kcal.

[0153] Any conventional carbohydrate source found in milk formulas, such as lactose, sucrose, saccharose, maltodextrin, starch, or mixtures thereof, can be used, but one preferred source of carbohydrates for milk formulas is lactose.

[0154] Lipids The nutritional composition according to the present invention (for example, a milk formula) may contain lipids and essential fatty acids. The inclusion of lipids and essential fatty acids is particularly preferable when the nutritional composition of the present invention is a milk formula. The amount of lipids may be about 1 g to about 10 g per 100 kcal, or about 2 g to about 6 g per 100 kcal.

[0155] Non-limiting examples of lipids include palm olein, high-oleic sunflower oil, high-oleic safflower oil, canola oil, fish oil, coconut oil, bovine milk fat, and combinations thereof. Compositions may be particularly beneficial if they contain fat in an amount of about 25 to about 30 g / 100 g by dry weight of the composition. Non-limiting examples of essential fatty acids include linoleic acid (LA) and alpha-linolenic acid (ALA). The compositions of the present invention may further contain gangliosides, monosialoganglioside-3 (GM3) and disialoganglioside-3 (GD3), and combinations thereof.

[0156] Other ingredients The nutritional compositions of the present invention (e.g., milk formula) may also contain all vitamins and minerals understood to be essential for a daily diet in nutritionally significant amounts. Minimum requirements have been established for certain vitamins and minerals. Examples of minerals, vitamins, and other nutrients optionally present in the compositions of the present invention include vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B12, vitamin E, vitamin K1, vitamin C, folic acid, inositol, niacin, biotin, pantothenic acid, choline, calcium, phosphorus, iodine, iron, magnesium, copper, zinc, manganese, chlorine, potassium, sodium, selenium, chromium, molybdenum, taurine, and L-carnitine. Minerals are usually added in salt form. The presence and amount of certain minerals and other vitamins will vary depending on the target population. Where necessary, the nutritional compositions of the present invention may also contain emulsifiers and stabilizers, such as soy, lecithin, and mono- and diglyceride citrates.

[0157] The nutritional composition of the present invention (e.g., milk formula) may also contain other substances that may have beneficial effects, particularly on bone health or bone development, such as lactoferrin, osteopontin, TGFβ, slgA, glutamine, nucleotides, and nucleosides.

[0158] Preparation of composition The compositions according to the present invention can be prepared by any known or other suitable method. For example, a nutritional composition, such as a milk formula, may be proposed by blending a protein source with a carbohydrate source and a lipid source in appropriate proportions. If used, an emulsifier may be included at this point. Vitamins and minerals may be added at this point, but they can usually be added later to avoid thermal decomposition. Water, preferably reverse-osmotic water or deionized water, can then be added and mixed to form a liquid mixture. The mixing temperature is preferably room temperature, but may be higher. The liquid mixture can then be heat-treated to reduce the bacterial content. The mixture may then be homogenized.

[0159] If it is desired to produce a powdered composition, the homogenized mixture is dried in a suitable drying apparatus, such as a spray dryer or freeze dryer, to produce a powder.

[0160] The processes used in formula manufacturing are based on the concept that the product must be nutritionally appropriate and microbiologically safe for consumption. Therefore, steps to eliminate or limit microbial growth are central to the manufacturing process. While the processing techniques for each specific formula are proprietary to the manufacturer, they generally involve preservation of oil-in-water (o / w) emulsions by dehydration in the case of powder products, or sterilization in the case of ready-to-feed or concentrated liquid products. Powdered formulas can be manufactured using various processes, such as dry blending dehydrated components to form a uniform formula, or hydrating and wet mixing a mixture of macro components, such as fat components, protein components, and carbohydrate components, and then evaporating and spray-drying the resulting mixture. A combination of the above two processes may also be used, where the base powder is produced by first wet-mixing and spray-drying all or some of the macro components, and then dry-blending the remaining components, including carbohydrates, minerals, vitamins, and other micronutrients, to create the final formula. Liquid formulas are available in ready-to-feed form or as concentrates that typically need to be diluted with water at a 1:1 ratio. The manufacturing processes used for these products are similar to those used for the production of recycled milk.

[0161] If it is desirable to manufacture a liquid formula, the homogenized mixture may be filled into a suitable container, preferably aseptically. However, the liquid composition may be retorted in the container, and suitable equipment for this type of filling and retorting is commercially available.

[0162] subject The subject may be any suitable subject. Preferably, the subject may be a mammal. In a preferred embodiment, the subject is a human. In other embodiments, the subject may be an animal, preferably a pet. The pet may be an animal selected from dogs, cats, birds, fish, rodents, such as mice, rats and guinea pigs, rabbits, etc. In some embodiments, the pet is a small dog breed.

[0163] In some embodiments, the subjects are young people, adolescents, and children. The term “young people” may refer to individuals who have not yet reached adulthood. The term “adolescents” may refer to individuals during the period from the onset of puberty to adulthood. The term “children” may refer to individuals in the stage between birth and puberty.

[0164] In a preferred embodiment, the target population is approximately 3 years of age or older. In some embodiments, the target population is approximately 4 years of age or older, or approximately 5 years of age or older.

[0165] In a preferred embodiment, the target age is approximately 10 years or younger. In some embodiments, the target age is approximately 9 years or younger, approximately 8 years or younger, approximately 7 years or younger, approximately 6 years or younger, or approximately 5 years or younger.

[0166] In some embodiments, the target age group is approximately 3 to 10 years old, approximately 3 to 9 years old, approximately 3 to 8 years old, approximately 3 to 7 years old, approximately 3 to 6 years old, or approximately 3 to 5 years old.

[0167] The present invention is particularly suitable for children who have suffered from growth retardation due to being premature, having a low birth weight, having experienced intrauterine growth restriction, or having experienced malnutrition or disease, such as Crohn's disease and / or celiac disease and / or cancer, or for children who have been treated with drugs that cause malabsorption, anorexia and / or metabolic bone disease, such as chemotherapy drugs and / or corticosteroids. The present invention is particularly preferred for use in children who have been premature, had a low birth weight, experienced intrauterine growth restriction, had intrauterine malnutrition, or experienced growth retardation. The present invention is also suitable for children who are at risk of bone disease, have a family history of bone disease, or have already experienced at least one, preferably several, fracture episodes.

[0168] In some embodiments, the subjects suffer from and / or stunted growth. Stunted growth may be defined as having an "age-specific height" value less than two standard deviations of the WHO Child Growth Standards median (see, for example, De Onis, M. and Branca, F., 2016. Maternal & Child Nutrition, 12, pp. 12-26).

[0169] In some embodiments, subjects suffer from and / or faltering growth. The term “faltering growth” can describe a pattern in children and other adolescents in which weight gain is slower than expected for their age and sex (e.g., King, C. and Davis, T., 2010. European Journal of Clinical Nutrition, 64(1), pp. S11-S13). In some embodiments, subjects suffer from and / or faltering growth due to malnutrition and a history of disease, such as anorexia, Crohn's disease and / or celiac disease. In some embodiments, subjects suffer from and / or faltering growth due to treatment with drugs that cause malabsorption, anorexia and / or metabolic bone disease, such as chemotherapy drugs and / or corticosteroids.

[0170] In some embodiments, subjects were premature, low birth weight, or experienced intrauterine growth restriction. The term “premature” may refer to an infant born at a gestational age of less than 37 weeks. The term “low birth weight” may refer to an infant with a birth weight of less than 2500g.

[0171] Methods for increasing bone growth and / or bone strength The inventors have shown that the combination of the present invention can be used to enhance bone growth and / or bone strength in a subject.

[0172] In the context of the present invention, the term "enhancing bone growth and / or bone strength" may, in particular, refer to one or more of the following physiological processes: catch-up growth, bone mass acquisition, optimization of peak bone mass, promotion of bone formation, promotion of bone assimilation, promotion of bone mineralization, increase in bone density and microstructure, regulation of the biomechanical properties of bone, and regulation of the ratio of bone formation and / or bone resorption.

[0173] In one embodiment, the present invention provides a combination of the present invention for use in enhancing bone growth and / or bone strength in a given area.

[0174] In one embodiment, the present invention provides the use of a combination according to the present invention in the manufacture of a medical food for enhancing bone growth and / or bone strength in a subject.

[0175] In one embodiment, the present invention provides a method for enhancing bone growth and / or bone strength in a subject, comprising administering a therapeutically effective amount of the combination according to the present invention to a subject in need thereof.

[0176] As used herein, “enhancing bone growth and / or strength” may refer to supporting normal bone growth and / or strength, for example, during childhood and adolescence. Supporting normal bone growth and / or strength can result in normal bone anatomical structure and physiological function. Appropriate methods and parameters for measuring bone growth and strength are known to those skilled in the art (see, for example, Donnelly, E., 2011. Clinical Orthopaedics and Related Research, 469(8), pp. 2128-2138). Preferably, normal bone growth and / or strength can be measured using one or more bone parameters selected from trabecular volume fraction (BV / TV), bone mineral density (BMD), bone mineral content (BMC), cortical volume (Ct.BV), mediocre-lateral diameter, anteroposterior diameter, ultimate force (FMax), and bone stiffness. In some embodiments, normal bone growth and / or strength are measured using one or more bone parameters selected from bone mineral density (BMD), trabecular volume fraction (BV / TV), cortical bone volume (Ct.BV), and maximum bone load (FMax). Suitable methods for measuring these parameters are available to those skilled in the art.

[0177] Methods to promote catch-up growth The combination of the present invention can promote catch-up growth, for example, in subjects with developmental inhibition and / or developmental delay.

[0178] In one embodiment, the present invention provides a combination according to the present invention for use in promoting catch-up growth in a target.

[0179] In one embodiment, the present invention provides the use of a combination according to the present invention in the manufacture of a medical food for promoting catch-up growth in a subject.

[0180] In one embodiment, the present invention provides a method for promoting catch-up growth in a subject, the method comprising administering a therapeutically effective amount of the combination according to the present invention to a subject in need thereof.

[0181] As used herein, "catch-up growth" may refer to a height growth rate exceeding the normal range for the age over a period of at least one year following a temporary growth suppression period, and this growth may be complete or incomplete (see, for example, Wit, J., and Boersma, B., 2002. Journal of Pediatric Endocrinology and Metabolism, 15, pp. 1229-1242).

[0182] Appropriate methods and parameters for measuring catch-up growth are known to those skilled in the art. Preferably, catch-up growth can be measured using the rate of height increase or the height standard deviation score (see, for example, Frongillo, EA, Leroy, J.Land, Lapping, K., 2019. Advances in Nutrition, 10(3), pp.372-379 and Desmond, C. and Casale, D., 2017. PloS one, 12(12), p.e0189135).

[0183] In some embodiments, catch-up growth is measured in absolute terms of linear growth (i.e., a reduction in height deficit compared to the healthy reference population mean). In some embodiments, catch-up growth is measured in relative terms of linear growth (i.e., an improvement in age-specific height z-score and / or exceeding the -2SD or -1SD cutoff point). [Examples]

[0184] The present invention will be further illustrated with reference to the following examples. It will be understood that the claimed invention is not intended to be limited by these examples.

[0185] Example 1 - Effects of a combination of vitamin K2, vitamin A, vitamin D, and HMO mixture on bone development result The effects of vitamin K2, vitamin A, vitamin D, and short-chain fatty acids (SCFAs) on osteoblast alkaline phosphatase (ALP) activity and osteocalcin mRNA levels in the preosteoblast lineage were investigated.

[0186] Seven days after differentiation (without ascorbic acid), vitamins A and D showed a significant effect on ALP activity, a marker of osteoblast differentiation, but vitamin K2 did not show a significant effect (see Figure 1A). On the other hand, 21 days after differentiation (without ascorbic acid), vitamin K2 showed a significant effect on the expression of osteocalcin, an important protein for osteoblast mineralization activity, but vitamins A and D did not show a significant effect (see Figure 1B).

[0187] Twenty-eight days after differentiation (using ascorbic acid), a combination of vitamin K2, vitamin A, and vitamin D synergistically promoted osteoblast calcification (see Figure 1C).

[0188] The effects of SCFA were further investigated. Three mixtures—75% acetate, 20% propionate, and 5% butyrate—were evaluated to mimic normal physiological conditions (20 μM SCFA), physiological conditions after prebiotic addition (50 μM SCFA), and physiological conditions after synbiotic addition (60 μM SCFA).

[0189] Seven days after differentiation (without ascorbic acid), the combination of vitamin K2, vitamin A, and vitamin D with 50 μm or 60 μm SCFA synergistically promoted osteoblast differentiation (see Figure 2). This effect was up to 28.4% greater than the additive effect.

[0190] In an intestinal model mimicking the digestive tract, it was further shown that a mixture of human milk oligosaccharides (2.5 g / L of 2FL, DiFL, LNnT, LNT, and 6SL) can promote vitamin K2 production in the digestive tract, and that the addition of B. infantis can enhance this effect (see Figure 3A). Additionally, Lactobacillus rhamnosus LPR (4.5 × 10¹⁶) was added to the milk matrix. 7 The addition of cfu / mL was shown to further increase vitamin K2 production in the gastrointestinal tract by approximately 40% (see Figure 4).

[0191] Materials and methods MC3T3-E1 subclone 4 culture and processing conditions The preosteoblast cell line MC3T3-E1 subclone 4 (CRL-2593) was purchased from ATCC (Manassas; Virginia, USA). Cells were maintained in growth medium (GM) consisting of 10% fetal bovine serum (FCS, ThermoFisher Scientific) and 1% penicillin / streptomycin-free αMEM (ThermoFisher Scientific). All media were replaced every 2-3 days. Cells were passaged using trypsin / EDTA solution at a confluence of less than 80%. To induce differentiation into osteoblasts, cells were passed through 5 × 10⁶ cells. 4 pieces / cm 2The seeds were sown and grown in GM for 24 hours until confluence. The medium was then replaced with differentiation medium (DM), consisting of GM supplemented with 10 mM β-glycerophosphate and the target treatment solution. Depending on the experiment, 50 μg / mL of ascorbic acid was also added to the DM.

[0192] Osteoblast alkaline phosphatase activity Four subclonal cells of MC3T3-E1 were differentiated for 7 days using the following treatment solutions, without the addition of ascorbic acid except for the positive control: a mixture consisting of 3 μM vitamin K2 (menaquinone-7), 100 nM vitamin A (all-trans retinoic acid), and 1 nM vitamin D (1α,25-dihydroxyvitamin D3); a mixture called "SCFA20" consisting of 15 μM sodium acetate, 4 μM sodium propionate, and 1 μM sodium butyrate; a mixture called "SCFA50" consisting of 37.5 μM sodium acetate, 10 μM sodium propionate, and 2.5 μM sodium butyrate; and a mixture called "SCFA60" consisting of 45 μM sodium acetate, 12 μM sodium propionate, and 3 μM sodium butyrate. The vitamin mixtures were also combined with three different combinations of short-chain fatty acids (SCFAs).

[0193] Seven days after differentiation, cells were harvested, and alkaline phosphatase (ALP) activity was measured using a modified version of a previously reported method. Briefly, cells were lysed by heat shock and collected in ALP buffer (1M diethanolamine, 0.24M MgCl2, pH 9.8). After adding 4-nitrophenyl phosphate disodium salt hexahydrate, the enzymatic reaction was monitored at 405 nm. The Michaelis-Menten kinetics were evaluated at 30°C for 30 minutes. max This was used as a substitute for ALP activity. Activity values ​​were normalized by protein content measured using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific) according to the manufacturer's instructions.

[0194] Osteocalcin RNA Extraction Four MC3T3-E1 subclonal cells were differentiated for 21 days (in ascorbic acid-free DM, excluding the positive control) or 28 days (in ascorbic acid-containing DM). The cells were then harvested for gene expression analysis. RNA was extracted using the RNeasy plus mini kit (Qiagen; Hilden, Germany) with a QIAcube (Qiagen) according to the manufacturer's instructions. Briefly, cells were lysed in RLT buffer, rotated in a QIAshredder column (Qiagen), and then processed with a QIAcube. RNA concentration was measured using DropSense96 (TRINEAN, Gentbrugge, Belgium).

[0195] Reverse transcription and quantitative PCR (qPCR) cDNA was prepared using the High-Capacity cDNA Reverse Transcription Kit (AppliedBiosystems; Waltham, Massachusetts, USA) according to the manufacturer's instructions. Briefly, 0.7 μg of RNA was mixed with the kit components and reverse transcribed using the following program: 10 minutes at 25°C, 120 minutes at 37°C, and 5 minutes at 85°C. The cDNA was diluted 7-fold with RNase-free water and prepared using the LightCycler 1536 DNA Green Master Kit (Roche; Basel, Switzerland) according to the manufacturer's instructions. In short, cDNA was diluted seven-fold in a solution containing a master mix, Bright Green, and DNA primers with the following nucleotide sequences: Ocn-f ACCATCTTTCTGCTCACTCTG, Ocn-r GTTCACTACCTTATTGCCCTCC, B2m-f CACTGACCGGCCTGTATGCT, B2m-r GTATGTTCGGCTTCCCATTCTC, targeting osteocalcin (Ocn) and β-2-microglobulin (B2m, housekeeping gene). The reaction was performed on a LightCycler 480 II (Roche) using the following program: 7 minutes at 95°C, 1 second at 95°C, and 30 seconds at 60°C for 40 cycles. Relative gene expression was evaluated by the 2^-ΔCt method.

[0196] Pre-digestion and vitamin K2 production To evaluate the intestinal production of vitamin K2, a human microbial ecosystem simulator (SHIME®) was used (Van de Wiele, T., et al., 2015 The Impact of Food Bioactives on Health: in vitro and ex vivo models, pp. 305-317). The SHIME assay typically consists of colonic fermentation of a dose-selected test compound under simulated conditions representing the target gastrointestinal tract. Menaquinone-7 production was measured by supercritical fluid chromatography-tandem mass spectrometry (SFC-MS / MS).

[0197] In these experiments, a two-stage batch system mimicking the conditions of the upper gastrointestinal tract (upper GIT, stomach, and small intestine) and colon was used as a simplified SHIME® system. A bovine milk-based infant formula, also known as infant formula milk, containing age-appropriate minerals, was used in these studies.

[0198] To simulate the absorption process occurring in the infant's small intestine, a dialysis approach was applied using a cellulose membrane with a 14 kDa cutoff. By introducing the small intestinal suspension into the dialysis membrane, digested molecules such as amino acids, sugars, micronutrients, and minerals were gradually removed from the upper gastrointestinal matrix.

[0199] Furthermore, the pH was gradually decreased from 5.5 to 3.0 during a one-hour incubation in the stomach to simulate the pH of an infant's stomach. During the first 30 minutes of small intestinal incubation (duodenum), the pH was maintained at 4.5 to optimize the absorption of available minerals. The pH was then induced to 7 during the subsequent 145-minute small intestinal phase (jejunum + ileum). After exposure to gastric and small intestinal conditions, the milk matrix was transferred to a colonic compartment containing infant fecal samples.

[0200] Fresh fecal material was collected from 12-month-old infant donors. Fecal suspensions were prepared and mixed with protective agents. At the start of a short colon incubation, the test components were (blank; single HMO (1.3 g / L 2 FL); HMO mix (2.5 g / L 2 FL, DiFL, LNnT, LNT, and 6 SL); B. infantis (10 7 cfu / mL); single HMO + B. infantis; HMO mix + B. infantis) were added to a sugar-depleted nutrient medium containing essential nutrients present in the colon (e.g., host-derived glycans such as mucin).

[0201] Example 2 The preclinical trial setup was carried out as shown in Figure 4.

[0202] The tibia was placed in individual tissue cassettes sandwiched between foam and fixed in 10% (v / v) neutral buffered formalin at room temperature for at least 48 hours, decalcified in DC2 for at least 4 hours (if necessary), and then embedded in paraffin until further tissue processing. Two sagittal sections (5 μm) were excised with a microtome and stained according to the standard hematoxylin-eosin (H&E) protocol. Histological morphometric analysis was performed on the resting cell layer, proliferating cell layer, prehypertrophic cell layer, and hypertrophic cell layer to evaluate the overall height of the growth plate and the height of each of these four regions (Guevara-Morales JM, Frohbergh M, Castro-Abril H, et al. Growth Plate Pathology in the Mucopolysaccharidosis Type VI Rat Model - An Experimental and Computational Approach. Diagnostics. 2020;10(6).doi:10.3390 / diagnostics10060360; Wilson K, Usami Y, Hogarth D, et al. Analysis of Association between Morphometric Parameters of Growth Plate and Bone Growth of Tibia in Mice and Humans. Cartilage. 2020;13(2_suppl):315S-325S.doi:10.1177 / 1947603519900800).

[0203] As can be seen in Figures 5A and 5B, the vitamin K2, A, and D synbiotic [2'-fucosyl lactose + B. infantis] stimulated bone development through chondrocyte activation. Mature cartilage areas increased, while hypertrophic cartilage areas decreased. T

[0204] The effects of the vitamin K2AD+ / - synbiotic [2'-fucosyl lactose + B. infantis] on trabecular bone connection density (Conn.D) and trabecular bone number (Tb.N) were evaluated by microcomputed tomography of the femur. Microcomputed tomography (μCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) was used to evaluate the trabecular microstructure at the distal metaphysis of the femur, as previously reported (N. Bonnet, J. Brun, J. Crosseau, L. Duong, S. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7):1432-1441). Briefly, the trabecular bone region was evaluated using isotropic 6 μm voxels. To exclude primary trabecular bone, 30 slices of bone below the distal growth plate were excluded from the analysis. Eighty slices of the underlying secondary cancellous bone were analyzed. Morphometric variables were calculated from binarized images using a direct three-dimensional technique that does not depend on prior assumptions about the underlying structure (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, CLBenhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4):1286-97). Connectivity density (Conn.D) and trabecular number (Tb.N) were evaluated. As can be seen in Figures 6A and 6B, Vit K2AD increased both femoral connectivity density (Conn.D) and trabecular number (Tb.N). When K2AD was combined with the synbiotic [2'-fucosyl lactose + B. infantis], the increase was even greater.

[0205] The effect of the vitamin K2AD+ synbiotic [2'-fucosyl lactose + B. infantis] on cortical bone mineral density (Ct.BMD) was evaluated by microcomputed tomography of the femur.

[0206] As previously reported, we evaluated the trabecular microstructure of the mid-femoral diaphysis using microcomputed tomography (μCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) (N. Bonnet, J. Brun, J. Crosseau, L. Duong, S. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7):1432-1441). Briefly, we evaluated the cortical bone region using isotropic 6 μm voxels. We evaluated the femoral cortical structure using 60 consecutive CT slides of the mid-femoral diaphysis. Morphometric variables were calculated from binarized images using a direct three-dimensional technique that does not depend on prior assumptions about the underlying structure (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, CLBenhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4):1286-97). Cortical bone mineral density (Ct. BMD) was assessed. As can be seen in Figure 7, vitamin K2AD + synbiotics [2'-fucosyl lactose + B. infantis] increased femoral cortical bone mineral density (Ct. BMD).

[0207] The effect of vitamin K2AD + synbiotics [2'-fucosyl lactose + B. infantis] on femoral strength was evaluated by axial compression of the metaphysis.

[0208] Sections 1.7 mm high were cut from the femur, and the metaphysis was separated. The metaphysical slices were compressed axially, and the biomechanical properties of the femur were tested as previously reported (CHTurner, DBBurr, Basic biomechanical measurements of bone: a tutorial, Bone, 1993, 14(4):595-608). Load was applied in compression mode at a nominal deformation rate of 2 mm / min until fracture. The load-displacement curve was recorded and the elastic energy was calculated. As can be seen in Figure 8, vitamin K2AD + synbiotics [2'-fucosyl lactose + B. infantis] increased bone strength by increasing the elastic energy of the femoral metaphysis.

[0209] Embodiment Various preferred features and embodiments of the present invention are described below with reference to the numbered paragraphs.

[0210] 1. A combination of a vitamin mixture and a synbiotic for use in enhancing bone growth, strength and / or bone density in children or young persons, wherein the vitamin mixture contains or consists of vitamin K2, vitamin A and vitamin D, and the synbiotic contains or consists of 2'-fucosyl lactose (2'FL) and one or more probiotics.

[0211] 2. Combinations for use as described in paragraph 1, in which vitamin K2 is administered to the subject at a dose of approximately 5 μg / day to approximately 200 μg / day.

[0212] 3. A combination of uses described in either paragraph 1 or 2, wherein vitamin A is administered to the subject in an amount of approximately 100 μgRE / day to approximately 1000 μgRE / day.

[0213] 4. A combination of uses described in any one of paragraphs 1 to 3, wherein vitamin D is administered to the subject in an amount of approximately 2.5 μg / day to approximately 100 μg / day.

[0214] 5. The combination for use described in any one of paragraphs 1 to 4, wherein the synbiotic comprises an oligosaccharide mixture comprising 2'-fucosyl lactose (2'FL) and at least one further oligosaccharide, preferably the at least one further oligosaccharide comprising at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide.

[0215] 6. The combination for use described in paragraph 5, wherein the at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof, and preferably the at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof.

[0216] 7. The above-mentioned at least one fucosyl oligosaccharide is 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), lacto-N-difucosylhexaose A combination for use as described in either paragraph 5 or 6, selected from the group consisting of LNDFH-1, LNnDFH, MFNLH-III, DFLNHa, and combinations thereof, wherein at least one of the fucosyl oligosaccharides is difucosyl lactose (diFL).

[0217] 8. The combination for use described in any of paragraphs 5 to 7, wherein the at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, and preferably the at least one N-acetyloligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof.

[0218] 9.2'FL is administered to the subject in amounts of approximately 0.5 g / day to approximately 5 g / day, in combination for use as described in any one of paragraphs 1 to 8.

[0219] 10. A combination for use as described in any one of paragraphs 1 to 9, wherein one or more of the probiotics contains or consists of Bifidobacterium infantis.

[0220] 11. B. Infantis, approximately 10 6cfu / day ~ approximately 10 12 A combination of uses described in any one of paragraphs 1 to 10, administered to the subject in a total amount of cfu / day.

[0221] 12. The combination for use described in any one of paragraphs 1 to 11, wherein the synbiotic comprises B. infantis and at least one further probiotic, preferably the at least one further probiotic comprises or consists of Bifidobacterium animalis and / or Lactobacillus rhamnosus.

[0222] 13. The combination for use described in any one of paragraphs 1 to 17, wherein the combination is provided in the form of a nutritional composition.

[0223] 14. The combination for use described in any one of paragraphs 1 to 18, wherein the combination is provided in the form of a medical food for clinical nutrition.

[0224] 15. The combination for use described in any one of paragraphs 1 to 14, wherein the combination is provided in the form of a milk formula.

[0225] 16. A combination for use as described in any one of paragraphs 13 to 15, wherein the composition contains vitamin K2 in an amount of about 5 μg / 100g to about 200 μg / 100g on a dry weight basis.

[0226] 17. A combination for use described in any one of paragraphs 13 to 16, wherein the composition contains vitamin A in an amount of about 100 μg RE / 100 g to about 1000 μg RE / 100 g on a dry weight basis.

[0227] 18. A combination for use according to any one of paragraphs 13 to 17, wherein the composition contains vitamin D in an amount of about 2.5 μg / 100 g to about 100 μg / 100 g based on dry weight.

[0228] 19. A combination for use according to any one of paragraphs 13 to 18, wherein the composition contains 2’FL in an amount of about 0.5% to about 5% by weight based on dry weight.

[0229] 20. The composition contains about 10 6 cfu / 100 g to about 10 12 cfu / 100 g of B. infantis, a combination for use according to any one of paragraphs 13 to 19.

[0230] 21. A combination for use according to any one of paragraphs 1 to 26, wherein the subject is a human.

[0231] 22. A combination for use according to any one of paragraphs 1 to 21, wherein the subject is about 3 years old or older and / or about 10 years old or younger, preferably the subject is about 3 years old to about 10 years old.

[0232] 23. A combination for use according to any one of paragraphs 1 to 20, wherein the subject is an animal, preferably the animal is a pet.

[0233] 24. A combination for use according to any one of paragraphs 1 to 29, wherein the subject suffers from and / or is affected by growth inhibition and / or growth retardation.

[0234] 25. A combination for use according to any one of paragraphs 1 to 30, wherein the subject was a premature infant, or a low birth weight infant, or experienced intrauterine growth retardation.

[0235] 26. A combination for use according to any one of paragraphs 1 to 31, wherein the combination is for oral administration.

[0236] 27. A combination for use according to any one of paragraphs 1 to 26, wherein the vitamin mixture and the synbiotics are administered separately, simultaneously, or sequentially, preferably simultaneously.

[0237] 28. The combination for use described in any one of paragraphs 1 to 33, wherein the combination synergistically enhances bone growth and / or bone strength.

[0238] 29. The combination described above for use as described in any one of paragraphs 1 to 34, which enhances bone mineralization.

[0239] 30. The combination for use described in any one of paragraphs 1 to 35, wherein the combination promotes the calcification and / or differentiation of osteoblasts.

[0240] 31. A combination for use described in any one of paragraphs 1 to 37, wherein the combination improves one or more bone parameters selected from bone mineral density (BMD), trabecular volume fraction (BV / TV), cortical bone volume (Ct.BV), and maximum bone load (FMax).

[0241] 32. A combination for use described in any one of paragraphs 1 to 38, wherein the combination promotes catch-up growth, and preferably catch-up growth is measured using the rate of height increase.

[0242] 33. Use of a combination of vitamin mixture and synbiotics in the manufacture of a medical food for enhancing bone growth and / or bone strength in children or young persons, wherein the vitamin mixture contains or consists of vitamin K2, vitamin A and vitamin D, and the synbiotics contains or consists of 2'-fucosyl lactose (2'FL) and one or more probiotics.

[0243] 34. A method for enhancing bone growth and / or bone strength in a child or adolescent subject, the method comprising administering to the subject an effective amount of a combination of a vitamin mixture and a synbiotic, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A and vitamin D, and the synbiotic comprises or consists of 2'-fucosyl lactose (2'FL) and one or more probiotics.

[0244] 35. Use of synbiotics to promote vitamin K2 production in the target gut.

[0245] 36. The use according to paragraph 35, wherein the synbiotic comprises an oligosaccharide mixture comprising 2'-fucosyl lactose (2'FL) and at least one further oligosaccharide, preferably the at least one further oligosaccharide comprising at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide.

[0246] 37. The use as described in paragraph 36, wherein the at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof, preferably the at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof.

[0247] 38. The above-mentioned at least one type of fucosyl oligosaccharide is 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), lacto-N-difu The use according to paragraph 36 or 37, wherein the fucosyl oligosaccharide is selected from the group consisting of cosylhexaose-I (LNDFH-1), lacto-N-neo-difucosylhexaose (LNnDFH), monofucosyl lacto-n-hexaose-III (MFNLH-III), difucosyl lacto-N-hexaose-a (DFLNHa), and combinations thereof, and preferably, at least one of the fucosyl oligosaccharides is difucosyl lactose (diFL).

[0248] 39. The use described in any one of paragraphs 36 to 38, wherein the at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, preferably the at least one N-acetyloligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof.

[0249] The use described in any one of paragraphs 35-39, in which 40.2'FL is administered to the subject in an amount of approximately 0.5 g / day to approximately 5 g / day.

[0250] 41. The use described in any one of paragraphs 35 to 40, wherein the one or more probiotics contains or consists of Bifidobacterium infantis.

[0251] 42. B. Infantis is about 10 6 cfu / day ~ approximately 10 12The use according to any one of paragraphs 35 to 41, administered to the subject in a total amount of cfu / day.

[0252] 43. The use according to any one of paragraphs 35 to 42, wherein the symbiotics comprise a probiotic mixture comprising B. infantis and at least one further probiotic, preferably wherein the at least one further probiotic comprises or consists of Bifidobacterium animalis and / or Lactobacillus rhamnosus.

[0253] 44. A combination for use according to any one of paragraphs 13 to 18, wherein the composition comprises vitamin D in an amount of from about 5 μg / 100 g to about 100 μg / 100 g on a dry weight basis.

[0254] Although the invention has been described by way of example, it is to be understood that changes and modifications can be made without departing from the scope of the invention as defined in the claims. Further, where known equivalents exist for specific features, such equivalents are incorporated as if specifically recited herein.

Claims

1. A combination of a vitamin mixture and a synbiotic for use in enhancing bone growth, strength and / or bone density in children or young persons, wherein the vitamin mixture contains or consists of vitamin K2, vitamin A and vitamin D, and the synbiotic contains or consists of 2'-fucosyl lactose (2'FL) and one or more probiotics.

2. The combination for use according to claim 1, wherein vitamin K2 is administered to the subject in an amount of approximately 5 μg / day to approximately 200 μg / day, vitamin A is administered to the subject in an amount of approximately 100 μg RE / day to approximately 1000 μg RE / day, and / or vitamin D is administered to the subject in an amount of approximately 2.5 μg / day to approximately 100 μg / day.

3. The combination for use according to any one of claims 1 or 2, wherein the synbiotic comprises an oligosaccharide mixture comprising 2'-fucosyl lactose (2'FL) and at least one further oligosaccharide, preferably the at least one further oligosaccharide comprising at least one sialyl oligosaccharide, at least one fucosyl oligosaccharide, and / or at least one N-acetyl oligosaccharide.

4. (a) The at least one sialyl oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lacto-N-tetraose b (LSTb), sialyl lacto-N-tetraose c (LSTc), disial lacto-N-tetraose, and combinations thereof, preferably the at least one sialyl oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof; (b) The at least one fucosyl oligosaccharide is 3-fucosyl lactose (3FL), difucosyl lactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose-V (LNnFP-V), A selection from the group consisting of kuto-N-difucosylhexaose-I (LNDFH-1), lacto-N-neo-difucosylhexaose (LNnDFH), monofucosyllacto-n-hexaose-III (MFNLH-III), difucosyllacto-N-hexaose-a (DFLNHa) and combinations thereof, preferably at least one of the fucosyloligosaccharides is difucosyllactose (diFL); and / or (c) The combination for use according to claim 3, wherein the at least one N-acetyloligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, and preferably the at least one N-acetyloligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof.

5. The combination for use according to any one of claims 1 to 4, wherein 2'FL is administered to the subject in an amount of approximately 0.5 g / day to approximately 5 g / day.

6. The one or more probiotics mentioned above contain or consist of Bifidobacterium infantis, and optionally, B. infantis is present in the subject for about 10 6 cfu / day ~ approximately 10 12 A combination for use according to any one of claims 1 to 5, administered in a dose of cfu / day.

7. The combination for use according to any one of claims 1 to 6, wherein the synbiotic comprises a probiotic mixture containing B. infantis and at least one further probiotic, preferably the at least one further probiotic comprising or consisting of Bifidobacterium animalis and / or Lactobacillus rhamnosus.

8. The combination for use according to any one of claims 1 to 7, wherein the combination is provided in the form of a nutritional composition, and optionally, the combination is provided in the form of a milk formula.

9. The combination for use according to any one of claims 1 to 8, wherein the subject is a human, preferably a subject who is about 3 years of age or older and / or about 10 years of age or younger, and more preferably a subject who is about 3 years of age to about 10 years of age.

10. The combination for use according to any one of claims 1 to 9, wherein the subject is an animal, preferably a pet.

11. The combination for use according to any one of claims 1 to 10, wherein the subject is suffering from and / or developmental delay.

12. The combination for use according to any one of claims 1 to 11, wherein the combination is administered orally, preferably simultaneously.

13. The combination for use according to any one of claims 1 to 12, wherein the combination promotes the calcification and / or differentiation of osteoblasts.

14. The combination for use according to any one of claims 1 to 13, wherein the combination improves one or more bone parameters selected from bone mineral density (BMD), trabecular volume fraction (BV / TV), cortical bone volume (Ct.BV), and maximum bone load (FMax).

15. The combination for use according to any one of claims 1 to 14, wherein the combination promotes catch-up growth, and preferably the catch-up growth is measured using the rate of height increase.