dsRNA molecules that inhibit the expression of the LP(a) gene and their use
Modified dsRNA molecules targeting the Lp(a) gene via RNA interference provide an effective solution to reduce Lp(a) levels, addressing the limitations of current treatments and offering a targeted therapeutic approach for cardiovascular and cerebrovascular diseases.
Patent Information
- Application Number
- JP2025576141
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-07-04
- Filing Date
- 2024-07-03
- Publication Date
- 2026-07-06
AI Technical Summary
Current treatments for lowering Lipoprotein(a) (Lp(a)) levels, such as statins, fibrates, and exetimibe, are ineffective or have adverse effects, and there is a need for more effective interventions to address cardiovascular and cerebrovascular diseases associated with elevated Lp(a) levels.
Development of dsRNA molecules that inhibit Lp(a) gene expression through RNA interference, using modified strands with specific nucleotide sequences and ligand modifications to enhance cellular uptake and targeting, particularly for hepatic cells.
The dsRNA molecules effectively reduce Lp(a) levels by promoting sequence-specific degradation of Lp(a) mRNA, providing a targeted and specific therapeutic approach for cardiovascular and cerebrovascular diseases.
Smart Images

Figure 2026522119000046 
Figure 2026522119000047 
Figure 2026522119000048
Abstract
Description
Technical Field
[0001] This application belongs to the field of molecular biology and relates to modified dsRNA molecules and their use. Specifically, it relates to dsRNA molecules that inhibit the expression of the LP(a) gene, their pharmaceutical compositions, and methods for reducing the expression level of the LP(a) gene using the dsRNA molecules or their pharmaceutical compositions.
Background Art
[0002] RNA interference (RNAi) is a highly conserved evolutionary process in which homologous mRNA is efficiently and specifically degraded by double-stranded RNA (dsRNA). RNAi is a universally present regulatory mechanism in eukaryotes that resists viral invasion, inhibits transposon activity, and regulates gene expression. Small interfering RNA (dsRNA) is a short double-stranded RNA molecule with a length of 19-30 bp and is one of the important tools in RNAi technology. In natural organisms, when dsRNA enters a cell, it is specifically recognized by the Dicer enzyme and cleaved into small RNA fragments (i.e., dsRNA) with a length of 21-23 nucleotides. The resulting dsRNA fragments unwind into single strands and form a complex with a certain protein (abbreviated as RISC). RISC can bind to mRNA complementary to dsRNA within the cell, cleaving and degrading that mRNA. As a result, protein synthesis becomes impossible, and the gene "silencing" phenomenon occurs. In industrial production, there is a growing trend to further improve the stability and efficacy of dsRNA drugs by chemically synthesizing and modifying dsRNAs. In recent years, there have been groundbreaking advances in dsRNA-based drug research, and several dsRNA drugs targeting rare diseases, such as patisiran (treatment of hereditary transthyretin amyloid degeneration disease), eteplirsen (Duchenne muscular dystrophy), givosiran (acute intermittent porphyria), and spinraza (spinal muscular atrophy), have been approved and marketed by the FDA. The therapeutic field of dsRNA drugs is also gradually expanding from rare diseases to common diseases. For example, recently approved drugs include inclisiran for the treatment of hyperlipidemia, DCRHBVS for the treatment of hepatitis B, tivanisiran (dry eye), QPI-1007 (optic nerve atrophy), SYL040012 (glaucoma) for the treatment of eye diseases, and QPI-1002 for the treatment of severe kidney disease.The continued advancement of clinical research and successful marketing of dsRNA drugs has gradually clarified the path to development, bringing good news to all of humanity as their unique gene-silencing capabilities lead to the cure of an increasing number of diseases.
[0003] Lipoprotein A (Lp(A)) particles are essentially low-density lipoprotein-like particles in which apolipoprotein A is bound to LDL-like particles via the ApoB polypeptide. They are synthesized independently from triglycerides in the liver, unaffected by age or diet. High Lp(A) levels lead to atherosclerosis, and its presence has been observed in the walls of the ductus arteriosus. Because its structure is similar to plasminogen, Lp(A) also inhibits fibrinolysis, which can lead to thrombus formation. High serum Lp(A) concentrations are associated with premature onset of atherosclerosis and stroke. Serum Lp(A) concentrations are primarily genetically related and are largely unaffected by sex, age, weight, and most cholesterol-lowering medications. Studies suggest that Lp(A) levels in normal humans should be below 300 mg / L (30 mg / dL), and Lp(A) concentrations above 34 mg / dL approximately double the risk of coronary artery disease. When evaluated in conjunction with low-density lipoprotein-cholesterol levels, the risk increased approximately sixfold. When other plasma lipoproteins are not considered, Lp(a) levels are considered the most sensitive indicator of coronary artery disease progression. Therefore, Lp(a) inhibitors, which lower blood Lp(a) levels, are promising potential therapeutic targets for the treatment and prevention of cardiovascular and cerebrovascular diseases and their complications.
[0004] Conventional statins, which are lipid modulators and plaque stabilizers, do not cause significant changes in Lp(a) levels and do not make clinically significant differences in Lp(a) in patients at risk of CVD. Some studies even suggest that statins may cause an increase in Lp(a). Fibrates and exetimibe are not effective in lowering Lp(a). Currently, drugs known to be effective in lowering Lp(a) include niacin, PCSK9 inhibitors, estrogen, mypomesin, and lomeltapid, but these treatment regimens are not the best choice considering their effectiveness in lowering Lp(a), cost-effectiveness, clinical adverse events, clinical applicability and availability, and cardiovascular benefits. Novel drugs for lowering Lp(a)—small molecule nucleic acid drugs—are expected to be an effective intervention for lowering Lp(a). Therefore, the development of efficient inhibitors that silence Lp(a) will provide effective long-term treatment for cardiovascular and cerebrovascular diseases, achieving better efficacy, specificity, stability, targeting, or resistance. [Overview of the project]
[0005] Content of the invention This application provides a dsRNA molecule, reagent, kit, and pharmaceutical composition thereof that suppresses the expression of the Lp(a) gene, as well as a method and use of the dsRNA molecule, reagent, kit, or pharmaceutical composition thereof for preventing or treating diseases or symptoms associated with elevated Lp(a) protein levels, for inhibiting or reducing the expression of the Lp(a) gene. The dsRNA molecule promotes sequence-specific degradation of Lp(a) mRNA through RNAi action, thereby achieving inhibition of Lp(a) gene expression or a decrease in the level of Lp(a) gene expression.
[0006] In one embodiment, the present application provides a double-stranded ribonucleic acid (dsRNA) reagent for inhibiting the expression of Lp(a), wherein the dsRNA comprises a sense strand and an antisense strand, and the sense strand and / or antisense strand comprises at least 15 consecutive nucleotides that differ by 3 nucleotides or less from the nucleotide sequences of any sense and antisense sequences shown in Tables 2 and 8.
[0007] In some embodiments, the sense strand and / or the antisense strand contains or consists of 15–25 nucleotides, the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence in Table 2, the length of the double-stranded region is 15–25 bp, preferably 19–21 bp, and at least one nucleotide of the dsRNA molecule is modified. In some embodiments, the modification is selected from one or more of the following: locked nucleic acid (LNA) modification, ring-opening or unlocked (UNA) modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and ligand modification.
[0008] This invention provides a dsRNA molecule in which the nucleotide sequence of the sense strand is shown in one of the sense strand sequences in Table 2, and the nucleotide sequence of the antisense strand is shown in one of the antisense strand sequences in Table 2.
[0009] The dsRNA molecule may be selected from the dsRNAs listed in Table 2 in the examples.
[0010] In some embodiments, the sense strand structure of the dsRNA molecule is represented by one of the following sequences. AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) GAGGCACGUACUCCACCACUG (SEQ ID NO:491) AGUUAUCGAGGCACAUACUCC (SEQ ID NO:531) CUGCCAAGCUUGGUCAUCUAU (SEQ ID NO:119) CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709);
[0011] The antisense strand structure of the aforementioned dsRNA molecule is shown in one of the following sequences. AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486) CAGUGGUGGAGUACUGUGCCUCGA (SEQ ID NO:492) GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO:532) AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO:120) GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710).
[0012] In some embodiments, the modification pattern of the dsRNA molecule of the present invention includes: (1) sense strand: having a length of 17-21 nt, e.g., 21 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region having a length of 1-3 nucleotides; and having the same modification pattern for the first modified region from the 5' end and the 3' end; and (2) antisense strand: having a length of 19-23 nt, e.g., 23 nt; composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, each modified region having a length of 1-5 nucleotides; and having the 2nd-5th consecutive nucleotide regions from the 5' end and the 1st-3rd consecutive nucleotide regions from the 3' end linked by a phosphorothioate skeleton. In some alternative embodiments, the modification pattern of the dsRNA molecule of the present application may further include: (1) sense strand: having a length of 17-21 nt, preferably 21 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region having a length of 1-10 nucleotides; the first modified region from the 5' end and the 3' end are the same; the 1st-3rd consecutive nucleotide regions from the 5' end are linked by a phosphorothioate skeleton; (2) antisense strand: having a length of 19-23 nt, preferably 23 nt; composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, each modified region having a length of 1-11 nucleotides; and the 1st-3rd consecutive nucleotide regions from the 5' end and the 1st-3rd consecutive nucleotide regions from the 3' end are linked by a phosphorothioate skeleton.
[0013] In one embodiment, the length of the 2'-O-methyl modification region in the sense strand is 1-10 nucleotides, and the length of the 2'-fluoro modification region is 1-3 nucleotides; the length of the 2'-O-methyl modification region in the antisense strand is 1-11 nucleotides, and the length of the 2'-fluoro modification region is 1-3 nucleotides.
[0014] In some embodiments, the sense strand structure of the dsRNA molecule is represented by one of the following sequences. AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9).
[0015] The antisense strand structure of the aforementioned dsRNA molecule is shown in one of the following sequences. AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2) CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4) GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6) AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8) GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10)
[0016] Here, Am, Um, Cm, and Gm each represent 2'-O-methyl modified ribonucleotides A, U, C, and G, Af, Uf, Cf, and Gf each represent 2'-fluoro modified ribonucleotides A, U, C, and G, and s represents that the two nucleotides before and after are linked by a phosphorothioate backbone.
[0017] In some preferred embodiments, the dsRNA molecule is selected from the group consisting of the dsRNA molecules shown in LP164, LP173, LP508, LP2941, and LP4927. LP164: Sense strand: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) Antisense strand: AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2); LP173: Sense strand: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) Antisense strand: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4); LP508: Sense strand: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) Antisense strand: GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6); LP2941: Sense strand: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) Antisense chain: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8); and LP4927: Sense chain: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9) Antisense chain: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10). Here, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively, and s indicates that the two nucleotides at the beginning and end are linked by a phosphorothiocyanate skeleton.
[0018] The dsRNA of the present application may further include ligand modification. The ligand may be a portion taken up by the host cell. Ligand modification can improve the performance of the dsRNA molecule, such as cellular uptake, intracellular targeting, half-life, or drug metabolism or kinetics. In some embodiments, compared to dsRNA without ligand modification, dsRNA with ligand modification has increased affinity or cellular uptake to selected targets (e.g., specific tissue types, cell types, organelles, etc.), such as hepatocytes. Ligand modification does not interfere with the activity of the dsRNA.
[0019] In some embodiments, the ligand modification involves one or more ligand modifications to the 3' end, 5' end, and / or sequence of the dsRNA molecule of the present invention.
[0020] In some preferred embodiments, the ligand is selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine derivatives or analogs. The ligand targets cell surface receptors containing galactose, galactosamine, lactose, or an N-acetylgalactosamine / glucosamine moiety. The ligand preferably targets liver, particularly hepatic parenchymal cells.
[0021] In some preferred embodiments, the ligand targets the ASGPR receptor.
[0022] In some preferred embodiments, the ligand may also be human serum albumin (HSA), hyaluronic acid, polypeptide, etc.
[0023] In some preferred embodiments, the ligand-modified dsRNA is selected from any of the dsRNA molecules shown below (5' -> 3' orientation). 1) LP164-E05 Sense chain: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1)-L96, Antisense chain: AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2); 2) LP173-E05 Sense chain: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3)-L96, Antisense chain: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4); 3) LP508-E05 Sense chain: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5)-L96, Antisense chain: GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6); 4) LP2941-E05 Sense chain: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7)-L96, Antisense chain: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8); and 5) LP4927-E05 Sense chain: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9)-L96, Antisense chain: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10). Here, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively, Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively, and s indicates that the two nucleotides before and after are linked by a phosphorothioate skeleton. The structure of L96 and its linkage method with the sense strand nucleotide (i.e., "-L96") are as follows. [ka]
[0024] In some embodiments, the 3' end, 5' end and / or sequence of the dsRNA of the present application may also be modified with 1-5, 2-4, or 3 N-acetylgalactosamine derivatives or analogs, wherein the N-acetylgalactosamine derivative is preferably L96.
[0025] In some preferred embodiments, each strand of the dsRNA molecule of the present invention may contain 0% to 100% modified nucleotides, for example, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% modified nucleotides. The modifications may be located in the pendant region or the double-stranded region. The modifications may be used to improve the in vitro or in vivo properties of the dsRNA molecule, such as stability, distribution in vivo, or inhibitory activity. The modifications may be used in combination.
[0026] In some preferred embodiments, the ends of each strand of the dsRNA molecule of the present application have pendant ends or blunt ends. This includes having 1 to 8 pendants, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 pendants, at the 5' and / or 3' ends of either one or both strands, where the pendants are arbitrarily selected from U, A, G, C, T, and dT.
[0027] In some preferred embodiments, the dsRNA molecule of the present invention can inhibit the expression of the human Lp(a) gene. In some embodiments, when the antisense strand of the dsRNA of the present invention hybridizes with the mRNA precursor or mature mRNA of the LP(a) gene in maximum complementarity, the number of bases in the antisense strand that mismatch with the mRNA precursor or mature mRNA is 2 or less.
[0028] In some embodiments, the dsRNA molecule of the present application comprises a sense strand having 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, preferably 21 nucleotides in length, and an antisense strand having 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, preferably 23 nucleotides in length.
[0029] In one embodiment, the dsRNA molecule of the present invention comprises a sense strand and an antisense strand, the base sequences of which include the sense strand represented by CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709) and the antisense strand represented by GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710), and at least 15 consecutive nucleotides that differ by three or fewer nucleotides.
[0030] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, the base sequences of which include a sense strand represented by CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709) and an antisense strand represented by GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides, wherein the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
[0031] In some embodiments, the sense strand and / or antisense strand of the dsRNA molecule of the present application contains or consists of 15-25 nucleotides, wherein the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710), where the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example, 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the dsRNA molecule of the present invention has a sense strand length of 18, 19, 20, 21, or 22 nt, and the sense strand base sequence has CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709) and at least 19 consecutive identical bases, and an antisense strand length of approximately 21, 22, 23, 24, or 25 nt, and the antisense strand base sequence has GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710) and 21 consecutive identical bases.
[0032] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence containing CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709) and an antisense strand sequence containing GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710).
[0033] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence consisting of CAGAGUUAUCGAGGCACAUUC (SEQ ID NO: 709) and 0, 1, 2, 3, or 4 other nucleotides, and an antisense strand sequence consisting of GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710) and 0, 1, 2, 3, or 4 other nucleotides.
[0034] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence of CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709) and an antisense strand sequence of GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710).
[0035] In one embodiment, the dsRNA molecule of the present invention comprises a sense strand and an antisense strand, the base sequences of which include the sense strand represented by AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) and the antisense strand represented by AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides.
[0036] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, the base sequences of which include a sense strand represented by AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) and an antisense strand represented by GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:486), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides, and the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
[0037] In some embodiments, the sense strand and / or antisense strand of the dsRNA molecule of the present application contains or consists of 15-25 nucleotides, wherein the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486), where the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example, 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the dsRNA molecule of the present invention has a sense strand length of 18, 19, 20, 21, or 22 nt, and the sense strand base sequence has at least 19 consecutive identical bases to AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485), and an antisense strand length of approximately 21, 22, 23, 24, or 25 nt, and the antisense strand base sequence has 21 consecutive identical bases to AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486).
[0038] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence containing AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) and an antisense strand sequence containing AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486).
[0039] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence consisting of AGAGUUAUCGAGGCACGUACU (SEQ ID NO: 485) and 0, 1, 2, 3, or 4 other nucleotides, and an antisense strand sequence consisting of AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO: 486) and 0, 1, 2, 3, or 4 other nucleotides.
[0040] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence of AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) and an antisense strand sequence of AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486).
[0041] In one embodiment, the dsRNA molecule of the present invention comprises a sense strand and an antisense strand, the base sequences of which include the sense strand represented by GAGGCACGUACUCCACCACUG (SEQ ID NO:491) and the antisense strand represented by CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492), and at least 15 consecutive nucleotides that differ by three or fewer nucleotides.
[0042] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, the base sequences of which include a sense strand represented by GAGGCACGUACUCCACCACUG (SEQ ID NO:491) and an antisense strand represented by CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides, wherein the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
[0043] In some embodiments, the sense strand and / or antisense strand of the dsRNA molecule of the present application contains or consists of 15-25 nucleotides, wherein the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492), where the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example, 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the dsRNA molecule of the present invention has a sense strand length of 18, 19, 20, 21, or 22 nt, and the sense strand base sequence has GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and at least 19 consecutive identical bases, and an antisense strand length of approximately 21, 22, 23, 24, or 25 nt, and the antisense strand base sequence has CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492) and 21 consecutive identical bases.
[0044] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence containing GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and an antisense strand sequence containing CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492).
[0045] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence consisting of GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) and 0, 1, 2, 3, or 4 other nucleotides, and an antisense strand sequence consisting of CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO: 492) and 0, 1, 2, 3, or 4 other nucleotides.
[0046] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence of GAGGCACGUACUCCACCACUG (SEQ ID NO:491) and an antisense strand sequence of CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492).
[0047] In one embodiment, the dsRNA molecule of the present invention comprises a sense strand and an antisense strand, the base sequences of which include the sense strand represented by AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and the antisense strand represented by GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides.
[0048] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, the base sequences of which include a sense strand represented by AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and an antisense strand represented by GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides, and the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
[0049] In some embodiments, the sense strand and / or antisense strand of the dsRNA molecule of the present application contains or consists of 15-25 nucleotides, wherein the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532), where the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example, 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the dsRNA molecule of the present invention has a sense strand length of 18, 19, 20, 21, or 22 nt, and the sense strand base sequence has at least 19 consecutive identical bases to AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531), and an antisense strand length of approximately 21, 22, 23, 24, or 25 nt, and the antisense strand base sequence has 21 consecutive identical bases to GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).
[0050] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence containing AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and an antisense strand sequence containing GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).
[0051] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence consisting of AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and 0, 1, 2, 3, or 4 other nucleotides, and an antisense strand sequence consisting of GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532) and 0, 1, 2, 3, or 4 other nucleotides.
[0052] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence of AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) and an antisense strand sequence of GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532).
[0053] In one embodiment, the dsRNA molecule of the present invention comprises a sense strand and an antisense strand, the base sequences of which include the sense strand represented by ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO:119) and the antisense strand represented by AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO:120), and at least 15 consecutive nucleotides that differ by three or fewer nucleotides.
[0054] In one embodiment, the dsRNA molecule of the present application comprises a sense strand and an antisense strand, the base sequences of which include a sense strand represented by ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and an antisense strand represented by AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120), and at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides, wherein the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
[0055] In some embodiments, the sense strand and / or antisense strand of the dsRNA molecule of the present application contains or consists of 15-25 nucleotides, wherein the antisense strand is complementary to 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO:120), where the length of the double-stranded region of the dsRNA molecule is 15-25 bp, preferably 19-21 bp, for example, 16, 17, 18, 20, 22, 23, or 24 bp. In one embodiment, the dsRNA molecule of the present invention has a sense strand length of 18, 19, 20, 21, or 22 nt, and the sense strand base sequence has ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and at least 19 consecutive identical bases, and an antisense strand length of approximately 21, 22, 23, 24, or 25 nt, and the antisense strand base sequence has AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120) and 21 consecutive identical bases.
[0056] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence containing ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and an antisense strand sequence containing AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).
[0057] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence consisting of ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO: 119) and 0, 1, 2, 3, or 4 other nucleotides, and an antisense strand sequence consisting of AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120) and 0, 1, 2, 3, or 4 other nucleotides.
[0058] In one embodiment, the dsRNA molecule of the present invention has a sense strand sequence of ACUGCCAAGCUUGGUCAUCUAU (SEQ ID NO:119) and an antisense strand sequence of AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO:120).
[0059] In one embodiment, the sequences SEQ ID NO:709, SEQ ID NO:710, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:531, SEQ ID NO:532, SEQ ID NO:119, and SEQ ID NO:120 may include one or more nucleotide modifications selected from 2'-O-methyl modifications, 2'-fluoro modifications, phosphorothioate backbone modifications, and ligand modifications. The specific ligands are as described above.
[0060] In one embodiment, the characteristics of the dsRNA sense strands in SEQ ID NO:709, SEQ ID NO:485, SEQ ID NO:491, SEQ ID NO:531, and SEQ ID NO:119 include having a length of 17-21 nt, for example 21 nt; being composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, with each modified region having a length of 1-10 nucleotides; the first modified region from the 5' end and the 3' end are the same; and the 1st-3rd consecutive nucleotide regions from the 5' end are linked by a phosphorothioate skeleton. The characteristics of the antisense strands in SEQ ID NO:710, SEQ ID NO:486, SEQ ID NO:492, SEQ ID NO:532, and SEQ ID NO:120 include having a length of 19-23 nt, for example 23 nt, and comprising 2'-O-methyl modified regions and 2' -The alternating fluoromodified regions, each modified region having a length of 1-11 nucleotides, and the 1st-3rd consecutive nucleotide regions from the 5' end and the 1st-3rd consecutive nucleotide regions from the 3' end are linked by a phosphorothioate skeleton.
[0061] In one embodiment, the length of the 2'-O-methyl modification region in the sense strand is 1 to 10 nucleotides, and the length of the 2'-fluoro modification region is 1 to 3 nucleotides; and the length of the 2'-O-methyl modification region in the antisense strand is 1 to 11 nucleotides, and the length of the 2'-fluoro modification region is 1 to 3 nucleotides.
[0062] In one embodiment, the nucleotide sequences of SEQ ID NO:709, SEQ ID NO:710, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:531, SEQ ID NO:532, SEQ ID NO:119, and SEQ ID NO:120 are modified, and the modification pattern is as described above.
[0063] In one embodiment, the modified SEQ ID NO:709, SEQ ID NO:710, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:531, SEQ ID NO:532, SEQ ID NO:119, and SEQ ID NO:120 may further include ligand modifications at the 3' end, 5' end, and / or within the sequence. The specific ligands are as described above.
[0064] In some embodiments, the dsRNA of the present application has a sense strand length of 18, 19, 20, 21, or 22 nt and includes or is: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9); The antisense chain length is 21, 22, 23, 24, or 25 nt and includes or is: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10).
[0065] In some embodiments, the dsRNA of the present application has a sense strand length of 18, 19, 20, 21, or 22 nt and includes or is: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) The antisense chain length is 21, 22, 23, 24, or 25 nt and includes or is: AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2).
[0066] In some embodiments, the dsRNA of the present application has a sense strand length of 18, 19, 20, 21, or 22 nt and includes or is: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) The antisense chain length is 21, 22, 23, 24, or 25 nt and includes or is: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4)
[0067] In some embodiments, the dsRNA of the present application has a sense strand length of 18, 19, 20, 21, or 22 nt and includes or is: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) The antisense chain length is 21, 22, 23, 24, or 25 nt and includes or is: GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6); and
[0068] In some embodiments, the dsRNA of the present application has a sense strand length of 18, 19, 20, 21, or 22 nt and includes or is: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) The antisense chain length is 21, 22, 23, 24, or 25 nt and includes or is: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8).
[0069] In this application, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; and s indicates that the two nucleotides at the beginning and end are linked by a phosphorothiocyanate skeleton.
[0070] In another embodiment, the present application also relates to a biological material relating to the dsRNA of the present application. The biological material relating to the dsRNA of the present application may be selected from any one of the following: (A) A DNA molecule capable of producing the dsRNA of the present invention, (B) A vector capable of expressing the dsRNA of the present invention, (C) Reagents or kits comprising the dsRNA or DNA molecule of the present invention or the vector, (D) A pharmaceutical composition comprising the dsRNA molecule of the present application and other pharmaceutically acceptable components.
[0071] In some embodiments, the pharmaceutical composition comprises a pharmacologically effective amount of the dsRNA molecule of the Application and other pharmaceutically acceptable components. "Effective amount" means the amount of dsRNA molecule effective in producing the desired pharmacological therapeutic effect.
[0072] In some embodiments, “other components” include pharmaceutically acceptable carriers, such as water, saline solution, glucose, buffers (e.g., PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.
[0073] In another aspect, the present application relates to dsRNA or related biological material that can be used to prevent and / or treat Lp(a) gene-mediated diseases, or to alleviate the symptoms of Lp(a) gene-mediated diseases.
[0074] In some embodiments, the present application also provides the uses shown in any of the following:
[0075] Use of the dsRNA or biomaterial of the present invention for inhibiting the expression of the Lp(a) gene, or for preparing a product for inhibiting the expression of the Lp(a) gene. Here, inhibiting the expression of the Lp(a) gene means inhibiting or reducing the expression level of the Lp(a) gene in human or primate cells in vivo or in vitro. Inhibiting the expression of the Lp(a) gene means inhibiting or reducing the expression level of the Lp(a) gene by at least 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.
[0076] In some embodiments, the cells are mammalian animal cells, such as primate or human cells, that express the Lp(a) gene. More preferably, they are target cells that express the p(a) gene at a high level. More preferably, they are target cells derived from the brain, lung, liver, kidney, or tumor.
[0077] In some embodiments, the cells are selected from the group consisting of HepG2, HEP3B, Huh7, MHCC97H, HeLa, cynomolgus monkey primary cells, and human primary cells.
[0078] In some embodiments, the terminal cell concentration of the dsRNA molecule of the present invention is 0.001–1000 nM, for example, 0.001–10 nM, 10–500 nM, 25–300 nM, or 50–100 nM.
[0079] In some embodiments, the dsRNA or related biological material of the present application may be administered by any suitable means, such as parenteral administration including intramuscular, intravenous, arterial, peritoneal, or subcutaneous injection. The form of administration may include, but is not limited to, single doses or multiple doses.
[0080] In some preferred embodiments, the dose is in the range of 0.1 mg / kg-100 mg / kg, 0.5 mg / kg-50 mg / kg, 3 mg / kg-36 mg / kg, 2.5 mg / kg-20 mg / kg, 5 mg / kg-15 mg / kg, for example, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg g / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25m g / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg.
[0081] In some embodiments, a single-dose pharmaceutical composition can be long-lasting, for example, the reduction in Lp(a) expression lasts for at least 3, 5, 7, 10, 14, 18, 22, 25, 27, 29, 32, 35, 40, 45, 50, 55, 60 days or longer.
[0082] In some embodiments, the present application relates to the use of the present dsRNA or the present biological material for reducing Lp(a) in serum or for preparing a product for reducing Lp(a) in serum. Here, reducing the Lp(a) concentration in the serum means reducing the Lp(a) concentration in the serum of a human or primate, for example, the concentration or content of serum Lp(a) is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%.
[0083] In some embodiments, the present application relates to the use of the dsRNA or the biological material of the present application for preventing and / or treating diseases mediated by the Lp(a) gene, or for preparing products for preventing and / or treating diseases mediated by the Lp(a) gene.
[0084] In some embodiments, the present application relates to the use of the present dsRNA or the present biomaterial for alleviating symptoms of Lp(a) gene-mediated diseases or for preparing products for alleviating symptoms of Lp(a) gene-mediated diseases.
[0085] In some embodiments, the Lp(a) gene-mediated disease or condition may be caused by overexpression of the Lp(a) gene or overproduction of the Lp(a) protein and may be regulated by downregulation of Lp(a) gene expression. The treatment refers to the alleviation, reduction, or cure of the Lp(a) gene-mediated disease or condition, for example, a decrease in serum Lp(a) levels. For example, serum Lp(a) content or concentration was reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, and 95%.
[0086] In another embodiment, the present invention also provides methods and / or combination therapies for treating subjects having a disorder, such as an Lp(a)-related disorder, which would benefit from the inhibition or reduction of Lp(a) gene expression, the methods or combination therapies comprising the administration of the present invention's dsRNA or biomaterial alone or in combination with other therapeutic agents.
[0087] In one embodiment, the Application also includes the use of the LPA-targeted dsRNA of the Application for the manufacture of a pharmaceutical product for treating or preventing cardiovascular disease, including coronary artery disease, peripheral artery disease, myocardial infarction, or stroke, in patients who require treatment or prevention of such disease.
[0088] In one embodiment, the present application provides the use of the present LPA-targeted dsRNA for manufacturing a pharmaceutical for reducing LP(a) levels in patients who require a reduction in LP(a) levels.
[0089] The combination therapy of the present invention comprises administering the RNAi reagent and other therapeutic agents of the present invention to patients with Lp(a)-related disease. The combination therapy of the present invention reduces Lp(a) levels in the subjects (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%).
[0090] In some embodiments, the other therapeutic agent may be an anti-Lp(a) antibody or its antigen-binding fragment or derivative.
[0091] In some embodiments, the cardiovascular diseases include, but are not limited to, myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g., peripheral artery disease), cerebrovascular disease, vulnerable plaque, and aortic stenosis.
[0092] In some embodiments, patients requiring a reduction in LPA expression are those at risk of myocardial infarction, and these patients may have a history of myocardial infarction (e.g., have previously suffered a myocardial infarction). These patients may also have a family history of myocardial infarction or possess one or more risk factors for myocardial infarction. These risk factors include, but are not limited to, hypertension, elevated non-HDL cholesterol levels, elevated triglyceride levels, diabetes, obesity, or a history of autoimmune diseases (e.g., rheumatoid arthritis, lupus).
[0093] In one embodiment, patients at risk of myocardial infarction are those who have coronary artery disease or have been diagnosed with coronary artery disease.
[0094] In some embodiments, the application also includes LPA-targeted dsRNA for use in a method for reducing LP(a) levels in patients who require a reduction in LP(a) levels.
[0095] In some embodiments, the present application provides LPA-targeted dsRNAs for use in methods of reducing the risk of myocardial infarction in patients who require a reduction in the risk of myocardial infarction.
[0096] Exemplary, the present invention also provides the following optional technical solutions. 1. A dsRNA molecule that represses the expression of the Lp(a) gene, comprising a sense strand and an antisense strand that complementaryly form a double-stranded region, wherein the sense strand and the antisense strand each contain 15-25 nucleotides or consist of 15-25 nucleotides, the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence shown in Table 2, the length of the double-stranded region is 15-25 bp, and optionally, at least one nucleotide of the dsRNA molecule is modified. 2. The dsRNA molecule according to item 1, characterized in that the nucleotide sequence of the sense strand and the nucleotide sequence of the antisense strand are as shown in Table 2. 3. The dsRNA molecule according to item 1 or 2, characterized in that the modification is selected from one or more of the following: locked nucleic acid modification, ring-opening or unlocked nucleic acid modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and ligand modification. 4. The dsRNA molecule according to item 3, characterized in that the modification pattern of the dsRNA molecule includes: (1) sense strand: length 17-21 nt, preferably 21 nt; composed alternately of 2'-O-methyl modified regions and 2'-fluoro modified regions, with each modified region having a length of 1-3 nucleotides; the modification patterns of the 5' end and the first modified region from the 3' end are the same; (2) antisense strand: length 19-23 nt, preferably 23 nt; composed alternately of 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, with each modified region having a length of 1-5 nucleotides; and the 2nd-5th consecutive nucleotide regions from the 5' end and the 1st-3rd consecutive nucleotide regions from the 3' end are linked by a phosphorothioate skeleton. 5. The dsRNA molecule according to item 4, characterized in that the sense strand structure of the dsRNA molecule is shown in (A1), (A2), (A3), (A4), or (A5), and the antisense strand structure of the dsRNA molecule is shown in (A6), (A7), (A8), (A9), or (A10). (A1) AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) (A2) GAGGCACGUACUCCACCACUG (SEQ ID NO:491) (A3) AGUUAUCGAGGCACAUACUCC (SEQ ID NO:531) (A4) CUGCCAAGCUUGGUCAUCUAU (SEQ ID NO:119) (A5) CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709) (A6) AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486) (A7) CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492) (A8) GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO:532) (A9) AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO:120) (A10) GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO:710). 6. The dsRNA molecule according to item 5, characterized in that the sense strand structure of the dsRNA molecule is shown in (B1), (B2), (B3), (B4), or (B5), and the antisense strand structure of the dsRNA molecule is shown in (B6), (B7), (B8), (B9), or (B10). (B1) AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) (B2)GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) (B3) AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) (B4) CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) (B5) CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9) (B6) AmsGmsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2) (B7) CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm(SEQ ID NO:4) (B8) GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm(SEQ ID NO:6) (B9) AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm(SEQ ID NO:8) (B10) GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm(SEQ ID NO:10) Here, Am, Um, Cm, and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C, and G, respectively. Af, Uf, Cf, and Gf represent 2'-fluoromodified ribonucleotides A, U, C, and G, respectively, and (s) indicates that the two nucleotides at the beginning and end are linked by a phosphorothioate skeleton. 7. The dsRNA molecule according to item 6, characterized in that the dsRNA molecule is further modified with a ligand. The sense strand structure of the modified dsRNA is as shown in (C1), (C2), (C3), (C4), or (C5); the antisense strand structure of the dsRNA molecule is as shown in (C6), (C7), (C8), (C9), or (C10). (C1) AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1)-L96 (C2) GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3)-L96 (C3) AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5)-L96 (C4) CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7)-L96 (C5) CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9)-L96 (C6) AmsGmsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2) (C7) CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4) (C8) GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6) (C9) AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8) (C10) GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10) Here, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; (s) indicates that the two nucleotides before and after are linked by a phosphorothioate skeleton; L96 is linked to the 3' terminal nucleotide of the dsRNA sense strand nucleotide sequence by a phosphodiester bond or a phosphorothiodiester bond; the structure of L96 and its linkage to the sense strand nucleotide are as follows. [ka] . 8. The dsRNA molecule according to item 7, characterized in that the dsRNA molecule has a 5'->3' orientation and is selected from the following double-stranded RNA pairs. 1) Sense chain: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1)-L96 Antisense chain: AmsGmsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2) 2) Sense chain: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3)-L96 Antisense chain: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4) 3) Sense chain: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5)-L96 Antisense chain: GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6) 4) Sense chain: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7)-L96 Antisense chain: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8) 5) Sense chain: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9)-L96 Antisense chain: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10) Here, Am, Um, Cm, and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C, and G, respectively. Af, Uf, Cf, and Gf represent 2'-fluoromodified ribonucleotides A, U, C, and G, respectively, (s) indicates that the two nucleotides before and after are linked by a phosphorothioate backbone, and L96 is linked to the 3' terminal nucleotide of the dsRNA sense strand nucleotide sequence by a phosphodiester bond or phosphorothiodiester bond. 9. A biological material selected from one of the following groups. (A) A DNA molecule capable of producing dsRNA as described in any one of items 1-8, (B) A vector capable of expressing any one of the dsRNAs described in item 1-8, (C) Reagents or kits containing the dsRNA described in any one of items 1-8, or the DNA molecule of the dsRNA, or the vector of the dsRNA. (D) A pharmaceutical composition comprising a dsRNA molecule as described in any one of items 1-8 and other pharmaceutically acceptable components. 10. Use of dsRNA selected from one of the following groups. (I) Use of a dsRNA molecule as described in any one of items 1-8 or a biological material as described in item 9 for inhibiting the expression of the Lp(a) gene or for preparing a product for inhibiting the expression of the Lp(a) gene. (II) Use of dsRNA molecules or biological materials described in any one of items 1-8 or item 9 in products for reducing Lp(a) particle levels. (III) Use of dsRNA as described in any one of items 1-8 or biological material as described in item 9 for the prevention and / or treatment of disorders, conditions or syndromes associated with elevated levels of Lp(a) particles, or for the preparation of products for the prevention and / or treatment of disorders, conditions or syndromes associated with elevated levels of Lp(a) particles. The diseases associated with the elevated levels of Lp(a) particles include stroke, atherosclerosis, thrombosis, or cardiovascular disease, such as coronary heart disease or aortic stenosis, and any other diseases or conditions associated with elevated levels of Lp(a) particles, as well as reducing the risk of developing stroke, atherosclerosis, thrombosis, or cardiovascular disease, such as coronary heart disease or aortic stenosis, and any other diseases or conditions associated with elevated levels of Lp(a) particles.
[0097] The innovativeness of this invention includes, but is not limited to, the following: 1. The modified dsRNA molecule has high stability and high inhibitory activity; 2. The ligand-modified dsRNA molecule maintains high inhibitory activity and stability while exhibiting better liver targeting and cell endocytosis-promoting capabilities, reducing impact on other tissues or organs, and allowing for a reduction in the amount of dsRNA molecule used, thereby achieving the objectives of reduced toxicity and cost reduction. Furthermore, the ligand-modified dsRNA molecule can enter target cells or tissues without the need for transfection reagents, reducing the adverse effects of transfection reagents, such as cytotoxicity or tissue toxicity, and providing the possibility of targeted therapy. Many modifications can be attempted to improve the performance of dsRNA, but these attempts usually involve RNA interference, and it is difficult to increase stability in serum (e.g., increasing resistance to nucleases and / or extending the duration). However, the modified dsRNA of this invention maintains high inhibitory activity while possessing high stability, yielding unexpected technical effects.
[0098] Definition: As used herein, "LPA" and "Lp(A)" are interchangeable and, depending on the context, may be used to refer to lipoprotein A or a nucleic acid molecule encoding lipoprotein A. For example, dsRNAs that target LPA, i.e., dsRNAs that target the gene encoding LPA, such as mRNA or pre-mRNA transcribed from the gene encoding LPA.
[0099] "G", "C", "A", "T", and "U" generally represent nucleotides whose bases are guanine, cytosine, adenine, thymine, and uracil, respectively.
[0100] GalNAc refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, commonly known as N-acetylgalactosamine in the literature. When referring to "GalNAc" or "N-acetylgalactosamine," both the β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and the α-form: 2-(acetylamino)-2-deoxy-α-D-galactopyranose are included. Both the β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and the α-form: 2-(acetylamino)-2-deoxy-α-D-galactopyranose can be used interchangeably. Preferably, the compound of this application contains the β-form, i.e., 2-(acetylamino)-2-deoxy-β-D-galactopyranose.
[0101] L96: This is a GalNac conjugate, and its specific structure is as follows. [ka]
[0102] Typically, the majority of nucleotides in each strand of a dsRNA molecule are ribonucleotides, but each or both strands may also contain one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides, as described in detail herein. Furthermore, as used herein, the “RNAi reagent” may contain ribonucleotides with chemical modifications, and the RNAi reagent may contain many modifications on multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in dsRNA, siRNA-type molecules, are included in the “RNAi reagent” for the purposes of this specification and this item.
[0103] As used herein, “dsRNA” refers to double-stranded RNA, and since siRNA is RNA with a double-stranded structure, the term “dsRNA” includes siRNA. dsRNA further includes double-stranded RNA that is longer than siRNA, where longer than siRNA may mean that its sense strand is longer than siRNA, or its antisense strand is longer than siRNA, or both its sense and antisense strands are longer than siRNA. Typically, double-stranded RNA longer than the siRNA sequence it contains is degraded into siRNA by a type III endonuclease called Dicer once it enters a cell. In some embodiments, the two strands of dsRNA are each independently 15–30 nt (wherein “nt” is a nucleotide) in length. When “siRNA” is incorporated into an RNA-induced silencing complex (RISC), one or more helicases in the RISC unwind the double helix of the siRNA. When an siRNA binds to a target mRNA complementary to the antisense strand, one or more endonucleases in RISC cleave the target, inducing gene silencing. Typically, the majority of nucleotides in each strand of a dsRNA molecule are ribonucleotides, but this does not preclude the presence of one or more non-ribonucleotides, such as deoxyribonucleotides and / or non-native nucleotides, in either or both strands. In some embodiments, the dsRNA molecule does not contain non-native nucleotides. In some embodiments, each nucleotide in the dsRNA is a ribonucleotide. As used herein, the dsRNA may contain one or more chemically modified nucleotides, or it may not contain any chemically modified nucleotides. [Brief explanation of the drawing]
[0104] [Figure 1] This is the expression level of the LPA gene in RT4 cells after administration of the candidate modified sequence. [Figure 2] This is the expression level of the LPA gene in RT4 cells after administration of the candidate modified sequence. [Figure 3] This is the IC50 value in Hep3B cells after chemical modification of the candidate molecule. [Figure 4] This is the percentage of rhesus monkey serum Lp(a) content relative to baseline levels before administration. [Figure 5] This is a map of the psicheck-2 plasmid. [Modes for carrying out the invention]
[0105] Example 1: LPA-siRNA activity screening 1. siRNA design Based on the human LPA mRNA sequence (NM_005577.4), multiple LPA siRNAs were designed by selecting different sites. All designed single siRNAs can target all transcripts of the target gene (see Table 1). The above sequences (e.g., Table 2) show the lowest homology to all other non-target gene sequences after alignment using sequence similarity software. Here, the positive reference sequences were designed as OLP2706, an siRNA drug developed by Amgen, and SLN2545, an siRNA drug developed by Silence Therapeutics. OLP2706 is listed in WO 2021 / 119034A1 with sense and antisense sequence numbers 281 and 470, respectively. SLN2545 is listed in WO 2019 / 092283A1 with sense and antisense sequence numbers 9 and 10, respectively.
[0106] [Table 1]
[0107] [Table 2-1] [Table 2-2] [Table 2-3] Table 2-4 Table 2-5 Table 2-6 Table 2-7 Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18
[0108] 2. siRNA synthesis (natural RNA / 2'-methoxy or 2'-fluoromodified RNA / GalNAc-RNA) In this application, dsRNAs containing only ribonucleotides or 2'-methoxy or 2'-fluoro-modified oligonucleotides were synthesized according to a theoretical yield of 1 μmol. All oligonucleotides (including unmodified dsRNAs in Table 2 and modified dsRNAs in Table 8) were prepared in an LK-192X synthesizer using 1 μmol Universal Frit support (1000 Å = 100 nm, Biocomma) or a CPG support of the protecting group-containing GalNAc derivative L96 (WuXi AppTec / Glen Research, loading 30 μmol / g). All phosphoramidite monomers (Hongene biotech / Hitgene) were diluted 1:20 (g / mL) in anhydrous acetonitrile solvent. A total of two couplings were performed with a coupling time of 3 min. Deprotection was performed using 3% TCA, activation with 0.3 M benzylthiotetrazole acetonitrile solution, and capping and oxidation were performed with CAPA / CAPB and 50 mM I2 solution, respectively. After trityl-off synthesis, the solid support was transferred to a 2 mL centrifuge tube, 1.2 mL of ammonia was added, and the oven was heated at 65°C for 3 hours to remove the protecting group. The mixture was then cooled to room temperature, vacuum concentrated for 30 minutes, and the solution was filtered through a 0.22 μm filter membrane into a sample vial. Single-chain purification was performed using a semi-preparative reverse-phase purifier with an elution gradient of 7%-30% (ACN: 100 mM TEAA) for 10 minutes at a flow rate of 5 mL / min. After purification, the mixture was concentrated under vacuum and spin-dried at room temperature. Finally, the sample was dissolved in water, and each solution was desalted using a GE Hi-Trap desalting column to elute the final oligonucleotide product. All properties and purity were confirmed using ESI-MS and IEX HPLC, respectively. The concentration was measured using a microplate reader under UV light. Equimolar amounts of sense and antisense chains were mixed, transferred to a new 2 mL EP tube, heated at 95°C for 5 minutes, slowly annealed to room temperature, and finally spin-dried at room temperature using a vacuum concentrator to obtain the final product.
[0109] 3. Detection of LPA-siRNA inhibitory activity in vitro using the psicheck-2 system. 1. Construction of the detection plasmid The LPA recombinant plasmid was constructed using the psicheck-2 plasmid (GenScript Biotech Co., Ltd.). The psicheck-2 plasmid was purchased from Promega. As shown in Figure 5, its plasmid map contains all the target sequences of the test LPA siRNA (i.e., target sequences complementary to any antisense strand of the test siRNA), and the cloning sites are the 5'XhoI and 3'NotI regions of the psicheck-2 plasmid.
[0110] 2. Cotransfection of LPA siRNA with recombinant plasmids Both 293T cells and transfection reagents are commercially available. Cells are cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When they reach the logarithmic growth phase and are in good condition (70% confluence), they are plated and subjected to transfection. Cell density is adjusted to 5 × 10⁶ cells per well. 4 The cells were seeded in a 96-well plate. Transfection complex preparation: 5 μL of Opti-MEM, 8 ng of recombinant plasmid, and 1 μL of 10 μM siRNA were mixed, and 5 μL of Opti-MEM and 1 μL of Lipofectamine 2000 transfection reagent were mixed and allowed to stand for 5 minutes. Then, the two mixtures were mixed and allowed to stand for 5 minutes. The transfection complex was added to a 96-well plate and incubated for 24 hours in a 5% CO2, 37°C constant temperature incubator.
[0111] In addition to the test group, a control group was established for each cell transfection: NC was the negative control (unrelated siRNA), the Lipo group was the transfection reagent control group, and the Blank group was the untreated control group (no siRNA added). Both the test group and the control group were repeated three times.
[0112] 3. DLR detection analysis For detection, the Dual-Luciferase Reporter Assay System kit (Promega) was used. Cells were lysed and collected according to the kit instructions. The fluorescence intensities of Photinus pyralis luciferase and Renilla reniformis luciferase were detected sequentially using an Infinite Eplex microplate reader (TECAN), and the ratio of the fluorescence intensities of Renilla reniformis luciferase to Photinus pyralis luciferase was calculated and standardized using the NC group as a control. Tables 4 and 5 show the results of three replicates of DLR detection and represent the mean luciferase reporter gene expression levels of the LPA siRNA test group compared to the NC group.
[0113] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]
[0114] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]
[0115] As shown in Tables 4 and 5, LPA siRNA DLR screening with a total of 387 pairs of siRNAs in 293T cells identified the top 50 siRNA molecules with higher activity (see Table 7 for siRNA names), which were then screened in vitro using RT4 cells.
[0116] IV. LPA siRNA qPCR screening 1. Transfection of LPA siRNA into RT4 cells RT4 cells are cultured in McCoy's medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When they reach the logarithmic growth phase and are in good condition (70% confluence), they are plated and used for transfection. The cell density is adjusted to 1.5 × 10⁶ cells per well. 5 Nine cells were seeded into a 24-well plate. Transfection complex preparation: 50 μL of Opti-MEM and 1 μL of 10 nM siRNA were mixed, then 50 μL of Opti-MEM and 1.5 μL of RNAi Max transfection reagent were mixed, and then the two mixtures were mixed and allowed to stand for 15 minutes. The transfection complex was added to the 24-well plate and incubated for 48 hours in a 5% CO2, 37°C constant temperature incubator. In addition to the test group, a control group was established for each cell transfection: the NC group was a negative control (uncorrelated siRNA), the RNAi Max group was a transfection reagent control, and the Blank group was an untreated control (no siRNA added).
[0117] 2. Real-time fluorescence quantitative PCR analysis: After 48 hours of transfection, the cells were lysed and total cellular RNA was extracted using a column extraction kit (Novagen). Real-time fluorescence quantitative PCR was performed using the Sybrgreen method with the GAPDH gene as the internal standard, employing a CFX96 fluorescence quantitative PCR instrument (Bio-Rad). The primers used are as follows:
[0118] [Table 5]
[0119] 3. Data Analysis After the PCR reaction was completed, relative quantitative analysis was performed using the 2-ΔΔCt (Livak) method with an internal standard gene as the standard. Results from Table 7 and Figures 1 and 2 show that 100 nM LP4553 and LP4927 exhibited higher inhibitory activity in RT4 cells, 6.9% and 5.6% higher than the positive control OLP2706, and 15.5% and 14.2% higher than the positive control SLN2545. It should be understood that all dsRNAs used in this example, including the positive control, are unmodified, naked nucleic acid molecules.
[0120] [Table 6-1] [Table 6-2] [Table 6-3]
[0121] Example 2: Optimization of LPA-siRNA 1. Transfection of Hep3B cells with LPA plasmid To increase LPA expression, LPA plasmids were transfected into Hep3B cells. A plasmid capable of transcribing and forming LPA mRNA was constructed by recombination by incorporating the full-length LPA mRNA sequence (Gene ID: 4018) into the pcDNATM3.1 plasmid (GenScript Biotech Co., Ltd.). After subculturing Hep3B cells, they were grown in an incubator for 24 hours, and then the transfection experiment was performed. 5 μL of lipo2000 was added to a 10 cm dish, and 10 μg of plasmid was added to 500 μL of opti-MEM. After standing for 5 minutes, the lipo2000 mixture was added to the plasmid mixture, lightly pipetted three times, and then stood for 10 minutes. The mixture was then added to a 10 cm dish and ready for transfection after 24 hours. The top 5 highly active siRNA molecules were further identified, their sequences modified and optimized (Table 8), and compared with positive reference sequences (Table 9) (Table 10).
[0122] [Table 7]
[0123] In the table above, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; and s indicates that the two nucleotides at the beginning and end are linked by a phosphorothiocyanate skeleton.
[0124] [Table 8]
[0125] In the table above, Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; and s indicates that the two nucleotides at the beginning and end are linked by a phosphorothiocyanate skeleton.
[0126] [Table 9]
[0127] 2. IC in transfected Hep3B cells 50 value LP508, LP2941, LP4927, and the positive control OLP2706-modified plasmid were transfected into Hep3B cells using a 10-fold gradient dilution with Nuclease-Free Water (Invitrogen) at a total of six concentrations, with a maximum final concentration of 10 nM. The transfection procedures for LPA plasmids, siRNA transfection, and quantitative PCR detection are shown in Example 1, as well as IC. 50 The values were analyzed and calculated using GraphPad Prism software. Figure 3 shows IC in LP508-E05, LP2941-E05, LP4927-E05, and positive control OLP2706-modified Hep3B cells. 50 The values were 1.822 nM, 3.697 nM, 3.671 nM, and 15.62 nM, respectively, indicating that the inhibition rates of LP508-E05, LP2941-E05, and LP4927-E05 against LPA mRNA were superior to those of the positive control OLP2706-modified strains.
[0128] Example 3: Efficacy assay in rhesus monkeys Eight rhesus monkeys (Beijing JOINN Laboratories) were randomly assigned to four groups—a positive control group and four test groups (OLP2706-modified, LP508-E05, LP2941-E05, LP4927-E05—four test compounds)—with two animals in each group, one male and one female, based on body weight and lipoprotein Lp(a) levels. Before administration, serum was collected from the animals, and baseline Lp(a) levels were measured for each animal. Each test drug was administered once (at a dose of 3 mg / kg, by subcutaneous injection). On day 1 (the day before administration), and on days 5, 8, 12, 15, 19, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, 92, 99, 106, 113, 120, 127, 134, 141, 148, 155, 162, and 169 (the subjects were fasted overnight before blood collection, with the day of injection counted as day 1), approximately 3 mL of blood was collected from a subcutaneous vein in the forelimb or hindlimb, and the serum was separated and used for Lp(a) detection.
[0129] 1. Detection of Lp(a) protein Serum Lp(A) protein levels were detected using the Human Lipoprotein A ELISA Kit (abcam, ab212165). All values were standardized to baseline values collected from each animal before administration and expressed as a percentage of the initial level (Figure 4, Table 11).
[0130] [Table 10]
[0131] The results (Figure 4, Table 11) show that in all four animal groups, serum Lp(a) protein levels were significantly reduced compared to before administration. In particular, the OLP2706-modified, LP508-E05, and LP2941-E05 groups showed a decrease of 64-84% from day 19 to day 36, while the LP4927-E05 group showed a decrease of 97-99% on day 36. Subsequently, a rebound was observed in the OLP2706-modified, LP508-E05, and LP2941-E05 groups. Continued observation of the experiment showed that a stable decrease was maintained in the LP4927-E05 group on day 71, with serum Lp(a) protein levels being inhibited by 96-99%. By day 92, the reduction observed in the OLP2706-modified and LP508-E05-treated groups was only 17%–38%, the LP2941-E05-treated group returned to pre-treatment levels, and LP4927-E05 maintained a sustained reduction of 92%–94%. Therefore, the sampling period for LP4927-E05 was extended to day 169. Despite this, the reduction in serum Lp(a) protein levels remained at 70%–80%. From this, it was found that the long-term effect of LP4927-E05 in reducing serum Lp(a) protein levels is significantly superior to that of other dsRNAs targeting positive reference and LPA mRNA.
[0132] The above description is merely an example of preferred embodiments and does not limit the combination of features necessary to carry out the present invention. The title provided is not intended to limit the various embodiments of the present invention. Terms such as “includes,” “contains,” and “has” are not intended to limit. Furthermore, unless otherwise specified, plural forms are included where there is no numerical modification, and “or” and “or” mean “and / or.” All technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art unless otherwise defined. All publications and patents referenced herein are incorporated herein by reference. Various modifications and variations of the methods and compositions described herein are obvious to those skilled in the art without departing from the scope and spirit of this application. Although this application has been described using certain preferred embodiments, it should be understood that the claimed application is not unduly limited to these particular embodiments. In fact, various variations for carrying out the embodiments described herein that are obvious to those skilled in the art are intended to be included in the appended claims.
Claims
1. A dsRNA molecule that represses the expression of the Lp(a) gene, comprising a sense strand and an antisense strand complementary to form a double-stranded region, wherein the sense strand and the antisense strand each contain 15-25 nucleotides or consist of 15-25 nucleotides, the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sense strand sequence shown in Table 2, the length of the double-stranded region is 15-25 bp, and optionally, at least one nucleotide of the dsRNA molecule is modified.
2. The dsRNA molecule according to claim 1, characterized in that the nucleotide sequence of the sense strand and the nucleotide sequence of the antisense strand are selected from the sense strand and antisense strand sequences shown in Table 2.
3. The dsRNA molecule according to claim 1 or 2, characterized in that the modification is selected from one or more of the following: locked nucleic acid modification, ring-opening or unlocked nucleic acid modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, 2'-hydroxyl modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and ligand modification.
4. The dsRNA molecule according to claim 3, characterized in that the modification pattern of the dsRNA molecule includes: (1) sense strand: having a length of 17-21 nt, preferably 21 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region having a length of 1-10 nucleotides; the modification patterns of the first modified region from the 5' end and the 3' end are the same; the 1st to 3rd consecutive nucleotide regions from the 5' end are linked by a phosphorothioate skeleton; (2) antisense strand: having a length of 19-23 nt, preferably 23 nt; composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, each modified region having a length of 1-11 nucleotides; the 1st to 3rd consecutive nucleotide regions from the 5' end and the 1st to 3rd consecutive nucleotide regions from the 3' end are linked by a phosphorothioate skeleton.
5. The dsRNA molecule according to claim 1, wherein the sense strand and antisense strand base sequences of the dsRNA molecule include any one set of sequences selected from the following, or are the sequence of that set. 1) Sense chain: CAGAGUUAUCGAGGCACAUUC (SEQ ID NO:709) Antisense chain: GAAUGUGCCUCGAUAACUCUGGC (SEQ ID NO: 710); 2) Sense chain: AGAGUUAUCGAGGCACGUACU (SEQ ID NO:485) Antisense chain: AGUACGUGCCUCGAUAACUCUGU (SEQ ID NO:486); 3) Sense chain: GAGGCACGUACUCCACCACUG (SEQ ID NO: 491) Antisense chain: CAGUGGUGGAGUACGUGCCUCGA (SEQ ID NO:492); 4) Sense chain: AGUUAUCGAGGCACAUACUCC (SEQ ID NO: 531) Antisense chain: GGAGUAUGUGCCUCGAUAACUCU (SEQ ID NO: 532); and 5) Sense chain: CUGCCAAGCUUGGUCAUCUAU (SEQ ID NO:119) Antisense chain: AUAGAUGACCAAGCUUGGCAGGU (SEQ ID NO: 120).
6. The dsRNA molecule according to claim 1, wherein the sequences of the sense strand and antisense strand of the dsRNA include any one set of sequences selected from the following, or the sequence of that set. 1) Sense chain: CmsAmsGmAmGmUmUfAmUfCfGfAmGmGmCmAmCmAmUmUmCm (SEQ ID NO:9), Antisense chain: GmsAfsAmUmGmUmGmCmCmUmCmGmAmUfAmAfCmUmCmUmGmsGmsCm (SEQ ID NO:10); 2) Sense chain: AmsGmsAmGmUmUmAfUmCfGfAfGmGmCmAmCmGmUmAmCmUm (SEQ ID NO:1) Antisense chain: AmsGfsUmAmCmGmUmGmCmCmUmCmGmAfUmAfAmCmUmCmUmsGmsUm (SEQ ID NO:2) 3) Sense chain: GmsAmsGmGmCmAmCfGmUfAfCfUmCmCmAmCmCmAmCmUmGm (SEQ ID NO:3) Antisense chain: CmsAfsGmUmGmGmUmGmGmAmGmUmAmCfGmUfGmCmCmUmCmsGmsAm (SEQ ID NO:4) 4) Sense chain: AmsGmsUmUmAmUmCfGmAfGfGfCmAmCmAmUmAmCmUmCmCm (SEQ ID NO:5) Antisense chain: GmsGfsAmGmUmAmUmGmUmGmCmCmUmCfGmAfUmAmAmCmUmsCmsUm (SEQ ID NO:6); and 5) Sense chain: CmsUmsGmCmCmAmAfGmCfUfUfGmGmUmCmAmUmCmUmAmUm (SEQ ID NO:7) Antisense chain: AmsUfsAmGmAmUmGmAmCmCmAmAmGmCfUmUfGmGmCmAmGmsGmsUm (SEQ ID NO:8); where Am, Um, Cm, and Gm represent 2'-O-methyl modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro modified ribonucleotides A, U, C, and G, respectively; and s indicates that the two nucleotides at the beginning and end are linked by a phosphorothiocyanate skeleton.
7. The dsRNA molecule according to claim 6, further comprising at least one asialoglycoprotein receptor (ASGPR) ligand.
8. The dsRNA molecule according to claim 7, wherein the ligand is linked to the 5' or 3' terminal nucleotide of the sense strand or antisense strand nucleotide sequence of the dsRNA by a phosphodiester bond or a phosphorothiodiester bond.
9. The dsRNA molecule according to any one of claims 1 to 8, wherein the ASGPR ligand is one or more GalNAc derivatives linked by a divalent or trivalent branched structure.
10. The dsRNA molecule according to claim 9, wherein the GalNAc derivative is linked by a trivalent branched structure having the following structure: 【Chemistry 1】 。
11. The dsRNA molecule according to claim 10, wherein the GalNac derivative is L96, and the structure of L96 is as follows: 【Chemistry 2】 。
12. The aforementioned L96 is ligated to the 3' terminal nucleotide of the dsRNA sense strand nucleotide sequence by a phosphodiester bond or phosphorothiodiester bond, and the structure of L96 and its ligation to the sense strand nucleotide are as follows: 【Transformation 3】 。
13. Use of dsRNA selected from the following groups: (I) Use of the dsRNA molecule according to any one of claims 1-12 for inhibiting the expression of the Lp(a) gene or for preparing a product for inhibiting the expression of the Lp(a) gene. (II) Use of a dsRNA molecule according to any one of claims 1-12 in a product for reducing the level of Lp(a) particles, (III) Use of the dsRNA molecule according to any one of claims 1-12 for the prevention and / or treatment of disorders, conditions, or syndromes associated with elevated levels of Lp(a) particles, or for the manufacture of a product for the prevention and / or treatment of disorders, conditions, or syndromes associated with elevated levels of Lp(a) particles; Preferably, the disease associated with the elevated level of Lp(a) particles is selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.