Tissue staining reagents, tissue staining kits, and tissue staining methods
A tissue staining reagent with peptides matching the epitope sequence enhances antibody penetration into tissues, addressing inefficiencies in existing methods and ensuring consistent immunostaining results.
Patent Information
- Application Number
- JP2022051118
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-03-28
- Publication Date
- 2026-04-08
- Estimated Expiration
- 2042-03-28
AI Technical Summary
Existing methods for improving antibody penetration into thick tissue specimens are inefficient and require complex condition optimization, leading to variable staining results due to the lack of standardized antigen-antibody reaction conditions and insufficient penetration of antibodies.
A biological tissue staining reagent containing peptides with an amino acid sequence that matches the epitope of the target antigen, competing with the antibody for binding, thereby enhancing antibody penetration into the tissue.
The reagent allows for sufficient penetration of antibodies into tissue, ensuring consistent and efficient immunostaining results by controlling antibody affinity and inhibiting surface binding.
Smart Images

Figure 0007842447000009 
Figure 0007842447000010 
Figure 0007842447000011
Abstract
Description
Technical Field
[0001] The present invention relates to a biological tissue staining reagent, a biological tissue staining kit, and a biological tissue staining method.
Background Art
[0002] Antibodies have high specificity and binding ability to antigens, and thus are used in immunostaining, ELISA, Western blotting, etc. in basic research. Immunostaining using antibodies can be applied to a wide range of specimens including human and non-human animals, and can label multiple targets relatively easily, so the application range is wide. With the development of methods for tissue clearing and three-dimensional (3D) imaging, immunostaining is also used for systematic 3D observation and analysis targeting the whole tissue and the whole individual, etc.
[0003] There are several methods for improving the penetration of antibodies into thick specimens. For example, permeation treatment to expand the pores of fixed tissues has been attempted by degreasing treatment, dehydration treatment, mild fixation treatment, and partial degradation by protease, etc. In addition, physical methods such as electrophoresis and pressure have been applied to samples embedded in acrylamide.
[0004] If the affinity of an antibody for an antigen is too high, the antibody may not easily penetrate into the specimen due to the bias of the binding of the antibody to the antigen near the specimen surface. In particular, when immunostaining a thick tissue specimen, the antibody may not penetrate well into the tissue due to the complex physicochemical environment of the staining target. In contrast, in order to reduce the affinity of the antibody for the antigen, the binding reaction may be carried out at a high temperature. However, from the aspect of the thermal stability of the antibody, the temperature range that can be controlled is limited.
[0005] In addition, a denaturing agent that inhibits the binding of an antibody, such as urea, sodium dodecyl sulfate (SDS), and quadrol, etc. may be added. For example, Patent Document 1 discloses an immunostaining method in which an antibody composition containing urea at a predetermined concentration and an antibody for immunostaining is brought into contact with a biological material.
[0006] Furthermore, Non-Patent Documents 1 and 2 disclose the iDISCO method as an immunohistochemical staining method, in which a sample treated with methanol or dimethyl sulfoxide (DMSO) is incubated in a permeabilizing solution containing glycine and DMSO, then blocked, and subsequently reacted with a primary antibody in a solution containing heparin, DMSO, and donkey serum, followed by a reaction with a secondary antibody. [Prior art documents] [Patent Documents]
[0007] [Patent Document 1] International Publication No. 2014 / 010633 [Non-patent literature]
[0008] [Non-Patent Document 1] Nicolas Renier and others, “iDISCO: a simple, rapid method to immunolabel large tissue samples for volume imaging.” Cell, 2014, 159, 896-910 [Non-Patent Document 2] Nicolas Renier, et al., “Mapping of brain activity by automated volume analysis of immediate early genes.” Cell, 2016, 165, 1789-1802 [Overview of the project] [Problems that the invention aims to solve]
[0009] Denaturing agents such as the antibody composition disclosed in Patent Document 1 above are ineffective against some antibodies, exhibit concentration-dependent differences, and require complex condition optimization. Methods for improving antibody penetration, such as the iDISCO method disclosed in Non-Patent Documents 1 and 2 above, have not yet achieved sufficient penetration efficiency. When using antibodies, in order to maximize the antibody's antigen recognition ability, it is important to understand the amino acid sequence of the antibody binding site (epitope) on the antigen and determine the optimal reaction conditions based on scientific evidence.
[0010] With over 4 million commercially available antibodies currently in existence, detailed epitope information is unknown for most of them. Selecting an antibody suitable for research requires testing numerous antibodies, and further investigation into the conditions for using that antibody takes considerable time. Because the conditions for antigen-antibody reactions based on scientific evidence are not standardized, a problem arises where staining results differ from laboratory to laboratory, even when antibodies are bound to the same antigen.
[0011] This invention has been made in view of the above circumstances, and aims to provide a biological tissue staining reagent, a biological tissue staining kit, and a biological tissue staining method that can sufficiently penetrate antibodies into tissue. [Means for solving the problem]
[0012] A biological tissue staining reagent according to the first aspect of the present invention is: The antigen in the biological tissue targeted for immunohistochemical staining has a second amino acid sequence in which at least four amino acids match the first amino acid sequence of the epitope. And, competing with each other, bind to the antibody. It contains peptides.
[0013] The second amino acid sequence is: The first amino acid sequence matches five or more amino acids, It would be acceptable to do so.
[0014] A tissue staining kit according to a second aspect of the present invention is: A biological tissue staining reagent according to the first aspect of the present invention described above, The antibody and, comprises.
[0015] The biological tissue staining method according to the third aspect of the present invention includes an exposure step of exposing the biological tissue to the biological tissue staining reagent according to the first aspect of the present invention and the antibody.
Effect of the Invention
[0016] According to the present invention, the antibody can penetrate sufficiently into the tissue.
Brief Description of the Drawings
[0017] [Figure 1] It is a figure which shows the competitive inhibition by the epitope peptide with respect to the anti-NeuN antibody which concerns on Test Example 1. [Figure 2] It is a figure which shows the competitive inhibition by the substitution peptide with respect to the anti-NeuN antibody which concerns on Test Example 2. [Figure 3] It is a figure which shows the competitive inhibition by the epitope peptide with respect to the anti-TH antibody which concerns on Test Example 3. [Figure 4] It is a figure which shows the competitive inhibition by the substitution peptide with respect to the anti-TH antibody which concerns on Test Example 4. [Figure 5] It is a figure which shows the image of the immunostained brain which concerns on Example 1. [Figure 6] It is a figure which shows the luminance value of a partial area (area A - B shown in FIG. 5) of the image of the brain immunostained in the presence of the peptide containing the amino acid sequence of the epitope of NeuN. [Figure 7] It is a figure which shows the luminance value of a partial area (area A - B shown in FIG. 5) of the image of the brain immunostained in the presence of the peptide containing the amino acid sequence in which two amino acids in the amino acid sequence of the epitope of NeuN are substituted with alanine. [Figure 8] It is a figure which shows the image of the immunostained brain which concerns on Example 2. [Figure 9] It is a figure which shows the luminance value of a partial area (area A - B shown in FIG. 8) of the image of the brain immunostained in the presence of the peptide containing the amino acid sequence of the epitope of tyrosine hydroxylase (TH). [Figure 10] This figure shows the brightness values of a portion of a brain image (the CD region shown in Figure 8) that was immunostained in the presence of a peptide containing the amino acid sequence of the TH epitope. [Modes for carrying out the invention]
[0018] Embodiments of the present invention will now be described. However, the present invention is not limited to the embodiments described below. Unless otherwise specified in this specification, "%" means mass%.
[0019] The biological tissue staining reagent according to this embodiment includes a peptide having an amino acid sequence (second amino acid sequence) in which at least four amino acids match the amino acid sequence (first amino acid sequence, hereinafter also simply referred to as the "epitope sequence") of an epitope in a biological tissue that is the target of immunohistochemical staining with an antibody.
[0020] The biological tissues to be subjected to immunohistochemical staining with biological tissue staining reagents are, for example, animal-derived samples or plant-derived samples. Examples of animals include fish, amphibians, reptiles, birds, and mammals. Mammalian biological tissues are preferred. Mammals are not particularly limited and include, for example, mice, rats, rabbits, guinea pigs, marmosets, dogs, cats, ferrets, pigs, cattle, horses, monkeys, chimpanzees, and humans.
[0021] The biological tissue may be an individual other than a living human, or it may be an organ, tissue, cell mass, or cell obtained from an individual of a multicellular organism. Preferably, the biological tissue is, for example, the entire brain or a part of the brain such as the cerebral hemispheres.
[0022] The biological tissue may be a sample that has been immobilized, particularly for microscopic observation. Preferably, the biological tissue is immobilized by a known method using formaldehyde (FA) or paraformaldehyde (PFA), etc. After immobilization, it is preferable to immerse the sample in, for example, phosphate-buffered saline (PBS).
[0023] The biological tissue may be, for example, biological tissue injected with a fluorescent chemical substance, biological tissue stained with a fluorescent chemical substance, biological tissue in which cells expressing a fluorescent protein have been transplanted, or biological tissue of a genetically modified animal expressing a fluorescent protein.
[0024] Antigens are proteins expressed in biological tissues and are targets for antibody binding. The epitope sequence of an antigen can be identified by X-ray crystallography, hydrogen-deuterium exchange mass spectrometry, and epitope mapping analysis using peptide arrays. Preferably, the epitope sequence is identified by peptide selection. Peptide selection is a system that obtains only the peptides that bind to a target from a peptide library constructed by transcribing and translating a DNA library with random sequences, and identifies the base sequence encoding that peptide. An important feature of this system is that the genetic information of the obtained peptide is conserved via cells, phages, ribosomes, or puromycin. By repeating the series of steps of transcription, translation, binding to the target, and retrieval of the conserved genetic information, the genetic information converges only on peptides that strongly bind to the target.
[0025] Peptide selection methods include, for example, cell surface presentation, phage display, ribosome display, and mRNA display. Cell surface presentation involves displaying peptides produced through cells on the cell surface to store genetic information within the cell. Phage display involves displaying peptides on the surface of phages that use microorganisms as hosts to store genetic information in phage DNA. In ribosome display and mRNA display methods utilizing cell-free protein synthesis systems, genetic information is stored via ribosomes and puromycin, respectively.
[0026] A particularly preferred peptide selection method is the mRNA display method. Among mRNA display methods, the DECODE method (International Publication No. 2018 / 168999) is particularly preferred. In the DECODE method, (i) an RNA molecule is obtained from DNA by a transcription reaction. This DNA contains a promoter region and a peptide encoding region downstream of the promoter region, and contains at least one 2'-modified nucleoside derivative at the 5' end of the antisense strand. Subsequently, (ii) a peptide acceptor molecule such as puromycin is attached to the 3' end of the RNA using a sprinted polynucleotide. Then, (iii) the RNA to which the peptide acceptor molecule is attached is translated to synthesize an RNA-peptide complex in which the RNA and the peptide encoded by the RNA are linked via the peptide acceptor molecule. Furthermore, (iv) complexes are selected from the RNA-peptide complexes.
[0027] In step (iv), complexes that bind to the antibody via the peptide are selected. By repeating steps (i) to (iv), the genetic information that codes for the peptide that binds to the antibody, i.e., DNA, can be enriched from the DNA library.
[0028] The amino acid sequence encoded by the base sequence of DNA obtained by peptide selection is an epitope sequence that binds to an antibody. The base sequence of the DNA obtained by peptide selection is determined using a next-generation sequencer or similar method, with a number of reads ranging from 10,000 to several billion, several million to several hundred million, several hundred thousand to tens of millions, or several hundred thousand to several million, thereby collecting the amino acid sequence encoded by that base sequence.
[0029] The peptide contained in the biological tissue staining reagent according to this embodiment consists of, for example, 4 to 25, 5 to 22, 6 to 17, 7 to 16, 8 to 15, or 10 to 22 amino acids. The peptide contains an amino acid sequence that is in complete agreement with the epitope sequence. More preferably, the amino acid sequence of the peptide consists of an amino acid sequence that is in complete agreement with the epitope sequence.
[0030] Antibody recognition of antigens is said to depend on approximately five amino acids, and in the case of a linear amino acid sequence, it is often limited to around ten amino acids. Therefore, the amino acid sequence of the peptide contained in the biological tissue staining reagent according to this embodiment does not have to be a perfect match with the epitope sequence, as long as the peptide binds to the antibody. For example, the amino acid sequence of the peptide may include an amino acid sequence in which at least four amino acids match the epitope sequence. Alternatively, the peptide may consist of an amino acid sequence in which at least four amino acids match the epitope sequence. Here, "amino acid match" means that when the amino acid sequence of the peptide and the epitope sequence are aligned by a known method, the positions and types of amino acids match. The four amino acids may be four consecutive amino acids in the amino acid sequence, or four non-consecutive amino acid sequences.
[0031] Preferably, the amino acid sequence of the peptide matches the epitope sequence for five or more amino acids. These five or more amino acids may be five or more consecutive amino acids in the amino acid sequence, or five or more non-consecutive amino acids. For example, the amino acid sequence of the peptide may have five, six, seven, eight, nine, or ten amino acids that match the amino acid sequence of the epitope sequence.
[0032] The peptide according to this embodiment can be produced by known peptide synthesis methods based on its amino acid sequence. The peptide synthesis method may be either solid-phase synthesis or liquid-phase synthesis. In both solid-phase and liquid-phase synthesis, a starting material having a reactive carboxyl group and a starting material having a reactive amino group can be condensed using a conventional peptide synthesis method, such as a method using an active ester like HBTU or a coupling agent like carbodiimide. If the resulting condensate has a protecting group, the peptide can be obtained by removing the protecting group.
[0033] The peptide according to this embodiment may be modified. The amino terminus (N terminus) of the peptide may be an amino group (NH2-) or may have modifications such as an acetyl group (CH3CO-). The carboxyl terminus (C terminus) of the peptide may be a carboxyl group (-COOH) or may have modifications such as an amide group. The amino acid residues of the peptide may have modifications such as phosphate groups and sugar chains.
[0034] The peptide according to this embodiment may be a salt (acid addition salt or base salt). Examples of acid addition salts include inorganic salts such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, and perchloric acid, and salts of organic acids such as citric acid, succinic acid, maleic acid, fumaric acid, malic acid, tartaric acid, p-toluenesulfonic acid, benzenesulfonic acid, methanesulfonic acid, and trifluoroacetic acid. Examples of base salts include alkali metal salts such as sodium, potassium, and lithium, and alkaline earth metal salts such as calcium and magnesium.
[0035] The peptide according to this embodiment may be a solvate. Examples of solvates include water, methanol, ethanol, isopropanol, acetic acid, tetrahydrofuran, acetone, dimethylformamide, dimethyl sulfoxide, dimethylacetamide, acetamide, ethylene glycol, propylene glycol, and dimethoxyethane. In this embodiment, "peptide" includes the above-mentioned modified peptides, peptide salts, and peptide solvates. That is, the biological tissue staining reagent according to this embodiment may contain the above-mentioned modified peptides, peptide salts, or peptide solvates.
[0036] Whether or not a peptide binds to an antibody can be confirmed by known methods such as ELISA (competitive assay). In the competitive assay, for example, an antibody that binds to an antigen is reacted with a peptide against an antigen, unreacted antibody and peptide are removed, and then a labeled secondary antibody that binds to the antibody is reacted to quantify the antibody bound to the antigen. By comparing the amount of antibody bound to the antigen in the absence of the peptide with the amount of antibody bound to the antigen in the presence of the peptide, the amount of peptide that competed with the antigen and bound to the antibody can be quantified.
[0037] Next, a method for using the tissue staining reagent according to this embodiment will be described, specifically a method for staining biological tissue using the tissue staining reagent. This method includes an exposure step in which biological tissue is exposed to the tissue staining reagent and the antibody according to this embodiment. The exposure step can be carried out under the same conditions as when exposing tissue to an antibody in conventional tissue immunohistochemistry using an antibody, except that the tissue is exposed to the antibody in the presence of the tissue staining reagent.
[0038] The antibodies are, for example, antibodies for immunohistochemistry, or immunoglobulins derived from hybridoma culture supernatant, ascites fluid of animals that have undergone intrasplenic immunization, antiserum, antiplasma, or avian egg serous fluid. The biological tissue staining reagent is preferably used for one-step immunohistochemistry using a primary antibody labeled with a dye such as a fluorescent dye, or a complex of a primary antibody and a dye-labeled Fab fragment antibody. Examples of antibodies include the anti-NeuN antibody and anti-TH antibody used in the following examples. Examples of dyes used to label the antibodies include Alexa Fluor® dye, FITC (Fluorescein Isothiocyanate), and Cy dye.
[0039] More specifically, the exposure step involves pre-treating the fixed tissue and incubating it in an immunostaining buffer containing the antibody and the peptide. The incubation temperature is not particularly limited and is 23-40°C or 28-38°C. The exposure time for the tissue to the antibody and peptide is not particularly limited as long as it is sufficient for the antibody to penetrate into the tissue, and is 1 day to 8 weeks, 2 days to 7 weeks, 3 days to 6 weeks, 4 days to 5 weeks, or 1 to 4 weeks.
[0040] The concentrations of antibodies and peptides in the immunostaining buffer are set appropriately according to the affinity of the antibody to the antigen and the target of staining. For example, the concentration of peptides in the immunostaining buffer is 1 nM to 10 μM, 10 nM to 10 μM, or 100 nM to 5 μM.
[0041] According to the biological tissue staining reagent of this embodiment, the peptide competes with the antigen for binding to the antibody, thereby controlling the antibody's affinity for the antigen. By suppressing the antibody's affinity for the antigen, the binding of the antibody to the antigen near the outside of the tissue is inhibited, allowing the antibody to penetrate sufficiently into the tissue.
[0042] In another embodiment, a tissue staining kit is provided comprising the above-mentioned tissue staining reagent and the above-mentioned antibody. The tissue staining kit may also include blocking reagents such as skim milk, bovine serum albumin (BSA), fish gelatin, horse serum, fetal bovine serum (FBS), and casein, which are used to prevent nonspecific binding of the antibody. The tissue staining kit may further include additives that promote the penetration of the antibody into the tissue. For example, the additive is a compound that promotes the penetration of the antibody into the tissue. Examples of additives include compounds such as urea, urea derivatives, aromatic amines, aliphatic amides, nicotinamides, sulfamides, sulfonates, amino alcohols, alcohols, sulfinic acids, thioureas, and carboxylic acids.
[0043] The tissue staining reagent according to this embodiment can be incorporated into existing 3D clearing staining methods, as shown in the examples below. Furthermore, the tissue staining reagent and tissue staining method according to this embodiment can be applied not only to 3D staining but also to so-called 2D staining, which involves staining tissue sections.
[0044] The above-mentioned tissue staining kit may also be provided with an instruction manual or a guide. The instruction manual or guide may, for example, describe the composition of the tissue staining reagent and the protocol for the tissue staining method described above. In addition, the above-mentioned tissue staining reagent may contain other additives such as pH adjusters, osmotic pressure adjusters, preservatives, and tissue drying inhibitors, in addition to the components mentioned above. These additives may be included in the tissue staining kit separately from the tissue staining reagent.
[0045] A tissue staining kit is a package containing containers that hold specific materials such as components. The tissue staining kit may contain its multiple components mixed in the same container or in separate containers. Instructions or manuals may be recorded on paper, magnetic tape, computer-readable disks, tapes, or electronic media such as CD-ROMs. The tissue staining kit may also include containers containing diluents, solvents, washing solutions, or other reagents. Furthermore, the tissue staining kit may include the instruments and reagents necessary to perform the procedures required to realize the kit's intended use. [Examples]
[0046] The present invention will be described in more detail by the following examples, but the present invention is not limited to these examples.
[0047] Test Example 1: Competitive inhibition of anti-NeuN antibody by epitope peptide. To determine the epitope of the anti-NeuN antibody (clone name A60), the following decoding method was performed. Antibody antigen recognition is said to occur within approximately 5 amino acids, and in the case of a linear amino acid sequence, this often fits within about 10 amino acids. Therefore, a template DNA library was created so that 12 amino acids were randomized. The codons were randomized as NNK(G / T), and the DNA template was designed so that the only stop codon during random sequencing was UAG(Amber). The library size in the first round of selection was 1.5 × 10⁶. 13 To achieve this, a 0.05 μM template DNA library was prepared in a 500 μL scale PCR mixture. The base sequence of the template DNA was CCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATATG(NNK)nTGCGGCAGCGGCAGCGGCAGCTACTTTGATCCGCCGACC, with n=12. Note that N is one of A, T, G, and C, and K is either T or G. The base sequence of the template DNA when n=1 and K is T is shown in Sequence ID No. 1.
[0048] (Amplification of template DNA) A 500 μL scale PCR mixture, as shown in Table 1, was prepared, and the template DNA library was amplified. The prepared PCR mixture was incubated in a thermal cycler at 95°C for 3 minutes, and then the template DNA was amplified by repeating a temperature change of 95°C (10 seconds), 58°C (10 seconds), and 75°C (30 seconds) for 4 cycles. The nucleotide sequence of the forward primer (P1) is CCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATATG (SEQ ID NO: 2). The nucleotide sequence of the reverse primer (P2 (antigen) OMe) is ggTCGGCGGATCAAAGTAG (SEQ ID NO: 3).
[0049] [Table 1]
[0050] (Transcription of template DNA library and ligation of Pu-DNA) A 1000 μL scale transcription mixture was prepared by mixing 500 μL of transcription mixture buffer with 500 μL of template DNA. The amplified DNA library was transcribed using 50 mU / uL T7 RNA polymerase (5 μL). The transcription mixture buffer (TC mix) consisted of 40 mM HEPES-KOH (pH 7.6), 20 mM MgCl2, 2 mM Spermidine, 5 mM DTT, and 2.5 mM NTPs. The transcription reaction was carried out at 37°C for 40 minutes, followed by inactivation of the T7 RNA polymerase at 72°C for 5 minutes. The resulting transcript was subjected to electrophoresis (180 V, 40 minutes) on a 10% acrylamide gel containing 7 M urea to confirm the production of an mRNA library.
[0051] Next, under buffer conditions of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 10 mM DTT, and 1 mM ATP, the transcription product was mixed with 5 μM Pu-DNA (5'-[PHO]CTCCCGCCCCCCGTCC[SpC18]5CC[Puromycin], the base sequence from the 5' end to the spacer is shown in SEQ ID NO: 4) and 5 μM sprint DNA (5'-GGGCGGGAGGGTCGGCGGATCAA (SEQ ID NO: 5)) to prepare a 500 μL scale ligation mixture. The ligation mixture was heated at 95°C for 1 minute, then left at 75°C for 30 seconds, and the temperature was lowered to 25°C at a constant gradient of 1°C / 15 seconds to anneal the mRNA, Pu-DNA, and Splint DNA. Then, 35 U of T4 DNA ligase was added, and the ligation reaction was promoted at 37°C for 1 hour, after which it was left at 4°C. The obtained transcripts were subjected to electrophoresis (180V, 40 minutes) on a 10% acrylamide gel containing 7M urea to confirm that the mRNA library had ligated to Pu-DNA. The resulting Pu-DNA-ligated mRNA library was purified using the Agincourt AMPure® XP RNA purification reagent kit, and its concentration was determined.
[0052] (Cellless translation using a custom PURE system) A Pu-DNA-linked mRNA library was translated using a cell-free translation system (PURE system) to obtain a peptide library. 2.4 μL of 0.6 μM ligated sample, 0.5 μL of Solution B, 6 μL of Solution A, and 3 μL of Stock buffer were added to prepare 11.9 μL of PURE mixture. The PURE mixture was reacted at 37°C for 1 hour.
[0053] The composition of Solution B is shown in Table 2. The composition of the Stock buffer is 50 mM HEPES-KOH (pH 7.6), 100 mM KCl, 10 mM MgCl, and 30% glycerol.
[0054] [Table 2]
[0055] The composition of the factor mix is shown in Table 3.
[0056] [Table 3]
[0057] The composition of Solution A is shown in Table 4.
[0058] [Table 4]
[0059] The composition of the NTP cratine phosphate mixture is shown in Table 5.
[0060] [Table 5]
[0061] The composition of PURE buffer is shown in Table 6.
[0062] [Table 6]
[0063] (Preparation of antibody-immobilized beads) The antibody was immobilized on protein G magnetic beads. The beads were washed with 500 μL of wash buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 1% Triton, and 0.01% Tween20®) before use. 1 μL of antibody was added to 2.5 μL of beads, and the mixture was shaken for 30 minutes to bind the beads to the antibody.
[0064] (Binding reaction of peptide library to antibody-immobilized beads) To antibody-immobilized beads, 11.9 μL of post-translational product and 25 μL of binding buffer (50 mM Tris-HCl, pH 8.0 and 10 mM EDTA) were added, and the mixture was shaken for 30 minutes to bind the peptide library to the antibody-immobilized beads (positive selection). The supernatant was removed, the beads were collected, and washed 10 times with wash buffer to obtain a peptide library that specifically binds to the antibody.
[0065] (Reverse transcription) mRNA present on protein G magnetic beads was reverse transcribed into cDNA using ProtoScript II RTase. To achieve a final reverse transcription reaction on a 44.5 μL scale, 40 μL of RT mix, 4.25 μL of RT(-) (50 mM tris-HCl (pH 8.0) and 75 mM KCl) and 0.25 μL of ProtoScript II were mixed with the beads, and the reverse transcription reaction was carried out at 37°C for 40 minutes. The RT mix was a ProtoScript buffer containing 0.2 mM dNTPs, 10 mM DTT, and 0.2 μM RT-Primer (P2_ver2, GGTCGGCGGATCAAAGTAGCTGCCGCTGCCGCTGCCGCA (SEQ ID NO: 6)).
[0066] (elution) Magnetic beads immobilized with antibodies were held in 10 μL of phosphate buffer at 95°C for 3 minutes to extract the peptide library. After elution, the supernatant was collected, the beads were washed with 20 μL of ultratrapure water, and the supernatant was collected again.
[0067] (Quantification of cDNA amount recovered by qPCR) The cDNA ligated to the recovered peptide was quantified by qPCR to determine the optimal PCR amplification cycle for the next round. 7 μL of the qPCR mixture shown in Table 7 was dispensed into each of the 384 wells, and 0.5 μL of cDNA was added to each well. After incubating the plate at 95°C for 3 minutes, the cDNA was amplified by repeating a two-step process of 95°C (10 seconds) and 60°C (30 seconds) for 40 cycles. The nucleotide sequence of the reverse primer (P2 (antigen)) is GGTCGGCGGATCAAAGTAGCTGCCGCTGCCGCTGCCGCA (SEQ ID NO: 7).
[0068] [Table 7]
[0069] (Amplification of recovered DNA by PCR) 20 μL of amplified template DNA was added to the PCR mixture shown in Table 8, and the cDNA library was amplified using Phusion DNA polymerase. The prepared PCR mixture was incubated in a thermal cycler at 95°C for 3 minutes, and then the template DNA was amplified by repeating the cycles determined by qPCR with temperature changes of 95°C, 58°C, and 75°C. The optimal number of cycles (N) was determined by confirming amplification by electrophoresis on a 1% agarose gel. The template DNA library amplified under the determined PCR conditions was confirmed by electrophoresis on a 1% agarose gel. After confirming sufficient amplification, it was purified with Agencourt AMPure® XP.
[0070] [Table 8]
[0071] (Transfer of the second round) A 10 μL scale transcription mixture was prepared, and 0.1 μM of the amplified DNA library was transcribed using 50 mU / uL T7 RNA polymerase. 5 mM NTPs, 5 μM DTT, and 20 μM MgCl2 were added to the transcription mixture. The transcription mixture was allowed to proceed at 37°C for 1 hour, and then left at 75°C for 5 minutes to inactivate the T7 RNA polymerase.
[0072] (Second round of mRNA and Pu-DNA ligation) A ligation mixture was prepared in 8 μL scale using 1×ligation buffer by mixing 5 μM of transcription product with 1 mM ATPs, 10 μM Pu-DNA, and 10 μM split DNA. The ligation mixture was heated at 95°C for 1 minute, then the temperature was lowered to 25°C over 15 minutes using a constant gradient to anneal the mRNA, Pu-DNA, and split DNA. T4 ligase was added, and the mixture was reacted at 37°C for 1 hour.
[0073] The anti-NeuN antibody (clone name A60) was immobilized on the beads mentioned above, and the DECODE method was performed. For the cDNA of peptides screened by the DECODE method, approximately 1 million reads per antibody were sequenced using a next-generation sequencer, HiSeq3000 (Illumina). The obtained sequences were converted to amino acids and compared with a complete mouse and human protein database (obtained from UniProt). Clustering of specific amino acid sequences was performed to create motifs. The BLOSUM62 matrix was used as the substitution score function. However, since evolutionary resistance to amino acid substitution was not considered in this study, a matrix was used where negative values were treated as 0.
[0074] The motifs obtained for the anti-NeuN antibody matched a portion of NeuN. The epitope to which the anti-NeuN antibody binds. including The amino acid sequence was determined to be QPYPPAQYPPP (Sequence ID 8).
[0075] Competitive inhibition of an epitope peptide determined by the DECODE method against anti-NeuN antibody was investigated. After fixing brain lysates from C57BL / 6JJcl mice (12 weeks old, male), a mixture of anti-NeuN antibody (5 nM) and the peptide was placed in a blocked ELISA plate. The peptide in question was either the peptide whose amino acid sequence is shown in SEQ ID NO: 8 determined by the DECODE method (hereinafter referred to as "NeuN antigen peptide") or the peptide consisting of the amino acid sequence shown in SEQ ID NO: 9 (QPYAAAQYPPP), in which two consecutive amino acids of the antigen peptide are replaced with alanine (hereinafter referred to as "NeuN mutant peptide"). Samples of the NeuN antigen peptide and NeuN mutant peptide were prepared by serial dilution from 1024 nM in 1 / 2-fold increments.
[0076] Each well of the ELISA plate was washed four times with PBS containing 0.1% Tween20™, after which a secondary antibody conjugated with HRP was added. After washing twelve times with PBS containing 0.1% Tween20™, substrate was added to each well to induce color development, the reaction was stopped with 1M sulfuric acid, and the absorbance (450 nm) was measured.
[0077] (result) Figure 1 shows the absorbance in the presence of NeuN antigen peptide or NeuN mutant peptide. It was shown that the NeuN antigen peptide binds to the anti-NeuN antibody in a concentration-dependent manner and inhibits the binding of the anti-NeuN antibody to the antigen.
[0078] Test Example 2: Competitive inhibition of anti-NeuN antibody by substitution peptides The amino acid sequence location affecting inhibition by epitope peptides was investigated. After fixing brain lysates from C57BL / 6JJcl mice (12 weeks old, male), a mixture of anti-NeuN antibody (6.7 nM) and NeuN_WT peptide or alanine-substituted peptide, serially diluted in 1 / 5-fold increments starting from 500 nM, was placed in blocked ELISA plates. The NeuN_WT peptide is a portion of the NeuN amino acid sequence containing the amino acid sequence of the epitope to which the anti-NeuN antibody binds. The amino acid sequence of the NeuN_WT peptide is shown in SEQ ID NO: 10. Alanine-substituted peptides related to NeuN are peptides in which one amino acid in the NeuN_WT peptide sequence is substituted with alanine or glycine, as shown in SEQ ID NOs: 11-24. The N-terminus of both the NeuN_WT peptide and the NeuN-related alanine-substituted peptides is modified with biotin.
[0079] Each well of the ELISA plate was washed four times with PBS containing 0.1% Tween20™, after which a secondary antibody conjugated with HRP was added. After washing twelve times with PBS containing 0.1% Tween20™, substrate was added to each well to induce color development, the reaction was stopped with 1M sulfuric acid, and the absorbance (450 nm) was measured.
[0080] (result) Figure 2 shows the absorbance in the presence of NeuN_WT peptide or alanine-substituted peptide. It was shown that even an alanine-substituted peptide with only one amino acid substitution binds to the anti-NeuN antibody in a concentration-dependent manner and inhibits the binding of the anti-NeuN antibody to the antigen.
[0081] Test Example 3: Competitive inhibition of anti-TH antibodies by epitope peptides Instead of the anti-NeuN antibody, an anti-TH antibody (clone name EP1532Y) was immobilized on the beads mentioned above, and the DECODE method described above was performed.
[0082] The motif obtained for the anti-TH antibody matched a portion of TH. The epitope to which the anti-TH antibody binds. includingThe amino acid sequence was determined to be SPHTIRRSLEGVQDEL (SEQ ID NO: 25).
[0083] The competitive inhibition of an epitope peptide determined by the DECODE method against anti-TH antibody was investigated. After fixing the lysate of E. coli expressing GST-tagged TH, a mixture of anti-TH antibody (5 nM) and two peptides was placed in a blocked ELISA plate. The two peptides were a peptide whose amino acid sequence is shown in Sequence ID No. 25 determined by the DECODE method (hereinafter referred to as "TH antigen peptide") and a peptide consisting of the amino acid sequence shown in Sequence ID No. 26 (SPHTIRRSLAAVQDEL), in which two consecutive amino acids of the antigen peptide are replaced with alanine (hereinafter referred to as "TH mutant peptide"). Samples of the TH antigen peptide and TH mutant peptide were prepared by serial dilution from 1024 nM in 1 / 2-fold increments. Subsequently, secondary antibodies and substrates were added to each well in the same manner as in Test Example 1, and absorbance (450 nm) was measured.
[0084] (result) Figure 3 shows the absorbance in the presence of TH antigen peptide or TH mutant peptide. It was shown that the TH antigen peptide binds to the anti-TH antibody in a concentration-dependent manner and inhibits the binding of the anti-TH antibody to the antigen.
[0085] Test Example 4: Competitive inhibition of anti-TH antibodies by mutant peptides The amino acid sequence location affecting inhibition by epitope peptides was investigated. After fixing lysates of E. coli expressing GST-tagged TH, a blocking ELISA plate was placed in which a mixture of anti-TH antibody (5 nM) and TH_WT peptide or alanine-substituted peptide, serially diluted in 1 / 5-fold increments starting from 625 nM, was added. The TH_WT peptide is a portion of the TH amino acid sequence containing the amino acid sequence of the epitope to which the anti-TH antibody binds. The amino acid sequence of the TH_WT peptide is shown in SEQ ID NO: 27. The TH-related alanine-substituted peptide is a peptide whose amino acid sequence, shown in SEQ ID NOs: 28-41, is one amino acid in the TH_WT peptide sequence that is replaced with alanine. The N-terminus of both the TH_WT peptide and the TH-related alanine-substituted peptide is modified with biotin. Subsequently, the secondary antibody and substrate were added to each well in the same manner as in Test Example 2, and the absorbance (450 nm) was measured.
[0086] (result) Figure 4 shows the absorbance in the presence of TH_WT peptide or alanine-substituted peptide. It was shown that even alanine-substituted peptide with a single amino acid substitution binds to anti-TH antibodies in a concentration-dependent manner, inhibiting the binding of anti-TH antibodies to the antigen. Substitution of amino acids at specific positions reduced the binding affinity of alanine-substituted peptides to anti-TH antibodies.
[0087] The degreasing treatment, staining buffer, and immunohistochemical buffer used in the following examples are shown below. CUBIC-L: 10% by mass N-butyldiethanolamine (manufactured by Tokyo Chemical Industry Co., Ltd., #B0725) 10% by mass Triton X-100 (Nacalai Tesque #12967-45) ultra pure water Immunostaining buffer: 10mM HEPES (Nacalai Tesque #17514-15) 0.5M NaCl (Nacalai Tesque #31319-45) 10% by mass Triton X-100 (Nacalai Tesque #12967-45) 0.5% NaN3 (Wako Pure Chemical Industries, Ltd., #197-11091) CUBIC-R: 45% by mass of antipyrine (manufactured by Tokyo Chemical Industry Co., Ltd., #B1876) 30% by mass nicotinamide (manufactured by Tokyo Chemical Industry Co., Ltd., #N0078) 1% by mass N-butyldiethanolamine (manufactured by Tokyo Chemical Industry Co., Ltd., #B0725) ultra pure water
[0088] Example 1: Investigation of the effect of anti-NeuN antibody on penetration B6N mice (8 weeks old, male) were perfused and fixed, and their brains were removed and stored in 10 mL of 4% paraformaldehyde (PFA) for 24 hours. Then, the solution was replaced with 10 mL of 50% CUBIC-L and the mice were agitated at 20 rpm for 24 hours at 37°C. This process was repeated twice, with the solution replaced with 10 mL of 100% CUBIC-L and agitated at 20 rpm for 48 hours at 37°C. The solution was then replaced with 10 mL of PBS and agitated at 20 rpm for 2 hours at 37°C, with this process repeated three times. Finally, the solution was replaced with 15 mL of immunohistochemistry buffer and agitated at 20 rpm for 1.5 hours at 37°C. Mix 30 μL of 2× immunostaining buffer, 7.5 ng (50 pmol) of anti-NeuN antibody (clone name A60), 7.5 ng of Alexa 594 conjugated anti-mouse IgG1 Fab, and 50 pmol, 250 pmol, or 500 pmol of the NeuN antigen peptide or NeuN mutant peptide from Test Example 1, add water to make up 60 μL, and incubate at 37°C for 1 hour. Then, add 220 μL of 2× immunostaining buffer and 220 μL of water to the mixture and mix. Place the brain, which has been replaced with the immunostaining buffer, into the mixture and incubate at 37°C for 5 days. Replace with 10 mL of 0.1 MPB containing 10% triton and incubate at 37°C for 30 minutes, repeating the back-and-forth rocking at 20 rpm twice. Then replace with another 10 mL of 0.1 MPB and incubate at 37°C for 1 hour, incubating at 20 rpm. Subsequently, the sample was replaced with 10 mL of 0.1 MPB containing 1% formaldehyde and agitated back and forth at 20 rpm for 24 hours at 25°C. Then, it was replaced with another 10 mL of 0.1 MPB and agitated back and forth at 20 rpm for 2 hours at 25°C. Finally, it was replaced with 10 mL of 50% CUBIC-R and agitated back and forth at 20 rpm for 24 hours at 37°C. Finally, it was replaced with 10 mL of 100% CUBIC-R and agitated back and forth at 20 rpm for 48 hours at 37°C. The sample was then embedded in a gel prepared with CUBIC-R containing 2% agarose and observed using a light-sheet microscope.
[0089] (result) Brain images acquired with a light-sheet microscope are shown in Figure 5. When the region A and B shown in the leftmost figure was selected in each image and the brightness value was plotted against the distance from A, as shown in Figure 6, anti-NeuN antibodies accumulated in the brain, particularly near the lateral side of the cerebellum, in the absence of the NeuN antigen peptide, whereas in the presence of the NeuN antigen peptide, the accumulation near the lateral side was reduced in a concentration-dependent manner, and anti-NeuN antibodies penetrated into the inner part of the brain. On the other hand, as shown in Figure 7, in the case of the NeuN mutant peptide, the accumulation of anti-NeuN antibodies near the lateral side of the brain was not reduced even in the presence of the NeuN mutant peptide.
[0090] Example 2: Investigation of the effect of anti-TH antibody on penetration The procedure was the same as in Example 1, except that 5 ng (33 pmol) of anti-TH antibody (clone name EP1532Y) was used as the antibody, 5 ng of Alexa 594 conjugated anti-mouse IgG1 Fab was used, and the NeuN antigen peptide was the TH antigen peptide related to Test Example 3. The amount of TH antigen peptide used was 33 pmol, 330 pmol, or 3300 pmol.
[0091] (result) Brain images acquired with a light-sheet microscope are shown in Figure 8. Regions A, B, and C shown in the leftmost figure were selected from each image, and the brightness values were plotted against the distance from A or C, respectively, as shown in Figures 9 and 10. As shown in Figures 9 and 10, in the presence of the TH antigen peptide, the accumulation of anti-TH antibodies near the outer surface of the brain was mitigated in a concentration-dependent manner of the TH antigen peptide, and anti-TH antibodies penetrated into the inner part of the brain.
[0092] This invention allows for various embodiments and modifications without departing from the broad spirit and scope of the invention. Furthermore, the embodiments described above are for illustrative purposes only and do not limit the scope of the invention. In other words, the scope of the invention is indicated not by the embodiments, but by the claims. Various modifications made within the scope of the claims and the equivalent scope of the meaning of the invention are considered to be within the scope of the invention. [Industrial applicability]
[0093] This invention is suitable for staining biological tissues.
Claims
1. The peptide comprises a peptide having a second amino acid sequence in which at least four amino acids match the first amino acid sequence of an epitope in an antigen in a biological tissue that is the target of immunohistochemical staining with an antibody, and which competes to bind to the antibody. Tissue staining reagents.
2. The second amino acid sequence is, The first amino acid sequence matches five or more amino acids, The biological tissue staining reagent according to claim 1.
3. A biological tissue staining reagent according to claim 1 or 2, The antibody and, A biological tissue staining kit equipped with the necessary components.
4. The biological tissue staining reagent and the antibody according to claim 1 or 2 include an exposure step of exposing the biological tissue, Methods for staining biological tissues.
Citation Information
Patent Citations
Protein binding site information acquisition device and method and program for operating protein binding site information acquisition device
JP2021145604A
Epitope peptide to polymyalgia rheumatica disease antibody and testing reagent for polymyalgia rheumatica disease
WO2006040958A1
Antibody composition, kit for preparing antibody composition, and immunostaining method
WO2014010633A1
Biological tissue staining reagent, biological tissue staining kit and biological tissue staining method
WO2021039716A1