Microorganism of Corynebacterium genus having enhanced L-lysine productivity and method for producing L-lysine using the same

Abstract

The present invention relates to a microorganism of the genus Corynebacterium with improved L-lysine production capacity and a method for producing L-lysine using the same. The microorganism of the genus Corynebacterium has enhanced activity of glucose-promoting diffusion transporters and glucokinase, thereby improving the production yield of L-lysine compared to the parent strain or cases where glucose-promoting diffusion transporters or glucokinase are enhanced alone.

Description

Technology Field

[0001] The present invention relates to a microorganism of the genus Corynebacterium with enhanced L-lysine production capacity and a method for producing L-lysine using the same. Background Technology

[0002] L-lysine is an essential amino acid that is not synthesized in the bodies of humans or animals and must be supplied from an external source; it is generally produced through fermentation using microorganisms such as bacteria or yeast. L-lysine production can utilize wild-type strains obtained from nature or mutant strains modified to enhance their L-lysine production capacity.

[0003] Recently, to improve the production efficiency of L-lysine, various recombinant strains or mutant strains with excellent L-lysine production capabilities and methods for producing L-lysine using them are being developed by applying genetic recombination technology to microorganisms such as Escherichia coli and Corynebacterium, which are widely used for the production of L-amino acids and other useful substances. In particular, there have been attempts to increase L-lysine production by targeting genes such as enzymes, transcription factors, and transport proteins involved in the L-lysine biosynthetic pathway, or by inducing mutations in promoters that regulate their expression. However, since the types of proteins, such as enzymes, transcription factors, and transport proteins, that are directly or indirectly involved in L-lysine production amount to tens to hundreds of varieties, much research is still needed regarding whether changes in the activity of these proteins lead to an increase in L-lysine production capacity. Prior art literature

[0004] Korean Registered Patent No. 10-0838038 Korean Registered Patent No. 10-2139806 The problem to be solved

[0005] The present invention aims to provide a microorganism of the genus Corynebacterium with enhanced L-lysine production ability.

[0006] In addition, the present invention aims to provide a method for producing L-lysine using the microorganism of the genus Corynebacterium. means of solving the problem

[0007] One aspect of the present invention provides a microorganism of the genus Corynebacterium with enhanced L-lysine production capacity through enhanced activity of glucose-promoting diffusion transporters and glucokinases.

[0008] The “glucose facilitated diffusion protein” used in the present invention is a transport protein present in the plasma membrane that is involved in the facilitated diffusion of glucose. The glucose facilitated diffusion protein in the present invention may be a polypeptide encoded by the glf gene and having glucose facilitated diffusion protein activity, but is not limited thereto.

[0009] The “glucokinase” used in the present invention is an enzyme that catalyzes the reaction of producing glucose 6-phosphate from glucose and ATP, and corresponds to the first enzyme that introduces glucose into the glycolytic pathway together with other hexokinases. The glucokinase in the present invention may be a polypeptide encoded by the glk gene and having glucokinase activity, but is not limited thereto.

[0010] Nucleic acid sequence and protein sequence information for the above glucose-promoting diffusion transporter and glucokinase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0011] The term “enhanced activity” as used in the present invention means that the expression level of a gene encoding a target enzyme, transcription factor, transport protein, etc., is increased compared to the original microorganism, i.e., the wild-type strain or the strain before modification. Such enhanced activity includes cases where the activity of the protein itself increases compared to the activity of the protein possessed by the original microorganism through modification of the nucleotides encoding the gene (e.g., substitution, insertion, deletion, or combination thereof of some nucleotides within the target gene), cases where the copy number of the gene increases, cases where the overall degree of protein activity within the cell is higher than that of the wild-type strain or the strain before modification due to increased expression or translation of the target gene caused by modification of a non-coding region that does not encode a gene, such as a promoter (e.g., modification of all or some nucleotides within the promoter sequence, replacement with a strong promoter), and combinations thereof.

[0012] The above nucleotide modification refers to a nucleotide sequence that differs from the original nucleotide sequence in whole or in part due to substitution, insertion, deletion, or a combination thereof. The above promoter modification refers to a promoter sequence in which all or part of the nucleotides differ from the original promoter sequence due to substitution, insertion, deletion, or a combination thereof, resulting in an increased expression level or enhanced activity for the target gene. Furthermore, the above promoter modification includes replacing the original gene's promoter with a promoter that has a stronger expression level or activity for the target gene compared to the original gene's promoter. Here, substitution refers to a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced by another base, nucleotide, polynucleotide, or nucleic acid. Insertion refers to a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. Deletion refers to a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0013] According to one embodiment of the present invention, the enhancement of the activity of the glucose-promoting diffusion transporter may be achieved by introducing a gene encoding the glucose-promoting diffusion transporter, increasing the copy number, modifying the promoter, or a combination thereof.

[0014] According to one embodiment of the present invention, the glucose-promoting diffusion transporter is Zymomonas mobilis ( Zymomonas mobilis It may be encoded by the glf gene derived from ).

[0015] The above-mentioned glf gene derived from Zymomonas mobilis may include the nucleotide sequence of Sequence No. 1.

[0016] In addition, according to one embodiment of the present invention, the glucose-promoting diffusion transporter is Corynebacterium glutamicum ( Corynebacterium glutamicum It may be encoded by the iolT1 (NCgl0178) and iolT2 (NCgl2953) genes derived from ).

[0017] It has been known that the iolT1 and iolT2 genes derived from the above Corynebacterium glutamicum encode the myo-inositol transporters IolT1 and IolT2, respectively, and are functionally similar to the glucose-promoting diffusion transporter encoded by the glf gene of Zymomonas mobilis ( FEMS Microbiol Lett . 2009 Jan;290(2):227-35.).

[0018] The above-mentioned iolT1 gene derived from Corynebacterium glutamicum may include the nucleotide sequence of SEQ ID NO. 2, and the iolT2 gene derived from Corynebacterium glutamicum may include the nucleotide sequence of SEQ ID NO. 3.

[0019] According to one embodiment of the present invention, the enhancement of the activity of the glucokinase may be achieved by introducing a gene encoding the glucokinase, increasing the copy number, modifying the promoter, or a combination thereof.

[0020] According to one embodiment of the present invention, the glucokinase is Corynebacterium glutamicum ( Corynebacterium glutamicum It may be encoded by the glk (NCgl2105) gene derived from ).

[0021] The above-mentioned glk gene derived from Corynebacterium glutamicum may include the nucleotide sequence of SEQ ID NO. 4.

[0022] The nucleotide sequence of a glucose-promoting diffusion transporter or glucokinase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to each sequence, and may have an original function. Here, “homology” or “identity” refers to the percentage of agreement between two sequences when a reference nucleotide sequence and any other nucleotide sequence are aligned to correspond as much as possible and analyzed.

[0023] As used in the present invention, “improved production capacity” means that the productivity of L-lysine is increased compared to the mutation target (parent strain). The parent strain refers to the wild-type or mutant strain that is the subject of mutation, and includes the subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain has no L-lysine production capacity or possesses L-lysine production capacity, and wild-type Corynebacterium ( Corynebacterium It may be a microorganism or strain of the genus Corynebacterium that is either a derivative or mutated from the wild type.

[0024] According to one embodiment of the present invention, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium desertii( Corynebacterium deserti ), Corynebacterium carunae ( Corynebacterium callunae ), Corynebacterium suranaerae ( Corynebacterium suranareeae ), Corynebacterium lubricantis( Corynebacterium lubricantis ), Corynebacterium dusanense ( Corynebacterium doosanense ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium uterechi( Corynebacterium uteriqui ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium pacense ( Corynebacterium pacaense ), Corynebacterium singulare( Corynebacterium singular ), Corynebacterium humireducens( Corynebacterium humireducens ), Corynebacterium marinum( Marine Corynebacterium ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium spaniscorum( Corynebacterium spheniscorum ), Corynebacterium freyburgense ( Corynebacterium freiburgense ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium canis ( Corynebacterium canis ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium renale( Corynebacterium renale ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium caspium ( Corynebacterium caspium ), Corynebacterium testudinoris( Corynebacterium testudinoris ), Corynebacterium pseudopellage ( Corynebacterium pseudopelargus ), Corynebacterium flavuscens( Corynebacterium flavescens It may be ) etc., but is not limited thereto.

[0025] For example, the above-mentioned microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum It can be.

[0026] The microorganism of the genus Corynebacterium according to the present invention can have its L-lysine production capacity improved by enhancing the activity of glucose-promoting diffusion transporters and glucokinases.

[0027] Specifically, microorganisms of the genus Corynebacterium with enhanced L-lysine production capacity exhibit increased L-lysine production capacity compared to the parent strain, and in particular, compared to the parent strain, L-lysine production increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, It may be increased by 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited thereto. For example, a microorganism of the genus Corynebacterium with enhanced activity of the glucose-promoting diffusion transporter and glucokinase may have an L-lysine production of 3% or more, specifically 3 to 40% (preferably 5 to 30%), compared to the parent strain.

[0028] A composition comprising a microorganism of the genus Corynebacterium according to the present invention can be used as a composition for L-lysine production.

[0030] A microorganism of the genus Corynebacterium according to one embodiment of the present invention can be implemented through a recombinant vector comprising a gene encoding a glucose-promoting diffusion transporter and a glucokinase, targeting a parent strain.

[0031] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" comprises a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0032] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0033] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0034] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0035] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0036] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.

[0037] In the case of transforming prokaryotic cells to produce recombinant microorganisms, as a host cell E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli E. coli such as XL1-Blue, Corynebacterium ( Corynebacterium ) genus, Bacillus subtilis( Bacillus subtilis ), Bacillus thuringiensis( Bacillus thuringiensis Bacillus genera such as ), Salmonella typhimurium ( Salmonella typhimurium ), Serratia Marcescens( Serratia marcescens ) and Pseudomonas ( Pseudomonas Various intestinal bacteria such as those of the genus ) may be used, but are not limited to this.

[0038] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0039] As used in this invention, "transformation" refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and "transformant" refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0040] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0041] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0042] The genes inserted into the recombinant vector for transformation of the present invention can be substituted into host cells, such as microorganisms of the genus Corynebacterium, through homologous recombination crossing.

[0043] According to one embodiment of the present invention, the host cell may be a microorganism of the genus Corynebacterium, for example, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum It can be.

[0045] Another aspect of the present invention provides a method for producing L-lysine, comprising the steps of: culturing the microorganism of the genus Corynebacterium in a culture medium; and recovering L-lysine from the microorganism of the genus Corynebacterium or the culture medium in which the microorganism of the genus Corynebacterium is cultured.

[0046] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0047] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for strains of the genus Corynebacterium, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0048] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0049] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0050] According to one embodiment of the present invention, the step of recovering L-lysine from the cultured transformant or the medium in which the transformant is cultured may involve collecting or recovering L-lysine produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0051] According to one embodiment of the present invention, the step of recovering L-lysine may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0052] According to one embodiment of the present invention, the step of recovering L-lysine may include a process of purifying L-lysine. Effects of the invention

[0053] The genus Corynebacterium microorganism according to the present invention has enhanced activity of glucose-promoting diffusion transporters and glucokinase, thereby improving the production yield of L-lysine compared to the parent strain or cases where glucose-promoting diffusion transporters or glucokinase are enhanced alone. Specific details for implementing the invention

[0054] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0056] Example 1. Preparation of a strain with enhanced activity of glucose-promoting diffusion transporter and glucokinase

[0057] To produce strains with enhanced activity of glucose-promoting diffusion transporters and glucokinase, Corynebacterium glutamicum ( Corynebacterium glutamicum ) DS1 (Accession No. KCCM12969P) and E. coli DH5a (HIT Competent cells™, Cat No. RH618) was used.

[0058] The above Corynebacterium glutamicum DS1 was cultured at a temperature of 30°C in CM-broth medium (pH 6.8) composed of 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone, and 5.0 g of beef extract in 1 L of distilled water.

[0059] The above E. coli DH5a was cultured at a temperature of 37°C on LB medium composed of 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.

[0060] The antibiotic kanamycin used was a product from Sigma.

[0061] DNA sequencing analysis and gene synthesis were commissioned to Macrogen Co., Ltd.

[0063] 1-1. Recombinant Vector

[0064] Zymomonas mobilis ( Zymomonas mobilis glf gene encoding a glucose-promoting diffusion transporter derived from ) (Sequence No. 1), Corynebacterium glutamicum ( Corynebacterium glutamicum To introduce the iolT1 gene (SEQ No. 2) and iolT2 gene (SEQ No. 3), which encode myo-inositol transporters derived from ), and the glk gene (SEQ No. 4), which encodes glucokinase, the 594 bp sequence between the NCgl1668 gene and the NCgl1669 gene in Corynebacterium glutamicum was disrupted, and the target gene was introduced at that location. To express the target gene, a recombinant vector was constructed using the promoter of the ddh gene of Corynebacterium glutamicum (SEQ No. 5). On the genome of Corynebacterium glutamicum, the 762 bp portion of the left arm and the 7906 bp portion of the right arm, centered around the 594 bp fragmentation sequence, along with the corresponding promoter and target gene, were amplified by PCR. After ligation using the overlap PCR method, they were cloned into the pk19mobsacB (ATCC, 87098) vector. To construct the five plasmids mentioned above, the primers listed in Table 1 below were used to amplify each gene fragment, and the glf sequence was obtained through gene synthesis and used as a template.

[0065] primer Primer sequence (5'-3') Sequence number Pddh-glf Left homologous cancer amplification primer LF1 cacagatcgtcgtgcacagt 6 LF2 tgattacgcccacagatcgtcgtgcacagt 7 LR1 tgcgtacactttatggccca 8 LR2 ttatggcccataaaaatggt 9 Promoter Amplification Primer P-F1 atccggataaaccaccatga 10 P-F2 agtgtacgcaatccggataaaccaccatga 11 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 GLF amplification primer glf-F1 atgagttctgaaagtagtca 14 glf-F2 ttacaagaacatgagttctgaaagtagtca 15 glf-R1 ctacttctgggagcgccaca 16 glf-R2 gagcgccacatctcctcgat 17 Right-sided homologous cancer amplification primer RF1 aacgcttatattattttaag 18 RF2 ccagaagtagaacgcttatattattttaag 19 RR1 atggtgacaacatctgggcc 20 RR2 catctgggcctagtcgatta 21 Pddh-iolT1-Pddh-iolT2 Left homologous cancer amplification primer LF1 cacagatcgtcgtgcacagt 6 LF2 tgattacgcccacagatcgtcgtgcacagt 7 LR1 tgcgtacactttatggccca 8 LR2 ttatggcccataaaaatggt 9 Promoter 1 Amplification Primer P-F1 atccggataaaccaccatga 10 P-F2 agtgtacgcaatccggataaaccaccatga 11 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 iolT1 amplification primer iolT1-F1 atggctagtaccttcattca 22 iolT1-F2 ttacaagaacatggctagtaccttcattca 23 iolT1-R1 ttagtgcacctttccttttc 24 iolT1-R2 tttccttttcggatgtcctt 25 Promoter 2 Amplification Primer P-F1 atccggataaaccaccatga 10 P2-F2 ggtgcactaaatccggtaaaccaccatga 26 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 iolT2 amplification primer iolT2-F1 atgacggacatcaaggccac 27 iolT2-F2 ttacaagaacatgacggacatcaaggccac 28 iolT2-R1 ttaagccttcttgaagatct 29 iolT2-R2 ttgaagatctggccggtgaa 30 Right-sided homologous cancer amplification primer RF1 aacgcttatattattttaag 18 RF2 ggtgcactaaaacgcttatattattttaag 31 RR1 atggtgacaacatctgggcc 20 RR2 catctgggcctagtcgatta 21 Pddh-glk Left homologous cancer amplification primer LF1 cacagatcgtcgtgcacagt 6 LF2 tgattacgcccacagatcgtcgtgcacagt 7 LR1 tgcgtacactttatggccca 8 LR2 ttatggcccataaaaatggt 9 Promoter Amplification Primer P-F1 atccggataaaccaccatga 10 P-F2 agtgtacgcaatccggataaaccaccatga 11 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 GLK amplification primer glk-F1 atgccacaaaaaccggccag 32 glk-F2 ttacaagaacatgccacaaaaaccggccag 33 glk-R1 ctagttggcttccactacag 34 glk-R2 tccactacagagcgtcgagc 35 Right-sided homologous cancer amplification primer RF1 aacgcttatattattttaag 18 RF2 agccaactagaacgcttatattattttaag 36 RR1 atggtgacaacatctgggcc 20 RR2 catctgggcctagtcgatta 21 Pddh-glf-Pddh-glk Left homologous cancer amplification primer LF1 cacagatcgtcgtgcacagt 6 LF2 tgattacgcccacagatcgtcgtgcacagt 7 LR1 tgcgtacactttatggccca 8 LR2 ttatggcccataaaaatggt 9 Promoter 1 Amplification Primer P-F1 atccggataaaccaccatga 10 P-F2 agtgtacgcaatccggataaaccaccatga 11 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 GLF amplification primer glf-F1 atgagttctgaaagtagtca 14 glf-F2 ttacaagaacatgagttctgaaagtagtca 15 glf-R1 ctacttctgggagcgccaca 16 glf-R2 gagcgccacatctcctcgat 17 Promoter 2 Amplification Primer P-F1 atccggataaaccaccatga 10 P2-F2 ccagaagtagatccggataaaccaccatga 37 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 GLK amplification primer glk-F1 atgccacaaaaaccggccag 32 glk-F2 ttacaagaacatgccacaaaaaccggccag 33 glk-R1 ctagttggcttccactacag 34 glk-R2 tccactacagagcgtcgagc 35 Right-sided homologous cancer amplification primer RF1 aacgcttatattattttaag 18 RF2 agccaactagaacgcttatattattttaag 36 RR1 atggtgacaacatctgggcc 20 RR2 catctgggcctagtcgatta 21 Pddh-iolT1-Pddh-iolT2-Pddh-glk Left homologous cancer amplification primer LF1 cacagatcgtcgtgcacagt 6 LF2 tgattacgcccacagatcgtcgtgcacagt 7 LR1 tgcgtacactttatggccca 8 LR2 ttatggcccataaaaatggt 9 Promoter 1 Amplification Primer P-F1 atccggataaaccaccatga 10 P-F2 agtgtacgcaatccggataaaccaccatga 11 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 iolT1 amplification primer iolT1-F1 atggctagtaccttcattca 22 iolT1-F2 ttacaagaacatggctagtaccttcattca 23 iolT1-R1 ttagtgcacctttccttttc 24 iolT1-R2 tttccttttcggatgtcctt 25 Promoter 2 Amplification Primer P-F1 atccggataaaccaccatga 10 P2-F2 ggtgcactaaatccggtaaaccaccatga 26 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 iolT2 amplification primer iolT2-F1 atgacggacatcaaggccac 27 iolT2-F2 ttacaagaacatgacggacatcaaggccac 28 iolT2-R1 ttaagccttcttgaagatct 29 iolT2-R2 ttgaagatctggccggtgaa 30 Promoter 3 Amplification Primer P-F1 atccggataaaccaccatga 10 P3-F2 gaaggcttaaatccggtaaaccaccatga 38 P-R1 gttcttgtaatcctccaaaattgt 12 P-R2 tcctccaaaattgtggtggc 13 GLK amplification primer glk-F1 atgccacaaaaaccggccag 32 glk-F2 ttacaagaacatgccacaaaaaccggccag 33 glk-R1 ctagttggcttccactacag 34 glk-R2 tccactacagagcgtcgagc 35 Right-sided homologous cancer amplification primer RF1 aacgcttatattattttaag 18 RF2 agccaactagaacgcttatattattttaag 36 RR1 atggtgacaacatctgggcc 20 RR2 catctgggcctagtcgatta 21

[0067] PCR was performed under the following conditions using the primers above. Using a Thermocycler (TP600, TAKARA BIO Inc., Japan), 25 to 30 cycles were performed in the presence of 1 unit of pfu-X DNA polymerase mixture (Solgent) in a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 pM of oligonucleotide, and 10 ng of chromosomal DNA of Corynebacterium glutamicum ATCC 13032 or glf synthetic DNA derived from Zymomonas mobilis as a template. PCR was performed under the following conditions: (i) denaturation step: 30 seconds at 94°C, (ii) annealing step: 30 seconds at 58°C, and (iii) extension step: 1 to 2 minutes at 72°C (2 minutes of polymerization time per 1 kb).

[0068] The gene fragment prepared in this manner was cloned into the pk19mobsacB vector using self-assembly cloning. The above vector E. coli DH5a was transformed and plated on LB-agar plates containing 50 μg / ml kanamycin, and incubated at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was present in the vector, and then this vector was isolated and used for the recombination of Corynebacterium glutamicum strains.

[0069] As a common process in the above method, the relevant genes were amplified using the PCR method from the genomic DNA of Corynebacterium glutamicum ATCC 13032 or glf synthetic DNA derived from Zymomonas mobilis, and then inserted into the pk19mobsacB vector using the self-assembled cloning method according to the strategy. E. coliSelection was made from DH5a. For chromosomal base substitution, the target DNA fragment was prepared by individually amplifying the gene of each fragment and using overlap PCR. Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes for gene manipulation, and NEB products were used for various restriction enzymes and DNA modifying enzymes, which were used according to the supplied buffers and protocols.

[0071] Experimental Example 1. Evaluation of L-lysine production capacity

[0072] The L-lysine production ability of the Corynebacterium glutamicum mutant strain produced in Example 1 was evaluated compared with the parent strain.

[0073] Each strain (parent strain or mutant strain) was inoculated into a 100 mL flask containing 10 mL of the lysine production medium shown in Table 2 below, and cultured with shaking at 30°C, 180 rpm, for 28 hours. After the culture was finished, the concentration of L-lysine in the medium was measured using HPLC (Shimazu, Japan), and the results are shown in Table 3 below.

[0074] furtherance Content (based on 1 L of distilled water) Glucose 100 g Ammonium sulfate 55 g KH2PO4 1.1 g MgSO4·H2O 1.2 g MnSO4·H2O 180 mg FeSO4·H2O 180 mg Thiamine·HCl 9 mg Biotin 1.8 mg CaCO3 5% pH 7.0

[0075] strain OF 610 L-lysine (g / L) L-lysine per cell (g / gDCW) DS1 22.0 66.8 7.2 DS1_iolT1_iolT2 23.1 67.2 6.9 DS1_glf 23.6 71.5 7.2 DS1_glk 24.3 69.7 6.8 DS1_iolT1_iolT2_glk 21.5 71.2 7.9 DS1_glf_glk 20.2 78.3 9.2

[0077] As shown in Table 3 above, when the activity of glucose-promoting diffusion transporters or glucokinase was enhanced, there was no difference in L-lysine production per cell unit compared to the parent strain; however, when the activity of both glucose-promoting diffusion transporters and glucokinase was enhanced, it was confirmed that L-lysine production per cell unit increased compared to the parent strain, resulting in an increase in total L-lysine production of at least approximately 6.6% and up to approximately 17.2%. These results suggest that L-lysine production capacity is improved by increasing the glucose utilization capacity of microorganisms through the enhancement of glucose-promoting diffusion transporters or glucokinase activity.

[0079] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0080] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KCCM12969P Date of Deposit: 2021-04-02

Claims

Claim 1 Corynebacterium glutamicum with enhanced L-lysine production capacity due to enhanced activity of glucose-facilitated diffusion protein and glucokinase ( Corynebacterium glutamicum As a ) mutant, the above glucose-promoting diffusion transporter is Zymomonas mobilis ( Zymomonas mobilis glf gene derived from ), or Corynebacterium glutamicum ( Corynebacterium glutamicum It is encoded by iolT1 and iolT2 genes derived from ), and the glucokinase is Corynebacterium glutamicum ( Corynebacterium glutamicum A variant encoded by the glk gene derived from ). Claim 2 A variant of claim 1, wherein the enhancement of the activity of the glucose-promoting diffusion transporter is achieved by the introduction of a gene encoding the glucose-promoting diffusion transporter, an increase in the copy number, a modification of the promoter, or a combination thereof. Claim 3 A variant of claim 1, wherein the enhancement of the activity of the glucokinase is achieved by the introduction of a gene encoding the glucokinase, an increase in the copy number, a modification of the promoter, or a combination thereof. Claim 4 delete Claim 5 A method for producing L-lysine comprising the steps of: culturing a variant strain of Corynebacterium glutamicum of claim 1 in a medium; and recovering L-lysine from said variant strain or the medium in which the variant strain is cultured.