CFB gene modified non-human animal

Abstract

Provided in the present invention are a non-human animal expressing a human or chimeric (e.g. humanized) CFB protein and a use method thereof. Further provided in the present invention are a non-human animal genome, a humanized CFB gene, and a cell, tissue, organ or non-human animal containing the non-human animal genome and the humanized CFB gene. The non-human animal obtained by the present application successfully expresses the human or humanized CFB protein, wherein the protein can be cleaved by CFD, bind to C3b, and achieve a similar effect as in a human body. In addition, the non-human animal obtained in the present application has a complete renal function state and normal blood biochemical indexes. Even more rarely, potential diseases known in the prior art which have been observed in some other transgenic mice do not occur in the non-human animal.

Description

A CFB gene-modified non-human animal

[0001] Cross-references to related applications

[0002] This application claims the benefit of priority to Chinese invention patent application No. 202310778275.7 filed on June 28, 2023, Chinese invention patent application No. 202410169335.X filed on February 6, 2024, Chinese invention patent application No. 202410462699.7 filed on April 17, 2024, and Chinese invention patent application No. 202410555788.6 filed on May 7, 2024, and the entire contents of these four applications are incorporated into this application by reference. Technical Field

[0003] The present invention provides a non-human animal expressing a human or chimeric (eg, humanized) CFB protein and methods of using the same. Background Art

[0004] Traditional drug development typically uses in vitro screening methods. However, these screening methods cannot provide the body's environment (such as the tumor microenvironment, stromal cells, extracellular matrix components, and immune cell interactions), resulting in a high rate of drug development failure. In addition, given the differences between humans and animals, the results of in vivo pharmacology trials using conventional experimental animals may not reflect the actual disease state and the interaction of target sites, resulting in significant differences between the results of many clinical trials and those of animal experiments.

[0005] Therefore, developing humanized animal models suitable for screening and evaluation of human antibodies will significantly improve the efficiency of new drug development and reduce drug development costs.

[0006] However, the construction of humanized animal models is very difficult. For example, the non-patent literature: Generation and utility of genetically humanized mouse models (Scheer N, Snaith M, Wolf CR, Seibler J., Drug Discovery Today; 18(23-24):1200-11, 2013) discloses that the humanization of any gene carries certain risks, and even with carefully designed strategies, the expression and function of human genes in animals cannot be guaranteed.

[0007] Summary of the Invention

[0008] To address the shortcomings of the existing technology, the present application provides a genetically modified non-human animal. This non-human animal normally expresses the human CFB protein, which can be cleaved by CFD, binds to C3b, and exerts similar effects in humans. Furthermore, the non-human animal obtained in this application exhibits intact renal function and normal blood biochemical indicators. More importantly, this non-human animal does not exhibit potential diseases observed in certain other transgenic mice known in the art.

[0009] The present application provides an animal model with a human or chimeric CFB protein. The animal model can express a human or chimeric CFB (e.g., humanized CFB) protein. It can be used to study the function of the CFB gene, and can also be used to screen and evaluate CFB signaling pathway regulators (e.g., anti-human CFB antibodies, oligonucleotide drugs, and / or polypeptide drugs). In addition, the non-human animals or animal models prepared by the method described in the present application can be used for drug screening, pharmacodynamic studies, treatment of immune-related diseases, and treatment of diseases of human CFB target sites; the non-human animals or animal models can also be used to promote new drug development and design, saving time and cost. In summary, the present invention provides a powerful tool for studying the function of CFB protein and provides a platform for screening related drugs.

[0010] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric complement factor B (CFB) protein. In some embodiments, the expression of the nucleotide sequence encoding the human or chimeric CFB protein is regulated by a regulatory element (e.g., an endogenous regulatory element or a human regulatory element, preferably, the regulatory element is preferably a 5'UTR and / or a 3'UTR). In some embodiments, the chimeric CFB protein is a humanized CFB protein, and the humanized CFB protein comprises a portion of a human CFB protein. In some embodiments, the portion of the human CFB protein comprises the Ba region and / or the Bb region; preferably, the Bb region comprises the VWA domain, and further preferably further comprises von Willebrand factor and / or peptidase S1. In some embodiments, the humanized CFB protein comprises a contiguous amino acid sequence that is identical to a portion of the human CFB protein for at least 50 to 764 amino acids. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (e.g., a mouse or rat). In some embodiments, the human or chimeric CFB protein comprises SEQ ID NO: 2 or positions 26-764 thereof, or comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 2 or positions 26-764 thereof, or comprises an amino acid sequence that differs from SEQ ID NO: 2 or positions 26-764 thereof by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid, or comprises a substitution, deletion, and / or insertion of one or more amino acids from SEQ ID NO: 2 or positions 26-764 thereof. In some embodiments, the endogenous CFB protein in the non-human animal is not expressed or is expressed at a reduced level compared to CFB in wild-type animals. In some embodiments, the nucleotide sequence encoding the endogenous CFB protein in the non-human animal is silenced or disrupted (e.g., deleted). In some embodiments, the non-human animal comprises a deletion of the nucleotide sequence encoding the endogenous CFB protein, such as a deletion of the nucleotide sequence encoding SEQ ID NO: 1 or positions 18-712 thereof. In some embodiments, the modified CFB gene in the genome of the non-human animal is homozygous or heterozygous for the replaced endogenous locus. In some embodiments, the human or chimeric CFB protein expressed by the non-human animal has at least one CFB activity, such as a non-human animal CFB activity and / or a human CFB activity. In some embodiments, the non-human animal exhibits renal function substantially consistent with that of a wild-type non-human animal.In some embodiments, the non-human animal has no significant difference in the levels of urea, serum creatinine and / or total protein compared to the wild-type non-human animal. In some embodiments, the human or chimeric CFB protein expressed by the non-human animal can be cleaved by the human or non-human animal CFD. In some embodiments, the human or chimeric CFB protein expressed by the non-human animal can bind to human or non-human animal C3b. In some embodiments, the non-human animal further comprises nucleotide sequences of human or chimeric proteins encoded by other genes, including but not limited to at least one of CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1 and CTLA4.

[0011] In one aspect, the present invention provides a genetically modified non-human animal in which an endogenous CFB gene is replaced at the non-human animal's endogenous CFB locus with a nucleotide sequence comprising a human CFB. In some embodiments, expression of the human CFB nucleotide sequence is regulated by a regulatory element (e.g., an endogenous regulatory element or a human regulatory element). In some embodiments, one or more cells of the non-human animal express a human or chimeric CFB protein. In some embodiments, the endogenous CFB protein of the non-human animal is not expressed or is expressed at a reduced level compared to CFB in a wild-type animal. In some embodiments, the endogenous CFB gene is silenced or disrupted (e.g., deleted). In some embodiments, the nucleotide sequence of human CFB comprises a portion of exon 1 to exon 18 of the human CFB gene, for example, a portion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18, preferably comprising the nucleotide sequence of the coding region of the human CFB gene, more preferably comprising the nucleotide sequence from the start codon to the stop codon of the human CFB gene. In some embodiments, the nucleotide sequence of human CFB further comprises the 5'UTR and / or 3'UTR of human CFB, and further comprises a continuous nucleotide sequence of at least 50 bp to at least 10,000 bp upstream of the 5'UTR of human CFB and / or a continuous nucleotide sequence of at least 50 bp to at least 5,000 bp downstream of the 3'UTR of human CFB. In some embodiments, the nucleotide sequence of human CFB comprises the 5'UTR of human CFB and at least 50 bp to at least 10,000 bp (e.g., 50, 100, 500, 1000, 2000, 3000, 4000, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 7000, 8000, 9000 or 10,000 bp, preferably 3000-8000 bp, more preferably 5000-7000 bp) of consecutive nucleotides upstream thereof. , the nucleotide sequence from the start codon to the stop codon of the human CFB gene and the 3'UTR of human CFB and at least 50 bp to at least 5000 bp (e.g., 50, 100, 500, 600, 700, 800, 900, 910, 920, 930, 940, 950, 1000, 1100, 1200, 1300, 1400, 1500, 2000, 3000, 4000 or 5000, preferably 500-3000 bp, further preferably 500-1500 bp) of consecutive nucleotides downstream of the 3'UTR of human CFB.In some embodiments, the nucleotide sequence of human CFB comprises the nucleotide sequence of SEQ ID NO: 7 or 39, or a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 7 or 39, or a nucleotide sequence that differs from SEQ ID NO: 7 or 39 by no more than 50, 40, 30, 20, 10, 9, 6, 3, or 1 bp of nucleotides, or a nucleotide sequence that comprises substitutions, deletions, and / or insertions of one or more nucleotides from SEQ ID NO: 7 or 39. In some embodiments, exon 2 to exon 17 of the endogenous CFB gene is replaced. Preferably, the replaced endogenous CFB gene also includes a portion of exon 1, all of intron 1, and / or a portion of intron 17. More preferably, the replaced endogenous CFB gene also includes a portion of exon 18. In some embodiments, the nucleotide sequence from the start codon to the stop codon of the endogenous CFB gene is replaced, or alternatively, a portion of exon 1 to a portion of intron 17 of the endogenous CFB gene is replaced, wherein the portion of exon 1 includes up to 70, up to 60, up to 50, up to 40, up to 30, or up to 20 nucleotides from the 3' end of exon 1. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (e.g., a mouse or rat). In some embodiments, the modified CFB gene in the genome of the non-human animal is homozygous or heterozygous for the endogenous replaced locus. In some embodiments, the upstream junction of the human CFB nucleotide sequence in the genome of the non-human animal with the mouse sequence is SEQ ID NO: 9, and the downstream junction with the mouse sequence is SEQ ID NO: 10. In some embodiments, the upstream junction of the human CFB nucleotide sequence in the genome of the non-human animal with the mouse sequence is SEQ ID NO: 41, and the downstream junction with the mouse sequence is SEQ ID NO: 42. In some embodiments, the mRNA transcribed from the endogenous CFB-modified nucleotide sequence in the genome of the non-human animal comprises SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that differs from SEQ ID NO: 8 or 40 by no more than 50, 40, 30, 20, 10, 9, 6, 3 or 1 bp of nucleotides, or comprises a nucleotide sequence that is substituted, deleted and / or inserted with one or more nucleotides shown in SEQ ID NO: 8 or 40.In some embodiments, the human or chimeric CFB protein expressed by the non-human animal has at least one CFB activity, such as a non-human animal CFB activity and / or a human CFB activity. In some embodiments, the non-human animal has a renal function status substantially consistent with that of a wild-type non-human animal. In some embodiments, the non-human animal has no significant difference in urea, serum creatinine, and / or total protein levels compared to a wild-type non-human animal. In some embodiments, the human or chimeric CFB protein expressed by the non-human animal can be cleaved by a human or non-human CFD. In some embodiments, the human or chimeric CFB protein expressed by the non-human animal can bind to human or non-human C3b. In some embodiments, the non-human animal further comprises nucleotide sequences encoding human or chimeric proteins from other genes, including but not limited to at least one of CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, and CTLA4.

[0012] In one aspect, the present invention provides a non-human animal comprising at least one cell encoding a human or humanized CFB protein, wherein the humanized CFB protein comprises at least 50, 100, 200, 300, 400, 500, 600, 700, 710, 720, 730, 740, 750, 760, 763, or 764 consecutive amino acids identical to a human CFB protein, and the non-human animal expresses the human or humanized CFB protein. In some embodiments, the nucleotide sequence encoding the human or humanized CFB protein is operably linked to an endogenous or human CFB regulatory element. In some embodiments, the nucleotide sequence encoding the human or humanized CFB protein can be integrated into the non-human animal's endogenous CFB locus. In some embodiments, the human or humanized CFB protein has at least one CFB activity, such as a mouse CFB activity and / or a human CFB activity.

[0013] In one aspect, the present invention provides a non-human animal genome comprising at least one chromosome comprising a nucleotide sequence encoding a human or chimeric complement factor B (CFB) protein. In some embodiments, the endogenous CFB gene is silenced or disrupted (e.g., deleted). In some embodiments, the endogenous CFB gene is deleted, and the deleted region is replaced by a nucleotide sequence encoding a human or chimeric CFB protein. In some embodiments, the endogenous CFB gene is deleted, and the deleted region is replaced by a nucleotide sequence of a human CFB protein. In some embodiments, the chimeric CFB protein is a humanized CFB protein, comprising a portion of a human CFB protein and a portion of a non-human animal CFB protein. In some embodiments, the portion of the human CFB protein comprises a Ba region and / or a Bb region; preferably, the Bb region comprises a VWA domain, and further preferably further comprises von Willebrand factor and / or peptidase S1. In some embodiments, the humanized CFB protein comprises a contiguous amino acid sequence that is identical to a portion of a human CFB protein, for at least 50 to 764 amino acids. In some embodiments, the human or chimeric CFB protein comprises SEQ ID NO: 2 or positions 26-764 thereof, or comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 2 or positions 26-764 thereof, or comprises an amino acid sequence that differs from SEQ ID NO: 2 or positions 26-764 thereof by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid, or comprises a substitution, deletion, and / or insertion of one or more amino acids from SEQ ID NO: 2 or positions 26-764 thereof. At the endogenous CFB gene locus of a non-human animal, the endogenous CFB gene is replaced with a nucleotide sequence comprising the human CFB. In some embodiments, the nucleotide sequence of human CFB includes a portion of exon 1 to a portion of exon 18 of the human CFB gene; wherein the portion of exon 1 of the human CFB gene includes at least 5 bp of continuous nucleotide sequence of exon 1 of the human CFB gene, and the portion of exon 18 of the human CFB gene includes at least 20 bp of continuous nucleotide sequence of exon 18 of the human CFB gene. Preferably, the nucleotide sequence comprising the coding region of the human CFB gene, more preferably, comprises the nucleotide sequence from the start codon to the stop codon of the human CFB gene. In some embodiments, the nucleotide sequence of human CFB further includes the 5'UTR and / or 3'UTR of human CFB, and further includes at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp of continuous nucleotides downstream of the 3'UTR of human CFB.In some embodiments, the nucleotide sequence of human CFB includes the 5'UTR of human CFB and at least 50bp of continuous nucleotides upstream thereof, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50bp of continuous nucleotides downstream thereof.

[0014] In some embodiments, the nucleotide sequence of human CFB comprises the nucleotide sequence of SEQ ID NO: 7 or 39, or a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 7 or 39, or a nucleotide sequence that differs from SEQ ID NO: 7 or 39 by no more than 50, 40, 30, 20, 10, 9, 6, 3, or 1 bp, or a nucleotide sequence that comprises a substitution, deletion, and / or insertion of one or more nucleotides from SEQ ID NO: 7 or 39. In some embodiments, the deleted endogenous CFB gene comprises a nucleotide sequence encoding an endogenous CFB protein; preferably, it comprises a nucleotide sequence encoding SEQ ID NO: 1 or nucleotides 18-712 thereof. In some embodiments, exon 2 to exon 17 of the endogenous CFB gene is replaced. Preferably, the replaced endogenous CFB gene also includes a portion of exon 1, all of intron 1, and / or a portion of intron 17. More preferably, the replaced endogenous CFB gene also includes a portion of exon 18. In some embodiments, the nucleotide sequence from the start codon to the stop codon of the endogenous CFB gene is replaced, or a portion of exon 1 to a portion of intron 17 of the endogenous CFB gene is replaced, wherein the portion of exon 1 includes up to 70 nucleotides from the 3' end of exon 1. In some embodiments, the nucleotide sequence encoding the human or chimeric CFB protein or the nucleotide sequence of human CFB is operably linked to a regulatory element (e.g., an endogenous regulatory element or a human regulatory element) of the CFB locus on at least one chromosome. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (e.g., a mouse or rat). In some embodiments, the non-human animal is a mouse. In some embodiments, the upstream junction of the nucleotide sequence of human CFB in the genome of the non-human animal with the mouse sequence is SEQ ID NO: 9, and the downstream junction with the mouse sequence is SEQ ID NO: 10. In some embodiments, the upstream junction of the nucleotide sequence of human CFB in the genome of the non-human animal with the mouse sequence is SEQ ID NO: 41, and the downstream junction with the mouse sequence is SEQ ID NO: 42.In some embodiments, the mRNA transcribed from the endogenous CFB-modified nucleotide sequence in the non-human animal genome comprises SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that differs from SEQ ID NO: 8 or 40 by no more than 50, 40, 30, 20, 10, 9, 6, 3 or 1 bp of nucleotides, or comprises a nucleotide sequence that is substituted, deleted and / or inserted with one or more nucleotides shown in SEQ ID NO: 8 or 40.

[0015] In one aspect, the present invention provides a cell comprising the non-human animal genome described above.

[0016] In one aspect, the present invention provides a non-human animal comprising the above-mentioned non-human animal genome or the above-mentioned cell.

[0017] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal that expresses a human or chimeric CFB protein. In some embodiments, in at least one cell of the non-human animal, a nucleotide sequence comprising a human CFB protein is substituted for the endogenous CFB gene at the non-human animal's endogenous CFB locus. In some embodiments, the endogenous CFB protein in the non-human animal is not expressed or is expressed at a reduced level compared to CFB in a wild-type animal. In some embodiments, the nucleotide sequence of the human CFB protein comprises a portion of exon 1 to exon 18 of the human CFB gene; preferably, the nucleotide sequence comprises the coding region of the human CFB gene; more preferably, the nucleotide sequence comprises the start codon to the stop codon of the human CFB gene. In some embodiments, the nucleotide sequence of the human CFB protein further comprises the 5' UTR and / or 3' UTR of the human CFB protein, and further comprises at least 50 bp of contiguous nucleotides upstream of the 5' UTR of the human CFB protein and / or at least 50 bp of contiguous nucleotides downstream of the 3' UTR of the human CFB protein. In some embodiments, the nucleotide sequence of human CFB comprises the 5'UTR of human CFB and at least 50 bp of continuous nucleotides upstream of the 5'UTR, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50 bp of continuous nucleotides downstream of the 3'UTR. In some embodiments, the nucleotide sequence of human CFB comprises the nucleotide sequence of SEQ ID NO: 7 or 39, or comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 7 or 39, or comprises a nucleotide sequence that differs from SEQ ID NO: 7 or 39 by no more than 50, 40, 30, 20, 10, 9, 6, 3, or 1 bp, or comprises a nucleotide sequence that is substituted, deleted, and / or inserted with one or more nucleotides as set forth in SEQ ID NO: 7 or 39. In some embodiments, the nucleotide sequence of the endogenous replaced CFB region comprises a nucleotide sequence encoding an endogenous CFB protein, preferably comprising a nucleotide sequence encoding SEQ ID NO: 1 or positions 18-712 thereof. In some embodiments, the nucleotide sequence of the endogenous replaced CFB region comprises a portion of exon 1 to a portion of exon 18 of the endogenous CFB gene, such as a portion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18, such as a nucleotide sequence comprising a coding region.In some embodiments, the nucleotide sequence of the endogenous replaced CFB region comprises a portion of exon 1 to intron 17 of the endogenous CFB gene. In some embodiments, the nucleotide sequence of the human CFB is operably linked to a CFB regulatory element of the CFB locus of at least one chromosome, such as an endogenous regulatory element or an exogenous regulatory element, the exogenous regulatory element being, for example, a human regulatory element, which may be a promoter. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (e.g., a mouse or rat). In some embodiments, the non-human animal further comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, the human or chimeric protein including but not limited to at least one of CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, and CTLA4.

[0018] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal cell that expresses a human or chimeric CFB protein, the method comprising replacing an endogenous CFB gene at the non-human animal's endogenous CFB locus with a nucleotide sequence of a human CFB. In some embodiments, the nucleotide sequence of the human CFB comprises a portion of exon 1 to a portion of exon 18 of the human CFB gene, such as a portion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or a portion of exon 18, preferably comprising a nucleotide sequence of the coding region of the human CFB gene, and more preferably comprising a nucleotide sequence from the start codon to the stop codon of the human CFB gene. In some embodiments, the nucleotide sequence of human CFB further comprises the 5'UTR and / or 3'UTR of human CFB, and further comprises at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp of continuous nucleotides downstream of the 3'UTR of human CFB. In some embodiments, the nucleotide sequence of human CFB includes the 5'UTR of human CFB and at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50 bp of continuous nucleotides downstream of the 5'UTR of human CFB. In some embodiments, the expression of the nucleotide sequence of human CFB is regulated by a regulatory element, such as an endogenous regulatory element or a human regulatory element, and the regulatory element can be a promoter. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (e.g., a mouse or rat). In some embodiments, the non-human animal is a mouse. In some embodiments, the non-human animal cells further comprise nucleotide sequences of human or chimeric proteins encoded by other genes, including but not limited to at least one of CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1 and CTLA4.

[0019] In one aspect, the present invention provides a humanized CFB gene, comprising replacing an endogenous CFB gene at an endogenous CFB locus in a non-human animal with a nucleotide sequence of human CFB. In some embodiments, the humanized CFB gene comprises any of the following nucleotide sequences:

[0020] A) a nucleotide sequence encoding SEQ ID NO: 2 or positions 26-764 thereof;

[0021] B) SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46;

[0022] C) a nucleotide sequence that is at least 90% homologous to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46;

[0023] D) a nucleotide sequence that is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homologous to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46.

[0024] In one aspect, the present invention provides a polypeptide encoded by the humanized CFB gene.

[0025] In one aspect, the present invention provides a targeting vector comprising a 5' arm, a donor region, and a 3' arm, wherein the 5' arm is homologous to the 5' end of the region to be altered, the 3' arm is homologous to the 3' end of the region to be altered, and the donor region comprises a nucleotide sequence encoding a human or chimeric CFB protein. In some embodiments, the region to be altered is located at the endogenous CFB locus of a non-human animal. Preferably, the region to be altered comprises at least one exon or at least one intron of the endogenous CFB gene of the non-human animal, for example, from a portion of exon 1 to a portion of intron 17 of the endogenous CFB gene, or from a portion of exon 1 to a portion of exon 18 of the endogenous CFB gene. In some embodiments, the 5' end of the region to be altered is located at exon 1 of the endogenous CFB gene of the non-human animal, and / or the 3' end of the region to be altered is located at exon 18 of the endogenous CFB gene of the non-human animal. In some embodiments, the 5' end of the region to be altered is located at exon 1 of the endogenous CFB gene of the non-human animal, and / or the 3' end of the region to be altered is located at intron 17 of the endogenous CFB gene of the non-human animal. In some embodiments, the 5' arm sequence is the nucleotide sequence set forth in SEQ ID NO:3, and the 3' arm sequence is the nucleotide sequence set forth in SEQ ID NO:4. In some embodiments, the 5' arm sequence is the nucleotide sequence set forth in SEQ ID NO:5, and the 3' arm sequence is the nucleotide sequence set forth in SEQ ID NO:6. In some embodiments, the 5' arm sequence is the nucleotide sequence set forth in SEQ ID NO:37, and the 3' arm sequence is the nucleotide sequence set forth in SEQ ID NO:38. In some embodiments, the 5' arm sequence is the nucleotide sequence set forth in SEQ ID NO:45, and the 3' arm sequence is the nucleotide sequence set forth in SEQ ID NO:46. In some embodiments, the chimeric CFB protein is a humanized CFB protein, comprising a portion of a human CFB protein and a portion of a non-human CFB protein. In some embodiments, the portion of the human CFB protein comprises the Ba region and / or the Bb region; preferably, the Bb region comprises the VWA domain, and further preferably further comprises von Willebrand factor and / or peptidase S1. In some embodiments, the humanized CFB protein comprises a contiguous amino acid sequence of at least 50 to 764 amino acids identical to a portion of a human CFB protein.In some embodiments, the human or chimeric CFB protein comprises SEQ ID NO:2, or positions 26-764 thereof, or comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO:2, or positions 26-764 thereof, or comprises an amino acid sequence that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid from SEQ ID NO:2, or positions 26-764 thereof, or comprises substitutions, deletions, and / or insertions of one or more amino acids from SEQ ID NO:2, or positions 26-764 thereof. In some embodiments, the donor region includes a portion of exon 1 to exon 18 of the human CFB gene, preferably, includes the nucleotide sequence of the coding region of the human CFB gene, and more preferably includes the nucleotide sequence from the start codon to the stop codon of the human CFB gene. In some embodiments, the donor region also includes the 5'UTR and / or 3'UTR of human CFB, and further includes at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp of continuous nucleotides downstream of the 3'UTR of human CFB. In some embodiments, the donor region includes the 5'UTR of human CFB and at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50 bp of continuous nucleotides downstream of the 5'UTR of human CFB. In some embodiments, the nucleotide sequence of the donor region comprises the nucleotide sequence of SEQ ID NO: 7 or 39, or a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 7 or 39, or a nucleotide sequence that differs from SEQ ID NO: 7 or 39 by no more than 50, 40, 30, 20, 10, 9, 6, 3, or 1 bp of nucleotides, or a nucleotide sequence that comprises substitutions, deletions, and / or insertions of one or more nucleotides from SEQ ID NO: 7 or 39.

[0026] In one aspect, the present invention provides a cell, tissue or organ, comprising the humanized CFB gene or expressing the polypeptide.

[0027] In one aspect, the present invention provides an animal model, comprising the humanized CFB gene or the polypeptide or the cells, tissues or organs.

[0028] In one aspect, the present invention provides an application of the above-mentioned non-human animal, the non-human animal obtained by the above-mentioned construction method, the above-mentioned non-human animal genome, the above-mentioned cell obtained by the above-mentioned construction method, the above-mentioned humanized CFB gene, the above-mentioned polypeptide, the above-mentioned cell, tissue or organ, the above-mentioned animal model, and the above-mentioned targeting vector, wherein the applications include: A) application in the development of products involving immune processes related to CFB in human cells; B) application as a model system related to CFB in pharmacological, immunological, microbiological and medical research; C) application involving the production and utilization of animal experimental disease models for CFB-related pathological research and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies; D) application in the screening, efficacy testing, efficacy assessment, verification or evaluation of human CFB signaling pathway regulators in vivo; or, E) application in studying CFB gene function, studying drugs and drug efficacy targeting human CFB target sites, and studying drugs for CFB-related inflammation and immune-related diseases.

[0029] In one aspect, the present invention provides a method for determining the effectiveness of a CFB therapeutic agent in treating a disease, the method comprising: 1) administering a CFB therapeutic agent to a non-human animal or animal model described herein, wherein the non-human animal suffers from a disease; and 2) determining the therapeutic effect of the CFB therapeutic agent on the disease. In some embodiments, the disease is an immune disease, an inflammatory disease, or a tumor. In some embodiments, the immune disease is one or more of age-related macular degeneration (AMD), rheumatoid arthritis, colitis (including ulcerative colitis or Crohn's disease, such as perianal Crohn's disease), rheumatic disease, multiple sclerosis, Parkinson's disease, asthma, myasthenia gravis, or a complement disorder. In some embodiments, the inflammatory disease is one or more of IgA nephropathy, C3 glomerulopathy, glomerulonephritis, degenerative inflammation, exudative inflammation (such as serous, fibrinous, suppurative, hemorrhagic, necrotizing, or catarrhal inflammation), proliferative inflammation, or specific inflammation (such as tuberculosis, syphilis, leprosy, or lymphogranuloma). In some embodiments, the tumor comprises a solid tumor (eg, breast cancer) or a blood cell tumor (eg, a lymphocyte tumor, a B or T cell tumor), etc.

[0030] In one aspect, the present invention provides a method for determining the toxicity of a CFB therapeutic agent, comprising: 1) administering a CFB therapeutic agent to a non-human animal or animal model as described herein; and 2) determining the effect of the CFB therapeutic agent on the non-human animal. In some embodiments, determining the effect of the CFB therapeutic agent on the non-human animal involves measuring the non-human animal's weight or performing a blood test. Preferably, the blood test includes one or more of red blood cell count, hematocrit, or hemoglobin content.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. This application describes methods and materials for use with the present invention; other suitable methods and materials known in the art may be used. The materials, methods, and examples are illustrative only and not restrictive. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) will prevail.

[0032] The term "all or part" in the present invention, "all" refers to the whole, and "part" refers to a part of the whole, or an individual part that makes up the whole.

[0033] The term "humanized CFB protein" of the present invention includes portions derived from human CFB protein, and preferably also includes portions of non-human animal CFB protein. For example, the "human CFB protein" is identical to the entire human CFB protein, i.e., the amino acid sequence is identical to the full-length amino acid sequence of the human CFB protein. The "portion of the human CFB protein" is 5-764 consecutive or intermittent amino acids, preferably 10-764 or 50-764 consecutive or intermittent amino acids, such as 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 730, 735, 739, 750, 760, or 764 amino acids, that are identical to the sequence of the human CFB protein.

[0034] The term "humanized CFB gene" of the present invention includes parts derived from the human CFB gene and parts of the CFB gene of non-human animals. For example, the "human CFB gene" is the same as the entire human CFB gene, that is, its nucleotide sequence is consistent with the full-length nucleotide sequence of the human CFB gene. The “portion of the human CFB gene” is a continuous or intermittent 20-5990, or 20-2476 bp, or 20-2295 bp nucleotide sequence that is consistent with the nucleotide sequence of the human CFB gene, for example, a 20, 50, 100, 200, 500, 1000, 2000, 2200, 2200, 2250, 2290, 2295, 2300, 2400, 2470, 2475, 2476, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 5900, 5990 bp nucleotide sequence that is consistent with the nucleotide sequence of the human CFB gene.

[0035] In the present invention, the term "locus" broadly refers to the location of a gene on a chromosome, and narrowly refers to a DNA segment within a gene, which can be either a gene or a portion of a gene. For example, the "CFB locus" described herein refers to a DNA segment selected from exons 1-18 of the CFB gene. In some embodiments, the endogenous CFB locus of a non-human animal to be replaced can be a DNA segment selected from exons 1-18 of the endogenous CFB gene of the non-human animal.

[0036] 190, 191, 192, 193, 204, 206, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275

[0037] The term "exon XX to exon XXX" or "exon XX-XXX" or "the whole of exon XX to exon XXX" of the present invention refers to exons and introns therebetween, for example, exon 1 to exon 18 includes exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, The entire nucleotide sequence of exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17 and exon 18. For another example, “a portion of exon XX to a portion of exon XXX” or “a portion of exon XX-a portion of exon XXX” includes a portion of exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17, and a portion of the nucleotide sequence of exon 18.

[0038] The term "intron xx" in this application refers to an intron between two exons, for example, intron 1 is the intron between exon 1 and exon 2, and intron 17 is the intron between exon 17 and exon 18.

[0039] The terms "comprising" or "including" in the present invention are open-ended and encompass the specified components or steps being described, as well as other specified components or steps that do not substantially affect them. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still having the same or similar activity as the original sequence.

[0040] The term "and / or" in this invention includes all combinations of the items connected by the term, and each combination should be deemed to have been listed separately in this application. For example, "A and / or B" includes "A", "A and B", and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0041] Those skilled in the art can easily discern other conveniences and advantages of the present application from the following detailed description.

[0042] CFB

[0043] Complement factor B (CFB) is a single-chain protein. Upon activation of the alternative complement pathway, CFB is cleaved by CFD into the Ba region (~33 kD) and the Bb region (~60 kD). The Ba region (residues 1-259) contains three complement control protein (CCP) domains, which are important for the initial binding of CFB to C3b. The Bb region (residues 260-764) contains a von Willebrand factor, a type A domain (VWA), and a peptidase S1 (PA family) domain. The VWA domain consists of approximately 200 residues and forms an α / β opening. The MIDAS site within the VWA domain is also important for the protein's binding to C3b.

[0044] CFD is a key regulator of the alternative complement pathway. It acts on the C3b / CFB complex and cleaves CFB into Ba, which is then released. Bb remains attached to C3b. This C3bBb complex forms the C3 convertase. Direct biological effects of Ba and Bb have been reported, although the physiological significance of these effects remains unclear. Ba may have chemotactic activity for neutrophils and macrophages and may limit B cell proliferation. Bb has been reported to affect the function of macrophages and monocytes and may promote B cell growth.

[0045] In the human genome, the CFB gene (Gene ID: 629) contains 18 exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and exon 18 (Figure 1). The nucleotide sequence of human CFB mRNA is NM_001710.6, and the amino acid sequence of human CFB is NP_001701.2 (SEQ ID NO: 2). The corresponding positions of each exon in the nucleotide and amino acid sequences of transcript NM_001710.6 and its encoded protein NP_001701.2 are shown in Table 1.

[0046] Table 1

[0047] The human CFB gene (NCBI Gene ID: 629) is located on chromosome 6 at positions 31946095 to 31952084 of NC_000006.12 (based on transcript NM_001710.6). Among them, the 5'UTR is located at positions 31946095 to 31946221, exon 1 is located at positions 31,946,095 to 31,946,285, intron 1 is located at positions 31,946,286 to 31,946,372, exon 2 is located at positions 31,946,373 to 31,946,606, intron 2 is located at positions 31,946,607 to 31,947,006, exon 3 is located at positions 31,947,007 to 31,947,192, intron 3 is located at positions 31,947,193 to 31,947,347, and exon 4 is located at positions 31,947,34 8 to 31,947,521, intron 4 is at position 31,947,522 to 31,947,741, exon 5 is at position 31,947,742 to 31,947,843, intron 5 is at position 31,947,844 to 31,947,944, exon 6 is at position 31,947,945 to 31,948,081, intron 6 is at position 31,948,082 to 31,948,373, exon 7 is at position 31,948,374 to 31,948,512, intron 7 is at position 31,948,513 to 31,948,829, exon Exon 8 is located at positions 31,948,830 to 31,948,961, intron 8 is located at positions 31,948,962 to 31,949,242, exon 9 is located at positions 31,949,243 to 31,949,344, intron 9 is located at positions 31,949,345 to 31,949,419, exon 10 is located at positions 31,949,420 to 31,949,557, intron 10 is located at positions 31,949,558 to 31,950,049, exon 11 is located at positions 31,950,050 to 31,950,147, and intron 11 is located at positions 31,950,1 48 to 31,950,285, exon 12 is at positions 31,950,286 to 31,950,403, intron 12 is at positions 31,950,404 to 31,950,618, exon 13 is at positions 31,950,619 to 31,950,772, intron 13 is at positions 31,950,773 to 31,950,867, exon 14 is at positions 31,950,868 to 31,950,944, intron 14 is at positions 31,950,945 to 31,951,143, exon 15 is at positions 31,951,144 to 31,951,The CFB locus is located at position 244, intron 15 is located at position 31,951,245 to 31,951,340, exon 16 is located at position 31,951,341 to 31,951,473, intron 16 is located at position 31,951,474 to 31,951,554, exon 17 is located at position 31,951,555 to 31,951,604, intron 17 is located at position 31,951,605 to 31,951,874, exon 18 is located at position 31,951,875 to 31,952,084, and the 3' UTR is located at position 31952031 to 31952084. All relevant information about the human CFB locus can be retrieved on the NCBI website (Gene ID: 629). The entire contents of which are incorporated into this application by reference.

[0048] In the mouse genome, the CFB gene (Gene ID: 14962) contains 18 exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and exon 18 (Figure 1). The nucleotide sequence of mouse CFB mRNA is NM_008198.2, and the amino acid sequence of mouse CFB is NP_032224.2 (SEQ ID NO: 1). The corresponding positions of each exon in the nucleotide and amino acid sequences of the transcript NM_008198.2 and its encoded protein NP_032224.2 are shown in Table 2.

[0049] Table 2

[0050] The mouse CFB gene (NCBI Gene ID: 14962) is located at positions 35075350 to 35081492 of NC_000083.7 on chromosome 17 (based on transcript NM_008198.2). The 5'UTR is located at positions 35081490 to 35081089, exon 1 is located at positions 35,081,490 to 35,081,028, intron 1 is located at positions 35,081,027 to 35,080,941, exon 2 is located at positions 35,080,940 to 35,080,707, intron 2 is located at positions 35,080,706 to 35,080,190, and exon 3 is located at positions 35,080,189. to 35,080,004, intron 3 is at positions 35,080,003 to 35,079,913, exon 4 is at positions 35,079,912 to 35,079,739, intron 4 is at positions 35,079,738 to 35,079,602, exon 5 is at positions 35,079,601 to 35,079,500, intron 5 is at positions 35,079,499 to 35,079,399, and exon 6 is at positions 35,079,398 to 35,079,399. 079,262, intron 6 is at positions 35,079,261 to 35,079,051, exon 7 is at positions 35,079,050 to 35,078,912, intron 7 is at positions 35,078,911 to 35,078,550, exon 8 is at positions 35,078,549 to 35,078,418, intron 8 is at positions 35,078,417 to 35,078,308, and exon 9 is at positions 35,078,307 to 35,078,2 06, intron 9 is located at positions 35,078,205 to 35,078,123, exon 10 is located at positions 35,078,122 to 35,077,985, intron 10 is located at positions 35,077,984 to 35,077,572, exon 11 is located at positions 35,077,571 to 35,077,474, intron 11 is located at positions 35,077,473 to 35,077,131, and exon 12 is located at positions 35,077,130 to 35,077,0 13, intron 12 is located at positions 35,077,012 to 35,076,798, exon 13 is located at positions 35,076,797 to 35,076,644, intron 13 is located at positions 35,076,643 to 35,076,545, exon 14 is located at positions 35,076,544 to 35,076,468, intron 14 is located at positions 35,076,467 to 35,076,296, exon 15 is located at positions 35,076,295 to 35,076,The CFB locus is located at position 195, intron 15 is located at positions 35,076,194 to 35,076,113, exon 16 is located at positions 35,076,112 to 35,075,980, intron 16 is located at positions 35,075,979 to 35,075,906, exon 17 is located at positions 35,075,905 to 35,075,856, intron 17 is located at positions 35,075,855 to 35,075,559, exon 18 is located at positions 35,075,558 to 35,075,360, and the 3' UTR is located at positions 35075402 to 35075360. All relevant information about the mouse CFB locus can be found on the NCBI website (Gene ID: 14962). The entire contents of which are incorporated into this application by reference.

[0051] Figure 10 and Table 3 show an alignment of the human CFB amino acid sequence (NP_001701.2; SEQ ID NO: 2) and the mouse CFB amino acid sequence (NP_032224.2; SEQ ID NO: 1). Therefore, corresponding amino acid residues or regions between human and mouse CFB can be found in Figure 10 .

[0052] Table 3

[0053] CFB genes, proteins, and gene loci from other species are also known in the art. For example, Rattus norvegicus (rat) CFB has Gene ID: 294257, Macaca mulatta (rhesus monkey) CFB has Gene ID: 716809, Canis lupus familiaris (dog) CFB has Gene ID: 100688056, and Sus scrofa (pig) CFB has Gene ID: 100124383. Relevant information (e.g., intron sequences, exon sequences, and amino acid sequences) for these genes can be found in NCBI, the entire contents of which are incorporated into this application by reference.

[0054] Figure 11 and Table 4 show the amino acid sequence of human CFB (NP_001701.2; SEQ ID NO: 2) and rat CFB (NP_997631.2; SEQ ID NO: 57). Therefore, the corresponding amino acid residues or regions between human and rat CFB can be retrieved in Figure 11.

[0055] Table 4

[0056] The present invention provides a human or chimeric (eg, humanized) CFB protein, or a human or chimeric (eg, humanized) CFB gene.

[0057] In some embodiments, the humanized CFB protein comprises a portion of a human CFB protein. Preferably, it also comprises a portion of a non-human CFB protein. The portion of the human CFB protein comprises the Ba region and / or the Bb region. Preferably, the Bb region comprises the VWA domain, and more preferably, further comprises von Willebrand factor and / or peptidase S1. In some embodiments, the humanized CFB protein comprises the Ba region of a human CFB protein and the Bb region of a non-human CFB protein. In some embodiments, the humanized CFB protein comprises the Bb region of a human CFB protein and the Ba region of a non-human CFB protein. In some embodiments, the humanized CFB protein comprises the VWA domain of a human CFB protein and von Willebrand factor, peptidase S1, and the Ba region of a non-human CFB protein. In some embodiments, the humanized CFB protein comprises replacing the VWA domain of a non-human CFB protein with the VWA domain region of a human CFB protein. In some embodiments, the humanized CFB protein comprises replacing the Bb region of a non-human CFB protein with the Bb region of a human CFB protein. In some embodiments, the humanized CFB protein comprises replacing the Ba region of a non-human animal CFB protein with the Ba region of a human CFB. In some embodiments, the humanized CFB protein comprises at least 50 to 764 (e.g., 50, 60, 70, 80, 90, 100, 150, 200, 220, 240, 260, 280, 300, 310, 350, 400, 450, 500, 550, 600, 650, 700, 710, 720, 730, 739, 740, 750, 760, 761, 762, 763, or 764) consecutive amino acid sequences identical to a portion of a human CFB protein. In some embodiments, the humanized CFB protein comprises SEQ ID NO: 2, or positions 26-764 thereof, or comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 2, or positions 26-764 thereof, or comprises an amino acid sequence that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid from SEQ ID NO: 2, or positions 26-764 thereof, or comprises substitutions, deletions, and / or insertions of one or more amino acids from SEQ ID NO: 2, or positions 26-764 thereof.

[0058] In some embodiments, the humanized CFB gene encodes the aforementioned humanized CFB protein. It preferably comprises a portion of an endogenous CFB gene in a non-human animal and a portion of a human CFB gene. In some embodiments, the portion of the human CFB gene comprises a nucleotide sequence encoding the Ba region and / or the Bb region of the human CFB protein. In some embodiments, the portion of the human CFB gene comprises a nucleotide sequence encoding the VWA domain of the human CFB protein. In some embodiments, the humanized CFB gene comprises replacing the endogenous CFB gene at the endogenous CFB locus in a non-human animal with a nucleotide sequence comprising human CFB. In some embodiments, the non-human animal may be a mouse. In some embodiments, the nucleotide sequence of the human CFB gene comprises a nucleotide sequence encoding the Ba region and / or the Bb region. In some embodiments, the nucleotide sequence of the human CFB gene comprises a nucleotide sequence encoding the VWA domain. In some embodiments, the nucleotide sequence of the human CFB gene may be a genomic sequence, CDS, or cDNA sequence. In some embodiments, the nucleotide sequence of the human CFB gene comprises at least one exon and / or at least one intron of the human CFB gene. In some embodiments, the nucleotide sequence of human CFB includes any one or more of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, or exon 18 of the human CFB gene. In some embodiments, the nucleotide sequence of human CFB includes a portion of exon 1 to a portion of exon 18 of the human CFB gene, wherein the portion of exon 1 includes the nucleotide sequence of the coding region in exon 1, and the portion of exon 18 includes the nucleotide sequence of the coding region in exon 18. Preferably, the nucleotide sequence of human CFB includes the nucleotide sequence of the coding region of the human CFB gene, and more preferably includes the nucleotide sequence from the start codon to the stop codon of the human CFB gene. In some embodiments, the nucleotide sequence of human CFB comprises the nucleotide sequence from the start codon to the stop codon of the human CFB gene, preferably also including the 5'UTR and / or 3'UTR of human CFB; further comprising at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp of continuous nucleotides downstream of the 3'UTR of human CFB. In some embodiments, the nucleotide sequence of human CFB comprises the 5'UTR of human CFB and at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50 bp of continuous nucleotides downstream of the 5'UTR of human CFB.In some embodiments, the amino acid sequence of the human CFB comprises SEQ ID NO: 2, or positions 26-764 thereof, or comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 2, or positions 26-764 thereof, or comprises an amino acid sequence that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid from SEQ ID NO: 2, or positions 26-764 thereof, or comprises substitutions, deletions, and / or insertions of one or more amino acids as set forth in SEQ ID NO: 2, or positions 26-764 thereof. In some embodiments, the nucleotide sequence of the human CFB comprises the nucleotide sequence of SEQ ID NO: 7 or 39, or comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to SEQ ID NO: 7 or 39, or comprises a nucleotide sequence that differs from SEQ ID NO: 7 or 39 by no more than 50, 40, 30, 20, 10, 9, 6, 3, or 1 nucleotide, or comprises a substitution, deletion, and / or insertion of one or more nucleotides from SEQ ID NO: 7 or 39. In some embodiments, the nucleotide sequence encoding the Ba region and / or Bb region of the endogenous CFB is replaced. In some embodiments, the nucleotide sequence encoding the von Willebrand factor and / or peptidase S1 region of the endogenous CFB is replaced. In some embodiments, the nucleotide sequence encoding SEQ ID NO: 1 or positions 18-712 thereof, or SEQ ID NO: 57, is replaced. In some embodiments, at least one exon and / or at least one intron of the endogenous CFB gene is replaced. In some embodiments, one or more of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, or exon 18 of the endogenous CFB gene is replaced. In some embodiments, exons 2 to 17 of the endogenous CFB gene are replaced; preferably, the replaced endogenous CFB gene also includes a portion of exon 1, all of intron 1, and / or a portion of intron 17; more preferably, the replaced endogenous CFB gene also includes a portion of exon 18.In some embodiments, a portion of exon 1 to a portion of exon 18 of an endogenous CFB gene, for example, a nucleotide sequence encompassing the coding region or the start codon to the stop codon, is replaced. In some embodiments, a portion of exon 1 to a portion of intron 17 of an endogenous CFB gene is replaced. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (e.g., a mouse or rat). In some embodiments, the entire nucleotide sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of a CFB gene of a non-human animal (e.g., a mouse) is replaced with a nucleotide sequence of human CFB. In some embodiments, "part" of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of the CFB gene of a non-human animal (such as a mouse) is replaced by the nucleotide sequence or amino acid sequence of human CFB. The "part" refers to at least 1 bp to 2767 bp of a non-human animal (such as a mouse) CFB gene, or at least 1 bp to at least 2449 bp, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200、250、300、350、400、450、500、550、600、650、700、750、800、850、900、910、911、912、913、914、915、916、917、918、919、920、930、940、950、1000、1100、1200、1300、1400、1 500, 1600, 1750, 1800, 1900, 2000, 2080, 2085, 2100, 2200, 2292, 2295, 2449, 2700 or 2767 bp continuous nucleotide sequence, or at least 1 amino acid to 763 amino acids of a non-human animal (such as mouse) CFB protein, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 , 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 220, 240, 260, 280, 300, 310, 350, 400, 450, 500, 550, 600, 650, 690, 695, 700, 710, 720, 730, 740, 750, 760, 761, 762 or 763 consecutive amino acid sequences.In some embodiments, the "portion" is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% homologous to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of the CFB gene of a non-human animal (such as a mouse). In some embodiments, a “partial” or “complete” sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of a non-human animal (such as a mouse) CFB gene (e.g., a portion of exon 1, all of exons 2-17, and a portion of exon 18) is replaced by exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of a human CFB gene. In some embodiments, the nucleotide sequence encoding the human CFB protein replaces all or part of the nucleotide sequence encoding the endogenous CFB protein. In some embodiments, the nucleotide sequence encoding the human CFB protein replaces all or part of the nucleotide sequence encoding the endogenous CFB protein.

[0059] In some embodiments, the humanized CFB gene comprises, from the 5' end to the 3' end, a portion of exon 1 of the mouse CFB gene, a portion from exon 1 to exon 18 of the human CFB gene, and a portion of exon 18 of the mouse CFB gene. In some embodiments, the humanized CFB gene comprises, from the 5' end to the 3' end, a portion of exon 1 of the mouse CFB gene, the 5' UTR of the human CFB gene and at least 50 bp of contiguous nucleotides upstream of the human CFB gene, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, the 3' UTR of the human CFB gene and at least 50 bp of contiguous nucleotides downstream of the human CFB gene, a portion of intron 17 of the mouse CFB gene, and exon 18 of the mouse CFB gene. In some embodiments, the upstream linker of the human CFB nucleotide sequence in the humanized CFB gene to the mouse sequence is SEQ ID NO: 9, and the downstream linker to the mouse sequence is SEQ ID NO: 10. In some embodiments, the upstream linker of the human CFB nucleotide sequence in the humanized CFB gene to the mouse sequence is SEQ ID NO: 41, and the downstream linker to the mouse sequence is SEQ ID NO: 42. In some embodiments, the humanized CFB gene comprises, from 5' to 3' end, the following: A) SEQ ID NOs: 3, 7, and 4; B) SEQ ID NOs: 3, 39, and 4; C) SEQ ID NOs: 5, 7, and 6; D) SEQ ID NOs: 5, 39, and 6; E) SEQ ID NOs: 37, 7, and 38; F) SEQ ID NOs: 37, 39, and 38; G) SEQ ID NOs: 45, 7, and 46; H) SEQ ID NOs: 45, 39, and 46. In some embodiments, the humanized CFB gene comprises one or more of SEQ ID NOs: 11, 12, 43, or 44. In some embodiments, the mRNA transcribed from the humanized CFB gene comprises SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homologous to SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that differs from SEQ ID NO: 8 or 40 by no more than 50, 40, 30, 20, 10, 9, 6, 3, or 1 nucleotides, or comprises a nucleotide sequence that is substituted, deleted, and / or inserted with one or more nucleotides as set forth in SEQ ID NO: 8 or 40. In some embodiments, the humanized CFB gene further comprises a resistance gene, preferably, the humanized CFB gene further comprises two syntenic Frt recombination sites on either side of the resistance gene. In some embodiments, the resistance gene is the neomycin phosphotransferase encoding gene Neo.Preferably, the humanized CFB gene further comprises a specific inducer or repressor. Further preferably, the specific inducer or repressor may be a conventional substance that can be induced or repressed. In a specific embodiment of the present invention, the specific inducer includes but is not limited to the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System). Preferably, the humanized CFB gene is regulated in a non-human animal by a regulatory element. Further preferably, the regulatory element is an endogenous regulatory element or an exogenous regulatory element (e.g., a human regulatory element). Preferably, the regulatory element is a promoter.

[0060] In some embodiments, portions of endogenous exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17 and / or portions of exon 18 are deleted.

[0061] In some embodiments, portions of endogenous exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, and portions of intron 17 are deleted.

[0062] In some embodiments, the present invention provides a genetically modified non-human animal, the genome of which comprises a human, chimeric, or humanized CFB gene. In some embodiments, the protein encoded by the nucleotide sequence of the human, chimeric, or humanized CFB gene is at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2 or positions 26-764 thereof. In some embodiments, the non-human animal genome comprises a nucleotide sequence that is at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% homologous to the nucleotide sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46.

[0063] In some embodiments, the non-human animals described herein comprise a human or humanized CFB gene. In some embodiments, the humanized CFB gene comprises 18 exons. In some embodiments, the humanized CFB gene comprises human or humanized exon 1, human exon 2, human exon 3, human exon 4, human exon 5, human exon 6, human exon 7, human exon 8, human exon 9, human exon 10, human exon 11, human exon 12, human exon 13, human exon 14, human exon 15, human exon 16, human exon 17, and / or human or humanized exon 18. In some embodiments, the humanized CFB gene comprises human intron 1, human intron 2, human intron 3, human intron 4, human intron 5, human intron 6, human intron 7, human intron 8, human intron 9, human intron 10, human intron 11, human intron 12, human intron 13, human intron 14, human intron 15, human intron 16, and / or human or humanized intron 17. In some embodiments, the humanized CFB gene comprises a human or endogenous or humanized 5'UTR. In some embodiments, the humanized CFB gene comprises a human or endogenous or humanized 3'UTR. In some embodiments, the humanized CFB gene comprises an endogenous or human 5'UTR. In some embodiments, the humanized CFB gene comprises an endogenous or human 3'UTR.

[0064] In some embodiments, the genetically modified non-human animal can express human CFB and / or chimeric (e.g., humanized) CFB proteins, wherein the endogenous CFB gene sequence is replaced by a human CFB gene and / or nucleotide sequence. Furthermore, the human CFB gene and / or nucleotide sequence encodes an amino acid sequence of human CFB that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% identical to the amino acid sequence of human CFB set forth in SEQ ID NO: 2, or positions 26-764 thereof. In some embodiments, the nucleotide sequence of the endogenous non-human animal's CFB gene is replaced in whole or in part by a nucleotide sequence encoding a mature human CFB protein.

[0065] In some embodiments, the genetically modified non-human animal expresses human CFB and / or chimeric CFB proteins (e.g., humanized CFB proteins) under endogenous or human regulatory elements (e.g., promoters). Replacement of the endogenous locus provides a non-human animal that expresses human or chimeric CFB proteins (e.g., humanized CFB proteins) in the same type of cells. The genetically modified mice do not show potential diseases observed in certain other transgenic mice known in the art. The human CFB or chimeric CFB protein expressed in the non-human animal can maintain the function of one or more wild-type or human CFB proteins, for example, the expressed CFB protein can bind to a human or non-human CFB protein. Further, in some embodiments, the genetically modified non-human animal does not express endogenous CFB proteins. In some embodiments, the expression of endogenous CFB proteins in the genetically modified non-human animal is reduced. The "endogenous CFB protein" described in this application refers to the CFB protein encoded by the endogenous CFB nucleotide sequence of the non-human animal (e.g., mouse) before genetic modification.

[0066] The genome of the non-human animal comprises a nucleotide sequence encoding an amino acid that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the amino acid sequence of human CFB protein (NP_001701.2; SEQ ID NO: 2). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 39, or SEQ ID NO: 40.

[0067] The nucleotide sequence encoding the endogenous CFB region in the genome of the non-human animal is replaced by a nucleotide sequence encoding human CFB. In some embodiments, the nucleotide sequence encoding the endogenous CFB region is any sequence of the endogenous CFB locus, such as exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, 5'UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17 or any combination thereof. In some embodiments, the nucleotide sequence encoding the endogenous CFB region is located within the endogenous CFB regulatory region. In some embodiments, the nucleotide sequence encoding the endogenous CFB region is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17 and / or exon 18, or a portion thereof.

[0068] One or more cells of the genetically modified non-human animal express a human or chimeric CFB protein (e.g., a humanized CFB protein). In some embodiments, the human or chimeric CFB protein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 220, 240, 260, 280, 300, 310, 350, 400, 450, 500, 550, 600, 650, 700, 710, 720, 730, 739, 740, 750, 760, 761, 762, 763, or 764 consecutive amino acids of SEQ ID NO: 2, or amino acid sequences 26-764 thereof.

[0069] In some embodiments, the genome of the genetically modified non-human animal comprises all or part of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17 and / or exon 18 of the human CFB gene, or all or part of the nucleotide sequence shown in SEQ ID NO: 7, 8, 39 or 40.

[0070] In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 1, all of exons 2-17, and a portion of exon 18 of the human CFB gene, and preferably also includes intron 1 and / or intron 17. In some embodiments, the portion of exon 1 comprises at least 5, 10, 20, 30, 40, 45, 50, 55, 60, 61, 62, 63, 64, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 191 bp of contiguous nucleotide sequence of exon 1 of the human CFB gene. In some embodiments, the portion of exon 1 comprises 64 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 1 comprises at least 30 bp of nucleotide sequence, preferably comprising the nucleotide sequence of the coding region in exon 1. In some embodiments, the portion of exon 18 comprises at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 170, 180, 190, 200, or 210 bp of contiguous nucleotide sequence of human CFB gene exon 18. In some embodiments, the portion of exon 18 comprises 156 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 18 comprises at least 50 bp of nucleotides, preferably comprising the nucleotide sequence of the coding region in exon 18. The portion of exon 1, all of exons 2-17, and the portion of exon 18 of the human CFB gene comprise at least 100-500 bp, 500-1000 bp, 1000-2000 bp, or 2000-2500 bp of contiguous nucleotide sequence. In some embodiments, the genetically modified non-human animal genome comprises all of exon 1 to exon 18 of the human CFB gene, and further comprises the 5'UTR and / or 3'UTR of human CFB, and further comprises at least 50 bp to at least 10,000 bp (e.g., 50, 100, 500, 1000, 2000, 3000, 4000, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 7000, 8000, 9000, or 10,000 bp) upstream of the 5'UTR of human CFB. Preferably, the continuous nucleotides are 3000-8000 bp, more preferably 5000-7000 bp) and / or the continuous nucleotides of at least 50 bp to at least 5000 bp (e.g., 50, 100, 500, 600, 700, 800, 900, 910, 920, 930, 940, 950, 1000, 1100, 1200, 1300, 1400, 1500, 2000, 3000, 4000 or 5000, preferably 500-3000 bp, more preferably 500-1500 bp) downstream of the 3'UTR outside of human CFB.In some embodiments, the nucleotide sequence of human CFB is the nucleotide sequence of positions 1-2476 or positions 128-2422 of the human CFB gene transcript NM_001710.6.

[0071] In some embodiments, the CFB gene of the genetically modified non-human animal is heterozygous or homozygous for the endogenous modified locus.

[0072] In some embodiments, the humanized CFB genome comprises a 5'UTR of a human CFB gene. In some embodiments, the humanized CFB genome comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized CFB genome comprises a 3'UTR of a human CFB gene. In some embodiments, the humanized CFB genome comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, based on sequence similarity, it can be reasonably inferred that mouse and human CFB genes are subject to similar regulation. As described herein, humanized CFB mice comprise a replacement of an endogenous mouse locus that retains or does not retain mouse endogenous regulatory elements but comprises a humanized CFB coding sequence. Expression of CFB in genetically modified heterozygous or homozygous mice is completely normal.

[0073] In another aspect, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a deletion of an endogenous CFB gene.

[0074] In some embodiments, the deletion of the endogenous CFB gene comprises one or more exons or portions of exons selected from exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17 and / or exon 18.

[0075] In some embodiments, the endogenous CFB gene deletion further comprises one or more introns or portions of introns, wherein the introns are selected from CFB gene intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16 and / or intron 17.

[0076] In some embodiments, the deletion comprises deleting at least 1 bp to 6143 bp of the endogenous CFB gene. In some embodiments, the deletion comprises deleting at least 1 bp to 6143 bp of the endogenous CFB gene. 50, 1400, 1450, 1500, 1600, 1800, 2000, 2292, 2293, 2300, 2400, 2500, 2600, 2700, 2750, 2766, 2767, 3000, 4000, 5000, 5500, 5686, 5687, 5688, 5689, 5690, 5700, 5800, 5900, 6000, 6100 or 6143 bp of consecutive nucleotide sequence or more.

[0077] In some embodiments, the deletion comprises deleting at least 1 bp to 701 1 bp of the endogenous CFB gene. In some embodiments, the deletion comprises deleting at least 1 bp to 701 1 bp of the endogenous CFB gene. 600, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7010 or 7011 bp of continuous nucleotide sequence or more.

[0078] In some embodiments, the deletion of the endogenous CFB gene comprises at least 50 bp to at least 2767 bp, or at least 50 bp to 2449 bp, e.g., 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 25000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 150000, 250000, 300000 00, 1500, 2000, 2080, 2085, 2100, 2200, 2290, 2292, 2295, 2449, 2500, 2600, 2700, 2750, 2760, 2765 or 2767 bp of continuous nucleotide sequence or more (for example, deletion of at least 30 bp of continuous nucleotide sequence of exon 1, all of exons 2-17, at least 50 bp of continuous nucleotide sequence of exon 18, preferably also deletion of intron 1 and / or intron 17, for example, deletion of at least 10 bp of exon 1, all of exons 2-17 and part of intron 17).

[0079] The present invention provides a humanized mouse CFB genomic DNA sequence, a construct expressing the amino acid sequence of the humanized CFB protein, a cell comprising the construct, and a tissue comprising the cell.

[0080] Therefore, in some embodiments, the present invention provides a chimeric (e.g., humanized) CFB nucleotide sequence and / or amino acid sequence, wherein in some embodiments, the chimeric CFB nucleotide sequence and / or amino acid sequence is fused to mouse endogenous CFB mRNA (e.g., NM_008198.2), mouse CFB amino acid sequence (e.g., NP_032224.2, SEQ ID NO: 1), or a portion thereof (e.g., a portion of exon 1 (including the coding region and may also include the 5'UTR), a portion of exon 18 (including the coding region and may also include the 3'UTR)) has a sequence homology of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the chimeric nucleotide sequence is homologous to a human CFB mRNA sequence (e.g., NM_001710.6), a human CFB amino acid sequence (e.g., NP_001701.2, SEQ ID NO: 1). NO: 2), or a portion thereof (e.g., a portion of exon 1, exons 2-17, and also a 5'UTR and at least 50 bp of continuous nucleotides upstream thereof, a nucleotide sequence from the start codon to the stop codon of the human CFB gene, and a 3'UTR of the human CFB and at least 50 bp of continuous nucleotides downstream thereof) having a sequence identity of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0081] In some embodiments, the nucleotide sequence encoding mouse CFB (SEQ ID NO: 1) or amino acids 25-763 thereof is replaced with a nucleotide sequence encoding human CFB (SEQ ID NO: 2) or amino acids 26-764 thereof.

[0082] In some embodiments, the nucleotide sequence encoding mouse CFB (SEQ ID NO: 1) or amino acids 18-712 thereof is replaced with a nucleotide sequence encoding amino acids of human CFB (SEQ ID NO: 2).

[0083] In some embodiments, the nucleotide sequence is operably linked to a regulatory element (preferably a promoter), such as a human CFB promoter or an endogenous mouse CFB promoter, an inducible promoter, an enhancer, and / or mouse or human regulatory elements.

[0084] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleotide sequence described herein is different from all or a portion of a mouse CFB nucleotide sequence (e.g., a portion of exon 1, exons 2-17, and a portion of exon 18 of the mouse CFB gene transcript NM_008198.2, for example, exons 1-18 of the mouse CFB gene transcript NM_008198.2).

[0085] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleotide sequence is identical to all or a portion of a mouse CFB nucleotide sequence (e.g., a portion of exon 1 and all or a portion of exon 18 of the mouse CFB gene transcript NM_008198.2).

[0086] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleotide sequence differs from all or a portion of a human CFB nucleotide sequence (e.g., a portion of exon 1 and all or a portion of exon 18 of the human CFB gene transcript NM_001710.6).

[0087] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleotide sequence is identical to all or part of a human CFB nucleotide sequence (e.g., a portion of exon 1, exons 2-17, and a portion of exon 18 of the human CFB gene transcript NM_001710.6, for example, exons 1-18 of the human CFB gene transcript NM_001710.6).

[0088] In some embodiments, the amino acid sequence encoded by the chimeric nucleotide sequence is different from all or part of the mouse CFB protein amino acid sequence (e.g., mouse CFB protein sequence NP_032224.2 (SEQ ID NO: 1) or amino acids 18-712 thereof) in at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, such as contiguous or non-contiguous amino acid residues).

[0089] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence is identical to all or part of the amino acid sequence of a mouse CFB protein.

[0090] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence differs from all or a portion of the amino acid sequence of a human CFB protein.

[0091] In some embodiments, at least a portion of the amino acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) is identical to all or part of the amino acid sequence of a human CFB protein (e.g., human CFB protein sequence NP_001701.2 (SEQ ID NO: 2) or amino acids 26-764 thereof).

[0092] The present invention also provides a humanized CFB protein, the amino acid sequence of which comprises any one of the following groups:

[0093] A) SEQ ID NO: 2 or the amino acid sequence shown at positions 26-764 thereof;

[0094] B) is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 2 or the amino acid sequence set forth at positions 26-764 thereof;

[0095] C) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is capable of hybridizing under low stringency conditions or stringent conditions to a nucleotide sequence encoding SEQ ID NO: 2 or amino acids 26 to 764 thereof;

[0096] D) differs from SEQ ID NO: 2 or its amino acid sequence as shown in positions 26-764 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0097] E) an amino acid sequence having the same meaning as that shown in SEQ ID NO: 2 or positions 26-764 thereof, including substitution, deletion and / or insertion of one or more amino acid residues.

[0098] The present invention also provides a humanized CFB gene (eg, DNA or RNA), the nucleotide sequence of which comprises any one of the following groups:

[0099] A) a nucleotide sequence as shown in SEQ ID NO: 7, 8, 39 or 40, or a nucleic acid sequence encoding a humanized mouse CFB homologous amino acid sequence;

[0100] B) a nucleic acid sequence capable of hybridizing to the nucleotide sequence shown in SEQ ID NO: 7, 8, 39 or 40 under low stringency conditions or stringent conditions;

[0101] C) a nucleic acid sequence that is identical to, or at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to, the nucleotide sequence of SEQ ID NO: 7, 8, 39 or 40;

[0102] D) the amino acid sequence encoded by it is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to the amino acid sequence set forth in SEQ ID NO: 2 or positions 26-764 thereof;

[0103] E) encodes an amino acid sequence that differs from SEQ ID NO: 2 or the amino acid sequence set forth at positions 26-764 thereof by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0104] F) The encoded amino acid sequence is the same as that shown in SEQ ID NO: 2 or positions 26-764 thereof, including substitutions, deletions and / or insertions of one or more amino acid residues.

[0105] The present invention further provides a humanized mouse CFB genomic DNA sequence, which is obtained by reverse transcription of mRNA transcribed from the CFB genomic DNA sequence and is identical to or complementary to a DNA sequence homologous to the sequence shown in SEQ ID NO: 7, 8, 39, or 40.

[0106] In order to determine the percent identity of two amino acid sequences or two nucleotide sequences, for the purpose of best comparison, sequences are compared (for example, for best comparison, gaps can be introduced in one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be ignored for the purpose of comparison). The amino acid residues or nucleotides on the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the amino acid residue or nucleotide identical to the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, which, considering the number of gaps and the length of each gap, needs to be introduced to realize the best comparison of the two sequences. For example, the comparison of a sequence and the determination of the percent identity between the two sequences can be completed using the Blossum 62 scoring matrix of gap penalty 12, gap extension penalty 4, and frameshift gap penalty 5.

[0107] The percentage ratio (homology percentage) of conserved residues with similar physicochemical properties, such as leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues with similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (such as lysine, arginine, histidine), acidic side chains (such as aspartic acid, glutamic acid), uncharged polar side chains (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (such as threonine, valine and isoleucine) and aromatic side chains (such as tyrosine, phenylalanine, tryptophan, histidine). In many cases, the homology percentage ratio is higher than the identity percentage ratio.

[0108] In some embodiments, the "homology" refers to the fact that, in terms of the use of amino acid sequences or nucleotide sequences, those skilled in the art can adjust the sequence according to actual work needs, while ensuring that the structure or function is similar to the known sequence, so that the used sequence has (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 11 %, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% identity or consistency.

[0109] The present invention also provides cells, tissues and animals (e.g., mice) comprising the nucleotide sequences described herein, as well as cells, tissues and animals (e.g., mice) expressing human or chimeric (e.g., humanized) CFB at an endogenous non-human CFB locus.

[0110] Genetically modified non-human animals

[0111] The "genetically modified non-human animal" or "genetically modified non-human animal" described in the present invention refers to a non-human animal in which at least one chromosome in the genome of the non-human animal has exogenous DNA. In some embodiments, at least one or more cells, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40% or 50% of the cells in the genetically modified non-human animal have exogenous DNA. Cells with exogenous DNA can be various cells, for example, somatic cells, immune cells (such as T cells, B cells, NK cells, antigen presenting cells, macrophages, dendritic cells), germ cells, blastocysts or tumor cells. In some embodiments, a genetically modified non-human animal is provided, which comprises a modified endogenous CFB locus, comprising an exogenous sequence (such as a human sequence), for example, replacing one or more non-human animal sequences with one or more human sequences, or inserting one or more human and / or non-human sequences. Non-human animals are generally able to pass genetic modifications to offspring through germline transmission.

[0112] The "chimeric (x) gene" or "chimeric (x) nucleic acid" of the present invention refers to a gene or nucleic acid, wherein two or more parts of the gene or nucleic acid are from different species, or at least one sequence of the gene or nucleic acid is different from the nucleic acid in the wild-type animal. In some embodiments, the chimeric (x) gene or chimeric (x) nucleic acid has at least a portion of the sequence having two or more different species origins, for example, sequences encoding different proteins or sequences encoding the same (or homologous) proteins of two or more different species. In some embodiments, the chimeric (x) gene or chimeric (x) nucleic acid refers to a humanized gene or humanized nucleic acid.

[0113] The "chimeric (X) protein" or "chimeric (X) polypeptide" of the present invention refers to a protein or polypeptide, wherein two or more portions of the polypeptide or protein are derived from different species, or at least one sequence of the protein or polypeptide differs from the amino acid sequence in a wild-type animal. In some embodiments, at least a portion of the sequence of the chimeric (X) protein or chimeric (X) polypeptide is derived from two or more different species, for example, the same (or homologous) proteins from different species. In some embodiments, the chimeric (X) protein or chimeric (X) polypeptide is a humanized (X) protein or humanized (X) polypeptide.

[0114] As used herein, a "humanized (X) protein" or "humanized (X) polypeptide" refers to a protein or polypeptide, at least a portion of which is derived from a human protein or polypeptide. In some embodiments, a humanized (X) protein or humanized (X) polypeptide refers to a human protein or polypeptide.

[0115] As used herein, "humanized (x) nucleic acid" or "humanized (x) gene" refers to a nucleic acid, at least a portion of which is derived from a human. In some embodiments, all nucleic acids in the humanized (x) nucleic acid or humanized (x) gene are derived from a human. In some embodiments, the humanized (x) nucleic acid or humanized (x) gene refers to humanized exons, which may be human exons or chimeric exons. In some embodiments, the humanized (x) nucleic acid or humanized (x) gene refers to humanized exons and humanized introns, which may be human introns or chimeric introns.

[0116] In some embodiments, the chimeric (x) gene or chimeric (x) nucleic acid is a humanized CFB gene or humanized CFB nucleic acid. In some embodiments, at least a portion of the gene or nucleic acid is derived from a human CFB gene, and at least a portion of the gene or nucleic acid is derived from a non-human CFB gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding a CFB protein. The encoded CFB protein has at least one activity of a human CFB protein or a non-human animal CFB protein.

[0117] In some embodiments, the chimeric (x) protein or chimeric (x) polypeptide is a humanized CFB protein or humanized CFB polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a human CFB protein, and at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a non-human animal CFB protein. The humanized CFB protein or humanized CFB polypeptide is functional or possesses at least one activity of a human CFB protein or a non-human animal CFB protein.

[0118] The non-human animal of genetic modification can be various animals, for example, mouse, rat, zebrafish, rabbit, pig, cattle (for example, cattle, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (for example, marmoset, rhesus monkey).For the non-human animal of suitable genetically modified embryonic stem cell (ES) that is not easy to obtain, adopt alternative methods to construct the non-human animal comprising genetic modification.Such method includes, for example, modifying non-ES cell genome (for example, fibroblast or induced pluripotent stem cell) and adopting nuclear transplantation to transfer the modified genome to suitable cell, for example oocyte, and incubating the modified cell (for example, modified oocyte) to form embryo in non-human animal under appropriate conditions.Above-mentioned construction method is known in the art, and is described in " A.Nagy, et al., " Manipulating the Mouse Embryo:A Laboratory Manual (Third Edition), " Cold Spring Harbor Laboratory Press, 2006 ", the entire contents of which are incorporated herein by reference.

[0119] In one aspect, the non-human animal is a non-human mammal. In some embodiments, the genetically modified non-human animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the family Muridae. In one embodiment, the genetically modified non-human animal is from a family selected from the family Cricetidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (true mice and rats, gerbils, spiny mice, crested rats), Malborinidae (climbing mice, rock mice, tailed rats, Madagascar rats, and mice), Spiny Mouse (e.g., spiny dormouse), and Muridae (e.g., mole rats, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from a true mouse or rat (Muroidea), gerbils, spiny mice, and crested rats. In one embodiment, the genetically modified mouse is from a member of the family Muridae. In one embodiment, the non-human animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0120] In some embodiments, the non-human animal can be an immunodeficient non-human mammal, such as an immunodeficient rodent, an immunodeficient rabbit, an immunodeficient pig, or an immunodeficient monkey.

[0121] In some embodiments, the non-human animal is a mouse of the C57BL strain, wherein the C57BL strain is selected from the group consisting of C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / min, C57BL6J, C57B1 / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL10SnSn, C57BL / 10Cr and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2. These mice are described, for example, in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10:836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), the relevant contents of which are incorporated herein by reference in their entirety. In some embodiments, the genetically modified mouse is a hybrid of 129 strains and C57BL / 6 strains. In some embodiments, the mouse is a hybrid of 129 strains, or a hybrid of BL / 6 strains. In some embodiments, the mouse is a BALB strain, such as a BALB / c strain. In some embodiments, the mouse is a hybrid of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid system (e.g., 50% BALB / c-50% 12954 / Sv; or 50% C57BL / 6-50% 129). In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB / c, a, a / He, a / J, a / WySN, AKR, AKR / a, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL6, C57L / 6J, C57BL / 6ByJ, C5C57BL / 6NJ.Mice of C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola), C58, CBA / Br, CBA / Ca, CBA / J, CBA / st or CBA / H strains and NOD, NOD / SCID, NOD-Prkdc. scid IL-2rg null Background of mice.

[0122] Genetically modified non-human animals include modifications to an endogenous non-human animal CFB gene site (or locus). In some embodiments, the modification comprises a nucleotide sequence encoding at least a portion of a mature CFB protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the mature CFB protein amino acid sequence). While cells (e.g., ES cells, somatic cells) that may include the genetic modifications described herein are provided herein, in many embodiments, the genetically modified non-human animal includes modifications to an endogenous CFB gene site in the non-human animal.

[0123] The genetically modified non-human animal can express human CFB and / or chimeric (e.g., humanized) CFB at an endogenous locus of the non-human animal (e.g., mouse), wherein the endogenous CFB gene of the non-human animal (e.g., mouse) has been replaced or inserted with a human CFB gene and / or a nucleotide sequence encoding a human CFB, or a nucleotide sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, or 100% homologous to a human CFB sequence. In various embodiments, the endogenous CFB locus of the non-human animal is modified with a nucleic acid sequence that comprises all or part of a mature human CFB protein.

[0124] In some embodiments, genetically modified non-human animals (such as mice) can express human CFB and / or chimeric CFB (e.g., humanized CFB) under the control of endogenous or human regulatory elements (including 5'UTR, 3'UTR, enhancer, or promoter) of the non-human animal. Insertion or substitution at the endogenous locus of the non-human animal (such as a mouse) provides a non-human animal that expresses human CFB or chimeric CFB (e.g., humanized CFB) in suitable cells and does not cause the potential pathology observed in some other transgenic mice known in the art. The human CFB or chimeric CFB (e.g., humanized CFB) expressed in the non-human animal can maintain one or more functions of the wild-type mouse or human CFB in the non-human animal. In addition, in some embodiments, the non-human animal does not express endogenous CFB. In some embodiments, the expression level of endogenous CFB in the non-human animal is reduced compared to the expression level of CFB in the wild-type animal. As used herein, the term "endogenous CFB" refers to a CFB protein expressed by an endogenous CFB nucleotide sequence of a non-human animal (e.g., a mouse) before any genetic modification.

[0125] The genome of the genetically modified non-human animal comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% homologous to the amino acid sequence of human CFB (NP_001701.2; SEQ ID NO: 2). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% homologous to SEQ ID NO: 7, 8, 39, or 40. In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to positions 1-2476 or 128-2422 of NM_001710.6.

[0126] In some embodiments, the genome of the non-human animal includes: part of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17 and / or part of exon 18 of the human CFB gene, or all of exons 1-18 of the human CFB gene, or the 5'UTR of human CFB and at least 50 bp of consecutive nucleotides upstream of its outer side, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50 bp of consecutive nucleotides downstream of its outer side; or a nucleotide sequence encoding all or part of the amino acid sequence of human CFB; or a nucleotide sequence encoding SEQ ID NO: 2 or positions 26-764 thereof.

[0127] In some embodiments, the genome of the genetically modified non-human animal comprises a portion of exon 1, all of exons 2-17, and a portion of exon 18 of the human CFB gene, preferably further comprising intron 1 and / or intron 17. In some embodiments, the portion of exon 1 comprises a continuous nucleotide sequence of at least 5 bp to 191 bp, such as 5, 10, 20, 30, 40, 45, 50, 55, 60, 61, 62, 63, 64, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 191 bp of nucleotides. In some embodiments, the portion of exon 1 comprises 64 bp of nucleotides. In some embodiments, the portion of exon 1 comprises at least 30 bp of nucleotides. In some embodiments, the portion of exon 18 comprises at least 20 to 210 bp of contiguous nucleotide sequence, such as 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 170, 180, 190, 200, or 210 bp of nucleotides. In some embodiments, the portion of exon 18 comprises 156 bp of nucleotides. In some embodiments, the portion of exon 18 comprises at least 50 bp of nucleotides.

[0128] In some embodiments, the genome of the genetically modified non-human animal comprises a portion of exon 1 and exon 18 of an endogenous CFB gene (e.g., mouse CFB). In some embodiments, the portion of exon 1 comprises at least 1, 2, 3, 4, 5, 6, 10, 20, 50, 100, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 170, 180, 190, 200, 300, 400, 401, 402, 403, 404, 405, 410, 450, 460, or 463 nucleotides. In some embodiments, the portion of exon 1 comprises 452 bp of nucleotides. In some embodiments, the portion of exon 1 comprises at least 100 bp, 150 bp, or 200 bp of nucleotides.

[0129] In some embodiments, the genome of the genetically modified non-human animal comprises a portion of exon 1 and a portion of exon 18 of an endogenous CFB gene (e.g., mouse CFB). In some embodiments, the portion of exon 1 comprises at least 1, 2, 3, 4, 5, 6, 10, 20, 50, 100, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 170, 180, 190, 200, 300, 400, 401, 402, 403, 404, 405, 410, 450, 460, or 463 nucleotides. In some embodiments, the portion of exon 1 comprises 402 bp or 155 bp of nucleotides. In some embodiments, the portion of exon 1 comprises at least 100 bp, 150 bp, or 200 bp of nucleotides. In some embodiments, the portion of exon 18 includes at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 45, 50, 51, 52, 53, 54, 55, 60, 70, 80, 90, 100, 150, 200, 205, 208, or 209 nucleotides. In some embodiments, the portion of exon 18 includes 209 or 53 bp of nucleotides. In some embodiments, the portion of exon 18 includes at least 20 bp, 150 bp of nucleotides.

[0130] In some embodiments, a non-human animal harbors a nucleotide sequence encoding a chimeric human / non-human CFB polypeptide at an endogenous CFB locus, and the non-human animal expresses functional CFB on the cell surface. The human portion of the chimeric human / non-human CFB polypeptide can comprise an amino acid sequence encoded by a portion of exon 1, exons 2-17, and / or exon 18 of a human CFB gene, or an amino acid sequence encoded by all of exons 1-18 of a human CFB gene. In some embodiments, the human portion of the chimeric human / non-human CFB polypeptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 2, or positions 26-764 thereof.

[0131] In addition, the modified gene in the genome of the modified non-human animal is homozygous or heterozygous for the endogenous replaced locus. In a specific embodiment, the modified CFB gene in the genome is homozygous or heterozygous for the endogenous replaced locus.

[0132] In some embodiments, the humanized CFB locus comprises a human 5'UTR. In some embodiments, the humanized CFB locus comprises a non-human animal endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized CFB locus comprises a human 3'UTR. In some embodiments, the humanized CFB locus comprises a non-human animal endogenous (e.g., mouse) 3'UTR. Under appropriate circumstances, it is reasonable to assume that, based on the similarity of mouse and human CFB gene sequences, they appear to be similarly regulated. As shown in the application, humanized CFB mice containing insertions or replacements in the non-human animal endogenous CFB locus, which retain mouse regulatory elements but contain humanization of the CFB coding sequence, do not exhibit pathological phenomena. Both genetically modified mice, either heterozygous or homozygous for humanized CFB, are normal.

[0133] In another aspect, the present invention also provides a genetically modified non-human animal whose genome comprises a disruption of an endogenous CFB gene of the non-human animal, wherein the disruption of the endogenous CFB gene comprises a deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17 and / or exon 18, or a partial deletion thereof.

[0134] In some embodiments, the disruption of the endogenous CFB gene of the non-human animal further comprises the deletion of one or more introns selected from intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, and intron 17.

[0135] In some embodiments, the deletion may comprise the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 450, 460, 465, 466, 467, 468, 469, 470, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 5500, 5600, 5686, or more nucleotides.

[0136] In some embodiments, the disruption of the endogenous CFB gene comprises a deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 nucleotides of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18.

[0137] The present invention further relates to the CFB genomic DNA sequence of humanized mice, a DNA sequence obtained by reverse transcription of mRNA that is identical to or complementary to the DNA sequence; a construct expressing the amino acid sequence thereof; a cell comprising the construct thereof; and a tissue comprising the cells thereof.

[0138] The present invention further relates to a non-human mammal produced by the above method. In some embodiments, its genome comprises human genes.

[0139] In some embodiments, the non-human mammal is a rodent, preferably, the non-human mammal is a mouse.

[0140] In some embodiments, the non-human mammal expresses a protein encoded by a humanized CFB gene.

[0141] In addition, the present invention also provides a non-human mammal model carrying a tumor, wherein the non-human mammal model is obtained by the method described in the present application. In some embodiments, the non-human mammal is a rodent (eg, a mouse).

[0142] The present invention also provides a cell or cell line, or primary cell culture derived from a non-human mammal or its progeny, or a non-human mammal carrying a tumor, wherein the cell or cell line is derived from a non-human mammal or its progeny, or a non-human mammal carrying a tumor, or a tissue, organ, or culture thereof derived from a non-human mammal or its progeny. In the case of a tumor, the cell or cell line is derived from a tumor tissue of a non-human mammal or its progeny, or a non-human mammal carrying a tumor.

[0143] The present invention provides a non-human mammal produced by any of the methods described herein. In some embodiments, a non-human mammal or a genetically modified non-human animal is provided, wherein the genome of the genetically modified non-human animal comprises DNA of a human or humanized CFB.

[0144] In some embodiments, a non-human mammal comprises a gene construct described herein (e.g., a gene construct as shown in Figures 2-5 and 17-19). In some embodiments, a non-human mammal expressing a human or humanized CFB protein is provided. In some embodiments, a tissue specifically expressing a human or humanized CFB protein is provided.

[0145] In some embodiments, the expression of human or humanized CFB protein in non-human animals can be controlled, such as by adding specific inducers or repressors. In some embodiments, the specific inducers include but are not limited to the Tet-Off System / Tet-On System or the Tamoxifen System.

[0146] The non-human mammal can be any non-human animal known in the art that can be used in the methods described herein. Preferred non-human mammals are mammals (e.g., rodents). In some embodiments, the non-human mammal is a mouse.

[0147] The non-human mammal described above is subjected to genetic, molecular and behavioral analysis. The present invention provides offspring produced by mating with a non-human mammal of the same genotype or another genotype.

[0148] The present invention provides a cell line or primary cell culture derived from a non-human mammal or its descendants. For example, a cell culture-based model can be prepared by the following methods. The cell culture can be obtained by isolating cells from the non-human mammal, or by using the same construct and establishing a cell culture using standard cell transfection techniques. Integration of a genetic construct containing a DNA sequence encoding a human CFB protein can be detected by various methods.

[0149] There are many analytical methods that can be used to detect exogenous DNA, including nucleic acid level methods (including reverse transcription-polymerase chain reaction (RT-PCR) or Southern Blot and in situ hybridization) and protein level methods (including histochemical analysis, immunoblotting analysis and in vitro binding studies). In addition, the expression level of the target gene can be quantified by the ELSA method well known to those skilled in the art. Many standard analytical methods can be used to perform quantitative detection. For example, RT-PCR and hybridization methods can be used to detect transcription levels, including RNase protection assays, Southern Blots, and RNA dot hybridization analysis (RNAdot). Immunohistochemical staining, flow cytometry, and Western blots can also be used to detect the presence of human or humanized CFB protein.

[0150] In some embodiments, the genetically modified non-human animals described herein (eg, mice homozygous for humanized CFB genes) can express human or humanized CFB in one or more liver tissue cells.

[0151] carrier

[0152] The present invention provides a targeting vector comprising: a) a DNA fragment homologous to the 5' end of the region to be changed (5' arm), which is selected from the genomic DNA of the CFB gene and has a length of 100 to 10,000 nucleotides; b) a desired donor DNA sequence encoding the donor region; and c) a second DNA fragment homologous to the 3' end of the region to be changed (3' arm), which is selected from the genomic DNA of the CFB gene and has a length of 100 to 10,000 nucleotides.

[0153] In some embodiments, a) the DNA fragment homologous to the 5' end of the region to be changed is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000083.7; c) the DNA fragment homologous to the 3' end of the region to be changed is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000083.7.

[0154] In some embodiments, a) the DNA fragment homologous to the 5' end of the region to be changed is selected from the nucleotide sequence at positions 35081089 to 35084696 of NCBI Accession No. NC_000083.7; c) the DNA fragment homologous to the 3' end of the region to be changed is selected from the nucleotide sequence at positions 35070668 to 35074536 of NCBI Accession No. NC_000083.7.

[0155] In some embodiments, a) the DNA fragment homologous to the 5' end of the region to be changed is selected from the nucleotide sequence at positions 35081089 to 35082539 of NCBI Accession No. NC_000083.7; c) the DNA fragment homologous to the 3' end of the region to be changed is selected from the nucleotide sequence at positions 35073826 to 35075402 of NCBI Accession No. NC_000083.7.

[0156] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from the nucleotide sequence at positions 35081039 to 35084904 of NCBI Accession No. NC_000083.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from the nucleotide sequence at positions 35071591 to 35075667 of NCBI Accession No. NC_000083.7.

[0157] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from the nucleotide sequence at positions 35081039 to 35082302 of NCBI Accession No. NC_000083.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from the nucleotide sequence at positions 35074350 to 35075667 of NCBI Accession No. NC_000083.7.

[0158] In some embodiments, the length of the genomic nucleotide sequence selected for the targeting vector can exceed about 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 5.5 kb, 5.8 kb, or 6 kb.

[0159] In some embodiments, the region to be altered is located in the endogenous CFB gene locus of a non-human animal, for example, exon 1 to exon 18 of a non-human animal CFB gene, or for example, exon 1 to exon 17 of a non-human animal CFB gene.

[0160] In certain embodiments, the targeting vector further comprises one or more marker genes (or resistance genes). For example, a positive screening marker gene or a negative screening marker gene. In certain embodiments, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo. Preferably, the targeting vector further comprises two Frt recombination sites arranged in the same direction on both sides of the marker gene. In certain embodiments, the coding gene for the negative screening marker is a coding gene for the diphtheria toxin A subunit (DTA).

[0161] In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 3, and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 4. In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 5, and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 6.

[0162] In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 37, and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 38. In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 45, and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 46.

[0163] In some embodiments, the 5' arm comprises nucleotides that are at least 90% homologous to NCBI Accession No. NC_000083.7. More preferably, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3 or 5. More preferably, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 37 or 45. In some embodiments, the 3' arm comprises nucleotides that are at least 90% homologous to NCBI Accession No. NC_000083.7. More preferably, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 4 or 6. More preferably, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 38 or 46.

[0164] In some embodiments, the targeting vector comprises a human sequence (e.g., positions 31946222 to 31952030 of NC_000006.12). For example, the donor region in the targeting vector includes: a partial or complete nucleotide sequence of the human CFB gene, preferably exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of the human CFB gene. In some embodiments, the nucleotide sequence of the humanized CFB gene encodes all or part of the human CFB protein, and the NCBI protein number is NP_001701.2 (SEQ ID NO: 2).

[0165] In some embodiments, the targeting vector includes, from the 5' end to the 3' end, a portion of exon 1 of the mouse CFB gene, a portion of exon 1 to exon 18 of the human CFB gene, and a portion of exon 18 of the mouse CFB gene.

[0166] In some embodiments, the targeting vector includes, from the 5' end to the 3' end, a portion of exon 1 of the mouse CFB gene, exon 1 to exon 18 of the human CFB gene, and exon 18 of the mouse CFB gene.

[0167] In some embodiments, the targeting vector includes, from the 5' end to the 3' end, a portion of exon 1 of the mouse CFB gene, the 5'UTR of the human CFB gene and at least 50 bp of continuous nucleotides upstream of the 5'UTR and its outer upstream, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of the human CFB and at least 50 bp of continuous nucleotides downstream of the 3'UTR and the mouse CFB gene exon 18.

[0168] In some embodiments, the connecting sequence between the 5' end of the donor region sequence and the 5' homology arm in the targeting vector is SEQ ID NO: 9, and the connecting sequence between the 3' end and the 3' homology arm is SEQ ID NO: 10.

[0169] In some embodiments, the connecting sequence between the 5' end of the donor region sequence and the 5' homology arm in the targeting vector is SEQ ID NO: 41, and the connecting sequence between the 3' end and the 3' homology arm is SEQ ID NO: 42.

[0170] In some embodiments, the targeting vector comprises, from the 5' end to the 3' end:

[0171] A) SEQ ID NOs: 3, 7 and 4;

[0172] B) SEQ ID NOs: 3, 39 and 4;

[0173] C) SEQ ID NOs: 5, 7 and 6;

[0174] D) SEQ ID NOs: 5, 39 and 6;

[0175] E) SEQ ID NOs: 37, 7, and 38;

[0176] F) SEQ ID NOs: 37, 39 and 38;

[0177] G) SEQ ID NOs: 45, 7 and 46;

[0178] H) SEQ ID NOs: 45, 39 and 46.

[0179] In some embodiments, the targeting vector comprises a Neo cassette. The Neo cassette can be inserted into a 5' homology arm, a 3' homology arm, or a donor region sequence.

[0180] In some embodiments, the targeting vector further comprises one or more of SEQ ID NO: 11, 12, 43 or 44.

[0181] The present invention also provides an sgRNA vector for constructing a humanized animal model or a knockout model. In some embodiments, the vector comprises an sgRNA sequence, wherein the sgRNA sequence targets the CFB gene, and the sgRNA is unique in the target sequence of the gene to be changed and satisfies the sequence arrangement rule of 5'-NNN(20)-NGG3' or 5'-CCN-N(20)-3'; and in some embodiments, the targeting site of the sgRNA in the mouse CFB gene is located at exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17, exon 18, for example, exon 1, intron 17 and / or exon 18 of the mouse CFB gene.

[0182] In some embodiments, the targeting sequence is shown as one or more of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, and 22. In some embodiments, the targeting sequence is shown as one or more of SEQ ID NOs: 47, 48, 49, 50, 51, 52, 53, 54, 55, and 56. Thus, the present invention provides sgRNA sequences for constructing genetically modified animal models. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NOs: 15 and 17. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NOs: 16 and 18. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NOs: 19 and 21. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NOs: 20 and 22. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NOs: 49 and 51. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NOs: 50 and 52. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 53 and 55. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 54 and 56.

[0183] In some embodiments, the present invention relates to a plasmid construct comprising an sgRNA sequence (e.g., pT7-sgRNA) and / or a cell comprising the construct.

[0184] The present invention also relates to a cell comprising the targeting vector or sgRNA vector as described above.

[0185] In addition, the present invention also provides a non-human mammalian cell having any one of the above-mentioned targeting vectors and one or more in vitro transcripts of the constructs described herein. In some embodiments, the cell comprises Cas9 mRNA or its in vitro transcript.

[0186] In some embodiments, the cell is heterozygous for the gene. In some embodiments, the cell is homozygous for the gene.

[0187] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0188] The present invention also relates to the use of the above-mentioned targeting vector or sgRNA or sgRNA vector in CFB gene modification.

[0189] Method for constructing genetically modified non-human animals

[0190] Genetically modified non-human animals can be prepared by several gene editing technologies known in the art, including homologous recombination technology (including gene targeting technology, CRISPR / Cas9 gene editing technology) using embryonic stem cells, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease or other molecular biology techniques. In some embodiments, homologous recombination technology is preferably used. In some embodiments, CRISPR / Cas9 gene editing technology can construct genetically modified non-human animals. In some embodiments, CRISPR-Cas9 gene editing technology is used to produce genetically modified non-human animals. Many of these gene editing technologies are known in the art and are described in “Delivery technologies for genome editing,” Nature Reviews Drug Discovery 16.6 (2017): 387-399, by Yin et al., which is incorporated herein by reference. The present invention also provides many other methods for gene editing, for example, microinjecting transgenic cells into enucleated oocytes and fusing the enucleated oocytes with another transgenic cell.

[0191] In some embodiments, the nucleotide sequence encoding the endogenous CFB region in the endogenous genome of at least one cell of a non-human animal is replaced with a nucleotide sequence encoding a human CFB region. In some embodiments, the non-human animal's endogenous CFB protein is expressed at reduced levels or absent compared to wild-type. In some embodiments, the replacement occurs in a cell, such as a germ cell, somatic cell, blastocyst, or fibroblast. The nucleus of a somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0192] Figures 3, 5 and Figures 18 and 19 show the humanization targeting strategy for the mouse CFB locus. The targeting vector comprises a vector consisting of a 5' homology arm, a human or humanized CFB gene fragment, and a 3' homology arm. The process involves replacing the endogenous CFB sequence with the human or humanized CFB sequence using homologous recombination. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nucleases, TALENs, or CRISPR) can result in a double-strand break of the DNA, and homologous recombination is used to replace the mouse endogenous CFB sequence with the human or humanized CFB sequence to form a chimeric CFB gene (e.g., a humanized CFB gene).

[0193] Therefore, in some embodiments, the method for preparing a genetically modified humanized animal comprises replacing a nucleic acid sequence encoding an endogenous CFB region with a nucleotide sequence encoding human CFB at an endogenous CFB locus (or site). The replaced sequence may include regions (e.g., part or all) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, and / or exon 18 of the human CFB gene. In some embodiments, the sequence includes a portion of exon 1, exons 2-17, and a portion of exon 18 of the human CFB gene (e.g., nucleotide sequence 1-2476 or 128-2422 of NM_001710.6). In some embodiments, the sequence includes exon 1 to exon 18 of a human CFB gene (e.g., nucleotides 1-2476 of NM_001710.6). In some embodiments, the sequence includes a portion of exon 1 and all or a portion of exon 18 of an endogenous CFB gene (e.g., nucleotides 1-402 and 2695-2747 of NM_008198.2, or nucleotides 1-452 and 2539-2747 of NM_008198.2, or nucleotides 1-155 and 2241-2449 of NM_008198.3).

[0194] The present invention also provides a method for establishing a CFB gene humanized animal model, comprising the following steps:

[0195] (a) providing cells (e.g., fertilized egg cells) according to the method described in this application;

[0196] (b) culturing the cells (preferably culturing the cells in a liquid culture medium);

[0197] (c) transplanting the cultured cells into the oviduct or uterus of a recipient female non-human mammal, and allowing the cells to develop in the uterus of the female non-human mammal;

[0198] (d) identifying germline transmission in offspring of the genetically modified humanized non-human mammal of the pregnant female in step (c).

[0199] In some embodiments, the non-human mammal in the above methods is a mouse (eg, a C57BL / 6 mouse).

[0200] In some embodiments, the non-human mammal in step (c) is a pseudo-pregnant (or pregnant) female.

[0201] In some embodiments, the fertilized eggs used in the above methods are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs, and DBA / 2 fertilized eggs.

[0202] The fertilized egg can be from any non-human animal, such as any of the non-human animals described herein. In some embodiments, the fertilized egg cell is derived from a rodent. The genetic construct can be introduced into the fertilized egg by microinjection. For example, by culturing the fertilized egg after microinjection, the cultured fertilized egg can be transferred to a pseudopregnant non-human animal, which can then give birth to a non-human mammal, thereby producing the non-human mammal mentioned in the above method.

[0203] In some embodiments, methods for preparing genetically modified non-human animals include modifying the coding framework of the non-human animal's CFB gene, for example, by replacing a nucleic acid sequence encoding an endogenous CFB protein (e.g., genomic DNA, CDS, or cDNA sequence) with a nucleotide sequence encoding human CFB under the control of endogenous regulatory elements of the non-human animal's CFB gene. For example, one or more functional region sequences of the non-human animal's CFB gene can be deleted or inserted into sequences, such that the non-human animal's endogenous CFB protein cannot be expressed or its expression level is reduced. In some embodiments, the coding framework of the modified non-human animal's CFB gene can be all or part of the nucleotide sequence of exon 1 to exon 18 of the non-human animal's CFB gene.

[0204] In some embodiments, a method for preparing a genetically modified non-human animal comprises inserting a nucleotide sequence encoding a human or humanized CFB protein after the endogenous regulatory elements of the CFB gene of the non-human animal, and may further comprise an auxiliary sequence. In some embodiments, the auxiliary sequence may be a stop codon, such that the CFB gene humanized animal model can express the human or humanized CFB protein in vivo without expressing the CFB protein of the non-human animal. In some embodiments, the auxiliary sequence comprises a WPRE (WHP post-transcriptional response element), loxP, STOP, and / or polyA.

[0205] In some embodiments, methods for preparing a genetically modified non-human animal comprise using the above-described vectors, e.g., targeting vectors and / or sgRNA vectors.

[0206] In some embodiments, a method for producing a transgenic non-human animal comprises:

[0207] (1) providing a plasmid comprising a human CFB gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' and 3' homology arms target endogenous CFB;

[0208] (2) providing one or more guide RNAs (sgRNAs) targeting endogenous CFB genes;

[0209] (3) modifying the genome of a fertilized egg or embryonic stem cell by using the plasmid of step (1), the sgRNA of step (2), and Cas9;

[0210] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudo-pregnant female non-human animal (such as a mouse), or transplanting the embryonic stem cells obtained in step (3) into a blastocyst, and then transplanting the blastocyst into the oviduct of a pseudo-pregnant female non-human animal (such as a mouse) to produce an offspring non-human animal (such as a mouse) that functionally expresses the humanized CFB protein;

[0211] Preferably, the method further comprises step (5) of mating the offspring non-human animals (such as mice) obtained in step (4) to obtain homozygous non-human animals (such as mice).

[0212] In some embodiments, the zygote is modified by CRISPR with sgRNAs targeting a 5'-terminal targeting site and a 3'-terminal targeting site.

[0213] In some embodiments, the sequence encoding the humanized CFB protein is operably linked to endogenous or human regulatory elements at the endogenous CFB locus.

[0214] In some embodiments, the genetically modified non-human animal does not express endogenous CFB protein.

[0215] In some embodiments, a method for producing a transgenic non-human animal comprises:

[0216] (1) providing a plasmid comprising a human or chimeric CFB gene segment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' homology arm and the 3' homology arm target endogenous CFB;

[0217] (2) providing one or more guide RNAs (sgRNAs) targeting endogenous CFB genes;

[0218] (3) Modifying the genome of a fertilized egg or embryonic stem cell by inserting the human or chimeric CFB gene fragment into the genome.

[0219] Use of genetically modified non-human animals

[0220] Replacing a non-human animal gene with a homologous or orthologous human gene or human sequence or inserting a homologous or orthologous human gene or human sequence into a non-human animal at an endogenous non-human animal locus and under the control of an endogenous or human regulatory element (e.g., a promoter) can produce a non-human animal with qualities and characteristics that may be significantly different from a typical knockout plus transgenic animal. In a typical knockout plus transgenic animal, the endogenous locus is removed or destroyed, and a full human transgene is inserted into the genome of the animal and may be randomly integrated into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of human genes and / or protein assays and / or functional assays. In human transgenes, the upstream and / or downstream of the human sequence provide suitable support for expression and / or regulation of the transgene.

[0221] Genetically modified non-human animals that express human or humanized CFB proteins, e.g., in a physiologically appropriate manner, provide a variety of uses, including but not limited to developing treatments for human diseases and disorders, and evaluating the toxicity and / or efficacy of these human treatments in animal models.

[0222] The present invention also provides a use of the CFB gene-modified non-human animal or its offspring, or a non-human animal or its offspring obtained by any of the above construction methods.

[0223] In some embodiments, the application comprises:

[0224] A) Applications in product development involving human cells for CFB-related immune processes;

[0225] B) Application as a CFB-related model system for pharmacology, immunology, microbiology, and medical research;

[0226] C) applications involving the production and use of animal experimental disease models for the study of the etiology of CFB and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies;

[0227] D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human CFB signaling pathway modulators; or

[0228] E) Study the function of the CFB gene, research the drugs and efficacy targeting human CFB target sites, and study the application of drugs in CFB-related inflammatory and immune-related diseases.

[0229] The present invention provides a non-human animal expressing a human or humanized CFB protein, which can be used to screen therapeutic agents (e.g., anti-human CFB modulators, oligonucleotide drugs, and / or polypeptide drugs). In some embodiments, the non-human animal is an animal model for a human disease. For example, the disease is genetically induced (knock-in or knock-out). In various embodiments, the genetically modified non-human animal further comprises a compromised immune system, such as a genetically modified human tissue xenograft, including human solid tumors (e.g., breast cancer) or blood cell tumors (e.g., lymphocytic tumors, B or T cell tumors), etc.

[0230] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents in treating various diseases. In some embodiments, the diseases are associated with CFB expression or abnormal expression (e.g., overexpression). In some embodiments, the diseases are diseases for which targeting CFB or downregulating CFB expression is beneficial.

[0231] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-human CFB modulators, oligonucleotide drugs, and / or peptide drugs) in treating various immune diseases. In some embodiments, the immune diseases include, but are not limited to, age-related macular degeneration (AMD), rheumatoid arthritis, colitis (including ulcerative colitis or Crohn's disease, such as perianal Crohn's disease), rheumatic diseases, multiple sclerosis, Parkinson's disease, asthma, myasthenia gravis, or complement diseases.

[0232] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-human CFB modulators, oligonucleotide drugs, and / or polypeptide drugs) in treating various inflammatory infections. In some embodiments, the inflammation includes both acute and chronic inflammation. Specifically, it includes, but is not limited to, IgA nephropathy, C3 glomerulopathy, glomerulonephritis, degenerative inflammation, exudative inflammation (e.g., serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, or catarrhal inflammation), proliferative inflammation, or specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc.).

[0233] In some embodiments, genetically modified non-human animals can be used to test whether an anti-CFB antibody or anti-CFB nucleic acid drug is an agonist or antagonist. In some embodiments, the methods described herein can be used to test the function of a therapeutic agent (e.g., an anti-human CFB modulator, oligonucleotide drug, and / or peptide drug), for example, whether the therapeutic agent can upregulate or downregulate an immune response, and / or whether the therapeutic agent can induce complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, genetically modified non-human animals can be used to determine the effective dose of a therapeutic agent for treating a disease (e.g., an immune disease) in a subject.

[0234] The present invention also provides a method for determining the toxicity of a therapeutic agent (e.g., an anti-human CFB modulator, an oligonucleotide drug, and / or a polypeptide drug). The method comprises administering the therapeutic agent to a non-human animal as described above and assessing the non-human animal's weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can reduce red blood cells (RBCs), hematocrit, or hemoglobin by 20%, 30%, 40%, or 50% or more. In some embodiments, the non-human animal's weight is at least 5%, 10%, 20%, 30%, or 40% less than a control group (e.g., the average weight of a non-human animal not treated with the antibody).

[0235] The present invention also provides an animal model constructed by the method described in the present application for developing products related to human cellular immune processes, producing human antibodies, or a model system for pharmacology, immunology, microbiology and medical research.

[0236] In some embodiments, an animal model generated by the methods described herein is provided for producing and utilizing animal experimental disease models of immune processes in human cells, studying pathogens, or developing new diagnostic and / or therapeutic strategies.

[0237] The present invention also provides an animal model generated by the method described herein to screen, verify, evaluate or study CFB gene function, human CFB antibodies, drugs or effectiveness of human CFB target sites, drugs for immune-related diseases and anti-tumor drugs.

[0238] Non-human animal models with two or more human or chimeric (x) genes

[0239] The present invention also provides a method for generating a transgenic animal model having two or more human or chimeric (x) genes. The animal model may comprise a human or chimeric CFB gene and a sequence encoding an additional human or chimeric (x) protein.

[0240] In some embodiments, the additional human or chimeric (x) protein comprises at least one of CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, and CTLA4. In some embodiments, the animal model further expresses at least one of human or humanized CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, and CTLA4 protein.

[0241] The present invention also provides a method for constructing a non-human animal with two or more human or chimeric (x) genes, the method comprising:

[0242] (1) Providing the aforementioned non-human animals or methods for obtaining non-human animals or animal models;

[0243] (2) mating, in vitro fertilization, or direct gene editing of the non-human animal provided in step (1) with other genetically modified non-human animals, and screening to obtain multi-gene modified non-human animals.

[0244] In some embodiments, the other genetically modified non-human animals include non-human animals humanized with one or a combination of two or more of the genes CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, or CTLA4.

[0245] In some embodiments, CFB humanization is performed directly on at least one non-human animal with human or chimeric CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, and CTLA4 genetic modifications.

[0246] Each of the individual genes modified in the genome of the two or more human or chimeric non-human animals or animal models is homozygous or heterozygous for the endogenous modified (preferably replaced) locus.

[0247] Since these proteins may involve different mechanisms, a combination therapy targeting two or more of these proteins may be a more effective treatment method. In fact, many related clinical trials are underway and have shown good results. Multigene-modified non-human animal models can be used to determine the effectiveness of combination therapies targeting two or more proteins, for example, anti-CFB antibodies, and additional therapeutic agents for treating cancer or immune diseases (e.g., asthma or atopic dermatitis). The method comprises administering an anti-CFB antibody and an additional therapeutic agent to a non-human animal, wherein the non-human animal has a tumor or immune disease, and determining the effect of the combination therapy on the immune tumor or immune disease. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1 and CTLA4. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., nivolumab) or an anti-PD-L1 antibody. In some embodiments, the non-human animal further comprises a sequence encoding human or humanized PD-1, a sequence encoding human or humanized PD-L1, or a sequence encoding human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1 and / or PD-L2. BRIEF DESCRIPTION OF THE DRAWINGS

[0248] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, in which:

[0249] Figure 1: Schematic comparison of the mouse CFB locus and the human CFB locus (not to scale);

[0250] Figure 2: Schematic diagram of the humanized transformation of the mouse CFB locus (not to scale);

[0251] Figure 3: Schematic diagram of the CFB gene targeting strategy and targeting vector V1 design (not to scale);

[0252] Figure 4: Schematic diagram of the FRT recombination process of CFB gene humanized mice (not to scale);

[0253] Figure 5: Schematic diagram of the CFB gene targeting strategy and targeting vector V2 design (not to scale);

[0254] Figure 6: PCR identification results of the F1 generation of humanized CFB gene mice, where the primers used in A are WT-F / WT-R, and the primers used in B are WT-F / Mut-R, M is a marker, WT is a wild-type control, H2O is a water control, and PC is a positive control;

[0255] Figure 7: Southern blot analysis of the F1 generation of humanized CFB mice, where WT is the wild-type control.

[0256] Figure 8: RT-PCR test results, where + / + represents wild-type C57BL / 6 mice, H / H represents CFB gene humanized homozygous mice, and H2O represents water control;

[0257] Figure 9: ELISA detection of human CFB protein expression in CFB humanized mice, where + / + represents wild-type C57BL / 6 mice, and H / H represents homozygous humanized CFB mice;

[0258] Figure 10: Alignment of the human CFB amino acid sequence (NP_001701.2; SEQ ID NO: 2) and the mouse CFB amino acid sequence (NP_032224.2; SEQ ID NO: 1);

[0259] Figure 11: Alignment of the human CFB amino acid sequence (NP_001701.2; SEQ ID NO: 2) and the rat CFB amino acid sequence (NP_997631.2; SEQ ID NO: 57);

[0260] Figure 12: ELISA detection of human Ba ​​protein expression in CFB humanized mice, where H / H is a homozygous humanized CFB gene mouse;

[0261] Figure 13: HE staining analysis of kidney tissue of CFB gene humanized mice;

[0262] Figure 14A: Complement alternative pathway activity was measured using a hemolysis assay for human C3b protein (71.4 ug / mL) and human C3b protein (71.4 ug / mL) + C5 protein (107 ug / mL), with Nc serving as the solvent control.

[0263] Figure 14B: Hemolysis assay was used to determine the activity of the alternative complement pathway in the human C3b protein (71.4 ug / mL) + C5 protein (107 ug / mL) and human C3 protein (143 ug / mL) + human C5 protein (107 ug / mL) groups, with Nc serving as the solvent control.

[0264] Figure 15: Complement alternative pathway activity assay using the alternative pathway kit;

[0265] Figure 16: Inhibition rate of small nucleic acid drugs on CFB protein (A) and mRNA (B) expression levels.

[0266] Figure 17: Schematic diagram of the humanized transformation of the mouse CFB locus (not to scale);

[0267] Figure 18: Schematic diagram of the CFB gene targeting strategy and targeting vector V3 design (not to scale);

[0268] Figure 19: Schematic diagram of CFB gene targeting strategy and targeting vector V4 design (not to scale). DETAILED DESCRIPTION

[0269] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0270] In each of the following examples, equipment and materials were obtained from the following companies:

[0271] C57BL / 6 mice and Flp transgenic mice were purchased from the National Rodent Laboratory Animal Seed Center, China Food and Drug Administration;

[0272] Human Factor B ELISA kit was purchased from Abcam, catalog number: ab137973.

[0273] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are explained in detail in the following literature. For example: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (DNGlovered., 1985); Oligonucleotide Synthesis (MJGaited., 1984); Mullisetal. US Pat. No. 4, 683, 195; Nucleic Acid Hybridization (BDHames&S.J.Higginseds.1984); Transcription And Translation (BDHames&S.J.Higginseds.1984); Culture Of Animal Cells (RIFreshney, AlanR.Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B.Perbal, A Practical Guide To Molecular Cloning(1984);the series, Methods In ENZYMOLOGY (J.Abelson and M.Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154 and 155 (Wuetal.eds.) and Vol.185, "Gene Expression Technology" (D.Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (JHMiller and MPCaloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes V (DMWeir and CCBlackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). .

[0274] Example 1: Method 1 for constructing humanized CFB gene mice

[0275] A schematic diagram of the comparison of the mouse CFB gene (NCBI Gene ID: 14962, Primary source: MGI: 105975, UniProt ID: B8JJM5, located at positions 35075350 to 5081492 of chromosome 17 NC_000083.7, based on transcript NM_008198.2 and its encoded protein NP_032224.2 (SEQ ID NO: 1)) and the human CFB gene (NCBI Gene ID: 629, Primary source: HGNC: 1037, UniProt ID: P00751-1, located at positions 31946095 to 31952084 of chromosome 6 NC_000006.12, based on transcript NM_001710.6 and its encoded protein NP_001701.2 (SEQ ID NO: 2)) is shown in Figure 1.

[0276] To achieve the objectives of the present invention, a nucleotide sequence encoding a human CFB protein can be introduced into the mouse endogenous CFB locus, allowing the mouse to express a human or humanized CFB protein. Specifically, using gene editing technology, under the control of the mouse CFB gene regulatory elements, a partial sequence coding region from exon 1 to exon 18 of the human CFB gene (e.g., from the start codon ATG to the stop codon TAA) of approximately 5.8 kb is replaced with a partial sequence coding region from exon 1 to exon 18 of the mouse (e.g., from the start codon ATG to the stop codon TAA). The resulting humanized CFB locus is shown in Figure 2, achieving humanization of the mouse CFB gene.

[0277] Based on Figure 2, a targeting strategy was further designed as shown in Figure 3. The figure shows the V1 targeting vector containing upstream and downstream homology arm sequences of the mouse CFB gene and segment A containing the human CFB fragment. The upstream 5' homology arm sequence (SEQ ID NO: 3) is identical to the nucleotide sequence from positions 35081089 to 35084696 of NCBI Accession No. NC_000083.7, and the downstream 3' homology arm sequence (SEQ ID NO: 4) is identical to the nucleotide sequence from positions 35070668 to 35074536 of NCBI Accession No. NC_000083.7. The nucleotide sequence of the human CFB fragment (SEQ ID NO: 7) is identical to the nucleotide sequence from positions 31946222 to 31952030 of NCBI Accession No. NC_000006.12. The upstream junction of the human CFB fragment sequence and the mouse CFB fragment sequence was designed as: 5'-AGGGCTTTGGGCCACTGGACTCTCTGGTGCTTTCC GAGCAATCTCAGCCCCCAACTCTGCCTGATGCCCTTTATCTTGGGC-3' (SEQ ID NO: 9), wherein the last "C" in the sequence "TTTCC" is the last nucleotide of the mouse, the sequence The "A" in the sequence is the first nucleotide of the human sequence. The downstream connection of the human CFB fragment sequence and the mouse sequence is designed as: 5'-TGCTGCCCTGGCTGAAGGAGAAACTCCAAGATGAGGATTTGGGTTTTCTATAA TTCCTGCAGGGAGAGTGTGAGGACAGATTAAAGCAGTTACA-3' (SEQ ID NO: 10), wherein the last "A" in the sequence "TATAA" is the last nucleotide of the human sequence, and the sequence The first "A" in is the first nucleotide of the mouse sequence.

[0278] The targeting vector also contains a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo. Two site-specific recombination system Frt recombination sites are arranged in the same direction on both sides of the resistance gene to form a Neo cassette. The 5' end of the Neo cassette is connected to the mouse CFB gene in the following manner: 5'-GGGGTTGTTCTTAGCTTGGACTCTTCTTCATGGCTCCTTTGCTGCAGAC ACGGTATCGATAAGCTTGATATCGAATTCCGAAGTTC-3' (SEQ ID NO: 11), wherein the last "C" in the sequence "CAGAC" is the last nucleotide of the mouse CFB gene, and the sequence The first "G" in the Neo box is the first nucleotide; the connection between the 3' end of the Neo box and the mouse CFB gene is designed as: 5'-TATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCC TTGGGCCTAGCAAGCCAGGACTGCTGGAGGT-3' (SEQ ID NO: 12), wherein the last "C" in the sequence "GATCC" is the last nucleotide of the Neo box, and the sequence The first "T" in is the first nucleotide of the mouse CFB gene. The mRNA sequence of the modified humanized mouse CFB is shown in SEQ ID NO: 8, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0279] Targeting vector construction can be performed using conventional methods, such as enzyme digestion and ligation. After preliminary verification of the constructed targeting vector by enzyme digestion, it is sent to a sequencing company for sequencing verification. The sequencing-verified targeting vector is electroporated and transfected into embryonic stem cells of C57BL / 6 mice. The resulting cells are screened using a positive clone screening marker gene to identify the correct positive clone cells. The screened correct positive clone cells (black mice) are introduced into isolated blastocysts (white mice) according to techniques known in the art. The resulting chimeric blastocysts are transferred to culture medium for a short period of time and then transplanted into the oviducts of recipient female mice (white mice), producing F0 generation chimeric mice (black and white). F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice. F1 generation heterozygous mice are then mated to obtain F2 generation homozygous mice. Alternatively, positive mice can be mated with Flp tool mice to remove the positive clone screening marker gene (see Figure 4 for a schematic diagram of this process), and then mated to obtain CFB gene homozygous mice.

[0280] In addition, CRISPR / Cas9 technology can be used for gene editing, further designing a targeting strategy as shown in Figure 5. The figure shows the upstream and downstream homology arm sequences of the mouse CFB gene and the human CFB fragment on the targeting vector V2. A schematic diagram of the constructed humanized CFB locus is shown in Figure 2. The upstream 5' homology arm sequence (SEQ ID NO: 5) is identical to nucleotides 35081089 to 35082539 of NCBI Accession No. NC_000083.7, and the downstream 3' homology arm sequence (SEQ ID NO: 6) is identical to nucleotides 35073826 to 35075402 of NCBI Accession No. NC_000083.7. The nucleotide sequence of the human CFB fragment (SEQ ID NO: 7) is identical to nucleotides 31946222 to 31952030 of NCBI Accession No. NC_000006.12. The mRNA sequence of the transformed humanized CFB mouse is shown in SEQ ID NO: 8, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0281] Targeting vector construction can be performed using conventional methods, such as enzyme digestion, ligation, and direct synthesis. After initial verification of the constructed targeting vector through enzyme digestion, it is sent to a sequencing company for sequencing verification. Targeting vectors that have been verified to be correct by sequencing are used in subsequent experiments.

[0282] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are prerequisites for constructing sgRNA expression vectors. Design and synthesize the sgRNA sequence that recognizes the target site. The target sequence of the exemplary sgRNA on the CFB gene is as follows:

[0283] sgRNA1 target site (SEQ ID NO: 13): 5'-AGCCTAAGACCAAGAGGACGAGG-3';

[0284] sgRNA2 target site (SEQ ID NO: 14): 5'-GTGGAAGTCCCGGGCATAAGAGG-3';

[0285] The activity of sgRNA was detected using a UCA kit. After confirming that it could mediate efficient cleavage efficiency, enzyme cleavage sites were added to its 5' end and complementary chain to obtain forward oligonucleotide and reverse oligonucleotide sequences as shown in Table 5. After annealing, the annealed products were ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) to obtain expression vectors pT7-CFB-1 and pT7-CFB-2.

[0286] Table 5: Sequence list of sgRNA1 and sgRNA2

[0287] The pT7-sgRNA vector is synthesized by a plasmid synthesis company. The fragment DNA containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 23) is then ligated to a backbone vector (source: Takara, Cat. No. 3299) using enzyme digestion (EcoRI and BamHI). Sequencing verification by a professional sequencing company indicates that the target plasmid has been obtained. Pronuclear fertilized eggs of mice, such as C57BL / 6 mice, are taken. In vitro transcription products of the pT7-CFB-1 and pT7-CFB-2 plasmids (transcribed using the Ambion in vitro transcription kit according to the instructions), the targeting vector, and Cas9 mRNA are premixed and injected into the cytoplasm or nucleus of the mouse fertilized eggs using a microinjector. Microinjection of fertilized eggs was performed according to the method in the "Mouse Embryo Manipulation Experiment Manual (3rd Edition)" (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs were transferred to culture medium for a short period of culture and then transplanted into the oviduct of the recipient mother mouse for development. The obtained mice (F0 generation) were expanded through hybridization and self-pollination to establish a stable CFB gene humanized mouse strain.

[0288] The somatic cell genotype of F1 generation mice can be identified by PCR (primers are shown in Table 6). The identification results of exemplary F1 generation mice are shown in FIG6 . All 14 mice numbered F1-01 to F1-14 are positive mice.

[0289] Table 6: F1 generation genotype PCR detection primer sequences and recombinant fragment sizes

[0290] Southern blot analysis was performed on F1 generation PCR-positive mice to confirm the presence of random insertions. Genomic DNA was extracted from the mouse tails and digested with either BglII or ScaI, transferred to a membrane, and hybridized. The 5' probe (5'Probe) and 3' probe (A Probe (3')) were located on the 5' homology arm and on the human CFB genomic fragment, respectively. The specific probes and target fragment lengths are shown in Table 7. Exemplary results are shown in Figure 7. Combined with the PCR and sequencing results, eight mice numbered F1-03, F1-08, and F1-14 were positive. This demonstrates that this method can be used to construct CFB gene-humanized mice that can be stably propagated and free of random insertions.

[0291] Table 7: Specific probe and target fragment lengths

[0292] 5'Probe-F (SEQ ID NO: 27): 5'-GCTCACTGCTTCCATGACATTCAG-3',

[0293] 5'Probe-R (SEQ ID NO: 28): 5'-GGGTTCAGGCACCTGGCATGGGTGG-3';

[0294] A Probe(3')-F (SEQ ID NO: 29): 5'-CTGGGGAGATGCCAAGTGGTCAGC-3',

[0295] A Probe(3')-R (SEQ ID NO: 30): 5'-AGCTGATTACACCAACCTGCAGA-3';

[0296] RT-PCR can be used to detect mRNA expression in humanized CFB gene mice. Specifically, one 8-week-old male C57BL / 6 mouse (+ / +) and one 8-week-old male homozygous humanized CFB gene mouse (H / H) prepared in this example were selected, euthanized by cervical dislocation, and liver tissue was obtained. RT-PCR was performed using the primer sequences shown in Table 8. The test results are shown in Figure 8. As can be seen from the figure, only mouse CFB mRNA was detected in wild-type C57BL / 6 mice, and no human CFB mRNA was detected; only human CFB mRNA was detected in mice homozygous for the humanized CFB gene.

[0297] Table 8: RT-PCR primer sequences and target fragment sizes

[0298] In addition, the expression of human CFB protein in CFB humanized mice can be detected by conventional methods such as ELISA.

[0299] Five 8-week-old male C57BL / 6 mice (+ / +) and five 8-week-old male homozygous humanized CFB mice (H / H) prepared in this example were selected. Serum was collected and assayed using a human Factor B ELISA kit (Abcam, Catalog No. ab137973, detection range: 2.188 ng / ml-140 ng / ml). The results are shown in Figure 9. Combined with the above RT-PCR results, this demonstrates that human CFB protein can be successfully expressed in mice homozygous for the humanized CFB gene.

[0300] Example 2: Functional testing of CFB humanized mice

[0301] The complement factor B encoded by the CFB gene is a component of the alternative pathway of complement activation. Complement factor B circulates in the blood as a single-chain polypeptide. After activation of the alternative pathway, it can be cleaved by complement factor D to produce the non-catalytic chain Ba (also known as Fba) and the catalytic subunit Bb. Furthermore, the expression of human Ba ​​protein in the CFB humanized mice prepared in Example 1 was detected by ELISA. Specifically, the humanized homozygotes of the CFB gene (H / H) were selected, serum was taken, and the human-mouse cross ELISA kit (Ba ELISA kit, QuidelOrtho, product number A033) was used for detection. The test results are shown in Figure 12.

[0302] As can be seen in Figure 12, when the Ba ELISA kit was used, Ba protein was detected in all CFB humanized homozygous mice. This indicates that human CFB protein can be cleaved by CFD to produce Ba fragments in CFB humanized homozygous mice, and the CFB signaling pathway in these mice is normal.

[0303] In another experiment, six 7-week-old male wild-type C57BL / 6 mice (+ / +) and six homozygous CFB humanized mice (H / H) were selected, and peripheral blood was collected for biochemical analysis. Blood biochemical parameters included urea (UREA), serum creatinine (CREA), and total protein (TP). The results are shown in Table 9. The results showed that humanization of the CFB gene did not affect the levels of UREA, CREA, and TP in the mice, and the transformed mice maintained renal function similar to wild-type mice.

[0304] Table 9: Blood biochemical test results

[0305] In addition, three 7-week-old male wild-type C57BL / 6 mice (+ / +) and three homozygous CFB humanized mice (H / H) were selected and euthanized by cervical dislocation. Kidney tissue was collected and analyzed by HE staining. As shown in Figure 13, no kidney damage was observed in either the G1 (C57BL / 6 mice) or G2 (homozygous CFB humanized mice) groups, indicating that humanization of the CFB gene does not affect the mice's kidney health.

[0306] In addition, the hemolytic activity of the complement activation alternative pathway of CFB humanized mice can also be measured (OD415 when hemolysis occurs). Specifically, three male CFB humanized homozygous mice (H / H) were selected, euthanized by cervical dislocation, and serum was collected. Rabbit red blood cell separation fluid was added and mixed together, and then divided into four groups. The control group (Nc) was added with an equal volume of H2O or PBS, and the experimental groups were added with human C3b protein (71.4ug / mL) or human C3b protein (71.4ug / mL) + C5 protein (107ug / mL), and the OD415 value was read on a spectrophotometer to measure the complement alternative pathway activity of the mouse serum. In another similar experiment, serum from homozygous humanized CFB mice was collected and divided into three groups. The control group (Nc) was supplemented with equal volumes of H2O or PBS, and the experimental groups were supplemented with human C3b protein (71.4ug / mL) + C5 protein (107ug / mL), or human C3 protein (143ug / mL) + human C5 protein (107ug / mL). The OD415 value was read on a spectrophotometer to determine the activity of the mouse serum alternative complement pathway.

[0307] The results are shown in Figures 14A and 14B. Compared with the control group, the addition of human C3b+C5 and C3+C5 recombinant proteins can rescue the alternative pathway.

[0308] The activity of the alternative pathway of complement activation in humanized CFB mice (homozygous H / H) was assessed using an alternative pathway ELISA kit (Hycult Biotech, Cat. No. HIT422). Specifically, 5-6 week-old humanized CFB male mice were euthanized by cervical dislocation, and serum was collected. The mice were then divided into seven groups. C3b, C3, C5, C3b + C5, or C3 + C5 recombinant proteins were added to the serum, and the alternative pathway ELISA kit was used to detect the activity of complement activation in response to the addition of different components. The results in Figure 15 show that the addition of C3b + C5 and C3 + C5 can rescue the activity of the alternative pathway of complement.

[0309] Humanized CFB mice (8-week-old, male, homozygous H / H) were randomly divided into a control group or a treatment group (n=3 / group). On the day of grouping (day 0), the treatment group was randomly injected subcutaneously with 1 mpk (G2) or 3 mpk (G3) of a siRNA drug (sense: SEQ ID NO: 58, linked to the 3' end of N-[tris(GalNAc-alkyl)-amidodecanoyl]-4-hydroxyprolinol; antisense: SEQ ID NO: 59). The control group (G1) was injected subcutaneously with an equal volume of PBS solvent. On day 7 after grouping, liver tissue and plasma were collected from mice for analysis of human CFB mRNA and protein levels. The results showed that the plasma protein concentration of human CFB in the treatment groups (G2 and G3) was significantly decreased compared to the control group (G1) (Figure 16A). The mRNA level of human CFB in the liver tissue of the treatment groups (G2 and G3) was also significantly decreased (Figure 16B), and there was a dose-dependent decrease. This indicates that humanized CFB mice can be used for preclinical drug screening of small nucleic acid drugs.

[0310] SEQ ID NO: 58: sense (5'-3')

[0311] Gm-s-Am-s-Am-Um-Um-Cm-Cm-Um-Gf-Af-Af-Um-Um-Um-Um-Am-Um-Gm-Am-Cm-Um

[0312] SEQ ID NO: 59: antisense(5'-3')

[0313] Am-s-dG-s-Um-Cm-dA-Um-dA-Am-Am-Am-Um-dT-Cm-Af-Gm-Gm-Am-Am-Um-Um-Cm-s-Cm-s-Um wherein m is 2'-O-methyl, s is phosphorothioate linkage, f is 2'-fluoro modification, dG is 2'-deoxyguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, and dT is 2'-deoxythymidine-3'-phosphate.

[0314] Example 3 Method 2 for constructing CFB gene humanized mice

[0315] Mouse CFB gene (NCBI Gene ID: 14962, Primary source: MGI: 105975, UniProt ID: B8JJM5, located at positions 35075350 to 5081492 of chromosome 17 NC_000083.7, based on transcript NM_008198.3 and its encoded protein NP_032224.2 (SEQ ID NO: 1)) and human CFB gene (NCBI Gene ID: 629, Primary source: HGNC: 1037, UniProt ID: P00751-1, located at positions 31946095 to 31952084 of chromosome 6 NC_000006.12, based on transcript NM_001710.6 and its encoded protein NP_001701.2 (SEQ ID NO: 2)).

[0316] In addition, in order to achieve the purpose of the present invention, the portion from mouse exon 1 to exon 17 (approximately 5.4 kb) can be further replaced with the approximately 13.0 kb nucleotide sequence from the 5'UTR upstream nucleotide sequence to the 3'UTR downstream nucleotide sequence of the human CFB gene to obtain a schematic diagram of the humanized CFB locus as shown in Figure 17, thereby realizing the humanization transformation of the mouse CFB gene.

[0317] Based on Figure 17 , a targeting strategy was further designed as shown in Figure 18 . The targeting vector V3 (see Figure 18 ) contains upstream and downstream homology arm sequences for the mouse CFB gene, as well as an A3 segment containing the human CFB segment. The upstream 5' homology arm sequence (SEQ ID NO: 37) is identical to nucleotides 35081039 to 35084904 of NCBI Accession No. NC_000083.7, and the downstream 3' homology arm sequence (SEQ ID NO: 38) is identical to nucleotides 35071591 to 35075667 of NCBI Accession No. NC_000083.7. The nucleotide sequence of the human CFB gene fragment (SEQ ID NO: 39) is identical to the nucleotide sequence from positions 31940095 to 31953084 of NCBI accession number NC_000006.12; the upstream linker of the human CFB fragment sequence to the mouse is designed as: 5'-TGACAATGGAGAGCCCCCAGCTCTGCCTCGTCCTCTTGGTCTTAGGCTT TTATTTTTAATCAACAGCTTTAGACAGAGAACCTTGGTTT-3' (SEQ ID NO: 41), wherein the last "T" in the sequence "GGCTT" is the last nucleotide of the mouse, the sequence The first "A" in the sequence is the first nucleotide of the human sequence. The downstream connection of the human CFB fragment sequence and the mouse sequence is designed as: 5'-GATCTCTGTGCCTCAACACTGCTGGCTACTCCCTCTTTCTC TCCTATTCTCTAGAAAGTATAGGAACTTCAGGTCTGAAGA-3' (SEQ ID NO: 42), wherein the last "C" in the sequence "TTCTC" is the last nucleotide of the human sequence, and the sequence The first "G" in is the first nucleotide of the mouse sequence.

[0318] The targeting vector also contains a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo. Two site-specific recombination system Frt recombination sites are arranged in the same direction on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the human CFB gene is designed as: 5'-CCATCCTGTGATCTCTGTGCCTCAACACTGCTGGCTACTCCCTCTTTCTC TCCTATTCTCTAGAAAGTATAGGAACTTCA-3' (SEQ ID NO: 43), wherein the last "C" in the sequence "TTTCTC" is the last nucleotide of the human CFB gene, and the sequence The first "G" in the Neo box is the first nucleotide; the connection between the 3' end of the Neo box and the mouse CFB gene is designed as: 5'-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC GACAGGGGGAGCTAGGCTCCCAGTGCACTTCTTTAG-3' (SEQ ID NO: 44), wherein the last "C" in the sequence "ACTTC" is the last nucleotide of the Neo box, and the sequence The "C" in the expression vector is the first nucleotide of the mouse CFB gene. The mRNA sequence of the modified humanized mouse CFB is shown in SEQ ID NO: 40, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0319] Targeting vector construction can be performed using conventional methods, such as enzyme digestion and ligation. After preliminary verification of the constructed targeting vector by enzyme digestion, it is sent to a sequencing company for sequencing verification. The sequencing-verified targeting vector is electroporated and transfected into embryonic stem cells of C57BL / 6 mice. The resulting cells are screened using a positive clone screening marker gene to identify the correct positive clone cells. The screened correct positive clone cells (black mice) are introduced into isolated blastocysts (white mice) according to techniques known in the art. The resulting chimeric blastocysts are transferred to culture medium for a short period of time and then transplanted into the oviducts of recipient female mice (white mice), producing F0 generation chimeric mice (black and white). F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice. F1 generation heterozygous mice are then mated with each other to obtain F2 generation homozygous mice. Alternatively, positive mice can be mated with Flp tool mice to remove the positive clone screening marker gene, and then mated with each other to obtain CFB gene homozygous mice.

[0320] In addition, CRISPR / Cas9 technology can be used for gene editing. A targeting vector, V4 (see Figure 19), was further designed. This vector contains upstream and downstream homology arm sequences for the mouse CFB gene, as well as the human CFB fragment. A schematic diagram of the constructed humanized CFB locus is shown in Figure 17. The upstream 5' homology arm sequence (SEQ ID NO: 45) is identical to nucleotides 35081039 to 35082302 of NCBI Accession No. NC_000083.7, and the downstream 3' homology arm sequence (SEQ ID NO: 46) is identical to nucleotides 35074350 to 35075667 of NCBI Accession No. NC_000083.7. The nucleotide sequence of the human CFB fragment (SEQ ID NO: 39) is identical to nucleotides 31940095 to 31953084 of NCBI Accession No. NC_000006.12. The mRNA sequence of the transformed humanized CFB mouse is shown in SEQ ID NO: 40, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0321] Targeting vector construction can be performed using conventional methods, such as enzyme digestion, ligation, and direct synthesis. After initial verification of the constructed targeting vector through enzyme digestion, it is sent to a sequencing company for sequencing verification. Targeting vectors that have been verified to be correct by sequencing are used in subsequent experiments.

[0322] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are prerequisites for constructing sgRNA expression vectors. Design and synthesize the sgRNA sequence that recognizes the target site. The target sequence of the exemplary sgRNA on the CFB gene is as follows:

[0323] sgRNA3 target site (SEQ ID NO: 47): 5'-TGCAGGTTCGAGTCTGCACGGGG-3';

[0324] sgRNA4 target site (SEQ ID NO: 48): 5'-TCTTCTACAGGAGATTCCGGGGG-3';

[0325] The activity of sgRNA was detected using a UCA kit. After confirming that it could mediate efficient cleavage efficiency, enzyme cleavage sites were added to its 5' end and complementary chain, respectively, to obtain forward oligonucleotide and reverse oligonucleotide sequences as shown in Table 10. After annealing, the annealed products were ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) to obtain expression vectors pT7-CFB-1 and pT7-CFB-2.

[0326] Table 10: Sequence list of sgRNA3 and sgRNA4

[0327] The pT7-sgRNA vector is synthesized by a plasmid synthesis company. The fragment DNA containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 23) is then digested with EcoRI and BamHI and ligated to a backbone vector (source: Takara, Cat. No. 3299). Sequencing verification by a professional sequencing company indicates that the target plasmid has been obtained. Pronuclear fertilized eggs of mice, such as C57BL / 6 mice, are taken. In vitro transcription products of the pT7-CFB-3 and pT7-CFB-4 plasmids (transcribed using the Ambion in vitro transcription kit according to the instructions), the targeting vector, and Cas9 mRNA are premixed and injected into the cytoplasm or nucleus of the mouse fertilized eggs using a microinjector. Microinjection of fertilized eggs was performed according to the method in the "Mouse Embryo Manipulation Experiment Manual (3rd Edition)" (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs were transferred to culture medium for a short period of culture and then transplanted into the oviduct of the recipient mother mouse for development. The obtained mice (F0 generation) were expanded through hybridization and self-pollination to establish a stable CFB gene humanized mouse strain.

[0328] Example 4 Pharmacodynamic Model

[0329] The humanized CFB mice produced using this method can be used to evaluate the efficacy of modulators targeting human CFB. For example, homozygous humanized CFB mice were randomly divided into a control group and a treatment group. On day 0 after grouping, the treatment group was injected with a drug targeting human CFB, while the control group was injected with an equal volume of PBS. Peripheral blood was collected on day 14 after administration, and the expression of human CFB protein in the mouse serum was measured. On day 14, the mice were euthanized, and liver tissue was obtained to measure mRNA expression levels in the mouse liver. The mice were weighed regularly throughout the experiment. The safety and in vivo efficacy of the drug in the humanized CFB mice can be effectively assessed using the mouse weight data and the expression of human CFB protein in the mice.

[0330] Example 5 Preparation of double-gene or multi-gene humanized mice

[0331] The CFB gene-humanized mice produced by this method can also be used to create multi-humanized mouse models. For example, in Example 1 above, the embryonic stem cells used for microinjection can be derived from mice modified for genes such as CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1, and CTLA4. Alternatively, based on humanized CFB mice, double-humanized or multi-humanized mouse models can be obtained by isolating mouse ES embryonic stem cells and using gene recombination targeting technology. Homozygous or heterozygous CFB mice obtained by this method can also be mated with other genetically modified mice, and the offspring screened. According to Mendelian inheritance, there is a certain probability of obtaining multi-gene mice modified with the humanized CFB gene and other genes. Homozygous mice with double or multiple genetic modifications can then be mated with heterozygous mice. The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0332] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations. In addition, the various different embodiments of the present invention can also be arbitrarily combined, as long as they do not violate the concept of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A genetically modified non-human animal, characterized in that The genome of the non-human animal comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric complement factor B (CFB) protein.

2. The non-human animal according to claim 1, characterized in that The expression of the nucleotide sequence encoding the human or chimeric CFB protein is regulated by a regulatory element, and the regulatory element is an endogenous regulatory element or a human regulatory element.

3. The non-human animal according to claim 1, characterized in that The chimeric CFB protein is a humanized CFB protein, and the humanized CFB protein includes a portion of a human CFB protein; preferably, the portion of the human CFB protein includes the Ba region and / or the Bb region; Further preferably, the Bb region includes a VWA domain; more preferably, it also includes von Willebrand factor and / or peptidase S1.

4. The non-human animal according to claim 3, characterized in that The humanized CFB protein comprises a continuous amino acid sequence of at least 50 to 764 amino acids that is identical to a portion of the human CFB protein.

5. The non-human animal according to any one of claims 1 to 4, characterized in that: The non-human animal is a mammal, such as a monkey or a rodent (eg, a mouse or a rat).

6. The non-human animal according to any one of claims 1 to 5, characterized in that: The human or chimeric CFB protein comprises SEQ ID NO: 2 or positions 26-764 thereof, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% homologous to SEQ ID NO: 2 or positions 26-764 thereof, or comprises an amino acid sequence that differs from SEQ ID NO: 2 or positions 26-764 thereof by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid, or comprises a substitution, deletion and / or insertion of one or more amino acids as shown in SEQ ID NO: 2 or positions 26-764 thereof.

7. The non-human animal according to any one of claims 1 to 6, characterized in that: The non-human animal does not express endogenous CFB protein or the expression level is reduced compared to CFB in wild-type animals.

8. A genetically modified non-human animal, characterized in that: At the endogenous CFB locus of the non-human animal, the endogenous CFB gene is replaced with a nucleotide sequence comprising human CFB.

9. The non-human animal according to claim 8, characterized in that The expression of the nucleotide sequence of human CFB is regulated by a regulatory element, and the regulatory element is an endogenous regulatory element or a human regulatory element; Preferably, one or more cells of the non-human animal express a human or chimeric CFB protein.

10. The non-human animal according to claim 8, characterized in that The endogenous CFB protein of the non-human animal is not expressed or is expressed at a reduced level compared to CFB in wild-type animals.

11. The non-human animal according to any one of claims 8 to 10, characterized in that: The nucleotide sequence of human CFB includes part of exon 1 to part of exon 18 of the human CFB gene; preferably, it includes the nucleotide sequence of the coding region of the human CFB gene; further preferably, it includes the nucleotide sequence from the start codon to the stop codon of the human CFB gene.

12. The non-human animal according to claim 11, characterized in that The nucleotide sequence of human CFB also includes 5'UTR and / or 3'UTR of human CFB, and further includes at least 50 bp continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp continuous nucleotides downstream of the 3'UTR of human CFB.

13. The non-human animal according to any one of claims 8 to 12, characterized in that: The nucleotide sequence of human CFB includes 5'UTR of human CFB and at least 50bp continuous nucleotides upstream of it, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and 3'UTR of human CFB and at least 50bp continuous nucleotides downstream of it.

14. The non-human animal according to any one of claims 8 to 13, characterized in that: The nucleotide sequence of human CFB comprises the nucleotide sequence of SEQ ID NO: 7 or 39, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% homologous to SEQ ID NO: 7 or 39, or comprises a nucleotide sequence that differs from SEQ ID NO: 7 or 39 by no more than 50, 40, 30, 20, 10, 9, 6, 3 or 1 bp nucleotides, or comprises a nucleotide sequence that substitutes, deletes and / or inserts one or more nucleotides as shown in SEQ ID NO: 7 or 39.

15. The non-human animal according to any one of claims 8 to 14, characterized in that: Exon 2 to exon 17 of the endogenous CFB gene are replaced; preferably, the replaced endogenous CFB gene also includes part of exon 1, all of intron 1 and / or part of intron 17; further preferably, the replaced endogenous CFB gene also includes part of exon 18.

16. The non-human animal according to any one of claims 8 to 15, characterized in that: The nucleotide sequence from the start codon to the stop codon of the endogenous CFB gene is replaced, or a portion of exon 1 to a portion of intron 17 of the endogenous CFB gene is replaced, wherein the portion of exon 1 includes up to 70 nucleotides from the 3' end of exon 1.

17. The non-human animal according to any one of claims 8 to 16, characterized in that: The non-human animal is a mammal, such as a monkey or a rodent (eg, a mouse or a rat).

18. The non-human animal according to any one of claims 8 to 17, characterized in that: The mRNA transcribed from the nucleotide sequence after endogenous CFB modification in the genome of the non-human animal comprises SEQ ID NO: 8 or 40, or comprises a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 95% or 99% homology to SEQ ID NO: 8 or 40, or comprises a nucleotide sequence that differs from SEQ ID NO: 8 or 40 by no more than 50, 40, 30, 20, 10, 9, 6, 3 or 1 bp nucleotides, or comprises a nucleotide sequence that replaces, deletes and / or inserts one or more nucleotides as shown in SEQ ID NO: 8 or 40.

19. The non-human animal according to any one of claims 1 to 18, characterized in that: The modified CFB gene in the genome of the non-human animal is homozygous or heterozygous for the endogenous replaced locus.

20. The non-human animal according to any one of claims 1 to 19, characterized in that: The human or chimeric CFB protein expressed by the non-human animal has at least one CFB activity, such as a non-human animal CFB activity and / or a human CFB activity.

21. The non-human animal according to any one of claims 1 to 20, characterized in that: The non-human animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, and the human or chimeric proteins are selected from at least one of CFD, C3, C5, C5AR1, ANGPTL3, IL36R, IGF1R, TSLP, TLR8, OX40, PD-1, PD-L1 and CTLA4.

22. A non-human animal genome, characterized in that The non-human animal genome comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric complement factor B (CFB) protein.

23. The non-human animal genome according to claim 22, characterized in that At the endogenous CFB locus of the non-human animal, the endogenous CFB gene is replaced with a nucleotide sequence comprising human CFB.

24. The non-human animal genome according to claim 23, characterized in that The nucleotide sequence of human CFB includes part of exon 1 to part of exon 18 of the human CFB gene; preferably, it includes the nucleotide sequence of the coding region of the human CFB gene; further preferably, it includes the nucleotide sequence from the start codon to the stop codon of the human CFB gene.

25. The non-human animal genome according to claim 24, characterized in that The nucleotide sequence of human CFB also includes 5'UTR and / or 3'UTR of human CFB, and further includes at least 50 bp continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp continuous nucleotides downstream of the 3'UTR of human CFB.

26. The non-human animal genome according to claim 23, characterized in that The nucleotide sequence of human CFB includes 5'UTR of human CFB and at least 50bp continuous nucleotides upstream of it, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and 3'UTR of human CFB and at least 50bp continuous nucleotides downstream of it.

27. The non-human animal genome according to any one of claims 23-26, characterized in that: Exon 2 to exon 17 of the endogenous CFB gene are replaced; preferably, the replaced endogenous CFB gene also includes part of exon 1, all of intron 1 and / or part of intron 17; further preferably, the replaced endogenous CFB gene also includes part of exon 18.

28. The non-human animal genome according to claim 27, characterized in that The nucleotide sequence from the start codon to the stop codon of the endogenous CFB gene is replaced, or a portion of exon 1 to a portion of intron 17 of the endogenous CFB gene is replaced, wherein the portion of exon 1 includes up to 70 nucleotides from the 3' end of exon 1.

29. A method for constructing a genetically modified non-human animal, characterized in that: At the non-human animal endogenous CFB locus in at least one cell of the non-human animal, the endogenous CFB gene is replaced with a nucleotide sequence comprising human CFB.

30. The construction method according to claim 29, characterized in that: The nucleotide sequence of human CFB includes part of exon 1 to part of exon 18 of the human CFB gene; preferably, it includes the nucleotide sequence of the coding region of the human CFB gene; further preferably, it includes the nucleotide sequence from the start codon to the stop codon of the human CFB gene.

31. The construction method according to claim 30, characterized in that: The nucleotide sequence of human CFB also includes 5'UTR and / or 3'UTR of human CFB, and further includes at least 50 bp continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp continuous nucleotides downstream of the 3'UTR of human CFB.

32. The construction method according to any one of claims 29 to 31, characterized in that: The nucleotide sequence of human CFB includes 5'UTR of human CFB and at least 50bp continuous nucleotides upstream of it, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and 3'UTR of human CFB and at least 50bp continuous nucleotides downstream of it.

33. A method for constructing a genetically modified non-human animal cell that expresses a human or chimeric CFB protein, the construction method comprising replacing the endogenous CFB gene with a nucleotide sequence of human CFB at the endogenous CFB locus of the non-human animal.

34. The construction method according to claim 33, characterized in that: The nucleotide sequence of human CFB includes part of exon 1 to part of exon 18 of the human CFB gene; preferably, it includes the nucleotide sequence of the coding region of the human CFB gene; further preferably, it includes the nucleotide sequence from the start codon to the stop codon of the human CFB gene.

35. The construction method according to claim 34, characterized in that: The nucleotide sequence of human CFB also includes the 5'UTR and / or 3'UTR of human CFB, and further includes at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp of continuous nucleotides downstream of the 3'UTR of human CFB; Preferably, the nucleotide sequence of human CFB includes the 5'UTR of human CFB and at least 50bp continuous nucleotides upstream thereof, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50bp continuous nucleotides downstream thereof.

36. The construction method according to any one of claims 33 to 35, characterized in that: The expression of the nucleotide sequence of human CFB is regulated by a regulatory element, and the regulatory element is an endogenous regulatory element or a human regulatory element.

37. A humanized CFB gene, characterized in that: The humanized CFB gene comprises any of the following nucleotide sequences: A) a nucleotide sequence encoding SEQ ID NO: 2 or positions 26-764 thereof; B) SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46; C) a nucleotide sequence that is at least 90% homologous to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46; D) a nucleotide sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to SEQ ID NO:3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 37, 38, 39, 40, 41, 42, 43, 44, 45 or 46.

38. A cell, tissue or organ, characterized in that: The cell, tissue or organ contains the humanized CFB gene of claim 37.

39. An animal model, characterized in that The animal model comprises the humanized CFB gene of claim 37 or the cell, tissue or organ of claim 38.

40. A targeting vector, characterized in that The targeting vector comprises a 5' arm, a donor region and a 3' arm, wherein the 5' arm is homologous to the 5' end of the region to be changed, the 3' arm is homologous to the 3' end of the region to be changed, and the donor region comprises a nucleotide sequence encoding a human or chimeric CFB protein.

41. The targeting vector according to claim 40, characterized in that The region to be changed is located at the endogenous CFB locus of the non-human animal; preferably, the region to be changed includes at least one exon or at least one intron of the endogenous CFB gene of the non-human animal, for example, part of exon 1 to part of intron 17 of the endogenous CFB gene, or part of exon 1 to part of exon 18.

42. The targeting vector according to claim 40, characterized in that The donor region includes a portion of exon 1 to a portion of exon 18 of the human CFB gene; preferably, it contains the nucleotide sequence of the coding region of the human CFB gene; more preferably, it contains the nucleotide sequence from the start codon to the stop codon of the human CFB gene.

43. The targeting vector according to claim 42, characterized in that The donor region also comprises the 5'UTR and / or 3'UTR of human CFB, and further comprises at least 50 bp of continuous nucleotides upstream of the 5'UTR of human CFB and / or at least 50 bp of continuous nucleotides downstream of the 3'UTR of human CFB; Preferably, the donor region includes the 5'UTR of human CFB and at least 50 bp of continuous nucleotides upstream thereof, the nucleotide sequence from the start codon to the stop codon of the human CFB gene, and the 3'UTR of human CFB and at least 50 bp of continuous nucleotides downstream thereof.

44. A use of the non-human animal according to any one of claims 1-21, the non-human animal genome according to any one of claims 22-28, the non-human animal obtained by the construction method according to any one of claims 29-32, the cell obtained by the construction method according to any one of claims 33-36, the humanized CFB gene according to claim 37, the cell, tissue or organ according to claim 38, the animal model according to claim 39 or the targeting vector according to any one of claims 40-43, characterized in that: The application includes: A) Applications in product development involving human cells for CFB-related immune processes; B) Application as a CFB-related model system for pharmacology, immunology, microbiology, and medical research; C) applications involving the production and use of animal experimental disease models for the study of the etiology of CFB and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies; D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human CFB signaling pathway modulators; or, E) Study the function of CFB gene, study the drugs and efficacy targeting human CFB target sites, and study the application of drugs in inflammation and immune-related diseases related to CFB.

45. A method for determining the effectiveness of a CFB therapeutic agent in treating a disease, characterized in that: The method comprises: 1) administering a CFB therapeutic agent to the non-human animal according to any one of claims 1 to 21, the non-human animal obtained by the construction method according to any one of claims 29 to 32, or the animal model according to claim 39, wherein the non-human animal suffers from a disease; 2) Determine the therapeutic effect of CFB therapeutic agents on diseases; Preferably, the disease is an immune disease, inflammation or tumor.

46. ​​The method according to claim 45, characterized in that The immune disease is one or more of age-related macular degeneration (AMD), rheumatoid arthritis, colitis (including ulcerative colitis or Crohn's disease, such as perianal Crohn's disease), rheumatism, multiple sclerosis, Parkinson's disease, asthma, myasthenia gravis or complement disease.

47. The method according to claim 45, characterized in that The inflammation includes one or more of IgA nephropathy, C3 glomerulopathy, glomerulonephritis, degenerative inflammation, exudative inflammation (such as serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation or catarrhal inflammation), proliferative inflammation or specific inflammation (such as tuberculosis, syphilis, leprosy or lymphogranuloma).

48. The method according to claim 45, characterized in that The tumor includes solid tumors (eg, breast cancer) or blood cell tumors (eg, lymphocyte tumors, B or T cell tumors), etc.

49. A method for determining the toxicity of a CFB therapeutic agent, characterized in that: The method comprises: 1) administering a CFB therapeutic agent to the non-human animal according to any one of claims 1 to 21, the non-human animal obtained by the construction method according to any one of claims 29 to 32, or the animal model according to claim 39; 2) Determine the effects of CFB therapeutics on non-human animals.

50. The method according to claim 49, characterized in that Determining the effect of the CFB therapeutic agent on the non-human animal involves measuring the body weight or blood test of the non-human animal; preferably, the blood test includes one or more of red blood cell count, hematocrit or hemoglobin content.

Images