PCR method for detecting at least two multi-target nucleic acids with single signal

Abstract

The present invention discloses a PCR method for real-time detection of two target nucleic acids with a single signal. The method of the present invention detects a signal for each target nucleic acid in an annealing step and an extension step among the three steps of PCR including denaturation, annealing step, and extension steps. That is, among the two target nucleic acids, a signal for a first target nucleic acid is detected in an annealing step, and a signal for a second target nucleic acid is detected in an extension step. Each detected signal provides qualitative and / or quantitative information about each of the two target nucleic acids. At this time, the detection signal is the same single signal for both of the two target nucleic acids, which can be detected in one detection channel.

Description

PCR method for detecting two or more multiple target nucleic acids with a single signal

[0001] The present invention relates to a multiplex detection PCR method for detecting two or more target nucleic acids with a single signal.

[0002] Polymerase chain reaction (PCR) is a method of amplifying target nucleic acid (DNA) using DNA polymerase. 6 ~10 10 It is a molecular biological technology that amplifies DNA by multiples, developed by Mullis et al. in 1983, and is used in all fields of life sciences, including medicine, for gene detection, gene isolation, and acquisition.

[0003] Real-time polymerase chain reaction (real-time PCR or quantitative PCR) is a technology that detects target nucleic acids simultaneously with amplification, unlike the technology that analyzes the amplified product by electrophoresis after conventional PCR amplification. This allows for more accurate quantitative analysis by accurately knowing the initial concentration of the target nucleic acid. In addition, since amplification and detection are performed in a sealed reaction tube, the possibility of contamination is low, resulting in high detection accuracy and reliability.

[0004] Real-time polymerase chain reaction uses intercalators such as ethidium bromide, SYBR Green I, EvaGreen to detect amplification products simultaneously with PCR amplification, or uses hydrolyzable probes such as TaqMan probe (U.S. Patent Nos. 5,210,015 and 5,538,848), or uses hybridization probes such as molecular beacon (Tyagi et al, Nature Biotechnology v14 MARCH 1996), HyBeacon (French DJ et al, Mol Cell Probes, 15(6):363-374, 2001), or two hybridization probes each labeled with a donor and an acceptor (Bernad et al, 147-148 Clin Chem 2000; 46), or Labeled primers such as Sunrise primer (US Patent No. 6,117,635), Scorpion primer (US Patent No. 6,326,145), and TSG primer (WO 2011 / 078441) are used. Since intercalators have the property of intercalating into all DNA double strands, melting curve analysis is required after PCR amplification to increase specificity or multiplex detection of target nucleic acids. However, in the case of probe or labeled primer methods, the probe binds to the target nucleic acid in a sequence-specific manner to generate a signal, so not only is the specificity high, but melting curve analysis for multiplex detection of target nucleic acids is not necessarily required.

[0005] Multiple detection of target nucleic acids using real-time polymerase chain reaction in the probe method can simultaneously detect various genes in a single sample with high accuracy, but it requires the use of multiple probes labeled with different signal molecules as many as the number of target nucleic acids, and the ability to distinguish and detect signals generated from such multiple probes.

[0006] Typically, in real-time polymerase chain reaction, signal molecules use fluorescent molecules. However, since the types of available fluorescent molecules are limited by wavelength overlap, that is, only one single fluorescent signal can be detected in one fluorescent detection channel, the number of target nucleic acids that can be detected simultaneously in one reaction tube is limited to 4 to 7.

[0007] To overcome these limitations, attempts have been made to detect two or more target nucleic acids in a single detection channel.

[0008] Melting curve analysis is an analytical method that detects two or more target nucleic acids by measuring changes in fluorescence while increasing or decreasing the temperature after a PCR reaction using primers or hybridizing probes labeled with a single fluorescent molecule. Primers or probes are designed to have unique melting temperatures for each target nucleic acid by adjusting their GC content or length, resulting in a unique melting curve profile for each target nucleic acid.

[0009] However, this melting curve analysis requires designing the probe to have a unique melting temperature depending on the target nucleic acid, and detection of multiple target nucleic acids is possible only through temperature changes after the PCR reaction is completed.

[0010] In contrast, International Publication No. WO 2018 / 050824, entitled "Method for Performing Multiplex PCR," discloses a PCR method capable of real-time detection of up to three target nucleic acids with a single signal by configuring a hydrolyzable probe so that a single fluorescent signal is generated with different intensities depending on the target nucleic acid to be detected at each of the three PCR steps of denaturation, hybridization, and / or extension. However, this method requires data processing, such as increasing or decreasing signal intensity at each step, to accurately quantify the target nucleic acids.

[0011] The present invention also discloses a multiplex detection PCR method capable of real-time detection of two or more target nucleic acids in a single detection channel without requiring data processing such as increase or decrease of signal intensity.

[0012] An object of the present invention is to provide a PCR method for real-time detection of two or more target nucleic acids in a single detection channel.

[0013] Other or specific purposes of the present invention will be presented below.

[0014] The PCR method for real-time detection of two or more target nucleic acids in a single detection channel of the present invention detects signals for each target nucleic acid in the annealing step and the extension step among the three steps of PCR: denaturation, annealing, and extension. That is, among the two target nucleic acids, a signal for a first target nucleic acid is detected in the annealing step, and a signal for a second target nucleic acid is detected in the extension step. Each detected signal provides qualitative and / or quantitative information for each of the two target nucleic acids. At this time, the detection signal is a single signal that is the same for both target nucleic acids, and this can be detected in a single detection channel.

[0015] The method of the present invention is possible by using first and second hybridization probes and one quencher probe, which have a structure in which a signal substance and a quencher substance are separated when bound to a target nucleic acid to generate a signal. The first and second hybridization probes have a melting temperature with respect to their target nucleic acid, such that the first hybridization probe is between the temperature of the annealing step and the temperature of the extension step, and the other second hybridization probe is between the temperature of the extension step and the temperature of the denaturation step. The quencher probe can quench the second hybridization probe, which has a melting temperature between the temperature of the extension step and the temperature of the denaturation step. The melting temperature of the quencher probe with respect to the second hybridization probe is between the temperature of the annealing step and the temperature of the extension step. Therefore, in the annealing step, a signal is generated only by the first hybridization probe, and in the extension step, the quencher probe is separated, so that a signal is generated only by the second hybridization probe.

[0016] The PCR method of the present invention, which enables real-time detection of two target nucleic acids in a single detection channel during a PCR process using a single signal, specifically comprises the following steps (a) to (c):

[0017] (a) A step of preparing a mixture for PCR reaction including (i) to (iv) below in a sample to be detected

[0018] (i) a pair of forward and reverse primers for amplifying a first target nucleic acid, wherein one of the primer pairs sequentially includes a random nucleic acid sequence that is non-complementary to the first target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid sequence that is complementary to the first target nucleic acid,

[0019] A pair of forward and reverse primers for amplifying a second target nucleic acid, wherein one of the primer pairs sequentially comprises a random nucleic acid sequence non-complementary to the second target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the second target nucleic acid;

[0020] (ii) a first hybridization probe having a complementary sequence specific to a first artificial target nucleic acid generated depending on a first target nucleic acid among two or more target nucleic acids, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the artificial target nucleic acid does not bind to the probe, and a melting temperature at which the first hybridization probe dissociates from the artificial target nucleic acid complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, such that in the annealing step, the signal substance and the quencher are separated by binding to the complementary sequence thereof (the first hybridization probe) and a signal is generated, but in the extension step, the signal substance and the quencher are adjacent by dissociating from the complementary sequence thereof (the first hybridization probe) and a structure in which the signal substance and the quencher can be extinguished;

[0021] (iii) a second hybridization probe having a complementary sequence specific to a second artificial target nucleic acid generated depending on a second target nucleic acid among two or more target nucleic acids, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the second artificial target nucleic acid does not bind to the probe, and has a single-stranded sequence extended in the terminal direction from the sequence to which the signal substance is bound, and a melting temperature at which it (the second hybridization probe) dissociates from the second artificial target nucleic acid complementary thereto is between the temperature of the extension step and the temperature of the denaturation step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that the second hybridization probe can maintain a binding state with the second artificial target nucleic acid complementary thereto in the annealing step and the extension step; and

[0022] (iv) A quenching probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the second hybridization probe and quenching the signal substance of the second hybridization probe, wherein when the quenching probe complementarily binds to the second hybridization probe and the single-stranded sequence extended toward the end thereof (the second hybridization probe), the quenching substance of the probe has a structure capable of quenching the signal substance of the second hybridization probe by being adjacent to the signal substance of the second hybridization probe, and the melting temperature at which the quenching probe dissociates from the sequence complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that in the annealing step, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe, but in the extension step, the quenching probe A probe capable of causing a signal to be generated from a second hybridization probe by dissociating from a complementary sequence;

[0023] (b) placing the mixture of step (a) into a single reaction vessel and performing two or more cycles of PCR reaction of denaturation at a relatively high temperature, hybridization at a relatively low temperature, and extension at a relatively medium temperature; and

[0024] (c) a step of simultaneously performing the PCR reaction, detecting the first target nucleic acid by measuring a signal generated from the first hybridization probe in the annealing step, and detecting the second target nucleic acid by measuring a signal generated from the second hybridization probe in the extension step.

[0025] In this specification, the target nucleic acid means an actual target nucleic acid in a sample or an artificial target nucleic acid generated depending on the actual target nucleic acid, depending on the context; however, unless otherwise specifically stated, the target nucleic acid means an actual target nucleic acid in a sample.

[0026] In the PCR method of the present invention, three probes, i.e., first and second hybridization probes and one quencher probe, as shown in Fig. 1 are used.

[0027] Both the first and second hybridization probes have a signal molecule (R) and a quencher (Q), and the signal molecule and the quencher have a structure in which, when the hybridization probe does not bind to a target nucleic acid, they are adjacent to each other and no signal is generated, but when the hybridization probe binds to a target nucleic acid, the signal molecule and the quencher are spaced apart and a signal is generated. The structure may include a random coil structure or a stem-loop structure. Among them, a hybridization probe having a stem-loop structure has a complementary sequence in the loop region that specifically binds to a target nucleic acid.

[0028] Among the hybridization probes, the second hybridization probe has a single-stranded sequence (Extended single strand, ESS) that extends in the terminal direction (i.e., in the opposite direction of the loop structure in the stem-loop structure) from the position where the signal substance is bound.

[0029] The quenching probe is a probe having a quencher to quench the signal of the second hybridization probe, and has a structure that has a sequence complementary to the extended single-stranded sequence (ESS) of the second hybridization probe and can specifically bind thereto. In the quenching probe, the quencher is present at a position where, when the quenching probe complementarily binds to the extended single-stranded sequence (ESS) of the second hybridization probe, the quencher of the quenching probe can quench the signal substance of the second hybridization probe by being adjacent to the signal substance. The quencher of the quenching probe will be located closer to the 3' end or the 3' end of the quenching probe if the signal molecule of the second hybridizable probe is located closer to the 5' end than the 3' end (in this case, the quencher of the second hybridizable probe is located closer to the 3' end or the 3' end), and will be located closer to the 5' end or the 5' end of the quenching probe if the signal molecule of the second hybridizable probe is located closer to the 3' end than the 5' end. Here, the fact that the signal molecule or quencher is located closer to the 5' end or the 3' end means that the signal molecule or quencher exists within the sequence near the 5' end or the 3' end.

[0030] In the first hybridization probe, the melting temperature with respect to its target nucleic acid is between the temperatures of the annealing step and the extension step among the three stages of the PCR reaction: a denaturation step at a relatively high temperature, an annealing step at a relatively low temperature, and an extension step at a relatively medium temperature. For example, if the denaturation step is performed at 92-98°C, the annealing step is performed at 50-60°C, and the extension step is performed at 70-80°C, the melting temperature will be around 65°C.

[0031] When the first hybridization probe has this melting temperature, in the annealing step, the first hybridization probe binds to the target nucleic acid, thereby separating the signal substance and the quencher, and generating a signal. However, in the extension step, the first hybridization probe dissociates from the target nucleic acid and assumes the original stem-loop structure, thereby bringing the signal substance and the quencher into proximity, and the signal is extinguished.

[0032] In contrast, the second hybridization probe has a melting temperature with respect to its target nucleic acid that is between the temperature of the extension step and the temperature of the denaturation step among the three stages of the PCR reaction: the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step. Therefore, the second hybridization probe remains bound to the target nucleic acid in both the annealing step and the extension step, but due to the action of the quenching probe, no signal is generated in the annealing step and only the extension step.

[0033] The quenching probe has a melting temperature relative to its second hybridizable probe that is between the temperature of the annealing step and the temperature of the extension step among the three steps of the PCR reaction, which are a denaturation step at a relatively high temperature, an annealing step at a relatively low temperature, and an extension step at a relatively medium temperature, and thus, as described above, the quenching probe remains bound to the second hybridizable probe in the annealing step to quench the signal of the second hybridizable probe, but dissociates in the extension step to allow a signal to be generated from the second hybridizable probe.

[0034] In addition, the method of the present invention comprises, instead of a primer for amplifying the first or second target nucleic acid, a non-complementary random nucleic acid sequence, a restriction enzyme recognition sequence and a complementary nucleic acid sequence to the first or second target nucleic acid of the above (i),

[0035] A pair of forward and reverse primers complementary to a target nucleic acid are used to amplify the target nucleic acid, and in this case, the production of an artificial target nucleic acid is characterized in that a PTO (Probing and Tagging Oligonucleotide) having an artificial random tag sequence together with a complementary probe sequence for the target nucleic acid is used to generate a PTO fragment, which is an artificial random sequence 5' tag consisting only of an artificial random sequence, and this PTO fragment becomes an artificial target nucleic acid.

[0036] A conceptual diagram of the PCR method of the present invention as described above is illustrated in Fig. 2.

[0037] In this way, in the present invention, when three probes are used, even if a single signal is used during the PCR process, the two target nucleic acids can be detected by detecting the signals for the two target nucleic acids in the annealing step and the extension step, respectively. In this case, the detection signals of the annealing step and the extension step are obtained without interference with each other. That is, the detection signal obtained in the annealing step becomes a detection signal for only the first target nucleic acid among the two target nucleic acids, and the detection signal obtained in the extension step becomes a detection signal for only the second target nucleic acid among the two target nucleic acids. Therefore, since these detection signals are obtained using the same single signal, there is no need for data processing such as addition or subtraction between them, so it is possible to easily check whether or not the two target nucleic acids were detected (qualitative information) and the degree of detection (quantitative information) in the PCR result graph composed of signal intensity and the number of PCR cycles. This is not only very convenient because the performer of the method of the present invention can immediately check whether the target nucleic acid has been detected in the PCR result graph, but in a multiplex real-time PCR method using different types of fluorescent substances, the number of nucleic acids that can be simultaneously detected in a single reaction tube can be increased by up to two times. For example, when five types of fluorescent substances are used in a multiplex real-time PCR method, two types of target nucleic acids can be detected with one fluorescent substance, enabling the simultaneous detection of ten types of target nucleic acids.

[0038] In the present invention, the sequences of the three probes should be designed in consideration of the melting temperature with respect to their complementary target nucleic acid (the quenching probe is the second hybridization probe), etc., and the design of the sequences in consideration of such melting temperature can be achieved by controlling the GC content, sequence length, or a combination thereof. The design of the probe sequences in consideration of such melting temperature can be performed in accordance with the methods known in the art [Unit Evol. Genet. 2005; 5:1-9]; [Afr. Jo. Biotechnol. 2003; 2:91-95], [Methods Mol. Biol. 1993; 15:31-40], [PCR Methods Appl. 1993; 3:S30-S37], [Nucleic Acids Res. 1994; 22:2760-2768], and it may be desirable to utilize commercially available programs such as Visual OMP™ software (DNA Software, Inc, Ann Arbor, Mich) and Oli2go™ software (Nucleic Acids Res. 2018 Jul 2; 46 (Web Server issue): W252-W256).

[0039] In the present invention, the second hybridization probe is in a state of being bound to the target nucleic acid during the extension step, since its melting temperature is between the relatively medium temperature extension step and the relatively high temperature denaturation step, and thus, when the extension reaction (polymerization reaction) proceeds, it can be hydrolyzed like a hydrolyzable probe such as a TaqMan probe by a polymerase (i.e., by the nuclease activity of Taq polymerase or the like). When the second hybridization probe is in a state of being bound to the target nucleic acid during the extension step and then hydrolyzed, a signal is generated like a hydrolyzable probe due to the hydrolysis, and the generated signal is detected together with the signal of the first hybridization probe in the annealing step of the next cycle of the PCR reaction, so there is a problem that the signal of the first hybridization probe does not accurately reflect the detection information (i.e., qualitative and quantitative information) about the first target nucleic acid.

[0040] Therefore, in the present invention, the target nucleic acid to which the second hybridization probe complementarily recognizes and specifically binds must not be the target nucleic acid that is the target of detection in the sample to be actually detected (i.e., the actual target nucleic acid or the second actual target nucleic acid), but must be an artificial target nucleic acid generated depending on such an actual target nucleic acid.

[0041] It is desirable that such artificial target nucleic acids be generated quantitatively dependent on actual target nucleic acids, thereby enabling not only qualitative analysis of the actual target nucleic acids but also quantitative analysis. Various techniques for generating artificial target nucleic acids dependent on actual target nucleic acids are known in the art. As a technology for producing such an artificial target nucleic acid, for example, the C-TAG (Cleavable Tag) technology disclosed in international patent publication WO 2017188669 entitled "METHOD FOR DETECTING TARGET NUCLEIC ACID SEQUENCE USING CLEAVED COMPLEMENTARY TAG FRAGMENT AND COMPOSITION THEREOF" and the PCE-SH (PTO Cleavage and Extension-Dependent Signaling) technology disclosed in international patent publication WO 2013115442 entitled "DETECTION OF TARGET NUCLEIC ACID SEQUENCE BY PTO CLEAVAGE AND EXTENSION-DEPENDENT SIGNALING OLIGONUCLEOTIDE HYBRIDIZATION ASSAY" are disclosed. Examples include Oligonucleotide Hybridization (OLH) technology.

[0042] C-TAG technology is a technology that detects target nucleic acids by amplifying target nucleic acids using primers introduced together with sequences that can be cleaved by a restriction enzyme, and when a tag (C-TAG) complementary to the artificial random sequence is generated by the action of the restriction enzyme along with the amplification of the target nucleic acid, the tag is detected with a hybridization probe or the like. At this time, if the target nucleic acid does not exist, the restriction enzyme does not act, so the tag is not generated. However, if the target nucleic acid exists, the tag is generated in quantitative proportion to it, so qualitative and quantitative detection of the target nucleic acid is possible through tag detection. The tag itself can be detected as a hybridization probe, or if the tag has a shorter sequence length than the hybridization probe, it can act as a primer for the hybridization probe and be extended by an extension reaction like the target nucleic acid, thereby switching the signal of the hybridization probe from signal-off to signal-on, and can be detected. The specific mechanism of operation of the C-TAG technology described above can be found in International Patent Publication No. WO 2017188669. This document, together with all references cited herein, is incorporated herein by reference. A schematic diagram illustrating the mechanism of operation of this C-TAG technology is illustrated in Figure 3.

[0043] PCE-SH technology uses PTO (Probing and Tagging Oligonucleotide) with a complementary probe sequence to the target nucleic acid and an artificial random tag sequence while the 3' end is blocked with HEG (hexaethylene glycol), phosphate group, etc., when amplifying the target nucleic acid, and when there is a bifurcated duplex, the action of Taq polymerase that generates a single-stranded 5' tag by endonuclease activity (Proc Natl Acad Sci US A. 1999 May 25; 96(11): 6143-6148), generates a PTO fragment composed only of an artificial random sequence (i.e., a 5' tag of an artificial random sequence), and this PTO fragment acts as a primer for CTO (Capturing and Templating Oligonucleotide) so that it extends together during the extension reaction of the target nucleic acid, thereby generating a new extension. This is a technology that detects a target nucleic acid by detecting the new extended sequence when a sequence is generated using a hybridization probe, etc. In this case, if the target nucleic acid does not exist, the PTO fragment is not generated, so no new extended sequence is generated. However, if the target nucleic acid exists, the new extended sequence is generated in proportion to the amount of the target nucleic acid, so detecting the new extended sequence enables qualitative and quantitative detection of the target nucleic acid. In addition, in this case, the PTO fragment acts as a primer for the hybridization probe, so that it is extended by the extension reaction like the target nucleic acid, thereby switching the signal of the hybridization probe from signal-off to signal-on, and detection is possible. For the specific operation method of this PCE-SH technology, please refer to international patent publication WO 2013115442.

[0044] In addition to the C-TAG technology or PCE-SH technology described above, examples of technologies for generating artificial target nucleic acids include PTOCE (Probing & Tagging Oligonucleotide Cleavage and Extension) technology (International Patent Publication No. WO 2012096523) and PCE-NH (PTO Cleavage and Extension-Dependent Non-Hybridization) technology (International Application No. PCT / KR2013 / 012312). Similar to the PCE-SH technology, these PTOCE technologies and PCE-NH technologies all use a PTO (Probing and Tagging Oligonucleotide) having an artificial random tag sequence together with a complementary probe sequence for the target nucleic acid, thereby generating a PTO fragment consisting of only an artificial random sequence (i.e., a 5' tag of the artificial random sequence), and a step of extending this fragment using CTO (Capturing and Templating Oligonucleotide) as a template to generate a new sequence, thereby detecting the new sequence. A novel sequence extended from a PTO fragment consisting solely of artificial random sequences becomes an artificial target nucleic acid, which is qualitatively and quantitatively generated depending on the actual target nucleic acid of the sample.

[0045] In the present invention, the artificial target nucleic acid is a nucleic acid of a newly synthesized sequence that is generated only when the target nucleic acid is present in the sample or is generated in proportion to the amount of the target nucleic acid present in the sample. In the C-TAG technology, it refers to a sequence newly generated by extending from the tag using the hybridization probe as a template when the tag or the tag acts as a primer for the hybridization probe. In the PCE-SH technology, it refers to a sequence newly synthesized by extending from the PTO fragment that acts as a primer using the CTO or hybridization probe as a template.

[0046] In the present invention, the second hybridization probe must detect an artificial target nucleic acid generated depending on an actual target nucleic acid as described above, but the first hybridization probe is in a dissociated state with the target nucleic acid during the extension step because its melting temperature with respect to the target nucleic acid is between a relatively low temperature annealing step and a relatively medium temperature extension step, so there is no concern about decomposition during the extension reaction. Therefore, the nucleic acid detected by the first hybridization probe may be either an actual target nucleic acid in the sample or an artificial target nucleic acid generated depending on the actual target nucleic acid.

[0047] In the present invention, the probe is an oligonucleotide for detecting a target nucleic acid (an actual target nucleic acid in a sample or an artificial target nucleic acid), and refers to a nucleic acid or nucleic acid analogue that contains a base sequence complementary to the target nucleic acid and thus has a specific binding ability to the target nucleic acid. The probe may be RNA as well as DNA as long as it has a specific binding ability to the target nucleic acid (when the probe of the present invention is RNA, "T" in the base sequence of the above sequence number is read as "U"), and may also be a nucleic acid analogue such as PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), MNA (Mannitol Nucleic Acids) that is stable to nuclease or heat. The probe may also include modified nucleotides as well as natural nucleotides as long as it has a specific binding ability to the target nucleic acid. Such modified nucleotides may be modified in their sugars, phosphates and / or bases. Nucleotides modified in such sugars, phosphates and / or bases are specifically known in the art, including methods for their preparation. For example, nucleotides modified in sugars include those in which the hydroxyl group (OH group) of the sugar is modified with a halogen group, an aliphatic group, an ether group, an amine group, etc., those in which the sugar ribose or deoxyribose itself is replaced by an α-anomeric sugar, an epimeric sugar such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, etc.Also, for example, modifications in phosphate include modifications of phosphate to P(O)S(thioate), P(S)S(dithioate), P(O)NR2(amidate), P(O)R, P(O)OR', CO or CH2(formacetal). Here, R or R' is H or substituted or unsubstituted alkyl, etc., and when modified in phosphate, the linking group becomes -O-, -N-, -S- or -C-, and adjacent nucleotides are bonded to each other through this linking group.

[0048] The complementary sequence to the target nucleic acid in the probe need not be 100% complementary, but may be at least about 80%, preferably at least about 85%, more preferably at least about 90%, 95% or 99% complementary, as long as it confers specific binding ability to the target nucleic acid.

[0049] In the present invention, a hybridization probe refers to a probe having a complementary sequence to a target nucleic acid and a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid does not bind to the probe. The hybridization probe may have a stem-loop structure. In this case, the complementary sequence to the target nucleic acid is located in the loop region, and the signal substance and the quencher are located within the stem region (intra-stem) or at the end thereof. When the hybridization probe binds to the target nucleic acid, the signal substance and the quencher are separated, thereby generating a signal. Since a fluorescent substance is generally used as the signal substance, such a signal is a fluorescent signal. Various methods are known in the art for labeling a signal substance and a quencher to an oligonucleotide probe or for preparing such a probe, including a direct chemical labeling method via solid-phase synthesis and a two-step chemical labeling method via solid-phase synthesis, and are also described in the literature [Chem. Soc. Rev., 2020, 49, 8749-8773], [ACS Cent. Sci., 2017, 3, 701-707], [Curr. Opin. Biotechnol., 2015, 31, 42-49], [Annual Review of Physiology, ed. D. Julius, 2017, vol. 79, pp. 93-117], etc. Various references are known. For specific information regarding labeling methods, please refer to these references.

[0050] In the present invention, the first hybridization probe may be a molecular beacon.

[0051] In the present invention, the sample to be analyzed may be any mixture or solution that contains or is suspected of containing the target nucleic acid to be detected and thus requires detection. The sample may be a biological sample obtained from a human or animal, as well as a processed sample obtained by processing such a biological sample to increase the concentration of the target nucleic acid. Furthermore, it may be a sample requiring examination, such as water, food, industrial wastewater, etc. that contain or are suspected of containing the target nucleic acid, an environmental pollutant, a toxic agent, an organic material sample obtained from food processing equipment, etc. Such a sample may include an appropriate diluent or buffer solution, and when it is desired to detect the presence of bacteria or viruses, it may be a bacterial culture or viral culture containing a medium or medium components.

[0052] In addition, in the present invention, the sample to be analyzed may preferably be a biological sample obtained from a human or animal or a processed sample thereof. The biological sample may be obtained from a human or animal that contains or is suspected of containing the target nucleic acid to be detected, such as whole blood, serum, plasma, umbilical cord blood, urine, feces, saliva, nasal mucus, semen, amniotic fluid, lavage fluid (bronchoalveolar, stomach, peritoneal, ear, etc.), lymph, sputum, tissue, or cell, and thus has a need for detection. The processed sample may be, for example, plasma, serum, a sample obtained by increasing the concentration of nucleic acid (DNA and / or RNA) from a biological sample using a nucleic acid extraction kit, a tissue extract, cells obtained from a tissue, a cell lysate, a cell culture, a bacterial culture, a virus culture, etc.

[0053] In addition, in the present invention, the target nucleic acid refers to any nucleic acid that can bring about some usefulness, such as diagnosis or prognosis of a disease, confirmation of a biological indicator, and research on its function or properties, etc., by detecting or measuring the presence and / or amount of the target nucleic acid. The target nucleic acid refers to a single-stranded DNA containing a sequence to which a probe (i.e., a first or second hybridization probe) binds, i.e., a sequence complementary to the probe, or a double-stranded DNA to which the single-stranded DNA is bound. This single-stranded or double-stranded DNA may be genomic DNA in a sample, particularly a biological sample, cDNA generated by reverse transcription from RNA such as mRNA, rRNA, or microRNA, or an artificial target nucleic acid as described above, which is composed of an artificial arbitrary sequence generated depending on an actual target nucleic acid.

[0054] The actual target nucleic acid may be a nucleic acid of a prokaryotic cell such as a pathogenic bacterium, a nucleic acid of a eukaryotic cell derived from or isolated from a human, a nucleic acid of a pathogenic virus, or a viroid nucleic acid. Here, pathogenic bacteria include antibiotic-resistant Enterobacteriaceae such as vancomycin or carbapenem, Acinetobacter baumannii that can cause pneumonia or sepsis, Bordetella pertussis that can cause whooping cough, and Klebsiella pneumoniae that can cause pneumonia, and pathogenic viruses include viruses that cause gastrointestinal diseases (Rotavirus A, Astrovirus, Adenovirus F40, Adenovirus F41, Norovirus GⅠ, Norovirus GⅡ, etc.), human papillomavirus, and respiratory disease agents (Influenza A / H1N1, Influenza A / H3N2, Influenza A / H1N1 / 2009pdm, Influenza B, Parainfluenza 1, Parainfluenza 3, Respiratory syncytial virus A, Respiratory syncytial virus B, human metapneumovirus, adenovirus, etc.

[0055] In the present invention, a primer is an oligonucleotide capable of inducing the initiation of synthesis of a target nucleic acid, and is composed of a forward primer and a reverse primer for each target nucleic acid. The primer is designed to specifically bind to the target nucleic acid (the actual target nucleic acid in the sample or an artificial target nucleic acid generated depending on the target nucleic acid) and to have a melting temperature sufficient to maintain binding to the target nucleic acid during the extension reaction of the PCR reaction. The extension reaction is generally performed in the extension step, but this is not necessarily the case. The first hybridization probe may bind to and detect either the actual target nucleic acid or the artificial target nucleic acid in the sample. If the first hybridization probe detects the artificial target nucleic acid, and the artificial target nucleic acid is shorter than the first hybridization probe, it may act as a primer in the annealing step in which it complementarily binds to the first hybridization probe, thereby separating the signal substance and the quencher of the first hybridization probe and causing extension. If the extension reaction for a target nucleic acid occurs in the annealing step, the forward and reverse primers for the target nucleic acid are designed so that their melting temperatures are at least higher than the temperature of the annealing step, and if the extension reaction for a target nucleic acid occurs in the extension step, the forward and reverse primers for the target nucleic acid are designed so that their melting temperatures are at least higher than the temperature of the extension step. This design can usually be achieved by adjusting the length of the primer while making the sequence complementary to the target nucleic acid. For this primer design, reference can be made to the literature [PCR Methods Appl. 1993 Dec;3(3):S30-7], the literature [Biomolecular Detection and Quantification 14 (2017) 19-28], etc., or commercially available software (e.g., Visual OMP, Invitrogen OligoPerfect Designer) can be utilized.

[0056] Primers can have various lengths, but are typically 10 to 50 nucleotides long. Similar to probes, some sequences of the primer can be nucleic acid analogs such as PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), MNA (Mannitol Nucleic Acids), etc., as long as it does not affect the synthesis initiation inducing function of the primer, and can also include modified nucleotides as well as natural nucleotides.

[0057] In the present invention, the mixture for the PCR reaction of the step (a) includes, in addition to the primer set and the three probes described above, four NTPs, DNA polymerase, and other factors, such as Tris-HCl as a pH stabilizer, MgCl2 or MgSO4 or (NH4)2SO4 as a cofactor for promoting enzyme activity, BSA (Bovine Serum Albumin), gelatin, glycerol or PEG 6000 as a factor for stabilizing the enzyme, KCl as a factor for promoting binding of the primer to the target nucleic acid, Tween 20 or Triton X-100 as a nonionic surfactant for suppressing nonspecific amplification, spermidine for reducing nonspecific binding of DNA polymerase to the nucleic acid, urea, DMSO (dimethylsulfoxide) or DMF (dimethylformamide) as a factor for promoting annealing of the primer to the target nucleic acid, Betaine, SDS (Sodium Dodecyl Sulfate) or Triton X-100, which are factors to prevent aggregation of DNA polymerase, may also be included.

[0058] In the present invention, the DNA polymerase uses a thermostable polymerase, and these thermostable polymerases include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga It can be used by directly isolating from various bacterial species such as Pyrococcus neapolitana, Thermosipho africanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus, and Aquifex aeolieus, or by manufacturing it using genetic recombination technology, or by purchasing it as an isolate or manufacture and commercially available product.

[0059] DNA polymerases may be modified. Modified polymerases include those in which some sequences have been artificially modified or naturally modified (mutated). Examples of such modified polymerases include G46E E678G CS5 DNA polymerase, G46E L329A E678G CS5 DNA polymerase, G46E L329A D640G S671F CS5 DNA polymerase, G46E L329A D640G S671F E678G CS5 DNA polymerase, G46E E678G CS6 DNA polymerase, Z05 DNA polymerase, ΔZ05 polymerase, ΔZ05-Gold polymerase, ΔZ05R polymerase, E615G Taq DNA polymerase, E678G TMA-25 polymerase, and E678G TMA-30 polymerase.

[0060] The DNA polymerase is preferably a DNA polymerase with eliminated 5'->3' exonuclease activity. Commercially available polymerases include AptaTaq exo DNA Polymerase (Roche, Switzerland), TopDNA Polymerase (Bioneer, Korea), Vent® (exo-) DNA Polymerase (NEB, USA), Phusion® High-Fidelity DNA Polymerase (NEB, USA), and KlenTaq-1 DNA polymerase (an analog of the Klenow fragment in Taq polymerase).

[0061] In the present invention, the PCR reaction amplifies the template nucleic acid by repeatedly performing three stages: denaturation, annealing, and extension, at least two cycles, typically 15 to 50 cycles. Prior to performing these three cycles, an initial denaturation step may be included. This initial denaturation step is performed to activate DNA polymerase and denature the template DNA. This initial denaturation step may be performed for 30 seconds to 20 minutes, taking into account factors such as the GC content of the template DNA.

[0062] Additionally, a final elongation step may be included after the above three-step reaction. This elongation step is for the DNA polymerase to complete the final elongation reaction, and is typically performed at the same temperature as the three-step elongation step for approximately 1 to 20 minutes.

[0063] For more specific information regarding PCR reactions, see U.S. Patent Nos. 4,683,195, 4,683,202, PCR Protocols: A Guide to Methods and Applications, Innis et al, eds, 1990, BioTechniques 69: 317–325 (October 2020), Front Microbiol. 2017 Feb 2;8:108, J Invest Dermatol. 2013 Mar; 133(3): e6.

[0064] Also, in the present invention, a signal such as a fluorescent signal, a luminescent signal, or a colorimetric signal can be used without any special limitation, but it is preferable to use a fluorescent signal.

[0065] In the present invention, when using a fluorescent signal, any fluorescent material for generating the signal can be appropriately selected and used from among those known in the art, taking into consideration the detection wavelength of each detection channel of the PCR device, etc. Known fluorescent substances include, for example, Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy35™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), TexRed (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy55 (694), HEX (556), TET (536),Examples include Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). The numbers in parentheses are the maximum emission wavelengths in nanometers.

[0066] A quencher is a substance that absorbs and generates heat to extinguish fluorescence emitted by a fluorescent substance when it is adjacent to the fluorescent substance. Many such quenchers are known in the art. Among these known quenchers, one with an appropriate absorption wavelength can be selected and used in consideration of the emission wavelength of the fluorescent substance used. Known quenchers include Dabcyl (453), QSY 35 (475), BHQ-0 (495), Eclipse (530), BHQ-1 (534), QSY 7 (560), QSY 9 (562), BHQ-2 (579), ElleQuencher (630), Iowa Black (651), QSY 21 (661), BHQ-3 (672), etc. The numbers in parentheses are the maximum absorption wavelengths in nanometers.

[0067] In order to accurately detect without unnecessary noise signals, it is necessary to consider quenching efficiency in relation to a suitable pair of fluorescent substances and quenchers. Cy5 / BHQ-2, Cy5 / BHQ-1, TexRed / BHQ-2, TexRed / QSY 7, TexRed / BHQ-1, TexRed / Dabcyl, Cy3 / BHQ2, Cy3 / QSY 7, Cy3 / BHQ-1, Cy3 / Dabcyl, TET / BHQ-2, TET / QSY 7, TET / TAMRA, TET / BHQ-1, FAM / BHQ-2, FAM / QSY 7, FAM / TAMRA, FAM / BHQ-1, FAM / Dabcyl are known to have high quenching efficiency (Nucliec Acids Res. 30, e122, 2002), so it may be desirable to select and use one of these pairs.

[0068] There are numerous references in the art regarding signaling molecules and quenchers and the selection of suitable pairs, and references can be made to such references. Such references include [Methods Mol Biol. 335, 17-29, 2006], [Biotechniques 31, 1106-1121, 2001], [J. Am Chem. Soc. 124, 6950-6956, 2002], [Chem. Eur. J. 9, 3466-3471, 2003], [Nucliec Acids Res. 30, e122, 2002], and [J. Phys. Chem. 100, 5541-5553, 1996].

[0069] In the present invention, a single signal refers to a signal detected through a single detection channel. Therefore, even if two signal generating substances are used, if the signals generated by the two substances are detected in a single detection channel, it is a single signal. For example, if only one fluorescent substance, Cy2™ (506), is used as a signal substance, the fluorescent signal generated by it is naturally a single signal. However, even if two fluorescent substances, Alexa™ (520) and Rhodamine 110 (520), are used as signal substances, if their detection wavelengths are the same and are detected in a single fluorescence detection channel, the signals generated by these two fluorescent substances also become a single signal.

[0070] In the present invention, signal detection is performed in the annealing step and the extension step of the PCR reaction. In the annealing step, the signal of the first hybridization probe, which specifically binds to the first target nucleic acid (the actual target nucleic acid in the sample or an artificial target nucleic acid generated depending on the actual target nucleic acid) and generates a signal by separating the signal substance and the quencher, is detected, thereby detecting the first target nucleic acid. In the extension step, the signal of the second hybridization probe, which specifically binds to the second target nucleic acid (which is an artificial target nucleic acid) and generates a signal by separating the signal substance and the quencher, is detected, thereby detecting the second target nucleic acid. In the extension step, the signal of the second hybridization probe is generated by the dissociation of the quencher probe. Signal detection is typically performed by irradiating the sample with light from a light source (lamp, laser, LED) provided in the PCR device at the end of each step and detecting the light emitted from the sample in a detection channel.

[0071] Signal detection can occur in some or all cycles of the amplification reaction, but it is preferred that it occur in all cycles. When it occurs in all cycles, the detection results for the first target nucleic acid and / or the second target nucleic acid are derived as a PCR result graph consisting of signal intensities and the number of PCR cycles. The PCR result graph can be derived as a single graph showing two amplification curves for the two target nucleic acids, or as separate graphs showing amplification curves for the two target nucleic acids, respectively. If the target nucleic acid to be detected is present and the amplification reaction is performed for sufficient cycles, the PCR result graph will appear as an initiation phase, an exponential phase, and a plateau phase, through which detection information (qualitative and / or quantitative information) for the two target nucleic acids can be easily derived.

[0072] In the present invention, the first and second hybridization probes complementarily bind to the target nucleic acid, thereby generating a signal by separating the signal substance and the quencher. However, if the target nucleic acid is an artificial target nucleic acid and the artificial target nucleic acid is shorter than the hybridization probe, the artificial target nucleic acid may act as a primer for each of the first and second hybridization probes and be extended, thereby separating the signal substance and the quencher of the hybridization probe. In this case, the extension reaction is preferably performed in the annealing step, since the first hybridization probe binds to the target nucleic acid in the annealing step at a relatively low temperature to generate a signal, but dissociates in the extension step at a relatively medium temperature to quench the signal, and the second hybridization probe binds to the target nucleic acid in the annealing step at a relatively low temperature, but the signal is quenched by the quenching probe, and then the quenched signal reappears when the quenching probe dissociates in the extension step at a relatively medium temperature. Taq DNA polymerase is generally known to exhibit optimal activity at the typical extension temperature of 72-75°C, but it is also known to retain sufficient activity to allow the extension reaction to proceed at a sufficient rate at the typical annealing temperature of 50-65°C. If an artificial target nucleic acid acts as a primer and an extension reaction occurs during the annealing step, it is desirable to maintain the annealing step for an appropriate period of time (typically 30 seconds to 2 minutes) to ensure sufficient extension.

[0073] In the present invention, the first target nucleic acid detected by the first hybridization probe in the relatively low-temperature annealing step may be an actual target nucleic acid in the sample or an artificial target nucleic acid generated depending on the target nucleic acid, but the second target nucleic acid detected by the second hybridization probe in the relatively medium-temperature extension step must be an artificial target nucleic acid. If the nucleic acid detected by the second hybridization probe by binding to it is an actual target nucleic acid in the sample, as described above, the hybridization probe may be degraded by the exonuclease activity of DNA polymerase, similar to the TaqMan probe.

[0074] In summary of the above, the nucleic acid detected by the first hybridization probe and the second hybridization probe in the present invention, the detection step thereof, and the step in which the extension reaction of the actual target nucleic acid, etc. is performed can be summarized as follows:

[0075] (1) If the first target nucleic acid detected is an actual target nucleic acid in the sample and not an artificial target nucleic acid.

[0076] The first actual target nucleic acid undergoes an extension reaction in the extension step, and is detected by the first hybridization probe that binds complementarily to the first target nucleic acid in the annealing step of the next cycle.

[0077] The second target nucleic acid detected at this time is an artificial target nucleic acid that is generated dependently on the actual second target nucleic acid in the sample, and this artificial target nucleic acid is generated dependently on the actual second target nucleic acid in the sample as the actual second target nucleic acid in the sample is extended in the extension step, and binds to the second hybridization probe in the annealing step of the next cycle, but the signal is quenched and not detected as the quenching probe binds together with the second hybridization probe, and is then detected as the quenching probe dissociates as the temperature rises in the next step, the extension step.

[0078] (2) If the first target nucleic acid detected is an artificial target nucleic acid generated based on the actual target nucleic acid in the sample.

[0079] The first actual target nucleic acid undergoes an extension reaction in the extension step, and during this extension reaction, an artificial target nucleic acid is generated depending on the first actual target nucleic acid, and is detected by the first hybridization probe that binds complementarily to the first target nucleic acid in the annealing step of the next cycle.

[0080] Detection of the second target nucleic acid is the same as in case (1) above.

[0081] In this case, if the first and second artificial target nucleic acids are shorter than each hybridization probe, they can act as primers using each hybridization probe as a template, and when they act as primers, the extension reaction of the primers is performed in the annealing step.

[0082]

[0083] In another aspect, the present invention relates to a method for detecting a target nucleic acid using the hybridization probe and the quenching probe described above together.

[0084] The method of the present invention specifically comprises (a) a step of mixing a target nucleic acid, a hybridization probe, and a quenching probe to induce binding of the target nucleic acid, the hybridization probe, and the quenching probe, (b) a step of increasing a temperature to induce dissociation of the quenching probe so that a signal is generated from the hybridization probe, and (c) a step of detecting the signal.

[0085] Here, the hybridization probe is a probe having a complementary sequence specific to a target nucleic acid, and the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid is not bound to the probe, and has a single-stranded sequence extending in the terminal direction from the sequence to which the signal substance is bound.

[0086] The above quenching probe is a probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the hybridizable probe and quenching the signal substance of the hybridizable probe, and when the quenching probe complementarily binds to the single-stranded sequence extended toward the end of the hybridizable probe (the second hybridizable probe), the quenching substance of the probe has a structure capable of quenching the signal substance of the hybridizable probe by being adjacent to the signal substance of the hybridizable probe.

[0087] The hybridization probe and the quenching probe are designed so that the melting temperature at which the hybridization probe dissociates from its complementary target nucleic acid is higher than the melting temperature at which the quenching probe dissociates from its complementary hybridization probe.

[0088] Therefore, when the hybridization probe binds to its target nucleic acid, the signal substance and the quencher are separated, but no signal is generated by the quenching probe. However, when the temperature rises and the quenching probe dissociates, the quenching effect by the quenching probe disappears, and a signal is generated from the hybridization probe.

[0089] In addition to the above hybridization probes and quenching probes, by using one or more additional hybridization probes and quenching probes, and having different melting temperatures for each of the quenching probes, detection of two or more target nucleic acids may also be possible. Naturally, for these additional hybridization probes and quenching probes, the hybridization probes and quenching probes are designed such that the melting temperature at which the hybridization probe dissociates from its complementary target nucleic acid is higher than the melting temperature at which the quenching probe dissociates from its complementary hybridization probe. Using these one or more additional hybridization probes and quenching probes can be useful for analyzing melting curves for two multiple target nucleic acids after completion of PCR.

[0090] In the method of the present invention, the target nucleic acid may be an actual target nucleic acid in the sample or an artificial target nucleic acid generated depending thereon.

[0091] In the method of the present invention, the description of the second hybridization probe and the quenching probe in relation to the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention can be applied as is.

[0092] Meanwhile, the method of the present invention can also be applied to a PCR method for real-time detection of a target nucleic acid. This method is similar to the PCR method for real-time detection of two target nucleic acids with a single signal described above, in which only the second hybridization probe and the quenching probe are used, without using the first hybridization probe. When applied to a PCR method for real-time detection of a target nucleic acid, only one target nucleic acid is detected, and for the reasons already described above, the target nucleic acid is preferably an artificial target nucleic acid generated based on the actual target nucleic acid in the sample.

[0093] Specifically, the PCR method of the present invention is configured to include steps (a) to (c) below.

[0094] (a) Step of mixing (i) to (iii) below into the sample to be detected

[0095] (i) a set of forward and reverse primers for amplifying a target nucleic acid;

[0096] (ii) a hybridization probe having a complementary sequence specific to an artificial target nucleic acid generated depending on a target nucleic acid, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid is not bound to the probe, and has a single-stranded sequence extended in the terminal direction from the sequence to which the signal substance is bound, and the melting temperature at which it (the hybridization probe) dissociates from the artificial target nucleic acid complementary thereto is between the temperature of the extension step and the temperature of the denaturation step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that the hybridization probe can maintain a binding state with the artificial target nucleic acid complementary thereto in the annealing step and the extension step; and

[0097] (iii) a quenching probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the hybridizable probe and quenching a signal substance of the hybridizable probe, wherein the quenching probe has a structure in which, when complementarily binding to the hybridizable probe and the single-stranded sequence extended toward the end thereof (the hybridizable probe), the quenching substance of the probe is adjacent to the signal substance of the hybridizable probe and can quench the signal substance of the hybridizable probe, and the melting temperature at which the quenching probe dissociates from the sequence complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of a PCR reaction, such that in the annealing step, the signal of the hybridizable probe can be quenched by binding to the hybridizable probe, but in the extension step, the quenching probe can dissociate from the sequence complementary thereto, thereby generating a signal from the hybridizable probe;

[0098] (b) placing the mixture of step (a) into a single reaction vessel and performing two or more cycles of PCR reaction of denaturation at a relatively high temperature, hybridization at a relatively low temperature, and extension at a relatively medium temperature; and

[0099] (c) A step of detecting a target nucleic acid by measuring a signal generated from the hybridization probe in the extension step simultaneously with the performance of the PCR reaction.

[0100] For the method of the present invention, the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention can be applied as is.

[0101] In another aspect, the present invention relates to a set of (a) hybridization probes and (b) quenching probes.

[0102] (a) a probe having a complementary sequence specific to a target nucleic acid as a self-hybridizing probe, wherein the hybridizing probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid is not bound to the probe, and a probe having a single-stranded sequence extending in the terminal direction from the sequence to which the signal substance is bound; and

[0103] (b) a quenching probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the hybridizable probe and quenching the signal substance of the hybridizable probe, wherein the quenching probe has a structure in which, when complementarily binding to the single-stranded sequence extended toward the terminal of the hybridizable probe, the quenching substance of the probe is adjacent to the signal substance of the hybridizable probe and can quench the signal substance of the hybridizable probe;

[0104] Here, the hybridization probe and the quenching probe are designed so that the melting temperature at which the hybridization probe dissociates from its complementary target nucleic acid is higher than the melting temperature at which the quenching probe dissociates from its complementary hybridization probe.

[0105] The description of the second hybridization probe and the quenching probe in relation to the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention can also be applied to the probe set of the present invention.

[0106] In another aspect, the present invention relates to a kit for real-time detection of two or more target nucleic acids with a single signal during PCR.

[0107] The kit of the present invention comprises the primer set of (i) and the probes of (ii) to (iv) below.

[0108] (i) a set of forward and reverse primers for amplifying each of two target nucleic acids;

[0109] (ii) (ii-a) a first hybridization probe having a complementary sequence specific to the first target nucleic acid among two target nucleic acids, or (ii-b) a complementary sequence specific to the first artificial target nucleic acid generated depending on the first target nucleic acid, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid is not bound to the probe, and the melting temperature at which it (the first hybridization probe) dissociates from the target nucleic acid or the artificial target nucleic acid complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that in the annealing step, the signal substance and the quencher are separated by binding to the complementary sequence of it (the first hybridization probe), and a signal is generated, but in the extension step, the signal substance and the quencher are separated from each other. A probe having a structure in which a signal molecule and a quencher are adjacent to each other by dissociation from a complementary sequence, thereby causing the signal to be extinguished;

[0110] (iii) a second hybridization probe having a complementary sequence specific to a second artificial target nucleic acid generated depending on a second target nucleic acid among two or more target nucleic acids, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid is not bound to the probe, and has a single-stranded sequence extended in the terminal direction from the sequence to which the signal substance is bound, and a melting temperature at which it (the second hybridization probe) dissociates from the second artificial target nucleic acid complementary thereto is between the temperature of the extension step and the temperature of the denaturation step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, such that the second hybridization probe can maintain a binding state with the second artificial target nucleic acid complementary thereto during the annealing step and the extension step; and

[0111] (iv) A quenching probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the second hybridization probe and quenching the signal substance of the second hybridization probe, wherein when the quenching probe complementarily binds to the second hybridization probe and the single-stranded sequence extended toward the end thereof (the second hybridization probe), the quenching substance of the probe has a structure capable of quenching the signal substance of the second hybridization probe by being adjacent to the signal substance of the second hybridization probe, and the melting temperature at which the quenching probe dissociates from the sequence complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that in the annealing step, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe, but in the extension step, the quenching probe A probe capable of generating a signal from a second hybridization probe by dissociating from a complementary sequence.

[0112] The kit of the present invention may further include, in addition to the primer set and the three probes, four NTPs, DNA polymerase, and other factors, such as Tris-HCl as a pH stabilizer, MgCl2 or MgSO4 or (NH4)2SO4 as a cofactor for promoting enzyme activity, BSA (Bovine Serum Albumin), gelatin, glycerol or PEG 6000 as a factor for stabilizing the enzyme, KCl as a factor for promoting binding of the primer to the target nucleic acid, Tween 20 or Triton X-100 as a nonionic surfactant for suppressing nonspecific amplification, spermidine for reducing nonspecific binding of DNA polymerase to nucleic acid, urea or DMSO (dimethylsulfoxide) or DMF (dimethylformamid), betaine as a factor for promoting annealing of the primer to the target nucleic acid, and betaine for preventing aggregation of DNA polymerase. Additional factors such as Sodium Dodecyl Sulfate (SDS) or Triton X-100 may also be included.

[0113] The kit of the present invention may further include instructions for use of the kit. These instructions may teach a PCR method for real-time detection of two target nucleic acids using a single signal of the present invention as described above.

[0114] As described above, according to the present invention, a PCR method for detecting two or more target nucleic acids with a single signal can be provided.

[0115] The method of the present invention can detect signals for two target nucleic acids in the annealing and extension stages, respectively, without mutual interference, even when using a single signal during the PCR process. These detection signals according to the method of the present invention are obtained using the same single signal, so there is no need for data processing such as addition and subtraction between them. Therefore, it provides the effect of easily and immediately confirming whether or not two target nucleic acids are detected (qualitative information) and the degree of detection (quantitative information) in a PCR result graph composed of signal intensity and the number of PCR cycles.

[0116] FIG. 1 illustrates the structure of three probes according to the present invention, namely, first and second hybridization probes and one quenching probe.

[0117] Figure 2 is a conceptual diagram of a PCR method for real-time detection of two target nucleic acids with a single signal of the present invention.

[0118] Figure 3 is a conceptual diagram of C-TAG (Cleavable Tag) technology for generating artificial target nucleic acids.

[0119] Figure 4 shows the experimental results showing that in the case of the second hybridization probe (DaO), signals are generated in both the annealing step and the extension step, but when used together with the quenching probe (QO), signals are generated only in the extension step.

[0120] Figure 5 shows the results of confirming the melting temperature of the second hybridization probe (DaO) with its target nucleic acid and the melting temperature of the quenching probe (QO) with the second hybridization probe (DaO).

[0121] Figure 6 is a result showing that real-time detection of target nucleic acids H3 and 09pdm is possible during PCR with a single signal according to the method of the present invention.

[0122] Figure 7 is a result showing that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperatures in a multi-fluorescence channel configuration according to the method of the present invention, through real-time detection of SARS-CoV-2 and Flu A / H3N2.

[0123] Figure 8 is a result showing that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperatures in a multi-fluorescence channel configuration according to the method of the present invention through real-time detection of FluA / H1N1pdm and Flu B.

[0124] FIG. 9 is a result showing that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperatures in a multi-fluorescence channel configuration according to the method of the present invention, through real-time detection of adenovirus (ADV) and a control (NC) containing no target nucleic acids.

[0125]

[0126] Hereinafter, the present invention will be described with reference to examples. However, the present invention is not limited to the examples.

[0127] <Example> Real-time detection of two target nucleic acids with a single signal via PCR

[0128] definition

[0129] In this embodiment, the cTAG primer is a primer applied to the C-TAG technology, and refers to a primer that enables the generation of an artificial target nucleic acid depending on a target nucleic acid. In addition, the DaO (Dual-annealing oligonucleotide) probe in this embodiment refers to a second hybridization probe according to the present invention, which has a sequence that enables complementary binding to a target nucleic acid and a sequence that enables complementary binding to a quenching probe. In addition, the QO (Queching oligonucleotide) probe in this embodiment is a quenching probe according to the present invention, and this probe has a structure that can complementarily bind to the DaO and quench the signal of the DaO.

[0130] <Example 1> Confirmation of fluorescence signal suppression by QO probe

[0131] This experiment was conducted to confirm that the DaO probe binds to the target nucleic acid at a temperature lower than the melting temperature of the QO probe, and that the signal of the DaO probe is quenched by QO when the QO probe binds to it. In this example, the penton DNA of adenovirus, a causative agent of respiratory disease, was used as an actual target nucleic acid, and an artificial target nucleic acid generated from the actual target nucleic acid by C-TAG technology was detected using the DaO probe.

[0132] The DaO probe (DaO #1) is labeled with a quencher molecule (BHQ-2) at the 5' end and a fluorescent signal molecule (Cy5) in the internal portion, and the QO probe (QO #1) is labeled with a quencher molecule (BHQ-2) at the 3' end. In addition, the forward primer (primer 1) contains an artificial random sequence between the 5' end and the restriction enzyme recognition site to generate an artificial target nucleic acid sequence for implementing the C-TAG technology. The artificial target nucleic acid is a complementary sequence, and it is generated only when the actual target nucleic acid is present in the sample.

[0133] The primer and probe sequences used are as follows.

[0134] Primer 1: 5'-GCATCTCCGTGAGCCAGACCAGGCACCGTCAGTGAAAACGTTCC-3' (SEQ ID NO: 1)

[0135] Primer 2: 5'-ATGCCCAGGGCCTTGTAAAC-3' (SEQ ID NO: 2)

[0136] DaO #1:

[0137] 5'-[BHQ2]CGCCGCGAGTCCCTTCCGCCGTGAGCCAGACGGCGGCG[T(Cy5)]GACCTGCGTCGACCGCCGG[C3 spacer]-3' (SEQ ID NO: 3)

[0138] QO #1: 5'-CCGGCGGTCGACGCAGGTC[BHQ2]-3' (SEQ ID NO: 4)

[0139] The bold and slanted sequence of the above primer 1 represents the recognition sequence of the restriction enzyme PspGI, and the underlined sequence is the complementary sequence of the artificial target nucleic acid generated by it. In DaO and QO, the parentheses indicate the position of the base sequence where the quencher molecule, fluorescent signal molecule, or C3 spacer is located. The C3 spacer refers to an aliphatic linker consisting of three carbons. The C-TAG sequence generated from the amplicon is as follows.

[0140] C-TAG sequence 1: 5'-TCTGGCTCACGGAGATGC-3' (SEQ ID NO: 5)

[0141] The generated C-TAG sequence is hybridized and extended to a probe or DAO, and the extended sequence is as follows.

[0142] C-TAG extension sequence 1: TCTGGCTCACGGAGATGCGACGTCGCGGCG (SEQ ID NO: 6)

[0143] The melting temperature of DaO #1 with the target nucleic acid (C-TAG extension sequence 1) is designed to be 78°C, and the melting temperature of QO #1 with DaO #1 is designed to be 70°C.

[0144] A total of 20 μl of reaction mixture containing 0.3 μM each of forward and reverse primers and 0.1 μM DaO #1 without or with 0.3 μM QO #1, 5 U of PspGI (NEB, USA), 1x PCR buffer, 2.5 mM MgCl2, 200 μM dNTP, 1.6 U of Solg™ h-Taq DNA polymerase (Solgent, Korea), and 100 pg / ul of adenovirus template DNA was mixed to perform real-time PCR using CFX96 Real-time PCR (Bio-Rad, USA). The tube containing the above reaction solution was incubated at 55°C for 5 minutes, denatured at 95°C for 15 minutes, and cycled 40 times with denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 75°C for 30 seconds. Fluorescence signals were detected at the annealing step at 60°C and the extension step at 75°C for each cycle.

[0145] The results are shown in Fig. 4, and as can be confirmed in Fig. 4, the fluorescence signal detected in two sections, the annealing step at 60°C and the extension step at 75°C, under the condition without QO is confirmed to be detected only in one section, the extension step at 75°C, under the condition with QO.

[0146] Among the sequences of primer 1, a sequence complementary to 5'-GCATCTCCGTGAGCCAGA-3' (SEQ ID NO: 7), an artificial random sequence at the 5' end generated by PspGI that acts only when a target nucleic acid is present, complementarily binds to the position of the C-TAG sequence in the DaO probe sequence that is identical to the random sequence, thereby acting as a primer for the DaO probe and extending it in the annealing step at 60°C, thereby separating the quencher molecule and the fluorescent signal molecule of the DaO probe from each other. The extended C-TAG sequence is designed to have a dissociation temperature of 78°C, so that the binding is maintained even in the extension step at 75°C, thereby separating the quencher molecule and the fluorescent signal molecule.

[0147] Meanwhile, the QO probe binds to the QO complementary sequence at the 3' end of the DaO probe sequence during the annealing step at 60°C, thereby inhibiting the signal generation of the internal fluorescent signal molecule of the DaO probe by the quencher molecule at the 3' end of QO. The QO probe is designed to have a dissociation temperature of 70°C, so that it separates from DaO during the extension step at 75°C, thereby losing the fluorescent signal inhibition effect by the quencher molecule of QO.

[0148] Therefore, the results of Fig. 4 can be seen that when the QO probe is not present, the DaO probe is bound to its complementary sequence in both the annealing step at 60°C and the extension step at 75°C, so its quenching molecule and the fluorescent signal molecule are separated from each other, and thus a fluorescent signal is detected, but when the QO probe is present, it complementarily binds to the DaO probe in the annealing step at 60°C, so the quenching molecule of the QO probe and the fluorescent signal molecule of the DaO probe are adjacent to each other, and thus no signal is generated, but in the extension step at 75°C, the QO probe is melted and separated from the DaO probe, so that a signal of the DaO probe is generated.

[0149] Meanwhile, in the condition (NC) without addition of the actual target nucleic acid, adenovirus template DNA, no fluorescence signal is detected under either condition (see Figure 9).

[0150] <Example 2> Confirmation of melting temperature of DaO probe and QO probe

[0151] The change in fluorescence signal according to the melting temperature of the DaO probe (DaO #1) and QO probe (QO #1) of Example 1 was confirmed through melting peak analysis. 40 cycles were performed under the same conditions as Example 1, and the amplification product was extended for 10 minutes in the last 40 cycles. Then, the temperature of the obtained amplification product was increased by 0.5°C per 5 seconds from 55°C to 90°C, and the change in fluorescence signal according to the temperature change was observed.

[0152] The results are shown in Fig. 5, and as confirmed by the melting peak analysis results in Fig. 5, under the condition without QO, only a positive peak corresponding to the separation of DaO from its complementary sequence was observed (i.e., only a decrease in the fluorescence signal was confirmed), whereas under the condition with QO, in addition to the positive peak corresponding to the separation of DaO from its complementary sequence, a negative peak reflecting the separation of QO from its complementary sequence was simultaneously observed. From the melting peaks observed in this way, it can be confirmed that the melting temperature of DaO and its complementary sequence is 78°C, and the melting temperature of QO and its complementary sequence is 70°C.

[0153] In conditions where the target nucleic acid was not included, no peaks were observed due to an increase or decrease in the fluorescence signal, either with or without QO.

[0154] <Example 3> Analysis of two target nucleic acids in a single fluorescence channel

[0155] This experiment was conducted to demonstrate that detection of two different target nucleic acids within a single reaction tube is possible using a single fluorescence channel.

[0156] This example was conducted targeting RNA of influenza A virus H3N2 subtype and 09pdm subtype, which are the causative agents of respiratory diseases, and PCR using C-TAG technology was performed in the detection process described below.

[0157] Extension of forward and reverse primers was performed using Taq DNA polymerase, and a DNA fragment (C-TAG) complementary to the C-TAG probe or DaO was generated from the amplified product through restriction enzymes. The generated DNA fragment hybridizes to the complementary binding site within the C-TAG probe / DaO sequence and is extended by the polymerase, thereby changing the structure of the C-TAG probe / DaO. At this time, below the melting temperature of QO, quenching of DaO occurs by QO, and a fluorescence signal is detected above the melting temperature.

[0158] The primer information and target sequence information generated during the amplification process are as follows.

[0159] Primer 3: 5'-ACACATCGACCCGTACGATGCCAGGCCGACAGTCCTCACCGAATCC -3' (SEQ ID NO: 8)

[0160] Primer 4: 5'- GCTGTAAGCTTTGCTGCGTT -3' (SEQ ID NO: 9)

[0161] Primer 5: 5'-GTGCCTCAGGAACGCTCGCCAGGAGCAAGAAGTTCAAGCCGGA -3' (SEQ ID NO: 10)

[0162] Primer 6: 5'- CCCGGCTCTACTAGTGTCCA -3' (SEQ ID NO: 11)

[0163] C-TAG probe 1: 5'- ATAATTAAGAA[T(FAM)]ACACATCGACCCGTACGATG[BHQ1] -3' (SEQ ID NO: 12)

[0164] DaO #2:

[0165] 5'-[BHQ1]CGCCGCGGGTGCCTCAGGAACGCTCGCGCGGCG[T(FAM)]TAGACGACGGCCGACCCTGC[C3 spacer]-3' (SEQ ID NO: 13)

[0166] QO #2: 5'-GCAGGGTCGGCCGTCGTCTA[BHQ1]-3' (SEQ ID NO: 14)

[0167] The bold and slanted sequences of the above primers 3 and 5 represent the recognition sequence of the restriction enzyme PspGI, and the underlined sequence is the complementary sequence of the artificial target nucleic acid generated thereby. In the probes, DaO and QO, the parentheses indicate the positions of the base sequences where the fluorescent reporter, fluorescent quencher, or C3 spacer is located. The C3 spacer represents an aliphatic linker consisting of three carbons. The C-TAG sequence generated from the amplicon is as follows.

[0168] C-TAG sequence 2 5'-CATCGTACGGGTCGATGTGT-3' (SEQ ID NO: 15)

[0169] C-TAG sequence 3: 5'-CGAGCGTTCCTGAGGCAC-3' (SEQ ID NO: 16)

[0170] The generated C-TAG sequence is hybridized and extended to a probe or DAO to generate an artificial target nucleic acid, and the extended sequence is as follows.

[0171] C-TAG extension sequence 2: 5'-CATCGTACGGGTCGATGTGTATTCTTAATTAT-3' (SEQ ID NO: 17)

[0172] C-TAG extension sequence 3: 5'-CGAGCGTTCCTGAGGCACCCGCGGCG-3' (SEQ ID NO: 18)

[0173] The melting temperature of C-TAG probe 1 is designed to be 66°C, the melting temperature with the target nucleic acid of DaO #2 (an artificial target nucleic acid generated by C-TAG) is designed to be 77°C, and the melting temperature of QO #2 with DaO #2 is designed to be 68°C.

[0174] Primers 3 and 4 react with the H3N2 gene sequence, primers 5 and 6 react with the 09pdm gene sequence, and the C-TAG sequence 2 generated during the H3N2 gene amplification process of primers 3 and 4 reacts with probe 1, and the C-TAG sequence 3 generated during the 09pdm gene amplification process of primers 5 and 6 reacts with DaO #2. QO #2 reacts with the QO binding site of DaO #2.

[0175] A total of 20 μl of the reaction mixture containing 0.15 μM each of the above primers 1, 2, 3, 4, 0.1 μM each of C-TAG probe 1 and DaO #2, 0.3 μM of QO #2, 5 U of PspGI (NEB, USA), PCR buffer (PCR buffer, 1x), 2.5 mM of MgCl2, 200 μM of dNTP, 0.1 mM of DTT, 1 U of RNase Inhibitor, SuperiorScript III (Enzynomics, Korea) without template or with 100 pg / ul of H3 or 09pdm template RNA alone or 100 pg / ul of H3 and 09pdm template RNA was mixed to perform real-time PCR using CFX96 Real-time PCR (Bio-Rad, USA). The tube containing the above reaction solution was subjected to reverse transcription reaction at 55°C for 30 minutes, then denatured at 95°C for 15 minutes, and cycles consisting of a denaturation step at 95°C for 30 seconds, an annealing step at 60°C for 30 seconds, and an extension step at 75°C for 30 seconds were repeated 45 times. Fluorescence signals were detected at 60°C and 75°C for each cycle.

[0176] The results are shown in Fig. 6. As can be confirmed in Fig. 6, under the H3 template alone condition, an amplification curve is observed only at 60°C, and no fluorescence signal is observed at 75°C. Under the 09pdm template alone condition, no amplification curve is observed at 60°C, and only at 75°C. Under the mixed condition of H3 and 09pdm, an amplification curve of H3 is observed at 60°C, and an amplification curve of 09pdm is observed at 75°C. The PCR result graph observed at each temperature under the mixed condition of H3 and 09pdm is confirmed to have the same pattern as the PCR result graph detected under the condition of H3 or 09pdm alone with the same concentration of template, confirming that in the detection of two target nucleic acids, the detection results for each target nucleic acid are obtained by a single fluorescence detection channel without interference with each other.

[0177]

[0178] <Example 4> Analysis of multiple target nucleic acids in multiple fluorescence channels

[0179] This experiment was conducted to demonstrate that individual analysis of multiple target nucleic acids via fluorescence channels and detection temperatures is possible within a single reaction tube using multiple fluorescence channels.

[0180] This example was conducted on the nucleic acids of SARS-CoV-2, Influenza A virus / H3N2, Influenza A virus / 09pdm, Influenza B virus, and Adenovirus, which are causative agents of respiratory diseases, and PCR using C-TAG technology was performed in the detection process described below.

[0181] Extension of forward and reverse primers was performed using Taq DNA polymerase, and a DNA fragment (C-TAG) complementary to the C-TAG probe or DaO was generated from the amplified product through a restriction enzyme. The generated DNA fragment hybridizes to the complementary binding site within the C-TAG probe / DaO sequence and is extended by the polymerase, thereby changing the structure of the C-Tag probe / DaO. At this time, below the melting temperature of QO, quenching of DaO occurs by QO, and a fluorescence signal is detected above the melting temperature.

[0182] The primer information and target sequence information generated during the amplification process are as follows.

[0183] Primer 7: 5'-ACACATCGACCCGCGATGCCAGGACCCGCAATCCTGCTAACAA-3' (SEQ ID NO: 19)

[0184] Primer 8: 5'-ACGAGAAGAGGCTTGACTGC-3' (SEQ ID NO: 20)

[0185] Primer 9: 5'-GTGCCTCAGGAACGCTCGCCAGGAATAGAGCTCGCACCGTAGC-3' (SEQ ID NO: 21)

[0186] Primer 10: 5'-AACATGTTGTGCCAACCACC-3' (SEQ ID NO: 22)

[0187] Primer 11: 5'-CGCACGCGAAGCGTCTCCAGGCGCAGCAAAGCTTACAGCAA-3' (SEQ ID NO: 23)

[0188] Primer 12: 5'-AAACTCCAGGGTGCCTGATG-3' (SEQ ID NO: 24)

[0189] Primer 13: 5'-GACGACGCTGGCCACCCCAGGCAACCGCAAATGCAGACACA-3' (SEQ ID NO: 25)

[0190] Primer 14: 5'-ACCCAAATGCAATGGGGCTA-3' (SEQ ID NO: 26)

[0191] Primer 15: 5'-GCGACCCTGCGACGAGCCAGGACGCCAGAATGCAACTGAGA-3' (SEQ ID NO: 27)

[0192] Primer 16: 5'-TTCTGGATCAACCGCCCTTC-3' (SEQ ID NO: 28)

[0193] Primer 17: 5'-CTGGCGTGCACGGGTCCCAGGAGACATCAAGGCCAAGACGG-3' (SEQ ID NO: 29)

[0194] Primer 18: 5'-TGTCTGCAATCCCTGGGTTC-3' (SEQ ID NO: 30)

[0195] Primer 19: 5'-CTGGCAGCGCAGGCAGCCAGGCTGCTCTCACAGATCACGGG-3' (SEQ ID NO: 31)

[0196] Primer 20: 5'-CCCAGGGCCTTGTAAACGTA-3' (SEQ ID NO: 32)

[0197] C-TAG probe 2: 5'-ATAATTAAGAA[T(FAM)]ACACATCGACCCGTACGATG[BHQ1]-3' (SEQ ID NO: 33)

[0198] C-TAG probe 3: 5'-ATTATTATAA[T(HEX)]CGCACGCGAAGCGTCT[BHQ1]-3' (SEQ ID NO: 34)

[0199] C-TAG probe 4: 5'-CTATTATTA[T(Cy5)]GCGACCCTGCGACGAG[BHQ2]-3' (SEQ ID NO: 35)

[0200] DaO #3:

[0201] 5'-[BHQ1]CGCCGCGTGGTGCCTCAGGAACGCTCGCGCGGCG[T(FAM)]TAGACGACGGCCGACCCTGC[C3 spacer]-3' (SEQ ID NO: 36)

[0202] DaO #4:

[0203] 5'-[BHQ1]CGCGGGCAGGACGACGCTGGCCACCGCCCGCG[T(HEX)]TAGACGACGGCCGACCCTGC[C3 spacer]-3' (SEQ ID NO: 37)

[0204] DaO #5:

[0205] 5'-[BHQ2]GGCCGCGACCTGGCGTGCACGGGTCCGCGGCC[T(CalRed610)]GTGTGTGACGACTCGGCTGCG[C3 spacer]-3' (SEQ ID NO: 38)

[0206] DaO #6:

[0207] 5'-[BHQ2]CCCGGCCTCCTGGCAGCGCAGGCAGGGCCGGC[T(Cy5)]TCGAGGGCTGGAACACGGTG[C3 spacer]-3' (SEQ ID NO: 39)

[0208] QO #3: 5'-GCAGGGTCGGCCGTCGTCTA[BHQ1]-3' (SEQ ID NO: 40)

[0209] QO #4: 5'-GGTCGGTCGGGTCACCCCA[BHQ1]-3' (SEQ ID NO: 41)

[0210] QO #5: 5'-CGCAGCCGAGTCGTCACACAC[BHQ2]-3' (SEQ ID NO: 42)

[0211] QO #6: 5'-CACCGTGTTCCAGCCCTCGA[BHQ2]-3' (SEQ ID NO: 43)

[0212] The bold and slanted sequences of the above primers represent the recognition sequence of the restriction enzyme PspGI, and the underlined sequence is the complementary sequence of the resulting artificial target nucleic acid. In DaO and QO, the parentheses indicate the positions of the base sequences where the quencher molecule, fluorescent signal molecule, or C3 spacer is located, and the C3 spacer represents an aliphatic linker consisting of three carbons. The C-TAG sequence generated from the amplicon is as follows.

[0213] C-TAG sequence 4: 5'- CATCGTACGGGTCGATGTGT -3' (SEQ ID NO: 44)

[0214] C-TAG sequence 5: 5'- CGAGCGTTCCTGAGGCAC -3' (SEQ ID NO: 45)

[0215] C-TAG sequence 6: 5'- AGACGCTTCGCGTGCG -3' (SEQ ID NO: 46)

[0216] C-TAG sequence 7: 5'- GGTGGCCAGCGTCGTC -3' (SEQ ID NO: 47)

[0217] C-TAG sequence 8: 5'-CTCGTCGCAGGGTCGC-3' (SEQ ID NO: 48)

[0218] C-TAG sequence 9: 5'- GACCCGTGCACGCCAG -3' (SEQ ID NO: 49)

[0219] C-TAG sequence 10: 5'- CTGCCTGCGCTGCCAG -3' (SEQ ID NO: 50)

[0220] The generated C-TAG sequence is hybridized and extended to a probe or DAO, and the extended sequence is as follows.

[0221] C-TAG extension sequence 4: 5'-CATCGTACGGGTCGATGTGTATTCTTAATTAT-3' (SEQ ID NO: 51)

[0222] C-TAG extension sequence 5: 5'-CGAGCGTTCCTGAGGCACCCGCGGCG-3' (SEQ ID NO: 52)

[0223] C-TAG extension sequence 6: 5'-AGACGCTTCGCGTGCGATTATAATAAT-3' (SEQ ID NO: 53)

[0224] C-TAG extension sequence 7: 5'-GGTGGCCAGCGTCGTCCTGCCCGCG-3' (SEQ ID NO: 54)

[0225] C-TAG extension sequence 8: 5'-CTCGTCGCAGGGTCGCATAATAATAG-3' (SEQ ID NO: 55)

[0226] C-TAG extension sequence 9: 5'-GACCCGTGCACGCCAGGTCGCGGCC-3' (SEQ ID NO: 56)

[0227] C-TAG extended sequence 10: 5'-CTGCCTGCGCTGCCAGGAGGCCGGG-3' (SEQ ID NO: 57)

[0228] Primers 7 and 8, 9 and 10 react with the N and RDRP genes of SARS-CoV-2, respectively; primers 11 and 12, 13 and 14 react with the HA gene of the H3N2 and H1N1pdm types of influenza A virus, respectively; primers 15 and 16 react with the NP gene of influenza A virus; primers 17 and 18 react with the NP gene of influenza B virus; and primers 19 and 20 react with the penton gene of adenovirus. C-TAG sequences 4, 5, 6, 7, 8, 9, and 10 generated during the amplification process of SARS-CoV-2 N, RDRP, H3N2, H1N1pdm, Flu A, Flu B, and ADV genes by the above primers 7 to 20 react with C-TAG probe 2, DaO #3, C-TAG probe 3, DaO #4, C-TAG probe 4, DaO #5, and DaO #6, respectively, to form cTAG extended sequences 4, 5, 6, 7, 8, 9, and 10. QO #3, 4, 5, and 6 react with the QO binding sites of DaO #3, 4, 5, and 6, respectively.

[0229] The melting temperature of C-TAG probes 2 to 5 is designed to be 66 to 67°C, the melting temperature with each target nucleic acid of DaO #3 to 6 (an artificial target nucleic acid generated by C-TAG) is designed to be 77 to 78°C, and the melting temperature with DaO including each binding site of QO #3 to 6 is designed to be 68 to 70°C.

[0230] A total of 20 μl of reaction solution containing 0.15 μM each of the above primers 7-20, 0.1 μM each of C-TAG probes 2-4 and DaO #3-6, and 0.3 μM each of QO #3-6, 5 U of PspGI (NEB, USA), PCR buffer (PCR buffer, 1x), 2.5 mM MgCl2, 200 μM of dNTP, 0.1 mM DTT, 1 U of RNase Inhibitor, SuperiorScript III (Enzynomics, Korea) without template or with SARS-CoV-2, Influenza A virus / H3N2, Influenza A virus / H1N1pdm, Influenza B virus, and Adenovirus nucleic acids at a concentration of 10^6 copies / ul was used to perform real-time PCR using CFX96 Real-time PCR (Bio-Rad, USA). The tube containing the above reaction solution was subjected to reverse transcription reaction at 55°C for 30 minutes, then denatured at 95°C for 15 minutes, and cycled 45 times with a denaturation step at 95°C for 30 seconds, annealing step at 60°C for 30 seconds, and extension step at 75°C for 30 seconds. Fluorescence signals were detected at 60°C and 75°C for each cycle.

[0231] The results are shown in Fig. 7, and as can be confirmed in Fig. 7, under the SARS-CoV-2 template reaction conditions, only the amplification curves by C-TAG probe 2 and DaO #3 are confirmed in the FAM channel at 60°C and 75°C, and no fluorescence signals are confirmed in other channels. Under the H3N2 template reaction conditions, only the amplification curves by C-TAG probe 3 and DaO #4 are confirmed in the HEX channel at 60°C and in CalRed 610 at 75°C, and no fluorescence signals are confirmed in other channels.

[0232] Under the H1N1pdm template reaction conditions, only the amplification curve by C-TAG probe 4 and DaO #4 was observed at 75°C in HEX and CalRed 610, and no fluorescence signals were observed in other fluorescence channels at 60°C or 75°C. Under the Flu B template reaction conditions, only the amplification curve by C-TAG probe 5 in Cy5 was observed at 60°C, and no fluorescence signals were observed in other channels at 60°C or 75°C (Fig. 8).

[0233] Under ADV template reaction conditions, only the amplification curve by DaO #5 in Cy5 is observed at 75°C, and no fluorescence signals are observed in other fluorescence channels at 60°C and 75°C. Under template-free reaction conditions, no amplification curves are observed in any fluorescence channels at 60 and 75°C (Fig. 9).

[0234] Since only the fluorescence signal by the C-TAG probe or DaO probe for the template is detected under each condition and no other signals are detected, it can be confirmed that each target can be individually detected through the fluorescence channel and detection temperature range in the multiple fluorescence channels.

Claims

1. A PCR method for real-time detection of two or more target nucleic acids in a single detection channel comprising steps (a) to (c): (a) A step of preparing a mixture for PCR reaction including (i) to (iv) below in a sample to be detected (i) a pair of forward and reverse primers for amplifying a first target nucleic acid, wherein one of the primer pairs sequentially includes a random nucleic acid sequence that is non-complementary to the first target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid sequence that is complementary to the first target nucleic acid, A pair of forward and reverse primers for amplifying a second target nucleic acid, wherein one of the primer pairs sequentially comprises a random nucleic acid sequence non-complementary to the second target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the second target nucleic acid; (ii) a first hybridization probe having a complementary sequence specific to a first artificial target nucleic acid generated depending on a first target nucleic acid among two or more target nucleic acids, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the artificial target nucleic acid does not bind to the probe, and a melting temperature at which the first hybridization probe dissociates from the artificial target nucleic acid complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, such that in the annealing step, the signal substance and the quencher are separated by binding to the complementary sequence thereof (the first hybridization probe) and a signal is generated, but in the extension step, the signal substance and the quencher are adjacent by dissociating from the complementary sequence thereof (the first hybridization probe) and a structure in which the signal substance and the quencher can be extinguished; (iii) a second hybridization probe having a complementary sequence specific to a second artificial target nucleic acid generated depending on a second target nucleic acid among two or more target nucleic acids, wherein the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the second artificial target nucleic acid does not bind to the probe, and has a single-stranded sequence extended in the terminal direction from the sequence to which the signal substance is bound, and a melting temperature at which it (the second hybridization probe) dissociates from the second artificial target nucleic acid complementary thereto is between the temperature of the extension step and the temperature of the denaturation step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that the second hybridization probe can maintain a binding state with the second artificial target nucleic acid complementary thereto in the annealing step and the extension step; and (iv) A quenching probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the second hybridization probe and quenching the signal substance of the second hybridization probe, wherein when the quenching probe complementarily binds to the second hybridization probe and the single-stranded sequence extended toward the end thereof (the second hybridization probe), the quenching substance of the probe has a structure capable of quenching the signal substance of the second hybridization probe by being adjacent to the signal substance of the second hybridization probe, and the melting temperature at which the quenching probe dissociates from the sequence complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that in the annealing step, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe, but in the extension step, the quenching probe A probe capable of causing a signal to be generated from a second hybridization probe by dissociating from a complementary sequence; (b) placing the mixture of step (a) into a single reaction vessel and performing two or more cycles of PCR reaction of denaturation at a relatively high temperature, hybridization at a relatively low temperature, and extension at a relatively medium temperature; and (c) a step of simultaneously performing the PCR reaction, detecting the first target nucleic acid by measuring a signal generated from the first hybridization probe in the annealing step, and detecting the second target nucleic acid by measuring a signal generated from the second hybridization probe in the extension step.

2. In paragraph 1, A method characterized in that the first hybridization probe or the second hybridization probe has a stem-loop structure and a complementary sequence that specifically binds to the artificial target nucleic acid exists in the loop region.

3. In paragraph 1, A method characterized in that the above denaturation step is performed at 92 to 98°C, the above annealing step is performed at 50 to 65°C, and the above extension step is performed at 70 to 85°C.

4. In paragraph 1, A method characterized in that the first artificial target nucleic acid or the second artificial target nucleic acid is produced quantitatively dependent on the first target nucleic acid or the second target nucleic acid, respectively.

5. In the first paragraph, the method is characterized in that the production of the artificial target nucleic acid is performed by a process in which the complementary sequence of the random nucleic acid sequence included in the amplification product extended from a primer having a structure sequentially including a random nucleic acid sequence non-complementary to the target sequence, a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the target sequence is released as a complementary tag fragment of the random sequence during the cleavage process of the amplification product by the restriction enzyme.

6. In paragraph 1, The first hybridization probe of the above (ii-b) and the second hybridization probe of the above (iii) have complementary sequences specific to the first artificial target nucleic acid and the second artificial target nucleic acid, respectively, which are generated depending on the first target nucleic acid and the second target nucleic acid, respectively. A method characterized in that the first artificial target nucleic acid and the second artificial target nucleic acid act as primers for the first hybridizable probe and the second hybridizable probe, respectively, and are extended in an annealing step, thereby separating the signal material and the quencher of the first hybridizable probe and the second hybridizable probe, respectively.

7. In paragraph 1, The above method comprises, instead of a primer for amplifying the first or second target nucleic acid, the primer sequentially comprising a non-complementary random nucleic acid sequence, a restriction enzyme recognition sequence and a complementary nucleic acid sequence to the first or second target nucleic acid of the above (i). A method characterized in that a pair of forward and reverse primers complementary to a target nucleic acid are used to amplify the target nucleic acid, and in this case, the production of an artificial target nucleic acid is performed by using a PTO (Probing and Tagging Oligonucleotide) having an artificial random tag sequence together with a complementary probe sequence for the target nucleic acid to generate a PTO fragment, which is an artificial random sequence 5' tag consisting only of the artificial random sequence, and this PTO fragment becomes the artificial target nucleic acid.

8. In paragraph 1, A method characterized in that the first target nucleic acid or the second target nucleic acid is cDNA generated by reverse transcription from single-stranded DNA, double-stranded DNA, or RNA.

9. A method according to claim 1, wherein the artificial target nucleic acid is a sequence that is extended after a nucleic acid that is primarily generated based on the target nucleic acid is hybridized to a probe.

10. A kit for real-time detection of two target nucleic acids with a single signal during PCR, comprising the primer set of (i) below and the probes of (ii) to (iv). (i) a pair of forward and reverse primers for amplifying a first target nucleic acid, wherein one of the primer pairs sequentially includes a random nucleic acid sequence that is non-complementary to the first target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid sequence that is complementary to the first target nucleic acid, A pair of forward and reverse primers for amplifying a second target nucleic acid, wherein one of the primer pairs sequentially comprises a random nucleic acid sequence non-complementary to the second target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the second target nucleic acid; (ii) a first hybridization probe having a complementary sequence specific to a first artificial target nucleic acid generated depending on the first target nucleic acid among two target nucleic acids, wherein the artificial target nucleic acid includes a case where a nucleic acid primarily generated depending on the target nucleic acid is hybridized to the probe and then extended, and the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the first artificial target nucleic acid does not bind to the probe, and the melting temperature at which it (the first hybridization probe) dissociates from the artificial target nucleic acid complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that in the annealing step, the signal substance and the quencher are separated by binding to the complementary sequence of the (first hybridization probe), and a signal is generated, but in the extension step, the (first hybridization probe) A probe having a structure in which a signal substance and a quencher are adjacent to each other and the signal can be extinguished by dissociating from the complementary sequence of the probe; (iii) A second hybridization probe having a complementary sequence specific to a second artificial target nucleic acid generated depending on a second target nucleic acid among two or more target nucleic acids, wherein the artificial target nucleic acid includes a case where a nucleic acid primarily generated depending on the target nucleic acid is a sequence extended after hybridization to the probe, and the hybridization probe has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the artificial target nucleic acid is not bound to the probe, and has a single-stranded sequence extended in the terminal direction from the sequence to which the signal substance is bound, and the melting temperature at which it (the second hybridization probe) dissociates from the second artificial target nucleic acid complementary thereto is between the temperature of the extension step and the temperature of the denaturation step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that the second hybridization probe maintains a state of binding to the second artificial target nucleic acid complementary thereto during the annealing step and the extension step. probes that can; and (iv) A quenching probe having a quenching substance capable of complementarily binding to the extended single-stranded sequence of the second hybridization probe and quenching the signal substance of the second hybridization probe, wherein when the quenching probe complementarily binds to the second hybridization probe and the single-stranded sequence extended toward the end thereof (the second hybridization probe), the quenching substance of the probe has a structure capable of quenching the signal substance of the second hybridization probe by being adjacent to the signal substance of the second hybridization probe, and the melting temperature at which the quenching probe dissociates from the sequence complementary thereto is between the temperature of the annealing step and the temperature of the extension step among the relatively high temperature denaturation step, the relatively low temperature annealing step, and the relatively medium temperature extension step of the PCR reaction, so that in the annealing step, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe, but in the extension step, the quenching probe A probe capable of generating a signal from a second hybridization probe by dissociating from a complementary sequence.

11. In paragraph 10, A kit characterized in that, in addition to including the primer set and the three probes, the kit further includes four NTPs and a DNA polymerase.

12. In paragraph 11, The kit is characterized in that it further comprises at least one of Tris-HCl as a pH stabilizer, MgCl2 or MgSO4 or (NH4)2SO4 as a cofactor for promoting enzyme activity, BSA (Bovine Serum Albumin) or gelatin or glycerol or PEG 6000 as a factor for stabilizing the enzyme, KCl as a factor for promoting binding of the primer to the target nucleic acid, Tween 20 or Triton X-100 as a nonionic surfactant for suppressing nonspecific amplification, spermidine for reducing nonspecific binding of DNA polymerase to nucleic acid, urea or DMSO (dimethylsulfoxide) or DMF (dimethylformamid) as a factor for promoting annealing of the primer to the target nucleic acid, betain, and SDS (Sodium Dodecyl Sulfate) or Triton X-100 as a factor for preventing aggregation of DNA polymerase.

13. In paragraph 10, The above kit comprises a pair of forward and reverse primers complementary to the target nucleic acid for amplifying the first or second target nucleic acid instead of a primer for amplifying the first or second target nucleic acid, which sequentially includes a non-complementary random nucleic acid sequence, a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the first or second target nucleic acid of the above (i), In this case, the kit further comprises a probing and tagging oligonucleotide (PTO); wherein the PTO comprises (i) a 3'-targeting portion comprising a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; and (ii) a 5'-tagging portion comprising a nucleotide sequence non-complementary to the target nucleic acid sequence; wherein the 3'-targeting portion of the PTO hybridizes to the target nucleic acid sequence, and the 5'-tagging portion of the PTO does not hybridize to the target nucleic acid sequence; A kit characterized in that the fragment released from the above PTO becomes an artificial target nucleic acid.

14. In paragraph 10, The above signal material is a fluorescent material, The above fluorescent substance is any one of FAM (6-Carboxyfluorescein), HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TAMRA (6-carboxytetramethyl-rhodamine), Cy3 (Cyanine-3), and Cy5 (Cyanine-5), A kit characterized in that the above-mentioned quenching substance is one of BHQ1[2-[N-(2-hydroxyethyl)-4-[[2-methoxy-5-methyl-4-[(4-methyl-2-nitrophenyl)diazenyl]phenyl]diazenyl]anilino]ethanol], BHQ2(4-[[4-[2-[2,5-Dimethoxy-4-[2-(4-nitrophenyl)diazenyl]phenyl]-diazenyl]phenyl]methylamino]-butanoic acid), and dabcyl (N-[4-(4'-dimethylamino)phenylazo]benzoic acid).

Images