Zea mays zmtas3j gene and use thereof in improvement of plant lead tolerance

Abstract

The present invention relates to a Zea mays ZmTAS3j gene and a use thereof in improvement of plant lead tolerance. The nucleotide sequence of the Zea mays ZmTAS3j gene is as shown in SEQ ID NO. 1. According to the present invention, first, the ZmTAS3j gene is cloned from Zea mays, and by means of genetic transformation of Arabidopis thaliana and Zea mays, it is verified that the ZmTAS3j gene can improve the tolerance of a plant to lead stress.

Description

Maize ZmTAS3j gene and its application in improving plant lead tolerance Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and more specifically, relates to a maize ZmTAS3j gene and its application in improving plant lead tolerance. Background Art

[0002] Maize (Zea mays L.) is one of the most widely cultivated crops worldwide, widely used as food, feed, and industrial raw materials. Heavy metal pollution is one of the major environmental pollution issues today and one of the environmental stresses facing crop growth. Lead (Pb), a major heavy metal pollutant in the environment, has deleterious effects on maize biomass and grain yield. It can also enter the human body through the food chain, water, or air, accumulating over time and posing a serious threat to human health. Therefore, in-depth research on the molecular mechanisms of Pb tolerance in maize, identifying new Pb-tolerant genes, and cultivating maize germplasm with high or low Pb accumulation are important approaches for remediating Pb-contaminated soils or reducing Pb accumulation in maize. Small RNA plays an important role in plant processes such as biotic stress, leaf development, root development, and abiotic stress. Among them, phasiRNA is a type of small RNA produced by miRNA-mediated cleavage of RNA transcripts. Its function is similar to that of miRNA, directly targeting and cleaving endogenous complementary mRNAs to achieve post-transcriptional gene silencing (PTGS). This regulatory mechanism is believed to have evolved in plants and is involved in regulating a variety of biotic and abiotic stresses. Currently, there are no reports on whether phasiRNA is involved in the Pb stress response in maize seedlings.

[0003] PhasiRNAs are endogenous siRNAs with a length of 21 or 24 nt and a head-to-tail phased arrangement. Pri-phasiRNAs, generated by targeted cleavage of transcripts by miRNAs, are processed into double-stranded sequences by RDR6 under the action of the RNA-binding protein (SGS3), forming pre-phasiRNAs. These sequences are then transported into the nucleus and, with the assistance of double-stranded RNA-binding protein 4 (DRB4), cleaved by Dicer-like enzymes (DCLs) at a fixed length to form head-to-tail phased phasiRNAs. PhasiRNAs generated by DCL4 cleavage are 21 nt in length. When DCL4 is mutated, DCL2 and DCL3 complement their function. PhasiRNAs generated by DCL5 (DCL3b) cleavage are 24 nt in length and are primarily found in regenerating tissues of monocots. 24-nt PHAS sites have also been detected in dicots. These sites capable of generating phasiRNAs are termed "PHAS" sites. Trans-acting siRNA (tasiRNA) is a type of phasiRNA that is derived from non-coding RNA and is a plant-specific endogenous small RNA. The site where this type of small RNA is produced is called a "TAS" site. In Arabidopsis, only eight TAS sites have been reported, namely TAS1a / b / c, TAS2, TAS3a / b / c, and TAS4. Among them, TAS1a / b / c and TAS2 are targeted and recognized by miR173, while TAS3a / b / c and TAS4 are targeted and recognized by miR390 and miR828, respectively. Among them, TAS3 is considered to be a conserved TAS site. In addition to targeting the ARF family, tasiRNAs derived from TAS3 also have other potential targets, which means that tasiRNAs and their complex regulatory networks may play a regulatory role in plant adaptation to stress.

[0004] Summary of the Invention

[0005] In order to solve the above technical problems, the identification and functional analysis of PHAS genes and phasiRNAs that respond to Pb stress in maize seedlings in the present invention will provide a new perspective on the key genes and their expression regulatory networks under plant Pb stress.

[0006] The technical solution of the present invention is:

[0007] Application of maize ZmTAS3j gene in improving plant tolerance to lead stress.

[0008] The nucleotide sequence of the maize ZmTAS3j gene is shown in SEQ ID NO.1.

[0009] A method for improving a plant's tolerance to lead stress comprises overexpressing a maize ZmTAS3j gene in the plant.

[0010] A method for overexpressing the maize ZmTAS3j gene in Arabidopsis thaliana is as follows: (1) extracting total RNA from the B73 inbred line, reverse transcribing it into cDNA, amplifying the ZmTAS3j transcript sequence, and constructing the ZmTAS3j gene sequence into pRI101-AN by homologous recombination using the pRI101-AN basic expression vector and EcoRI as a single restriction enzyme site, and naming it AN101-ZmTAS3j.

[0011] (2) The target site of miR390 at the 5' end in ZmTAS3j was mutated by mismatch PCR amplification, destroying the target site of miR390 at the 5' end of the ZmTAS3j gene sequence. The mutant ZmTAS3j gene sequence was constructed into pRI101-AN by homologous recombination using the pRI101-AN basic expression vector and EcoRI as a single restriction site, and was named AN101-ZmTAS3jmut.

[0012] (3) The AN101-ZmTAS3j and AN101-ZmTAS3jmut plasmids were transformed into Agrobacterium GV3101, respectively, and the inflorescences of wild-type Arabidopsis thaliana were infected using the inflorescence immersion method to obtain transgenic plants.

[0013] In the above method, the homologous recombination primers in step (1) are AN101-ZmTAS3j-F: the nucleotide sequence is such as SEQ ID NO.2, and AN101-ZmTAS3j-R: the nucleotide sequence is such as SEQ ID NO.3.

[0014] In the above method, the homologous recombination primers in step (2) are ZmTAS3jmut-FL-R: the nucleotide sequence is such as SEQ ID NO.4, and ZmTAS3jmut-FL-F: the nucleotide sequence is such as SEQ ID NO.5.

[0015] A method for overexpressing the maize ZmTAS3j gene in maize comprises the following steps: using Ubi as a promoter, nos as a terminator, and Bar as a selection marker gene; designing primers for amplifying a target gene fragment according to the ZmTAS3j sequence; amplifying the ZmTAS3j gene fragment; using BamHI as a restriction site; and constructing an OE-ZmTAS3j overexpression vector for genetic transformation of maize by homologous recombination.

[0016] In the above method, the primers used for constructing the OE-ZmTAS3j overexpression vector by homologous recombination method are OE-ZmTAS3j-F: nucleotide sequence such as SEQ ID NO.6; OE-ZmTAS3j-R: nucleotide sequence such as SEQ ID NO.7.

[0017] To explore the effects of phasiRNAs (phasiRNAs) on lead tolerance in maize, this study constructed a database of 305 small RNAs from a genetically diverse maize inbred population. Bioinformatics analysis identified 41 phasiRNAs derived from nine PHAS genes that were significantly negatively correlated with Pb content in maize roots. Genome-wide expression association studies (eGWAS) revealed that only PHAS_1, whose expression was regulated by its cis-expression quantitative trait locus (cis-eQTL) and had the highest phase score, exhibited a significant negative correlation with Pb content in maize roots. This study first cloned the ZmTAS3j gene from maize and, through genetic transformation of Arabidopsis thaliana and maize (Zea mays), demonstrated that overexpression of the ZmTAS3j gene enhanced plant tolerance to lead stress. Inductively coupled plasma mass spectrometry, transmission electron microscopy, and EDS-X-ray microanalysis were used to determine lead concentrations in the roots of an overexpression (OE) strain and a wild-type (WT) strain under control (CK) and Pb treatment conditions, respectively. The locations of Pb aggregate deposition were observed, and the sediments in root tissues were analyzed. The results indicated that ZmTAS3j negatively regulates cell wall thickness and Pb aggregate accumulation in maize root cells, thereby affecting Pb content in maize roots. Finally, enzyme-linked immunosorbent assay (ELISA) and various assay kits were used to determine IAA levels, SOD, POD, and CAT activities, and H2O2 and MDA contents in the roots of OE and WT strains under CK and Pb treatment conditions. Results showed that compared with WT roots, OE roots showed increased IAA levels, increased SOD and CAT activities, and decreased H2O2 and MDA contents. In summary, tasiRNA derived from overexpression of ZmTAS3j may increase the IAA level in maize roots by regulating the auxin anabolic pathway and the expression of ROS-responsive genes, thereby promoting the growth of primary roots, enhancing the activity of ROS-scavenging enzymes to eliminate ROS in the body, and reducing the damage of ROS to plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 shows a. Small RNA library construction; b. PHAS site identification process;

[0019] Figure 2 shows the distribution of small RNAs, including A. the abundance ratio of 20-24 nt small RNAs; B. the abundance distribution of 21 nt small RNAs in 305 inbred lines;

[0020] Figure 3 shows the clustering of phasiRNA expression abundance and GO functional enrichment of target genes. A. K-mean clustering analysis of 305 inbred lines based on the expression of 55 phasiRNAs; B. phasiRNA expression levels among groups; C. Significance analysis of Pb content among groups; D. GO functional enrichment of phasiRNA target genes. RLC, root lead content; SLC, shoot lead content;

[0021] Figure 4 shows the expression-wide genome-wide association study (eGWAS) and genotyping of four PHAS genes. A.D. Manhattan plots of PHAS_1, PHAS_2, PHAS_6, and PHAS_12; E. Expression levels of PHAS_1 in two haplotypes (GG and AA); F. Differences in Pb content between haplotypes; G. Read abundance and distribution of ZmTAS3j-derived phasiRNAs in SCL114 and SCL312 (haplotype: GG) and SCL011 and SCL064 (haplotype: AA);

[0022] Figure 5 shows a map of the 35S:GFP-ZmTAS3j vector;

[0023] Figure 6 shows A is the AN101-MIR390 vector map, and B is the STTM390 structural diagram and vector map;

[0024] Figure 7 shows the predicted precursor structures of MIR390, MIRD5(+) mutation, and MIRD6(+) mutation. A and B, miR390; C and D, miRD5(+); E and F, miRD6(+);

[0025] Figure 8 shows the targeted cleavage of ZmTAS3j by miR390. A. Transient expression of green fluorescence in tobacco leaves; B. Transient expression of ZmTAS3j in tobacco leaves; C. Transient expression of eGFP in tobacco leaves;

[0026] Figure 9 shows the specific cleavage site of miR390 on ZmTAS3j verified by 5' RACE. A. Specific bands amplified by nested PCR, with "out" indicating the first-round specific amplification product and "inner" indicating the second-round specific amplification product; B. Distribution of sequencing results from 15 monoclonal clones, with the arrows below indicating the cleavage site confirmed by 5' RACE; C. The predicted target site is consistent with the 5' RACE sequencing results;

[0027] Figure 10 shows the structure and expression level of tasiRNA derived from ZmTAS3j. A. tasiRNA structure, D1(+) to D10(+) indicate the positions of tasiRNA derived from the 3'-5' direction and are indicated by brackets, and D1(-) to D10(-) indicate the positions of tasiRNA derived from the 5'-3' direction and are indicated by brackets; B. tasiRNA expression level in the 3'-5' direction; C. tasiRNA expression level in the 5'-3' direction;

[0028] Figure 11 shows that tasiD5(+) and tasiD6(+) negatively regulate the expression of ZmARF3. A. Green fluorescence decreases after the addition of tasiD5(+) or tasiD6(+); B. ZmTAS3j mRNA decreases after the addition of tasiD5(+) or tasiD6(+);

[0029] Figure 12 Vector maps. A. AN101-ZmTAS3j; B. AN101-ZmTAS3jmut.

[0030] Figure 13 shows the phenotypic analysis of the WT, OE-ZmTAS3j, and OE-ZmTAS3jmut strains. A. Phenotypic analysis of the WT, OE-ZmTAS3j, and OE-ZmTAS3jmut strains after 10 days of growth in 1 / 2 MS medium; B. Phenotypic analysis of the WT, OE-ZmTAS3j, and OE-ZmTAS3jmut strains after 10 days of growth in 1 / 2 MS medium supplemented with 200 mg / L Pb(NO3)2.

[0031] Figure 14 shows the statistical analysis of phenotypic data for WT, OE-ZmTAS3j, and OE-ZmTAS3jmut lines. A. Rosette size, root length, and plant height; B. Number of lateral roots;

[0032] Figure 15 OE-ZmTAS3j carrier map.

[0033] Figure 16 shows phenotypic analysis of WT and OE strains under control and Pb stress conditions. A. ZmTA3j overexpression vector; B. ZmTA3j expression analysis; C. tasiARF expression analysis; D. ZmARF3 expression analysis; E. taproot length (PRL); F. root dry weight (RDW); G. total root length (TRL); H. phenotypes of each strain under control conditions; I. phenotypes of each strain after 7 days of Pb stress treatment.

[0034] Figure 17 shows the statistical analysis of lead content in roots of overexpressing ZmTAS3j and the effects of lead stress on root tissue structure and ultrastructure. A. Pb content in roots and leaves of WT and OE maize lines; B. Total Pb content of maize lines; C. Peak area of ​​lead aggregates; D and E. Transmission electron microscopy (TEM) images of WT and OE root tissues after Pb treatment, respectively; F and G. Pb aggregates in the cytoplasm of root tissues of WT and OE lines after Pb treatment, respectively; H and I. EDS images of WT, OE, and KO root tissues after Pb treatment, respectively. CW: cell wall; CT: cytoplasm; IS: intercellular space; aggregates: Pb aggregates;

[0035] Figure 18 shows the changes in indoleacetic acid (IAA) levels, hydrogen peroxide (H2O2) and malondialdehyde (MDA), superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) contents in WT and OE strains under control and Pb stress conditions. A and B. IAA content in roots from 0 to 72 h under control and Pb stress conditions; C and D. Changes in H2O2 content in roots from 0 to 72 h under control and Pb stress conditions; E and F. DAB staining of leaves under control and Pb stress conditions; G and H. Changes in MDA content in roots from 0 to 72 h under control and Pb stress conditions; I and J, Changes in SOD content in roots from 0 to 72 h under control and Pb stress conditions; K and L, Changes in POD content in roots from 0 to 72 h under control and Pb stress conditions; M and N, Changes in CAT content in roots from 0 to 72 h under control and Pb stress conditions;

[0036] Figure 19 shows the differentially expressed genes (DEGs) in wild-type (WT) and overexpression (OE) maize lines in response to Pb stress. A. Venn diagram of DEGs in WT and transgenic lines; B. Number of upregulated and downregulated genes; C. Heat map of gene expression in each experimental group; D. GO enrichment scatter plot of specifically expressed DEGs in OE lines under Pb stress; E. Heat map of specifically highly expressed genes in OE lines under Pb stress; red and blue colors in the heat map represent upregulated and downregulated genes, respectively. Specific implementation method:

[0037] Materials, methods and results analysis

[0038] 1. Identification of PHAS sites and phasiRNAs in response to Pb stress in maize

[0039] 1.1 Materials and Methods

[0040] 1.1.1 Experimental Materials This study used 305 inbred lines collected from the Southwest China Breeding Program for small RNA library construction and sequencing. The population materials were provided by the Maize Research Institute of Sichuan Agricultural University and mainly came from China, the United States, Mexico, etc.

[0041] 1.1.2 Test methods

[0042] (1) Preparation of corn hydroponic nutrient solution

[0043] The corn hydroponic nutrient solution used in this experiment was modified from the Hoagland formula. The specific formula is shown in Table 1.

[0044] Table 1 Formula of nutrient solution for corn seedling stage

[0045] (2) Corn seedling cultivation and stress treatment

[0046] 1) From the same batch of seeds, select uniform and plump seeds for later use.

[0047] 2) Soak in 10% hydrogen peroxide (H2O2) for 15 minutes, then rinse with distilled water three times, and finally soak in saturated calcium sulfate (CaSO4) overnight.

[0048] 3) Rinse the soaked seeds three times with distilled water, then transfer the seeds to a germination box, arrange them neatly, and culture them in the dark at 28°C for germination.

[0049] 4) Transfer seeds that have germinated about 1 cm to vermiculite and move them into the artificial climate room of the corn research institute (temperature and light-dark cycle set to 28°C / 14h and 22°C / 10h) until the corn seedlings grow to the stage of three leaves and one heart.

[0050] 5) Select 30 corn seedlings with uniform growth, remove the endosperm, and wash away the vermiculite remaining on the roots with clean water; fix the corn seedlings with foam rings and transfer them to a hydroponic device filled with half nutrient solution for 3 days of adaptive cultivation; then transfer them to a hydroponic device containing 1mM L -1 Stress treatment in nutrient solution containing Pb(NO3)2.

[0051] 6) After 24 hours of Pb stress treatment, all seedlings were washed twice with EDTA solution and then twice with water. Sampling was divided into two parts: first, sRNA-seq sequencing samples. Three plants from each inbred line were randomly selected and their roots were collected for RNA extraction and sequencing. Second, Pb content determination samples were collected. The roots and aerial parts of each inbred line after stress treatment were placed in kraft paper bags and dried in an 80°C oven to constant weight for subsequent Pb content determination.

[0052] (3) Extraction and detection of RNA from root tissues of corn seedlings

[0053] 1) RNA was extracted using a minimal amount of total RNA extraction kit for difficult-to-extract plants (Magen, R4165-03). For detailed procedures, see www.magentec.com.cn.

[0054] 2) Agarose gel electrophoresis: Analyze the integrity of the sample RNA and whether it is contaminated by DNA;

[0055] 3) NanoPhotometer spectrophotometer: detect RNA purity (OD260 / 280 and OD260 / 230 ratios).

[0056] (4) Construction, sequencing and data analysis of small RNA libraries

[0057] After 24 hours of Pb treatment, 3 plants were randomly selected from each inbred line to extract and sequence the roots for RNA extraction and sequencing to construct a small RNA library. Beijing Novogene Technology Co., Ltd. (https: / / www.novogene.com / ) was commissioned to complete the construction and sequencing of the small RNA library of the maize inbred line population, and the sequencing instrument was Illumina HiSeq2000. The specific sequencing process and data analysis process are shown in Figure 1A. After the test sample is qualified (RIN>7), the special structure contained in the 3' and 5' ends of the small RNA (the 3' end has a hydroxyl group and the 5' end has a complete phosphate group) is used to directly add adapters to both ends of the small RNA, and then reverse transcribe it into cDNA. Subsequently, after PCR amplification, PAGE gel electrophoresis is used to separate the target fragments, and the cDNA library is obtained by gel cutting and recovery, which is then sequenced on the machine to obtain high-quality sequencing data for subsequent PHAS site identification.

[0058] This study used the method proposed by Axtell and Guo et al. to identify PHAS sites and phasiRNAs, combined with a small RNA database to predict PHAS sites and phasiRNAs. We used the psRNATarget prediction website to identify miRNAs targeting PHAS sites. The detailed steps are shown in Figure 1B.

[0059] Detailed identification process of PHAS sites and phasiRNA:

[0060] 1) Identification of phasiRNA clusters

[0061] First, the raw data of the small RNA database must be processed, including removing adapters, reads with too low frequency (reads less than 3), multi-site matching (hit number>20), reads containing playA / T / G / C, and rRNA / snRNA / tRNA / miRNA, to obtain valid data (clean read). The present invention only identifies PHAS sites that produce 21nt, so only 21nt clean reads are screened for the next step of analysis. The filtered 21nt clean reads are aligned to the corn B73 V4 reference genome using bowtie, and the starting position, abundance, positive and negative chains, and chromosome position information that can match the small RNA are recorded. Those sites that are aligned to the repetitive region are removed to reduce background noise. The small RNA cluster in the genome is then identified, and the starting position of the small RNA on the genome is recorded.

[0062] The conditions that a cluster must meet refer to the identification process of Guo Qingli:

[0063] A. Each read is 21 nt long, and the interval between reads should be a multiple of 21. They are sorted in ascending order according to their position on the genome, P1, P2, P3...P n .

[0064] BP n -P n-1 If the length is ≤84 nt and there are more than 4 consecutive reads, the largest continuous segment that meets these conditions will be regarded as the phasiRNA cluster.

[0065] 2) Calculation method for screening PHAS sites

[0066] Each identified phasiRNA cluster was divided into 21 bins. The abundance of small RNAs in each bin (Bin_Abu), the abundance of small RNAs in each cluster (Cluster_Abu), the number of specific small RNAs in each bin (Bin_Num), and the bin length (bin_length) were calculated using the following formulas: 1) phase_ratio = unique number of small RNAs × 21 / bin_length, 2) phase_score = Abu_ration × Bin_Num × ln(Bin_Abu), and 3) Abu_ratio = Bin_Abu / Cluster_Abu. The phasi_ratio primarily represents the proportion of specific small RNAs in each bin, reflecting the degree to which specific small RNAs meet phase alignment criteria. A larger phase_ratio indicates a more pronounced head-to-tail phase alignment of the small RNAs. Abu_ratio represents the ratio of the abundance of a small RNA in a bin to the abundance of the identified cluster. A larger Abu_ratio indicates a higher abundance of small RNAs in that bin compared to other bins in the cluster, indicating that the site corresponding to that bin is likely a true PHAS site. Phase_score is a composite score of small RNA phase arrangement and small RNA abundance. Therefore, the number of small RNAs in each of the 21 bins in each cluster was counted, and the phase_ratio for each bin was calculated. Bins were then sorted from highest to lowest based on the phase_ratio value. Furthermore, the differential small RNA abundance in each of the 21 bins in each cluster was counted, and the Abu_ratio for each bin was calculated. Bins were then sorted from highest to lowest based on the Abu_ratio. Finally, the combined score (the sum of the phase_ratio and Abu_ratio rankings) was used to sort the sites in ascending order. Sites with lower combined scores are more likely to be PHAS sites producing phasiRNAs.

[0067] (5) Determination of Pb content:

[0068] 1) Pulverize the dried sample and weigh approximately 0.2 g of the sample powder into a microwave digestion tube. Perform three biological replicates for each sample, then add 10 ml of high-purity nitric acid.

[0069] 2) Place the sample in a microwave digester and select the plant digestion program: heat to 80°C for 5 minutes, hold for 5 minutes, then heat to 180°C and hold for 20 minutes to complete digestion.

[0070] 3) Place the digestion tube in an intelligent temperature-controlled electric heater (PreeKem, G-400) after opening the lid, and heat at 180°C to remove the acid until the remaining liquid is about 0.5 ml;

[0071] 4) Filter the remaining liquid with filter paper and rinse with ultrapure water three times. Collect the liquid and dilute to 10 ml.

[0072] 5) Debug the ICP-MS instrument before measurement and tune it with tuning fluid before measurement to ensure it is in the best operating state and improve the accuracy of the measurement data;

[0073] 6) After the instrument is tuned, prepare a standard curve using seven concentrations of 5, 10, 20, 40, 60, 80, and 100 ng / mL Pb solution. The correlation coefficient of the standard curve should be no less than 0.999.

[0074] 7) Calculate the Pb content of the sample based on the measured concentration and sample mass.

[0075] 1.2 Results and Analysis

[0076] To investigate the role of phasiRNA in Pb stress at the maize seedling stage, this study sequenced 305 genetically diverse inbred lines treated with Pb for 24 hours and constructed 305 small RNA libraries. After removing low-quality, contaminated, and adapter reads, and removing non-coding small RNAs such as rRNA, tRNA, snRNA, snoRNA, and miRNA, and retaining small RNAs of 20-24 nt, 1.78×10 9clear reads. The proportion of small RNA reads of different lengths was 16% (20nt), 20% (21nt), 26% (22nt), 22% (23nt), and 16% (24nt) respectively (Figure 2A). In this study, only PHAS sites that can produce 21nt pahsiRNA were analyzed, so only 21n small RNAs were retained. The distribution of their abundance in 305 inbred lines is shown in Figure 2B. Sequencing reads were analyzed using the comprehensive indicators phase_score ≥ 25 and phase_ratio ≥ 0.5 as thresholds. A total of 1,161,927 phasiRNAs (21nt) were derived from the 137 PHAS sites screened, of which 71 PHAS sites were located in gene models. However, some PHAS sites have long bin_lengths, resulting in an abnormally large number of specific small RNAs, thereby expanding the phase_score. These PHAS sites are generally considered to be false positive sites. To further exclude false-positive sites, we set Abu_ratio ≥ 0.3 as a more stringent filtering parameter to identify PHAS sites, identified 22 PHAS sites with corresponding gene models, and derived 423 specific phasiRNAs.

[0077] Generally, highly abundant phasiRNAs are functional small RNAs. Therefore, in this study, the expression levels of 423 specific phasiRNAs across all accessions were normalized by RPM. Using an average RPM ≥ 3 within each accession as the criterion, phasiRNAs with low expression abundance were filtered out, ultimately retaining 55 highly expressed phasiRNAs, which ultimately originated from 13 PHAS loci (Table 2). Based on the expression levels of these 55 phasiRNAs, 305 maize inbred lines were divided into four groups (I, n = 27; II, n = 73; III, n = 154; IV, n = 51) using k-mean cluster analysis (Figure 3A). The expression levels of phasiRNAs in Groups I and IV were significantly higher than those in Groups II and III (P < 0.01) (Figure 3B). The Pb content in the roots of Groups I and IV was extremely significantly lower (P < 0.01) than that of Groups II and III (Figure 3C). It is speculated that the differential expression of phasiRNAs affects Pb content in maize roots.

[0078] Correlation analysis between the expression levels of 55 phasiRNAs in each crossbreeding material and root Pb content revealed that 41 phasiRNAs, originating from nine PHAS loci, were significantly negatively correlated with root Pb content (P < 0.05), with correlation coefficients ranging from -0.141 to -0.328. Based on the sequences of the 41 phasiRNAs that were significantly negatively correlated with Pb content at the maize seedling stage, target genes for these phasiRNAs were predicted using the website http: / / plantgrn.noble.org / psRNATarget / . Gene ontology (GO) enrichment analysis of phasiRNA target genes was then performed using online tools at http: / / geneontology.org / . These target genes were found to participate in multiple ion transport pathways, including potassium, inorganic cation, and sodium transport (Figure 3D). This suggests that phasiRNAs produced in maize roots may participate in multiple ion transport pathways by regulating the expression of their target genes, and may also be involved in Pb absorption and transport, thereby contributing to Pb absorption and transport at the maize seedling stage.

[0079] Table 2 PHAS sites derived from high-abundance phasiRNAs

[0080] 2. eGWAS analysis highlights the important role of PHAS_1 in lead tolerance in maize

[0081] 2.1 Materials and Methods

[0082] A genome-wide association study (eGWAS) of gene expression was performed using the expression levels of nine PHAS genes negatively correlated with Pb content in 305 maize inbred lines, combined with 56,110 single-nucleotide polymorphisms (SNPs). After removing SNPs with >20% missing data, minor allele frequency <0.05, or heterozygosity >20%, a total of 43,668 high-quality SNPs were obtained. The MLM (Q+K) model was used to test the association between each SNP and the expression levels of these PHAS genes. The significance threshold was P = 0.05 / number of SNPs (1.14×10 -6 ).

[0083] 2.2 Results and Analysis

[0084] 2.2.1 eGWAS analysis results

[0085] This study identified nine PHAS genes involved in maize Pb stress response. This study combined 43,668 SNPs with the expression levels of these nine genes in population materials to conduct an eGWAS analysis to identify significant SNPs affecting the expression of these genes. Using the MLM (Q+K) model, the P=0.05 / SNP number (1.14×10 -6) was used as the screening threshold, and significant SNP sites were detected in 4 PHAS genes, namely PHAS_1 (3 SNPs), PHAS_2 (22 SNPs), PHAS_6 (3 SNPs) and PHAS_12 (1 SNP) (Figure 4A-D). According to previous studies, the determination of eQTL should meet the following conditions: the number of SNPs significantly associated with a certain trait should be no less than three, and the position interval should be less than 5kb. According to the previous identification conditions, this study only identified one candidate eQTL (eQTL1), which included three significant SNPs (PZE-109085571, PZE-109085594 and SYN21521), all of which were located in the PHAS_1 gene and were promoter or exon variants. Among them, PZE-109085594 had the lowest P value (7.36×10 -12 ), and is therefore considered the most important SNP locus for eQTL1. The maize population was classified according to the genotype of PZE-109085594, primarily into two alleles, A and G, encompassing 154 and 103 maize lines, respectively. ANOVA results showed that the average expression level of the PHAS_1 gene in lines with the A allele (551.61 TPM) was significantly lower than that in lines with the G allele (2092.13 TPM) (P = 3.12 × 10-32) (Figures 4E and 4G). However, the Pb content in the roots of maize plants with the A allele was significantly higher than that of plants with the G allele (P = 0.022) (Figure 4F). In summary, eQTL1 affects Pb content in maize seedling roots by regulating PHAS_1 expression.

[0086] 2.2.2 PHAS_1 is a new member of the TAS3 gene family (ZmTAS3j)

[0087] Thirteen phasiRNAs derived from PHAS_1 were retained and showed significant negative correlation with the Pb content in maize roots. The correlation coefficients of phasiRNA_136742998, phasiRNA_136743059, and phasiRNA_136743017 with the Pb content in maize roots at the seedling stage were -0.328 (P = 2.88 × 10 -6 ), -0.318(P=6.02×10 -6 ) and -0.304 (P = 1.55 × 10 -5At the same time, the target genes of tasiRNAs derived from PHAS_1 were predicted by the website http: / / plantgrn.noble.org / psRNATarget / . phasiRNA_136743059 and phasiRNA_136743080 located in phases 5 and 6 targeted multiple ZmARF genes, such as Zm00001d039006, Zm00001d043922, Zm00001d012731, Zm00001d038698, Zm00001d043431 and Zm00001d042267, among which Zm00001d039006, Zm00001d043922, Zm00001d012731 and Zm00001d038698 all belong to the ZmARF3 gene family. Therefore, PHAS_1 meets the characteristics of the TAS3 gene family and is named ZmTAS3j.

[0088] 3. ZmTAS3j is targeted for cleavage by miR390

[0089] 3.1 Materials and Methods

[0090] 3.1.1 Test materials

[0091] The tobacco used in this study was Nicotiana benthamiana. Seeds of Nicotiana benthamiana were stored by the research group and cultured in the plant culture laboratory of Sichuan Agricultural University. The expression vectors pCAMBIA2300-35S-eGFP and pRI101-AN were also stored by the research group. Agrobacterium tumefaciens used for transformation was GV3101, purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0092] 3.1.2 Test methods

[0093] (1) Construction of ZmTAS3 and eGFP fusion expression vector

[0094] The pCAMBIA2300-35S-eGFP expression vector was used as the base vector. The target fragment of the ZmTAS3j gene was constructed into the pCAMBIA2300-35S-eGFP expression vector by homologous recombination using the restriction site BsrGI (TGTACA) for single digestion. The vector was named 35S:eGFP-ZmTAS3j. The vector map is shown in Figure 5. The primers for vector construction were GFP-ZmTAS3j-F: tcggcatggacgagctgtacaGCGGTTTCGTTCTCCTTCCT; GFP-ZmTAS3j-R: atgcctgcagttacttgtacaCTCAACACAGCTCAGAAGGGAT.

[0095] (2) Construction of miR390 overexpression and STTM390 vector

[0096] Using pRI101-AN as the basic expression vector and EcoRΙ (GAATTC) as the single restriction enzyme cutting site, the MIR390 sequence was constructed into pRI101-AN by homologous recombination and named 35S:MIR390. The vector map is shown in Figure 6A. The vector construction primers are AN101-miR390-F: gggggtaccggatccgaattcCATTCCCATCCGTTCCTGCT; AN101-miR390-R: agagttgttgattcagaattcGCGTGTACCTGACGAGAGAC.

[0097] A 146bp STTM (Short Tandem Target Mimic) fragment containing two miR390 target sites was synthesized by Qingke Biotechnology. Three base mismatches occur at the miR390 targeted cleavage site, forming a bubble that prevents miR390 cleavage, thereby adsorbing miR390 and inhibiting its targeted cleavage of the target gene ZmTAS3j. Using the pRI101-AN basic expression vector and EcoRI (GAATTC) as a single restriction site, the STTM390 (146bp) sequence was constructed into pRI101-AN via homologous recombination and designated 35S:STTM390. A map of the STTM vector is shown in Figure 6B. STTM390 fragment sequence: catttggagaggacagcccaagcttGGCGCTATctaTCCTGAGCTTgttgttgttgttatggtctaatttaaatatggtctaaagaagaagaatGGCGCTATctaTCCTGAGCTTgaattcggtacgctgaaatcaccag.

[0098] (3) Tobacco transient expression system verifies that miR390 targets and regulates the expression of ZmTAS3j

[0099] The 35S:eGFP-ZmTAS3j, AN101-MIR390, and AN101-STTM390 vectors were transformed into Agrobacterium GV3101, and the bacterial solution was tested by PCR to identify positive clones. The targeted cleavage of ZmTAS3j by miR390 was verified using a tobacco transient expression system. If ZmTAS3j can be targeted by miR390, the expression of eGFP protein will gradually weaken with the increase of miR390 concentration. When the target gene STTM390 bacterial solution is added, miR390 is adsorbed by the STTM390 sequence, which reduces the targeted cleavage of the ZmTAS3j gene sequence by miR390, thereby weakening the inhibition of eGFP expression and increasing the fluorescence intensity. The specific steps of tobacco transient expression are as follows:

[0100] 1) Pick each positive clone after transformation and add 1 ml of YEP medium containing the corresponding resistance (Kan and Rif, concentration ratio 1:1000) and culture at 28°C with a shaker at 250 rpm for 16 h;

[0101] 2) Transfer the Agrobacterium from the small shake into a flask containing 50 ml of resistance culture medium (Kan and Rif, concentration ratio 1:1000) and culture overnight (approximately 16-18 hours). When the bacterial solution has an OD value of approximately 1.0, centrifuge at 4000 rpm for 10 minutes at room temperature and collect the bacterial solution.

[0102] 3) Resuspend the bacteria in 10 mM MgCl2 (MES and AS added at a ratio of 1:1000) and adjust the concentration of the Agrobacterium transformed with the 35S:eGFP-ZmTAS3j vector to an OD600 of 0.6; set three concentration gradients of 35S:MIR390 Agrobacterium (OD600 of 0.6, 1.0, and 1.4, respectively); adjust the OD600 of Agrobacterium expressing the STTM390 vector to 1.0;

[0103] 4) Select well-grown and uniform Nicotiana benthamiana (approximately one month old and not yet flowering) and mix different concentrations of miR390 bacterial solution (OD600 0.6, 1.0, and 1.4) with the target gene bacterial solution (OD600 0.6) in equal proportions and inject them into tobacco leaves;

[0104] 5) Mix the miR390 concentration of 1.0, the target gene concentration of 0.6, and the STTM390 expression vector containing Agrobacterium at a concentration of 1.0 in equal proportions and inject into tobacco;

[0105] 6) The injected tobacco plants were placed in a tobacco culture chamber, and eGFP fluorescence was observed using a fluorescence confocal microscope (LSM 800, ZEISS, Germany) 48 hours later.

[0106] (4) 5' RACE verification of miR390-mediated targeted splicing site of ZmTAS3j

[0107] This study used The RLM-RACE Kit (Invitrogen) was used to verify the specific cleavage site of the ZmTAS3j gene by miR390. Since the target fragments of 5' RACE are degradation fragments formed by miRNA cleavage of the target gene, these degradation fragments do not have a cap structure at the 5' end but have an exposed monophosphate group. Therefore, no decapping and dephosphorylation treatment is required before adding an adapter to the 5' end. The remaining steps were performed according to the kit instructions. Nested PCR primers Race-out: TCAGCCACCATCTTTATCCTTCCTCARace-inner: AGATCAGGTCTTCTTGACCTTGCA were designed based on the target gene sequence. PCR amplification was performed, and the expected single fragment was cut from the gel and the PCR product was recovered using a gel recovery kit (Hipure Gel Pure DNA Mini kit, Magen). The gel recovery product was then ligated to Blant and sent for sequencing.

[0108] (5) Tobacco transient expression system verifies that tasiARF negatively regulates the expression of ZmARF3

[0109] Following the method of Montgomery et al. for modifying miRNA precursor structures, the mature miR390 sequence was replaced with tasiD5(+) and tasiD6(+) based on the miR390 sequence. The miR390 sequence was replaced with sequences complementary to tasiD5(+) and tasiD6(+). Through sequence modification, miR-D5(+) and miR-D6(+) were constructed, as shown in Figure 7. Sequence alignment of the ZmARF3 gene family revealed that genes in the ZmARF3 family contain two tasiARF target recognition sites, and the sequences of these two target sites are relatively conserved. Target fragments were amplified by PCR using maize B73 cDNA as a template and recovered using a gel recovery kit. Specific steps were described in the kit instructions (Hipure Gel Pure DNA Mini kit, Magen). Subsequently, using the pCAMBIA2300-35S-eGFP expression vector as the base vector, the conserved ARF3 gene sequence was constructed into the pCAMBIA2300-35S-eGFP expression vector using the BsrGI (TGTACA) restriction enzyme cutting site and homologous recombination. The vector was named pCAMBIA2300-35S-eGFP-ZmARF3. The pCAMBIA2300-35S-eGFP-ZmARF3 Agrobacterium solution was co-injected into tobacco leaves with miR-D5(+) or miR-D6(+), and the pCAMBIA2300-35S-eGFP-ZmARF3 Agrobacterium solution was injected into tobacco leaves alone. The injected tobacco leaves were placed in the plant culture room of Sichuan Agricultural University, and eGFP fluorescence was observed 48 hours later using a fluorescence confocal microscope (LSM 800, ZEISS, Germany).

[0110] (6) RNA extraction, reverse transcription, and quantification of ARF3 gene

[0111] Tobacco leaves were collected 48 hours after Agrobacterium infection, frozen in liquid nitrogen, and ground. RNA was extracted using a plant total RNA miniprep kit (Magen, R4165-03). For detailed protocols, see the manufacturer's instructions at www.magentec.com.cn. First-strand cDNA was synthesized using a reverse transcription kit (First Strand cDNA Synthesis Kit, novoprotein). Forward and reverse primers were designed, and ARF3 was quantified using a SYBR qPCR SuperMix Plus kit (novoprotein). The specific experimental system was described in the kit's instructions. The tobacco 18s gene was used as an internal reference gene. Quantitative primers for the target gene and internal reference gene were: AtARF3-F: AGGTTCTGCATCACCCTCAC, At-ARF3-R: GGTTCACGCCAGTAGCATCT, AtActin-F: TGGAATCCACGAGACAACCTA, AtActin-R: TTCTGTGAACGATTCCTGGAC. All experiments were performed in triplicate, and relative gene expression levels were analyzed using Excel.

[0112] 3.2 Results and Analysis

[0113] 3.2.1 ZmTAS3j is targeted for cleavage by miR390

[0114] The present invention verified that miR390 negatively regulates the expression of ZmTAS3j using a tobacco transient expression system. Agrobacterium transformed with a 35S:eGFP-ZmTAS3j overexpression vector was mixed with different concentrations of miR390 Agrobacterium in equal proportions and then injected into tobacco. It was found that green fluorescence in tobacco leaves was strongest when 35S:eGFP-ZmTAS3j Agrobacterium was injected alone. When it was mixed with miR390 Agrobacterium at concentrations of 0.6, 1.0, and 1.4 in equal proportions and co-expressed in tobacco leaves, the green fluorescence intensity gradually weakened with increasing miR390 concentrations. When the miR390 Agrobacterium concentration was increased to 1.4, the green fluorescence almost disappeared. However, when STTM390 Agrobacterium was added in equal proportions to the mixture of 35S:eGFP-ZmTAS3j and miR390 (OD600 1.0), green fluorescence in the tobacco leaves was restored (Figure 8A). At the same time, quantitative qRT-PCR analysis showed that the expression levels of ZmTAS3j and eGFP gradually decreased with increasing miR390 concentration. When STTM390 Agrobacterium was added, the expression levels of eGFP and ZmTAS3j genes in tobacco leaves were significantly increased (Figure 8B, C). These results indicate that miR390 targets and cleaves ZmTAS3j, resulting in a decrease in the green fluorescence signal.

[0115] In this study, 5' RACE was used to verify the specific location of miR390-mediated targeted cleavage of ZmTAS3j. First, RNA was extracted from tobacco leaves co-expressing 35S:GFP-ZmTAS3j and miR390 in Agrobacterium tumefaciens. Following the protocol of the 5' RACE kit, the 5' linker sequence was ligated using T4 ligase. The sequence was then reverse-transcribed into cDNA using random primers. Specific primers were designed using primers containing the linker sequence and the ZmTAS3j sequence, and nested PCR was used to amplify specific bands (Figure 9A). Subsequently, the clones were transformed into Escherichia coli after ligation, and 15 single clones were randomly selected for sequencing. Sequencing results showed that the targeted cleavage of ZmTAS3j by miR390 occurred primarily between bases 10 and 11 of the 3' miR390 target site (9 of 15), a typical location for miRNA-mediated cleavage (Figures 9B and C).

[0116] 3.2.2 miR390 targets ZmTAS3j and derives tasiRNA along the 5′ direction

[0117] MiR390 targets TAS3 family genes in a typical "two-hit" pattern, with the sequence between the two target sites serving as the precursor sequence for tasiRNA production. The aforementioned 5' RACE assay confirmed that the cleavage site occurs between bases 10 and 11 of the 3' miR390 target site. DCL4 initiates this cleavage site and cleaves along the 5' end of the sequence, generating a series of phased tasiRNAs (Figure 10A). Bioinformatics analysis of a small RNA sequencing database revealed that perfectly phased tasiRNAs are generated along this cleavage site, with high tasiRNA abundance. Subsequently, tasiRNA expression was further verified by small RNA quantitative analysis. When 35S:eGFP-ZmTAS3j and miR390 Agrobacterium were co-expressed in tobacco leaves, the expression levels of multiple tasiRNAs were higher than those in leaves expressing 35S:eGFP-ZmTAS3j alone, with tasiARF (D5(+)) showing the highest expression abundance (Figure 10B and C).

[0118] 3.2.3 ZmTAS3j-derived tasiARFs target the ZmARF3 gene family

[0119] In this study, ZmTAS3j-derived tasiRNAs targeted ZmARF3 at the D5(+) and D6(+) sites. Subsequently, we used transient expression of eGFP in tobacco to verify the targeted splicing of ZmARF3 by ZmTAS3j-derived tasiARFs. We constructed the recombinant vector 35S:eGFP-ZmARF3 and injected the constructed 35S:eGFP-ZmARF3 into tobacco with tasiD5(+) or tasiD6(+) Agrobacterium. We found that green fluorescence was reduced in tobacco leaves co-expressed with tasiD5(+) or tasiD6(+) (Figure 11A). qRT-PCR analysis revealed that the expression level of ZmARF3 was also significantly reduced, consistent with the fluorescence observation results (Figure 11B). These results indicate that ZmTAS3j-derived tasiARFs target ZmARF3 at the transcriptional level, ultimately leading to the degradation of ZmARF3 mRNA.

[0120] 4. Overexpression of ZmTAS3j enhances Arabidopsis tolerance to Pb stress

[0121] 4.1 Materials and Methods

[0122] 4.1.1 Test materials

[0123] The wild-type (Col-0) Arabidopsis seeds used in this study were preserved in our laboratory, Escherichia coli Mach1-T1 was purchased from Biolabs, GV3101 Agrobacterium was purchased from Shanghai Weidi Biotechnology Co., Ltd., and the pRI101-AN expression vector was preserved in our laboratory for a long time.

[0124] 4.1.2 Test methods

[0125] (1) Vector construction

[0126] Total RNA of the B73 inbred line was extracted and reverse transcribed into cDNA. The ZmTAS3j transcript sequence was amplified. The ZmTAS3j gene sequence was constructed into pRI101-AN basic expression vector and EcoR1 (GAATTC) as a single restriction enzyme cutting site by homologous recombination and named AN101-ZmTAS3j ( Figure 12A ). The homologous recombination primers were AN101-ZmTAS3j-F: gggggtaccggatccgaattcGCGGTTTCGTTCTCCTTCCT, and AN101-ZmTAS3j-R: agagttgttgattcagaattcGCAGCTTATTCCATCGAGGC. At the same time, the target site of miR390 at the 5' end in ZmTAS3j was mutated by mismatch PCR amplification, destroying the target site of miR390 at the 5' end of the ZmTAS3j gene sequence. The pRI101-AN basic expression vector and EcoRI (GAATTC) were used as a single restriction enzyme cutting site. The mutated ZmTAS3j gene sequence was constructed into pRI101-AN by homologous recombination and named AN101-ZmTAS3mut ( Figure 12B ). The homologous recombination primers were ZmTAS3jmut-R: aatttcctattgcggGTGCTGATGCTAGGCATG, ZmTAS3jmut-F: ccgcaataggaAATTGAGCTTTTCAGCCACCA

[0127] (2) Arabidopsis genetic transformation

[0128] The AN101-ZmTAS3j and AN101-ZmTAS3jmut plasmids were transformed into Agrobacterium tumefaciens GV3101, and the inflorescences of wild-type Arabidopsis thaliana were infected using the inflorescence immersion method to obtain transgenic plants. The specific method is as follows:

[0129] 1) Wild-type Arabidopsis plant cultivation: Directly sow wild-type Arabidopsis seeds onto the surface of the soil. When the seedlings develop 4-5 true leaves, transplant them to new culture boxes, culturing two plants per box, and place them in a short-day incubator for vegetative growth. After the Arabidopsis seedlings have reached vegetative growth, transfer them to a long-day incubator for reproductive growth until most of the Arabidopsis plants have bolted.

[0130] 2) Agrobacterium activation: The transformed Agrobacterium was inoculated into 50 ml of YEP medium containing the corresponding antibiotics (Kan and Rif, at a concentration ratio of 1:1000) and cultured overnight at 28°C, 200 rpm until the OD600 absorbance reached 0.8-1.0.

[0131] 3) Preparation of the impregnation solution: Prepare the impregnation solution (5% sucrose solution) in advance and add a surfactant (Silwet L-77) to the impregnation solution at a ratio of 1:10000 to resuspend the bacterial solution;

[0132] 4) Inflorescence Dip Transformation: Remove the opened flowers of wild-type Arabidopsis and soak the remaining inflorescences in the resuspended bacterial solution for 1 minute. After transformation, cover the Arabidopsis with a fresh-keeping bag and invert it in the dark overnight. The next day, culture it under normal lighting conditions. One week later, perform a second inflorescence dip.

[0133] 5) Seed collection: Collect mature Arabidopsis siliques after genetic transformation, dry them in a 37°C oven, and store them at 4°C;

[0134] 6) Positive Seed Screening: Prepare 1 / 2 MS medium supplemented with the appropriate antibiotic (Kan). Wash Arabidopsis seeds with 70% alcohol for 1 minute, then sterilize with 1% NaClO for 10 minutes. Rinse the seeds six times with sterile water. Evenly spread the sterilized Arabidopsis seeds on the 1 / 2 MS medium, 60-100 seeds per dish. Air-dry the surface moisture from the seeds, seal the dish, and place in a 4°C refrigerator for vernalization for 2-3 days. Remove the seeds and place them under light conditions for positive seed screening. After 10-15 days, select positive plants. Plants with green leaves, elongated epicotyls, and normal rooting are considered positive plants and transplant them into culture soil.

[0135] (3) Positive identification of Arabidopsis transgenic lines

[0136] After Kanamycin (Kan) selection, a leaf was excised from each transgenic plant, placed in a 2.0 EP tube, and ground with liquid nitrogen to extract DNA. Specific PCR primers were designed based on the target sequence. Plants containing the target band were considered positive. The primer sequences for Arabidopsis positive plants are: F: GACGTAAGGGATGACGCACA; R: ACGATCGGGGAAATTCGAGC. Subsequent generations of Arabidopsis positive plants were screened as described above until a homozygous transgenic line was identified for subsequent experiments.

[0137] (4) Pb stress treatment and phenotypic identification of transgenic Arabidopsis lines

[0138] Wild-type seeds of Columbia, T3 homozygous lines transformed with the AN101-ZmTAS3j vector, and T3 homozygous lines transformed with the AN101-ZmTAS3jmut vector were germinated on 1 / 2 MS solid medium. After 7 days, half of the wild-type seedlings and each transgenic line were transferred to 1 / 2 MS solid medium supplemented with 200 mg / L Pb(NO3)2 (Pb treatment), while the remainder were transferred to 1 / 2 MS solid medium without Pb(NO3)2 (CK). After 10 days of culture, wild-type Col-0 plants were used as negative controls to assess Arabidopsis seedling traits including rosette diameter, plant height, root length, number of lateral roots, and total root length. Rosette diameter, plant height, and root length were measured with a ruler. Root images were scanned using an Epson Expression 10000XL scanner, and lateral root number and total root length were counted using WinRHIZO software. The phenotypic trait data of Arabidopsis thaliana were statistically analyzed using IBM SPSS Statistics 19 software.

[0139] 4.2 Results and Analysis

[0140] To investigate the role of ZmTAS3j in plant tolerance to lead stress, we cultured Col-0, ZmTAS3j-OE, and ZmTAS3jmut-OE plants under control (1 / 2 MS medium) and Pb-stress (1 / 2 MS medium containing 200 mg / L Pb(NO₃)₂) conditions. Under both control and Pb-treated conditions, the ZmTAS3j-OE line exhibited an increased number of lateral roots and a more developed root system compared with ZmTAS3jmut-OE and Col-0 plants (Figure 13A and B). Furthermore, under Pb stress, the ZmTAS3j-OE line exhibited significantly greater rosette size, plant height, taproot length, and lateral root number than Col-0 (Figure 14A and B). With the exception of the significantly longer taproot length, the ZmTAS3jmut-OE line showed no significant differences in the other traits mentioned above (Figure 14A and B). These results indicate that ZmTAS3j is a positive regulator of lead tolerance in Arabidopsis.

[0141] 5. Overexpression of ZmTAS3j promotes maize root growth under Pb stress

[0142] 5.1 Materials and Methods

[0143] 5.1.1 Plant materials

[0144] Maize inbred line KN5585, overexpression line (OE) obtained with KN5585 (WT) as background material.

[0145] 5.1.2 Test method

[0146] (1) Overexpression vector construction

[0147] Using Ubi as the promoter, nos as the terminator, and Bar as the selectable marker gene, primers for amplifying the target gene fragment were designed according to the ZmTAS3j sequence. The ZmTAS3j gene fragment was amplified and BamHI (GGATCC) was used as the restriction site. The OE-ZmTAS3j overexpression vector was constructed by homologous recombination for maize genetic transformation (Figure 15). The primers for vector construction were OE-ZmTAS3j-F: gcaggtcgactctagaggatccGCGGTTTCGTTCTCCTTCCTGC; OE-ZmTAS3j-R: tcgagctcggtacccggggatccGCAGCAGCTTATTCCATCGAGGC.

[0148] (2) Positive identification of transgenic maize lines

[0149] This study used excised endosperm PCR to identify positive seeds from each transgenic line. Two pairs of primers were designed. The first pair was based on the sequence of the marker gene Bar: F / R primers (F: CCATCGTCAACCACTACATCGAGACA; R: CTTCAGCAGGTGGGTGTAGAGCGT). To further eliminate false positives, a sequence from the Ubi promoter was used as the F primer (F: TTGTCGATGCTCACCCTGTTG) and a sequence from the target gene ZmTAS3j was used as the R primer (R: CTCATCATGCCAAGCGGACA). PCR identification with these two primer pairs allowed the selection of positive overexpression seeds for subsequent experiments.

[0150] (3) Reverse transcription and qRT-PCR analysis of ZmTAS3j and tasiRNA

[0151] Homozygous transgenic lines were sampled and high-quality RNA was extracted using a total RNA small-quantity extraction kit (Magen, R4165-03). For detailed operation steps, please refer to www.magentec.com.cn. Small RNA extraction refers to the experimental steps of the plant small RNA extraction kit (Magen, R4312). The extracted total RNA was reverse transcribed into cDNA according to the kit's First-strand cDNA synthesis. The specific reaction system and reaction procedure refer to the kit instructions. Using Mir-X TMThe miRNA First-Strand Synthesis Kit was used to tail small RNAs and reverse transcribe them into cDNA. The specific reaction system and procedure were referred to the kit's instructions. Target genes were quantified using a SYBR qPCR SuperMix Plus kit (novoprotein). Actin and U6 served as internal reference genes for quantification, respectively. The primer sequences for Actin were: F:TGGAATCCACGAGACAACCTA, R:TTCTGTGAACGATTCCTGGAC; the primer sequences for U6 were: F:CTCGCTTCGGCAGCACA, R:AACGCTTCACGAATTTGCGT.

[0152] (4) Pb stress and phenotypic identification of transgenic maize lines

[0153] In this study, seeds from two maize overexpression lines (designated OE-1 and OE-2) and the wild-type (WT) were sterilized with 2% NaClO for 15 minutes, rinsed three times with distilled water, and finally soaked overnight in saturated calcium sulfate (CaSO₄). The soaked seeds were then rinsed three times with distilled water and transferred to germination boxes, arranged neatly, and incubated at 28°C in the dark for germination. Seeds germinated approximately 1 cm in diameter were transferred to quartz sand and grown in a greenhouse at 70% relative humidity, with a light / dark cycle of 28°C / 14h and 22°C / 10h. Once the seedlings reached three leaves and one heart, they were acclimated to Hoagland nutrient solution for 3 days. The seedlings were then transferred to a modified Hoagland solution supplemented with 1 mM / L Pb(NO₃)₂ (Pb treatment). The pH of the solution was maintained at 4.5±0.1 with HCl or NaOH (0.1 M) as needed. After 7 days of incubation, maize plants under Pb stress and control conditions were harvested and measured for plant height, aboveground fresh weight, root fresh weight, aboveground dry weight, root dry weight, and chlorophyll content. Roots of individual plants were scanned using an Epson Expression 10000XL scanner, and traits such as total root length (TRL), taproot length (PRL), and root area were analyzed using WinRHIZO software. Phenotypic trait data were statistically analyzed using IBM SPSS Statistics 19 software.

[0154] 5.2 Results and Analysis

[0155] In order to further study the role of ZmTAS3j in the response to Pb stress in the seedling stage of corn, this study obtained ZmTAS3j overexpression corn lines by transgenic technology, and the ZmTAS3j gene model is shown in Figure 16A. The present invention selects two lines (OE-1, OE-2) with high ZmTAS3j expression for subsequent experimental analysis (Figure 16B). After obtaining homozygous transgenic lines, by qRT-PCR analysis, the expression levels of ZmTAS3j and tasiARF (D5 (+) and D6 (+)) in the two OE lines were significantly higher than those in the wild type (WT) (Figure 16C). In addition, quantitative analysis of the target gene ZmARF3 of tasiARF found that the expression level of ZmARF3 in the OE lines was lower than its expression level in WT, further confirming that the tasiARF derived from ZmTAS3j targeted shearing ZmARF3 (Figure 16D).

[0156] The present invention observed the growth status of OE strains and WT plants under control conditions and 1mM / L Pb(NO3)2 stress treatment conditions. Under control and Pb stress treatment conditions, the main root length (PRL) of the OE strain increased by 30.90-38.35% and 27.28-33.13% compared with WT, respectively (Figure 16E). Under Pb stress, the root dry weight (RDW) and total root length (TRL) of the OE strain increased by 18.47-19.74% and 24.88-56.02% compared with WT, respectively (Figures 16F and G); under control conditions, there was no significant difference in RDW and TRL between OE and WT (Figures 16F and G). These results indicate that under Pb stress, overexpression of ZmTAS3j can promote the growth of corn main roots, thereby having a positive effect on the increase of corn root length and biomass (Figures 16H and I).

[0157] 6 Overexpression of ZmTAS3j reduces cell wall thickness and Pb polymer accumulation in maize root cells

[0158] 6.1 Materials and Methods

[0159] 6.1.1 Test materials

[0160] The maize KN5585 (WT) and the ZmTAS3j overexpressing transgenic line (OE) are shown above.

[0161] 6.1.2 Test method

[0162] TEM-EDS ultramicrolocalization of Pb distribution in root cells and determination of Pb content: WT and OE roots after 7 days of Pb stress were fixed with FAA → eluted → fixed with osmium tetroxide → washed → replaced → infiltrated → embedded → polymerized → ultrathin sectioned → stained and examined under a microscope. The ultrastructure of the ultrathin sections was then observed and photographed using TEM, and elemental analysis of black spots or black aggregates was performed using EDS. After 7 days of treatment with 1mM Pb(NO3)2, the corn seedlings were washed twice in a 20mM EDTA solution and then rinsed three times with distilled water. After the aerial parts and roots were dried to constant weight, the aerial parts and roots of each strain were divided into three replicates for the determination of Pb content in the aerial parts and roots. The method was the same as the Pb content determination method in 1.1.2.

[0163] 6.2 Results and Analysis

[0164] In order to further study the role of overexpression of ZmTAS3j in the absorption and accumulation of Pb in corn seedlings, the present invention measured the Pb content in the aboveground parts and roots of OE and WT strains after 7 days of Pb stress treatment. The results showed that the Pb content (RLC) in the roots of the two OE strains was 1574.52 mg / kg and 1032.68 mg / kg, respectively, which was significantly lower than 2339.54 mg / kg DW of WT (P<0.001) (Figure 17A). There was no significant difference in the Pb content (SLC) of the aboveground part of the OE strain compared with that of WT (Figure 17A). In addition, the present invention calculated and analyzed the total Pb content in OE and WT plants and found that the total Pb content of the OE strain was significantly lower than that of the WT strain (P<0.001) (Figure 17B).

[0165] The present invention used transmission electron microscopy-energy dispersive spectroscopy (TEM-EDS) to investigate the accumulation of Pb in the root cells of OE and WT plants. The results showed that Pb existed mostly in aggregates in WT root cells, while aggregation was not obvious in OE lines (Figure 17E, G). These Pb aggregates tended to be deposited in the root cytoplasm and around the cell membrane, with some deposited in the intercellular spaces. The cell walls of WT roots were significantly thicker than those of OE roots, resulting in an increase in Pb ions and their aggregates in the root cells (Figure 17D, F). In addition, EDS-X-ray microanalysis showed that the sediments in the root tissue included elements such as Cl, C, O, Fe, Co, Cu, and Pb. Ten Pb-containing compounds were detected in the sediments of WT and OE roots. Among them, four Pb compounds showed obvious peaks (Figure 17H ​​and I), and the total peak area of ​​these Pb compounds was significantly smaller in the OE line than in the WT line (P<0.05) (Figure 17C, H, and I). In summary, ZmTAS3j negatively regulates the cell wall thickness and accumulation of Pb polymers in maize root cells.

[0166] 7. Overexpression of ZmTAS3j significantly increased the IAA content and ROS scavenging ability of maize roots

[0167] 7.1 Materials and Methods

[0168] 7.1.1 Test materials

[0169] After Pb stress treatment, the roots of the overexpression lines (OE-1, OE-2) and the wild type (WT) were collected at 0 h, 24 h, 48 h, and 72 h after Pb treatment, and three biological replicates were taken for each line at each time point.

[0170] 7.1.2 Test method

[0171] (1) IAA content determination

[0172] The IAA content in the samples was determined using a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) kit. The specific absorbance at a wavelength of 450 nm was determined on a microplate reader, and the IAA concentration in the samples was calculated based on a standard curve.

[0173] (2) Determination of antioxidant system activity and DAB staining

[0174] The antioxidant system activity was determined by referring to the SOD detection kit (Solarbio BC0175), POD detection kit (Solarbio BC0095), CAT detection kit (Solarbio BC0205), H2O2 detection kit (Solarbio BC3559), and MDA detection kit (Solarbio, BC0025) to measure the SOD, POD, and CAT activities, and the H2O2 and MDA contents in the above root samples, respectively.

[0175] At the same time, leaves of OE lines and wild-type (WT) plants were collected after 72 h of control and Pb treatment, and the distribution of H2O2 was detected by DAB staining. The Pb-treated leaves were treated in 1% DAB solution at room temperature for 24 h, and then the leaves were boiled in bleaching solution (75% ethanol) to remove chlorophyll, and the leaf images were captured using an Epson Expression 10000XL scanner.

[0176] 7.2 Results and Analysis

[0177] To investigate whether ZmTAS3j is involved in regulating endogenous auxin (IAA) levels, this study further measured the IAA content in OE and WT roots. Under both control and Pb stress conditions, the IAA content in the roots of the OE strain increased sharply from 0 to 24 hours, reaching a maximum at 24 hours, then gradually decreased and stabilized between 48 and 72 hours (Figures 18A and B). This study found that the IAA level in the roots of the OE strain was significantly higher than that of the WT plants under both control and Pb stress conditions from 0 to 72 hours (Figure 18B).

[0178] To further analyze the regulatory role of ZmTAS3j in Pb stress at the maize seedling stage, this study measured the H2O2 and MAD content and antioxidant system enzyme activities in maize seedlings. First, H2O2 was detected in leaves of OE and WT plants under control conditions and after 7 days of Pb stress treatment, and in roots from 0 to 72 hours of treatment. Under control conditions, there were no significant differences in H2O2 content in roots and leaves between OE and WT plants (Figures 18C and 17E). However, under Pb stress, H2O2 levels increased in leaves and roots of all lines compared to the control, but the amount of H2O2 in leaves and roots of OE lines was significantly lower than that of WT plants (Figures 18D and 17F). Furthermore, MDA measurements showed no significant differences between transgenic lines and wild-type plants under control conditions (Figure 18G). From 0 to 72 hours of Pb stress treatment, MDA levels in OE lines were lower than those in WT, with significant differences in MDA levels between both OE lines and WT at 72 hours (Figure 18H). In summary, overexpression of ZmTAS3j can reduce H2O2 and MDA levels, mitigate plant damage, and improve plant tolerance to Pb. Additionally, the activities of the antioxidant enzymes SOD, POD, and CAT were measured. Under control conditions, the three antioxidant enzymes in the roots of OE and WT plants showed significant differences except for CAT at 48 and 72 h, while there were no significant differences in the rest of the growth process (Figures 18I, K, and M). After 72 h of Pb treatment, the SOD activity in the roots of the OE strain was significantly higher than that of the WT (P < 0.05) (Figure 18J). During the 0-72 h of Pb stress treatment, the POD and CAT activities in the roots of the OE strain were significantly higher than those of the WT strain (P < 0.05) (Figures 18L and N). In summary, overexpression of ZmTAS3j can increase the IAA level in the roots of maize seedlings and promote root growth under Pb stress. In addition, the increase in ROS scavenging enzyme activity helps to remove ROS from the body and reduce the damage of ROS to the plant body, thereby improving the tolerance of maize seedlings to heavy metal Pb.

[0179] 8. Regulatory network of ZmTAS3j in response to lead stress in maize

[0180] To further explore the regulatory network involved in ZmTAS3j's response to Pb stress in maize, total RNA was extracted from roots of WT and OE plants treated with Pb for 24 hours and subjected to RNAseq analysis. A total of 46,276 gene transcripts were detected in the RNA-seq database, and genes with log2FC > 1 and P < 0.05 were identified as differentially expressed genes (DEGs) (Figure 19A). Under control conditions, 1,132 DEGs were identified in the overexpression lines compared to the wild type (CK_OE vs CK_WT), including 559 upregulated and 573 downregulated genes (Figure 19B). Under Pb stress, 871 DEGs were identified in the overexpression lines compared to the wild type (Pb_OE vs Pb_WT), including 599 upregulated and 272 downregulated genes (Figure 19B). Under control and Pb treatment conditions, a total of 3831 DEGs were identified in the WT strain, of which 1636 were upregulated and 2195 were downregulated; a total of 4834 DEGs were identified in the OE strain, of which 2404 were upregulated and 2430 were downregulated (Figure 19B). After Pb stress treatment, 334 genes were specifically differentially expressed in the overexpression strain (Figure 19A and C). GO functional enrichment analysis found that these specific differentially expressed genes were mainly enriched in responses to peroxidase, oxidoreductase and antioxidant activity, as well as cation and metal ion binding pathways (Figure 19D). This was verified by the increased reactive oxygen species scavenging ability of the ZmTAS3j-OE strain mentioned above. Under Pb stress, several SAUR auxin-responsive proteins (Zm00001d014774, Zm00001d021456, Zm00001d036623, Zm00001d026308, Zm00001d051302, and Zm00001d053815), peroxidase protein family (Zm00001d003707, Zm00001d017996, Zm00001d025402, Zm00001d024735, Zm00001d02 004, Zm00001d022290, Zm00001d021533, Zm00001d026357, Zm00001d040399 and Zm00001d050572), peroxisome biogenesis protein (Zm00001d051374), heavy metal transport / detoxification superfamily protein (Zm00001d038047 and Zm00001d026513) and heavy metal binding prenylated plant protein 27 (Zm00001d004138) were all upregulated ( Figure 19E ).Our previous studies have shown that the SAUR gene is related to the synthesis of IAA in maize, which also explains why the IAA content of the ZmTAS3j-OE strain is increased and root growth is promoted.

Claims

1. Maize ZmTAS3j gene and its application in improving plant lead tolerance.

2. The use according to claim 1, It is characterized in that The nucleotide sequence of the maize ZmTAS3j gene is shown in SEQ ID NO.

1.

3. A method for improving plant tolerance to lead stress, It is characterized in that The method is to overexpress the corn ZmTAS3j gene in plants.

4. A method for overexpressing the maize ZmTAS3j gene in Arabidopsis thaliana, It is characterized in that The specific method is as follows: (1) Total RNA of B73 inbred line was extracted and reverse transcribed into cDNA, and the ZmTAS3j transcript sequence was amplified. The ZmTAS3j gene sequence was constructed into pRI101-AN by homologous recombination using pRI101-AN basic expression vector and EcoR1 as a single restriction site, and the result was named AN101-ZmTAS3j. (2) The target site of miR390 at the 5' end in ZmTAS3j was mutated by mismatch PCR amplification, destroying the target site of miR390 at the 5' end of the ZmTAS3j gene sequence. The mutated ZmTAS3j gene sequence was constructed into pRI101-AN by homologous recombination using the pRI101-AN basic expression vector and EcoRΙ as a single restriction site, and the result was named AN101-ZmTAS3jmut. (3) The AN101-ZmTAS3j and AN101-ZmTAS3jmut plasmids were transformed into Agrobacterium GV3101, respectively, and the inflorescences of Columbia wild-type Arabidopsis were infected by the inflorescence immersion method to obtain transgenic plants.

5. The method according to claim 4, It is characterized in that The homologous recombination primers in step (1) are AN101-ZmTAS3j-F: the nucleotide sequence is as shown in SEQ ID NO.2, and AN101-ZmTAS3j-R: the nucleotide sequence is as shown in SEQ ID NO.

3.

6. The method according to claim 4, It is characterized in that The homologous recombination primers in step (2) are ZmTAS3jmut-FL-R: the nucleotide sequence is as shown in SEQ ID NO.4, and ZmTAS3jmut-FL-F: the nucleotide sequence is as shown in SEQ ID NO.

5.

7. A method for overexpressing the maize ZmTAS3j gene in maize, Features: Using Ubi as promoter, nos as terminator and Bar as selection marker gene, primers for amplification of target gene fragment were designed according to ZmTAS3j sequence, and ZmTAS3j gene fragment was amplified. BamHI was used as restriction site, and homologous recombination method was used to construct OE-ZmTAS3j overexpression vector for maize genetic transformation.

8. The method according to claim 7, Features: The primers used for constructing the OE-ZmTAS3j overexpression vector by homologous recombination method are OE-ZmTAS3j-F: nucleotide sequence such as SEQ ID NO.6; OE-ZmTAS3j-R: nucleotide sequence such as SEQ ID NO.7.

Images