Mouse Anti-human mismatch repair protein MLH1 monoclonal antibody, cell strain and use thereof

Abstract

A monoclonal hybridoma cell strain, with the deposit number of GDMCC No. 64004. The monoclonal hybridoma cell strain can stably secrete an anti-human mismatch repair protein MLH1 monoclonal antibody, which has the advantages of good specificity and high affinity. The antibody can specifically bind to a mismatch repair protein MLH1, thereby significantly improving the specificity and sensitivity of the immunological detection of the mismatch repair protein MLH1. Particularly, the antibody can specifically recognize the MLH1 protein in tumor tissues of colon cancer, gastric cancer, breast cancer and endometrial cancer, and in a human colon cancer cell line and a human cervical cancer cell line, but does not recognize the MLH1 protein in colon cancer with MLH1 deficiency and a human colon cancer cell line with MLH1 deficiency. Therefore, the antibody can be widely applied to the preparation of various immunological detection kits.

Description

Mouse anti-human mismatch repair protein MLH1 monoclonal antibody, cell line and application thereof

[0001] The present invention claims priority to Chinese patent application No. 2024100136236, filed with the Patent Office of China on January 4, 2024, entitled “Mouse anti-human mismatch repair protein MLH1 monoclonal antibody, cell line and its application”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention belongs to the field of biotechnology, and in particular relates to a mouse anti-human mismatch repair protein MLH1 monoclonal antibody, a cell line and applications thereof. Background Art

[0003] The DNA mismatch repair (MMR) system is one of several DNA self-repair mechanisms, designed to protect the integrity and fidelity of the genome during DNA replication. MMR proteins maintain genetic stability by recognizing and repairing base mismatches caused by physical and chemical damage, genetic recombination, and DNA replication errors. However, when MMR genes harbor germline mutations or somatic methylation defects, their associated proteins fail to express properly, leading to functional loss of the system and ultimately increased susceptibility to malignant tumors.

[0004] In humans, MMR-related proteins are known as hMutL homologs and hMutS homologs, with hMLH1 being a key member. The MLH1 gene is located on 3p21.3, a region with a high density of DNA mismatch repair. Studies have shown that MLH1 is expressed in a variety of tumor tissues, and its functional deficiency is believed to be a key mechanism in tumor pathogenesis, paving the way for the development of new research. Methylation of the MLH1 gene promoter silences MLH1 expression, reducing its expression level and leading to inactivation of mismatch repair, which in turn causes errors during DNA replication and ultimately tumorigenesis. As one of the MMR-related proteins, MLH1 is expressed in the nuclei of tumor cells in colorectal cancer. It is also positive in epithelial cells, infiltrating lymphocytes, and stromal cells in the lower third of the crypts of the normal colorectal mucosa, serving as an internal control. Studies have shown that in male colorectal cancer patients, when MLH1 expression is lost, Ki-67 protein is overexpressed, resulting in increased rates of tumor recurrence and metastasis, and a poor prognosis. (Xu Yan, Lei Junping, Shang Song, Lin Binghu. Significance of expression of mismatch repair proteins MLH1, PMS2, MSH2, MSH6 and Ki-67 in colorectal cancer and their relationship with prognosis [J]. Guangdong Medical Journal, 2023, 44(1): 90-95.). Other studies have found that MLH1 positive expression is a high-frequency event in gastric cancer. In gastric cancer patients, the loss of MLH1 expression may predict a good prognosis for patients with resectable gastric cancer and a negative response to preoperative neoadjuvant chemotherapy. Therefore, it is recommended that patients with MLH1 negative gastric cancer receive surgical treatment alone, while other patients may obtain a better prognosis by taking surgical treatment combined with preoperative or postoperative chemotherapy (Zhou Gaoyun, Lin Long, Lin Jinwei, Su Dewen. The predictive value of MLH1 expression on the prognosis of gastric cancer patients and the response to preoperative neoadjuvant chemotherapy [J]. Chinese Journal of Cancer Prevention and Treatment, 2022, 14(1): 65-69.). Other studies have found that MLH1 positive expression is also a high-frequency event in breast cancer. However, the proportion of MLH1 expression loss in triple-negative breast cancer is high, accounting for about 15% of all breast cancers. It is highly malignant and prone to recurrence and metastasis, and therefore has a very poor prognosis. Therefore, when breast cancer shows MLH1 loss expression, other targets can be combined to determine the breast cancer classification. (Li Hui, Kong Fanhong, Song Wenjing, Sun Lijuan. Expression and clinical significance of mismatch repair genes in breast cancer [J]. Journal of Diagnostic Pathology, 2021, 28(12): 1063-1065. / Hudis CA, Gianni L. Triple-negative breast cancer: an unmet medical need [J]. Oncologist, 2011, 1(6): 1-11.).Previously, other foreign studies reported that the MLH1 gene mutation rate in endometrial cancer patients is 37% to 48%. Compared with endometrial cancer patients with intact genes, patients with expression deletion have more severe disease progression and poorer prognosis (Kulmala J, Rantanen V, Pekkola-Heino K, et al. Dosimetry of irradiation models. The 96-well clonogenic assat for testing radiosensitivity of cell lines[J]. Acta Oncologica, 2019, 34(1): 105-109.).

[0005] In addition to human cancer tissues, MLH1 also has different expressions in a variety of human cancer cells. Studies have shown that MLH1 is positively expressed in both the human colon cancer cell line LoVo and the human cervical cancer cell line Hela (Zhang Yun, Qian Ying, Yu Yingnian, Wang Aijin, Luo Jianhong. Detection of biological characteristics of HeLa-MLH1- cells [J]. Carcinogenesis, Aberration and Mutation, 1998; 10(4): 203-206. / Ma Lin. Preliminary study on the effects of NSAIDs on hMLH1, hMSH2 and MSI in the loVo colon cancer cell line [D]. Hebei: Hebei Medical University, 2011: 13-48.). Other studies have shown that the colon cancer cell line HCT116 is an MLH1-deficient cell line, so MLH1 is negatively expressed (Wang Yating. The role of mismatch repair gene hMLH1 in estrogen-induced apoptosis of colon cancer cell line HCT116 [D]. Shanxi: Shanxi Medical University, 2012: 2-11.). Given the different expression patterns of MLH1 in different cancer cell lines, MLH1 can be used as a tool for related biological research.

[0006] Currently, immunohistochemistry (IHC) is the primary method used in clinical practice to detect the expression of the mismatch repair protein MLH1 in tumor tissue. The performance of IHC directly determines the sensitivity and specificity of the entire assay. Furthermore, related biological research also requires MLH1 antibodies with high specificity and affinity. Therefore, developing a monoclonal antibody against the mismatch repair protein MLH1 with high binding specificity is of great significance. Summary of the Invention

[0007] Based on this, the purpose of the present invention is to provide a hybridoma cell line, a mouse anti-human mismatch repair protein MLH1 monoclonal antibody with good specificity and high affinity, and applications thereof.

[0008] The technical solutions for achieving the above-mentioned objectives include the following.

[0009] The first object of the present invention is to provide a hybridoma cell line, named mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line, and the hybridoma cell line is deposited in Guangdong Provincial Microbiological Culture Collection Center (abbreviated as GDMCC), with a preservation date of November 9, 2023, and a preservation number of GDMCC No.64004.

[0010] The second object of the present invention is to provide a mouse anti-human mismatch repair protein MLH1 monoclonal antibody, which is secreted and produced by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line with the above-mentioned deposit number GDMCC No.64004.

[0011] Or a mouse monoclonal antibody against human mismatch repair protein MLH1, the amino acid sequences of the three complementary determining regions CDR-VH1, CDR-VH2, and CDR-VH3 of its heavy chain variable region are shown as SEQ ID No.1-3, respectively, and the amino acid sequences of the three complementary determining regions CDR-VL1, CDR-VL2, and CDR-VL3 of its light chain variable region are shown as SEQ ID No.4-6, respectively.

[0012] Furthermore, the monoclonal antibody is a mouse IgG2a subtype monoclonal antibody.

[0013] The third object of the present invention is to provide a nucleic acid molecule encoding any of the above-mentioned mouse anti-human mismatch repair protein MLH1 monoclonal antibodies or the antigen-binding portion (complementarity determining region) of the monoclonal antibody.

[0014] Furthermore, the nucleotide sequences encoding the three complementary determining regions of the heavy chain variable region of the monoclonal antibody are respectively shown as SEQ ID Nos. 7 to 9, or are nucleotide sequences encoding the amino acid sequences shown in SEQ ID Nos. 1 to 3, and the nucleotide sequences encoding the three complementary determining regions of the light chain variable region of the monoclonal antibody are respectively shown as SEQ ID Nos. 10 to 12, or are nucleotide sequences encoding the amino acid sequences shown in SEQ ID Nos. 4 to 6.

[0015] It should be understood that, taking into account the degeneracy of codons, those skilled in the art may modify the nucleotide sequence of the above-mentioned coding gene without changing the corresponding amino acid sequence encoded, which also falls within the scope of the present invention.

[0016] It should be understood that those skilled in the art can obtain the monoclonal antibody of the present invention by recombinant expression based on the complementary determining regions of the heavy and light chains of the monoclonal antibody to the mismatch repair protein MLH1 disclosed in the present invention. The expression vectors used for recombinant expression include but are not limited to: plasmids, expression cassettes, recombinant vectors or recombinant plasmids, recombinant cells or recombinant bacteria.

[0017] The fourth object of the present invention is to provide a use of any of the above-mentioned mouse anti-human mismatch repair protein MLH1 monoclonal antibodies in the preparation of a mismatch repair protein MLH1 immunoassay kit.

[0018] The fifth object of the present invention is to provide a mismatch repair protein MLH1 immunoassay kit, which contains any of the above-mentioned mouse anti-human mismatch repair protein MLH1 monoclonal antibodies.

[0019] Furthermore, the detection method of the kit is an immunological detection method, including immunofluorescence assay, enzyme-linked immunosorbent assay, immunoelectrophoresis, immunoflow cytometry, serum agglutination test, immunohistochemistry, immunocytochemistry and the like.

[0020] Furthermore, the immunological detection includes immunohistochemistry and immunocytochemistry.

[0021] The classification name for the deposited hybridoma cell line secreting anti-mismatch repair protein MLH1 is: Mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line PM0001L33-13D9-F5. The following is its deposit information:

[0022] Full name of the depository: Guangdong Provincial Microbial Culture Collection Center;

[0023] Abbreviation of depository unit: GDMCC;

[0024] Address of the preservation unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou;

[0025] Deposit date: November 9, 2023;

[0026] Deposit number: GDMCC No.64004.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) provided by the present invention can stably secrete an anti-human mismatch repair protein MLH1 monoclonal antibody. The antibody has the advantages of good specificity and high affinity. The antibody specifically binds to the mismatch repair protein MLH1, significantly improving the specificity and sensitivity of immunological detection of the mismatch repair protein MLH1. In particular, the antibody can specifically recognize MLH1 protein in tumor tissues of colon cancer, gastric cancer, breast cancer, and endometrial cancer, as well as in a human colon cancer cell line (LoVo cell line) and a human cervical cancer cell line (Hela cell line), but does not recognize MLH1 protein in MLH1-deficient colon cancer and a human MLH1-deficient colon cancer cell line (HCT116 cell line). The antibody is widely applicable to various immunological detections, particularly immunohistochemistry (IHC) and immunocytochemistry (ICC) detections. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is an SDS-PAGE electrophoresis diagram of the purified recombinant mismatch repair protein MLH1.

[0030] Figure 2 is a schematic diagram of the results of IHC detection of colon cancer using the supernatants of three anti-mismatch repair protein MLH1 monoclonal hybridoma cell lines and the antibodies and positive controls after supernatant purification in the late stage of the screening phase, wherein A1-A4, B1-B4, and C1-C4 correspond to PM0001L33-13D9-F5, PM0001L33-13D9-A7, and PM0001L33-4H3-D10 and the positive control, respectively.

[0031] FIG3 is an SDS-PAGE electrophoresis diagram of the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention.

[0032] FIG4 is a diagram showing the subtype detection results of antibodies in the supernatant of the anti-mismatch repair protein MLH1 monoclonal hybridoma cell line of the present invention.

[0033] FIG5 is a schematic diagram of affinity detection of the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention.

[0034] Figure 6 is a schematic diagram of the results of IHC detection of colon cancer (A), gastric cancer (B), breast cancer (C), and endometrial cancer (D) tissues using the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention and commercially available MLH1 antibodies, wherein: 1. mouse anti-human mismatch repair protein MLH1 monoclonal antibody, 2. commercially available MLH1 antibody with clone number ES05.

[0035] Figure 7 is a schematic diagram of the results of IHC detection of MLH1-deficient colon cancer tissue using the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention and commercially available MLH1 antibodies, wherein: 1. mouse anti-human mismatch repair protein MLH1 monoclonal antibody, 2. commercially available MLH1 antibody with clone number ES05.

[0036] Figure 8 is a schematic diagram of the results of ICC detection of human colon cancer cell line (LoVo cell line) (A) and human cervical cancer cell line (Hela cell line) (B) by the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention and commercially available MLH1 antibody, wherein: 1. mouse anti-human mismatch repair protein MLH1 monoclonal antibody, 2. commercially available MLH1 antibody with clone number ES05.

[0037] Figure 9 is a schematic diagram of the results of ICC detection of human MLH1-deficient colon cancer cell line (HCT-116 cell line) using the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention and commercially available MLH1 antibodies, wherein: 1. mouse anti-human mismatch repair protein MLH1 monoclonal antibody, 2. commercially available MLH1 antibody with clone number ES05. DETAILED DESCRIPTION

[0038] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0039] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those in Molecular Cloning: A Laboratory Manual (4th edition, edited by Green and Sambrook, published in 2013), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0041] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.

[0042] CDR-VH1, CDR-VH2, and CDR-VH3 are the three complementarity determining regions (CDRs) in the heavy chain variable region, and CDR-VL1, CDR-VL2, and CDR-VL3 are the three complementarity determining regions in the light chain variable region. The sequences of the complementarity determining regions are defined according to the International Immunogenetics Information System (IMGT).

[0043] In some embodiments of the present invention, a method for preparing anti-human mismatch repair protein MLH1 monoclonal antibodies is provided. Based on the structure, antigenicity, hydrophilicity, secondary structure, and tertiary structure of the human mismatch repair protein MLH1, a target amino acid fragment of the human mismatch repair protein MLH1 is selected, recombinantly expressed in Escherichia coli, and mice are immunized. After cell fusion, subcloning, and screening, a mouse anti-human mismatch repair protein MLH1 monoclonal cell line PM0001L33-13D9-F5 that efficiently secretes anti-human mismatch repair protein MLH1 monoclonal antibodies is obtained. The mouse anti-human mismatch repair protein MLH1 monoclonal cell line PM0001L33-13D9-F5 is cultured in mice in vivo, and the human mismatch repair protein MLH1 monoclonal antibodies secreted by the cell line are obtained.

[0044] The obtained mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line PM0001L33-13D9-F5 was deposited in Guangdong Provincial Microbiological Culture Collection on November 9, 2023, with the deposit number: GDMCC No.64004.

[0045] The present invention is further described in detail below with reference to specific embodiments.

[0046] Example 1

[0047] 1. Construction of recombinant expression plasmid

[0048] The MLH1 protein sequence numbered P40692 was selected from the Uniprot database (http: / / www.uniprot.org) as a reference sequence. Based on its DNA binding structure, antigenicity, hydrophilicity of its constituent amino acids, and secondary and tertiary structures, a region with specific antigenicity, distinct from other similar proteins, and an appropriate length was selected as an antigenic peptide. The target protein fragment was ligated into the plasmid vector pET23a-His to synthesize the pET23a-HisrMLH1 recombinant protein plasmid.

[0049] 2. Expression and Purification of Recombinant Protein

[0050] The pET23a-HisrMLH1 plasmid was transfected into competent E. coli cells. Following positive expression, IPTG-induced expression was performed in LB medium. MLH1 protein expression was then amplified and purified using a nickel column. Finally, the human MLH1 fragment protein was collected. The purified recombinant mismatch repair protein MLH1 fragment was identified by SDS-PAGE electrophoresis, revealing a molecular weight of approximately 26.8 kDa, consistent with expectations (see Figure 1).

[0051] 3. Preparation and Screening of Cell Lines Secreting Monoclonal Antibodies Against Mismatch Repair Protein MLH1

[0052] Purified recombinant mismatch repair protein MLH1 (hereinafter referred to as MLH1 antigen) was used to immunize Balb / C mice (Hunan Slake Jingda Laboratory Animal Co., Ltd.) according to standard methods. The specific method is as follows:

[0053] (1) Animal immunization:

[0054] Purified MLH1 antigen emulsified in Freund's complete adjuvant was subcutaneously injected into 6-8 week-old Balb / C mice at a dose of 80 μg per mouse. Two weeks later, a second immunization was performed with Freund's incomplete adjuvant at a dose of 60 μg per mouse. Two weeks later, a third immunization was performed with Freund's incomplete adjuvant at a dose of 60 μg per mouse. After the three immunizations, tail blood was collected and serum titers were determined by serial dilution ELISA. The results determined whether to boost immunizations, and mice with the highest antibody titers were selected for cell fusion. Three days before fusion, an intraperitoneal boost immunization was performed with saline at a dose of 120 μg per mouse.

[0055] (2) Cell fusion:

[0056] Myeloma cells were Balb / C-derived sp2 / 0 cells, which were in the logarithmic growth phase at the time of fusion. Spleens from immunized mice were harvested to prepare a single-cell suspension of lymphocytes. Mouse splenic lymphocytes were mixed with myeloma cells at a ratio of 1:4-6 and centrifuged at 1200 rpm for 5 minutes. The supernatant was discarded, and the cells were resuspended in 6.4 mL of ECF buffer. The cell mixture was slowly transferred to the fusion chamber of the electrofusion instrument. After confirming the parameters, the start button was pressed. After the instrument automatically completed electrofusion, the cell suspension was gently transferred to 10 mL of cell repair solution preheated to 37°C. The cell repair solution containing the fused cells was placed in a 37°C incubator to repair for 10 minutes. After repair, the solution was centrifuged at 1200 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in HAT medium. The entire solution was transferred to a 96-well plate at 100 μL / well and labeled. The 96-well plate was carefully transferred to a 37°C, 5% CO2 incubator for incubation. Regularly check cell growth and potential contamination, and minimize opening and closing the incubator to ensure a stable culture environment. Observe cell status on day 5 post-fusion and replace the culture medium in the culture plate with HT medium at 150 μL / well.

[0057] (3) Screening and cloning:

[0058] Hybridoma clones were selected within 6-9 days of fusion, and nearly 3,000 wells were screened (ELISA and ICC). Wells with high ELISA positivity, low ELISA-his protein tag reactivity, and strong ICC reactivity were selected as positive wells, totaling over 30 lines, and these were labeled. Limiting dilutions were performed on these positive wells. Five to six days after each limiting dilution, ELISA values ​​were measured and IHC results were tested for positivity. Monoclonal wells with high OD450 positivity and good IHC specificity and nonspecificity were selected and continued with limiting dilutions until the entire 96-well plate was positive by ELISA. Based on the IHC results, highly specific cell lines were selected, resulting in nine mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell lines. Positive monoclonal cell lines were further expanded until the cell lines could stably secrete the monoclonal antibody. IHC analysis was performed on the supernatants of the expanded positive monoclonal cell lines. At this stage, the signal-to-noise ratio was extremely low due to the complex composition of the supernatant, making it difficult to assess the performance of the cell lines. The supernatant secreted by the positive monoclonal cell line after expanded culture was purified by magnetic separation purification method (equipment: Auto-Pure20A fully automatic nucleic acid analyzer (Hangzhou Aosheng Instrument Co., Ltd.); operation process: see the instrument recommended process) and the titer of the purified antibody was adjusted, and IHC detection was performed again. The results are shown in Figure 2 (three representative cases (PM0001L33-13D9-F5 (1), PM0001L33-13D9-A7 (2) and PM0001L33-4H3-D10 (3)) and positive control (4) were selected for display). In Figure 2, A-1, A-2, and A-3 represent the results of IHC testing for colorectal cancer using the supernatants of the three cell lines before culture, with PM0001L33-13D9-F5 showing a slight advantage. B-1, B-2, and B-3 represent the results of IHC testing for colorectal cancer using the supernatants of the three cell lines after culture, with performance difficult to assess. C-1, C-2, and C-3 represent the results of IHC testing for colorectal cancer using antibodies purified from the supernatants of the three cell lines after culture, with PM0001L33-13D9-F5 and PM0001L33-4H3-D10 showing comparable performance. Based on a comprehensive assessment of the performance of the cell lines using multiple IHC assays, PM0001L33-13D9-F5 was ultimately selected as being capable of efficiently and stably secreting monoclonal antibodies.

[0059] (4) Preparation of monoclonal antibodies by induction method in mice:

[0060] Male Balb / C mice aged 10-14 weeks were intraperitoneally injected with 0.5 ml of liquid paraffin. Five days later, each mouse was intraperitoneally injected with a 2.5 ml syringe with a monoclonal cell suspension (PM0001L33-13D9-F5) washed with physiological saline and resuspended. The cell dosage was 1×10 ^6Each cell line was injected into 3 mice intraperitoneally. After ascites accumulated in the mice, the ascites was collected and centrifuged to obtain the supernatant for purification.

[0061] (5) Purification of monoclonal antibodies:

[0062] Antibodies were purified using a Mabselect SuRe LX (GE) affinity chromatography column: ① Column loading: an appropriate amount of purchased Protein A (Changzhou Tiandi Renhe Biotechnology Co., Ltd.) filler was loaded into the chromatography column and rinsed with equilibration buffer (0.01M PB + 0.15M NaCl, pH 7.4) to equilibrium; ② Sample loading: ascites filtered through a 0.22 μm filter membrane was added to the loaded chromatography column, and the linear flow rate was controlled at 150 cm / h; ③ Equilibration: after loading, the column was rinsed with equilibration buffer to equilibrium; ④ Elution: the column was rinsed with elution buffer (0.1M glycine, pH 4.0) and the eluate was collected. The eluate was immediately neutralized with 1.5M Tris-HCl; ⑤ Regeneration: after elution, the column was washed with 5 times 0.1M NaOH, equilibration buffer, ultrapure water, and 20% ethanol in sequence, and then stored at 4°C. ⑥ Antibody Storage: The eluate was exchanged by dialysis against phosphate buffer (pH 7.4), supplemented with 0.05% proclin 300, and stored at 4°C (-20°C for extended periods, aliquoted to avoid repeated freeze-thaw cycles). Antibody purity was assessed by SDS-PAGE. Figure 3 shows the polyacrylamide gel electrophoresis of the purified MLH1 monoclonal antibody, demonstrating a purity exceeding 95%. Antibody concentration was determined by BCA assay, indicating a concentration exceeding 3.0 mg / mL.

[0063] 4. Characterization of Monoclonal Antibodies Against Mismatch Repair Protein MLH1

[0064] (1) Subtype identification

[0065] The purified human MLH1 fragment protein described above was diluted to 0.5 μg / mL and coated onto an ELISA plate. 100 μL was added to each well and coated overnight at 4°C. The plate was then emptied and washed three times with PBS-T containing 0.05% Tween-20. 200 μL of blocking solution (3% BSA in PBS-T) was added to each well and incubated at 37°C for 2 h. The plate was then emptied and washed three times with PBS-T. 0.1 mL of culture supernatant from the aforementioned mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (PM0001L33-13D9-F5) was added to each well and incubated at 37°C for 1 h. The plate was then emptied and washed three times with PBS-T. HRP-conjugated goat anti-mouse (IgG1, IgG2a, IgG2b, IgG3, IgM, IgA) antibodies (Luoyang Bio-T Biotechnology Co., Ltd.) were added to each well and incubated at 37°C for 30 min. The liquid was emptied and the cells were washed three times with PBS-T. 100 μL of TMB substrate (a mixed solution of equal volumes of A and B) was added to each well for color development. The cells were incubated at 37°C for 10 min. The color development reaction was terminated by adding 50 μL of 2 mol / L H₂SO₄ solution to each well. The OD value at a wavelength of 450 nm was then measured using a microplate reader. The results showed that the monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line of the present invention, i.e., the mouse anti-human mismatch repair protein MLH1 monoclonal antibody, was an IgG2a mouse monoclonal antibody. The results are shown in Figure 4.

[0066] (2) Identification of affinity constants

[0067] The purified human MLH1 fragment protein described above was coated at a concentration of 100 μg / mL, 100 μL / well, overnight at 4°C, followed by a single wash with PBS-T. 200 μL of blocking buffer was added to each well, blocked at 37°C for 2 hours, and washed once with PBS-T. The purified monoclonal antibody described above was diluted to the following concentrations (in ng / mL): 10,000, 5,000, 2,500, 2,000, 500, 125, 62.5, 31.25, 15.625, 3.125, and 0.625. The cells were incubated at 37°C for 1 hour, followed by three washes with PBS-T. HRP-conjugated goat anti-mouse secondary antibody (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) was diluted 1:20,000, 100 μL / well, incubated at 37°C for 1 hour, and washed three times with PBS-T. Add 100 μL of TMB colorimetric solution to each well and develop for 10 minutes. Terminate the reaction by adding 50 μL of 2 M sulfuric acid solution. Measure absorbance at 450 nm using a microplate reader. Plot a curve plotting OD values ​​against antibody dilution factors, and determine the antibody concentration A corresponding to 1 / 2 the "plateau OD value." See Figure 5 for a schematic diagram. Calculate the affinity constant using the following formula: 1.37*10^10.

[0068] On November 9, 2023, the hybridoma cell line PM0001L33-13D9-F5 was deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC), with the deposit number: GDMCC No.64004.

[0069] RNA extracted after hybridoma cell lysis was reverse transcribed to obtain cDNA, which was then amplified by PCR. After Sanger sequencing and comparison of the sequencing results on IMGT, information on the mouse anti-human monoclonal antibody secreted by the hybridoma cell line PM0001L33-13D9-F5 (GDMCC No. 64004), i.e., the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention, was obtained, as follows:

[0070] MLH1 sequence listing:

[0071] 1. The amino acid sequence of the heavy chain variable region complementarity determining region CDR-VH1, SEQ ID NO.1: TYYMY.

[0072] 2. The amino acid sequence of the heavy chain variable region complementarity determining region CDR-VH2, SEQ ID NO.2: GINPSNGLTNFNERFKS.

[0073] 3. The amino acid sequence of the heavy chain variable region complementarity determining region CDR-VH3, SEQ ID NO.3: IYGNYPNWYFDV.

[0074] 4. The amino acid sequence of the light chain variable region complementarity determining region CDR-VL1, SEQ ID NO.4: KSSQSLLNSSNQKNYLA.

[0075] 5. The amino acid sequence of the light chain variable region complementarity determining region CDR-VL2, SEQ ID NO.5: FASTRQS.

[0076] 6. Light chain variable region complementarity determining region CDR-VL3 amino acid sequence, SEQ ID NO.6: QQHYNTPLT.

[0077] 7. Nucleotide sequence of the heavy chain variable region complementarity determining region CDR-VH1, SEQ ID NO.7: ACCTACTACATGTAC.

[0078] 8. Nucleotide sequence of the heavy chain variable region complementarity determining region CDR-VH2, SEQ ID NO.8: GGGATTAATCCTAGCAATGGTCTTACTAACTTCAATGAGAGGTTCAAGAGC.

[0079] 9. Nucleotide sequence of the heavy chain variable region complementarity determining region CDR-VH3, SEQ ID NO.9: ATCTATGGTAACTATCCCAACTGGTACTTCGATGTC.

[0080] 10. The nucleotide sequence of the light chain variable region complementarity determining region CDR-VL1, SEQ ID NO.10: AAGTCCAGTCAGAGCCTTTTAAATAGTAGCAATCAAAAGAACTATTTGGCC.

[0081] 11. The nucleotide sequence of the light chain variable region complementarity determining region CDR-VL2, SEQ ID NO.11: TTTGCATCCACTAGGCAATCT.

[0082] 12. The nucleotide sequence of the light chain variable region complementarity determining region CDR-VL3, SEQ ID NO.12: CAGCAACATTATAACACTCCGCTCACG.

[0083] 5. IHC comparative detection using the anti-mismatch repair protein MLH1 monoclonal antibody of the present invention or the commercially available classic MLH1 antibody with clone number ES05 as the primary antibody

[0084] (1) Experimental methods:

[0085] ① Formalin-fixed tissue blocks of colon cancer, gastric cancer, breast cancer, endometrial cancer, and MLH1-deficient colon cancer were paraffin-embedded and sliced ​​using a Leica tissue slicer with a tissue thickness of 4 μm.

[0086] ② Dewaxing and hydration: analytical grade xylene 10 min × 3 times, anhydrous ethanol 1 min × 3 times, 95% ethanol 1 min, 85% ethanol 1 min, 75% ethanol 1 min, soak in deionized water for 2 min × 3 times.

[0087] ③ Add antigen retrieval solution [1mM EDTA, 10mM Tris buffer (pH9.0)] and perform high-pressure heat repair in a pressure cooker for 2.5 minutes. When the temperature of the pressure cooker drops to room temperature, open the pressure cooker, take out the specimen, and soak it in deionized water for 2 minutes × 2 times.

[0088] ④ Inactivate endogenous peroxidase in the tissue using 3% hydrogen peroxide, and place the tissue in the dark at room temperature for 15 minutes. Immerse the tissue in PBST (0.1% Tween-20) for 2 minutes three times.

[0089] ⑤ Add the monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) (final concentration 0.86 μg / mL) or the commercially available MLH1 antibody with the classic clone number ES05 (GeneTex) (final concentration 11 μg / mL), place in a humidified chamber, and incubate at 37°C for 60 minutes. Rinse once with PBST, soak in deionized water for 1 minute × once, and then soak in PBST for 2 minutes × 3 times.

[0090] ⑥Add iVision TM Poly-HRP goat anti-mouse / rabbit secondary antibody reagent (Xiamen Tongling, DD-13) was incubated at 37°C for 30 minutes, rinsed once with PBST, and then washed three times with PBST for 2 minutes.

[0091] ⑦ Use DAB solution (Xiamen Tongling, KS-003) for color development for 2 minutes. Rinse with tap water and then rinse with tap water three times.

[0092] ⑧Restain the cell nucleus with hematoxylin for 5 minutes, rinse with tap water for 5 minutes, differentiate with 1% hydrochloric acid, and finally rinse with tap water for 1 minute.

[0093] ⑨ Dehydration and transparency: 75% ethanol for 1 min, 85% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 1 min × 3 times; xylene for 1 min × 3 times, and sealing with neutral gum.

[0094] ⑩Microscopic examination, see Figures 6 and 7.

[0095] (2) Experimental results:

[0096] ① As can be seen from the results in Figure 6, the monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) detected specific nuclear expression of the mismatch repair protein MLH1 in cancer cells of colorectal cancer tissue (A-1), gastric cancer tissue (B-1), breast cancer tissue (C-1), and endometrial cancer tissue (D-1), which is consistent with the expression pattern of the commercially available classic MLH1 antibody clone ES05 (corresponding to (A-2), (B-2), (C-2), and (D-2), respectively). However, when the antibody concentration is lower, the positive site staining is stronger, showing good specificity and better affinity. The arrows indicate colorectal cancer cells, gastric cancer cells, breast cancer cells, and endometrial cancer cells that positively express the mismatch repair protein MLH1, respectively.

[0097] ② As can be seen from the results in Figure 7, the monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) detected the MLH1 gene-deficient colorectal cancer tissue (1). The mismatch repair protein MLH1 was not expressed in cancer cells, but was specifically expressed in the nucleus in lymphocytes and stromal cells. This was consistent with the expression of the commercially available classic MLH1 antibody clone ES05 (corresponding to (2)), but the positive site was stained more strongly. The arrow indicates the MLH-deficient colorectal cancer cell.

[0098] The results showed that the anti-mismatch repair protein MLH1 monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) of the present invention can specifically recognize the mismatch repair protein MLH1 in colorectal cancer, gastric cancer, breast cancer and endometrial cancer cancer cells, but does not recognize the MLH1 protein in MLH1-deficient colorectal cancer cells. The positive staining site is consistent with that of the commercially available classic MLH1 antibody with clone number ES05, ​​and has better performance.

[0099] Example 2

[0100] The anti-mismatch repair protein MLH1 monoclonal antibody of the present invention or the commercially available MLH1 antibody with the classic clone number ES05 is used as the primary antibody for ICC comparative detection of the kit.

[0101] (1) Experimental methods:

[0102] ① Trypsin-digested human colon cancer cell line (LoVo cell line), human cervical cancer cell line (Hela cell line), and human MLH1-deficient colon cancer cell line (HCT-116 cell line) were plated in 96-well plates and cultured in a 37°C, 5% CO2 incubator for approximately 24 hours until the cells were fully expanded. After removing the culture medium from the wells, the cells were fixed with 4% PFA for 15 minutes and then soaked in PBS for 1 minute × 3 times.

[0103] ② Permeabilize the cells with 0.1% Triton X-100, let stand at room temperature for 15 minutes, and soak in PBS buffer (pH 7.4) for 1 minute x 3 times.

[0104] ③ Inactivate endogenous peroxidase in cells with 3% hydrogen peroxide and incubate at room temperature in the dark for 15 minutes. Soak in PBS for 1 minute three times.

[0105] ④ Add monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) (final concentration 0.86 μg / mL) or commercially available MLH1 antibody clone ES05 (GeneTex) (final concentration 11 μg / mL) and incubate at room temperature for 90 minutes. Soak in PBS for 1 minute × 3 times.

[0106] ⑤Use 2-fold diluted iVision TM Incubate with Poly-HRP goat anti-mouse / rabbit secondary antibody (Xiamen Tongling, DD-13) at room temperature for 30 min, and soak in PBS buffer for 1 min × 3 times.

[0107] ⑥ Use DAB solution (Xiamen Tongling, KS-003) for color development and incubate at room temperature in the dark for 5 minutes. Soak in PBS for 1 minute × 3 times, and keep the last PBS buffer in the well.

[0108] ⑦Microscopic examination, see Figures 8 and 9.

[0109] (2) Experimental results:

[0110] ① As can be seen from the results in Figure 8, the monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) detected specific nuclear expression of the mismatch repair protein MLH1 in the LoVo cell line (A-1) and the Hela cell line (B-1), which is consistent with the detection results of the commercially available classic MLH1 antibody clone ES05 (corresponding to (A-2) and (B-2), respectively), and the positive staining is stronger at lower antibody concentrations.

[0111] ② As can be seen from the results in FIG9 , the monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) detected no expression of the mismatch repair protein MLH1 in the MLH1 gene-deficient HCT-116 cell line (1), which is consistent with the detection results of the commercially available classic MLH1 antibody clone No. ES05 (corresponding to part 2 in FIG9 ).

[0112] The results showed that the mouse anti-human mismatch repair protein MLH1 monoclonal antibody secreted by the hybridoma cell line (GDMCC No. 64004) described in the present invention can specifically recognize the mismatch repair protein MLH1 in the LoVo cell line and the HeLa cell line, but does not recognize the MLH1 protein in the HCT-116 cell line. The detection results are consistent with those of the commercially available classic MLH1 antibody with clone number ES05, ​​and the performance is better.

[0113] Taken together, the above results indicate that the anti-human mismatch repair protein MLH1 monoclonal antibody secreted by the mouse anti-human mismatch repair protein MLH1 monoclonal hybridoma cell line (GDMCC No. 64004) of the present invention can not only specifically identify colon cancer deletion tumor tissue and cancer cells, but can also specifically recognize MLH1 protein in colon cancer, gastric cancer, breast cancer, endometrial cancer tumor tissue, human colon cancer cell line (LoVo cell line), and human cervical cancer cell line (Hela cell line), but does not recognize MLH1 protein in deletion colon cancer and human deletion colon cancer cell line (HCT116 cell line). It has high affinity and high specificity and is one of the highly sensitive and specific markers for gastrointestinal tumors and tumors related to female reproductive organs.

[0114] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A monoclonal hybridoma cell line, characterized in that, The monoclonal hybridoma cell line is deposited in the Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No. 64004.

2. A monoclonal antibody against human mismatch repair protein MLH1, characterized in that, It is secreted by the monoclonal hybridoma cell line described in claim 1.

3. A monoclonal antibody against human mismatch repair protein MLH1, characterized in that, The amino acid sequences of the three complementarity-determining regions CDR-VH1, CDR-VH2, and CDR-VH3 of the heavy chain variable region of the monoclonal antibody are respectively as shown in SEQ ID No. 1-3, and the amino acid sequences of the three complementarity-determining regions CDR-VL1, CDR-VL2, and CDR-VL3 of its light chain variable region are respectively the amino acid sequences as shown in SEQ ID No. 4-6.

4. The monoclonal antibody according to claim 2 or 3, characterized in that, The monoclonal antibody is a mouse IgG2a subtype monoclonal antibody.

5. A nucleic acid molecule encoding the monoclonal antibody against human mismatch repair protein MLH1 according to any one of claims 3-4.

6. The nucleic acid molecule according to claim 5, characterized in that, The nucleotide sequences encoding the three complementarity-determining regions of the heavy chain of the monoclonal antibody are respectively as shown in SEQ ID No. 7-9, or are nucleotide sequences encoding and expressing the amino acid sequences as shown in SEQ ID No. 1-3; the nucleotide sequences encoding the three complementarity-determining regions of the light chain of the monoclonal antibody are respectively as shown in SEQ ID No. 10-12, or are nucleotide sequences encoding and expressing the amino acid sequences as shown in SEQ ID No. 4-6.

7. Use of the monoclonal antibody against human mismatch repair protein MLH1 according to any one of claims 2-4 in the preparation of an immunoassay kit for mismatch repair protein MLH1.

8. A human mismatch repair protein MLH1 immunoassay kit, characterized in that, The kit contains the monoclonal antibody against human mismatch repair protein MLH1 according to any one of claims 2-4.

9. The kit according to claim 8, characterized in that, The detection method of the kit is an immunoassay method.

10. The kit according to claim 9, characterized in that, The immunoassay includes immunohistochemistry and immunocytochemistry.

Images