Nanobody targeting YAP and use thereof

By developing nano-antibody NbE3, NbE4 and NbE8 that target YAP and forming a complex with E3 ubiquitin ligase RNF4, the problem of difficulty in targeting YAP protein in the prior art was solved, and efficient tumor treatment effect was achieved.

WO2025160962A1PCT designated stage Publication Date: 2025-08-07NANFANG HOSPITAL OF SOUTHERN MEDICAL UNIV

Patent Information

Application Number
PCT/CN2024/075552
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-02-02
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

The lack of effective nano-antibody targeting YAP protein in the prior art leads to inefficient tumor treatment regimens and risk of off-targeting, and the inability to directly inhibit the function of YAP protein.

Method used

The nano-antibody targeting YAP is developed, NbE3, NbE4 and NbE8, which has strong binding power and can bind efficiently to YAP proteins. It also forms a complex through the E3 ubiquitin ligase RNF4, degrading YAP proteins in cells, changing signaling pathways, and alleviating tumor development.

Benefits of technology

It has achieved efficient targeted treatment for YAP-related diseases, has high binding force and efficient degradation ability, significantly inhibits tumor growth and migration, and has excellent clinical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024075552_07082025_PF_FP_ABST
    Figure CN2024075552_07082025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a nanobody targeting YAP and a use thereof. The nanobody targeting YAP comprises three complementarity determining regions and four framework regions. The three complementary determining regions are CDR1, CDR2, and CDR3, respectively, and the four framework regions are FR1, FR2, FR3, and FR4, respectively. The amino acid sequence of CDR1 is as shown in SEQ ID NO. 1, the amino acid sequence of CDR2 is as shown in SEQ ID NO. 2, and the amino acid sequence of CDR3 is as shown in SEQ ID NO. 3 or SEQ ID NO. 4; and the amino acid sequence of FR1 is as shown in SEQ ID NO. 5, the amino acid sequence of FR2 is as shown in SEQ ID NO. 6 or SEQ ID NO. 7, the amino acid sequence of FR3 is as shown in SEQ ID NO. 8 or SEQ ID NO. 9, and the amino acid sequence of FR4 is as shown in SEQ ID NO. 10 or SEQ ID NO. 11. The nanobody targeting YAP has a relatively high binding force to YAP. By means of the targeting effect of the antibody on YAP, the development of a drug related to a nanobody against YAP is facilitated, and targeted treatment of a disease associated with YAP is implemented.
Need to check novelty before this filing date? Find Prior Art

Description

Nanobodies targeting YAP and their applications Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a nanobody targeting YAP and its application. Background Art

[0002] Yes-associated protein (YAP) is a transcriptional coactivator and a key effector molecule in the Hippo signaling pathway. Its upregulation and activation promote cell proliferation, growth, and anti-apoptosis, and are closely linked to the development and progression of many diseases. Structurally, YAP is a multidomain protein with an N-terminal proline-rich domain, a TEAD-binding domain (TAD), a WW domain, an SH3-binding motif, a transcription activator-binding domain (TID), and a C-terminal PDZ-binding motif. The TID and TAD domains are essential for YAP to exert its transcriptional effects. Because YAP lacks a DNA-binding domain, it interacts with DNA-bound transcription factors and regulates gene expression as a coactivator. The TID domain primarily recruits transcriptional activators, while the TAD domain binds to transcription factor TEA domain family members 1-4 (TEAD1-4). Together, these complexes promote transcription of downstream target genes.

[0003] The Hippo signaling pathway, also known as the Salvador / Warts / Hippo (SWH) pathway, is named after the Drosophila protein kinase Hippo (Hpo). It controls organ size by regulating cell proliferation and apoptosis. Its core components include upstream kinases and downstream effector proteins. In mammalian cells, the upstream kinases of the Hippo signaling pathway primarily include mammalian STE20-like kinases 1 / 2 (MST1 / 2), large tumor suppressor 1 / 2 (LATS1 / 2), Sav family WW domain protein 1 (SAV1), and MOB kinase activator 1 (MOB1). The two main downstream effector proteins are YAP and TAZ. The Hippo signaling pathway receives external signals. For example, when cell density is too high, Merlin and Scribble localize to cell adhesion junctions or the cell membrane. They promote Hippo pathway activation by forming complexes with a series of kinases. After mediating phosphorylation of MST1 / 2 and LATS1 / 2, they further promote phosphorylation of YAP at Ser-127 (p-YAP Ser127) and TAZ at Ser-89 (p-TAZ Ser89), causing them to bind to 14-3-3 proteins, thereby retaining them in the cytoplasm. Further phosphorylation of YAP at Ser-381 (p-YAP Ser381) and TAZ at Ser-311 (p-TAZ Ser311) leads to their degradation by the ubiquitin proteasome system (USP). Phosphorylation of YAP / TAZ inhibits nuclear entry of YAP / TAZ, thereby suppressing the expression of downstream target genes and inhibiting cell growth and proliferation.

[0004] The mutational inactivation of the Hippo signaling pathway reduces the activity of the upstream kinase cascade, resulting in a decrease in YAP phosphorylation levels, causing nuclear accumulation, enhancing the transcriptional expression of downstream target genes, and promoting the occurrence and development of tumors. Studies have shown that YAP activity is upregulated in most tumors. In primary liver cancer (PLC), YAP expression is associated with high tumor progression and poor differentiation. At the same time, YAP upregulation is positively correlated with alpha-fetoprotein levels. Overactivation of YAP is commonly observed in patients with non-small cell lung cancer (NSCLC), and downregulation of LATS2 is observed in approximately 60% of cases. In addition, YAP upregulation has been found in tumors such as gastric cancer, colon cancer, ovarian cancer, and prostate cancer.

[0005] Given the important role of abnormalities in the Hippo-YAP pathway in tumor development and progression, targeting this pathway is currently a hot topic in anti-tumor drug development. Researchers have found that verteporfin (VP) can bind to YAP and alter its conformation, effectively blocking the YAP-TEAD interaction, thereby reducing tumor cell growth caused by YAP overactivation. However, due to verteporfin's systemic toxicity and poor pharmacokinetic properties, its clinical use in the treatment of YAP-dependent tumors is still limited. In addition, preventing YAP nuclear localization and translocation is also a targeted strategy. Drugs such as statins and zoledronic acid have been found to block YAP nuclear localization by acting on kinases downstream of Rho GTPase. The anchor polymerase inhibitor XAV939 blocks AMOT degradation, localizing YAP to the cytoplasm and reducing YAP nuclear accumulation. In addition, studies have found that YAP overexpression-mediated tumorigenesis is associated with immune escape. Overactivated YAP protein in tumor cells can induce the expression of two chemokines, CCL2 and CSF1, thereby strongly recruiting macrophages to the surrounding tumor-initiating cells. Further studies have shown that the recruited macrophages are type 2 macrophages, which suppress T cells, allowing tumor-initiating cells to escape immune surveillance and avoid elimination. Therefore, for tumor cells with high YAP expression, inhibiting their recruitment of macrophages may be a new therapeutic direction. By reviewing current therapeutic drugs and treatment directions, we found that tumors caused by inactivation of the Hippo signaling pathway are all related to excessive activation of YAP. Therefore, how to eliminate or inhibit the action of YAP protein has become the key to treating YAP-dependent tumors.

[0006] Current treatment options for YAP-overactivated tumors essentially inhibit the transcriptional effects of its downstream target genes, reducing its activity in the cell nucleus. This type of treatment may have a long onset, incomplete effects, and the potential for off-target effects. More importantly, there are currently no inhibitors that directly target the YAP protein, primarily because the protein itself has few binding sites, making it difficult for small molecule drugs to bind with sufficient strength.

[0007] Heavy-chain antibodies (HCAbs) are a new type of antibody found in camels and sharks that differs from traditional antibodies in structure. They are composed of only two heavy chains. The antigen-binding site in heavy-chain antibodies is composed of the variable domain of the heavy chain of the HcAbs (VHH). VHHs produced through in vitro recombinant expression have a molecular weight of only 15kDa, which is about one-tenth that of traditional antibodies and about half that of single-chain antibody fragments (scFV, VH-VL). Therefore, they are called nanobodies (Nb). Nanobodies are also the smallest unit antibodies currently available with complete biological functions. This type of antibody not only has a smaller size and molecular weight, but also has functional advantages that traditional monoclonal antibodies do not have. For example: (1) Nanobodies have more stable physical and chemical properties, and have better solubility, heat resistance, and resistance to proteolysis; (2) Nanobodies are simpler to produce on a large scale, because they have short sequences and simple protein structures, and can be expressed in large quantities in microbial systems, which has a lower production cost advantage than traditional antibodies; (3) Nanobodies have low immunogenicity, and their gene sequences are highly homologous to the human VH gene family III sequence, making them less likely to produce adverse reactions; (4) They have smaller molecular weight, stronger tissue permeability, and faster blood clearance; (5) Nanobodies have more significant advantages in recognizing antigenic epitopes than traditional antibodies. The former has a longer CDR3 region structure and can interact with epitopes that traditional antibodies cannot recognize; (6) Nanobodies have the ability to form polymers. This property can be used to construct multivalent antibodies and bispecific antibodies, producing antibody materials with higher binding efficiency and wider application.

[0008] Protease-targeting chimera (PROTAC) is a ternary complex consisting of three structures (target protein linker, intermediate linker, E3 ubiquitin ligase adapter). This complex draws the target protein and E3 ubiquitin ligase closer to each other, prompting the latter to ubiquitinate the former and initiate subsequent proteasomal degradation. Compared with traditional inhibitors, this complete elimination of protein function seems to be more likely to change related signal transduction changes within the cell and alleviate the disease process.

[0009] The E3 ubiquitin ligase RNF4 contains a C-terminal RING domain, which is responsible for binding to the ubiquitin-loaded E2 ligase to facilitate the transfer of ubiquitin to the target substrate, while the N-terminal region contains four SUMO interaction motifs (SIMs), which allow the E3 ubiquitin ligase to bind substrates containing multiple SUMOs. In short, RNF4 is an intermediary that can target ubiquitin to connect to a SUMO tag.

[0010] Summary of the Invention

[0011] The purpose of the present application is to provide a nanobody targeting YAP and its application, which aims to solve the problem in the prior art of the lack of nanobodies that can target YAP and perform corresponding effects.

[0012] In a first aspect, the present application provides a nanobody targeting YAP, wherein the nanobody comprises three complementary determining regions and four framework regions, the three complementary determining regions are CDR1, CDR2 and CDR3, and the four framework regions are FR1, FR2, FR3 and FR4;

[0013] Wherein, the amino acid sequence of the CDR1 is shown as SEQ ID NO.1, the amino acid sequence of the CDR2 is shown as SEQ ID NO.2, and the amino acid sequence of the CDR3 is shown as SEQ ID NO.3 or SEQ ID NO.4; the amino acid sequence of the FR1 is shown as SEQ ID NO.5, the amino acid sequence of the FR2 is shown as SEQ ID NO.6 or SEQ ID NO.7, the amino acid sequence of the FR3 is shown as SEQ ID NO.8 or SEQ ID NO.9, and the amino acid sequence of the FR4 is shown as SEQ ID NO.10 or SEQ ID NO.11.

[0014] In a second aspect, the present application provides a nucleic acid molecule comprising a nucleotide sequence encoding the above-mentioned nanobody.

[0015] In a third aspect, the present application provides a vector comprising the above-mentioned nucleic acid molecule.

[0016] In a fourth aspect, the present application provides a host cell, which contains the above-mentioned nucleic acid molecule, or contains the above-mentioned vector.

[0017] In a fifth aspect, the present application provides a drug conjugate, which contains: the above-mentioned nanoantibody, and a conjugated portion selected from the following group: a detectable marker, a drug, a toxin, a cytokine or an enzyme.

[0018] In a sixth aspect, the present application provides a nanobody complex comprising the above-mentioned nanobody and an E3 ubiquitin ligase.

[0019] In a seventh aspect, the present application provides a composition comprising the aforementioned nanobody, the aforementioned nucleic acid molecule, the aforementioned vector, the aforementioned host cell, the aforementioned drug conjugate, or the aforementioned nanobody complex.

[0020] In an eighth aspect, the present application provides the use of the aforementioned nanobody, the aforementioned nucleic acid molecule, the aforementioned vector, the aforementioned host cell, the aforementioned drug conjugate, the aforementioned nanobody complex, or the aforementioned composition in the preparation of a drug targeting YAP protein.

[0021] In a ninth aspect, the present application provides the use of the aforementioned nanoantibody, the aforementioned nucleic acid molecule, the aforementioned vector, the aforementioned host cell, the aforementioned drug conjugate, the aforementioned nanoantibody complex, or the aforementioned composition in detecting YAP protein activity levels for non-diagnostic and non-therapeutic purposes in vitro.

[0022] The beneficial effects of the present application are that the nanoantibodies NbE3, NbE4, and NbE8 provided herein all have high binding affinity to YAP, and the antibodies can be used to target the YAP protein, which is conducive to the development of drugs related to YAP nanoantibodies and the targeted treatment of YAP-related diseases, and has very large clinical application value. In addition, the anti-YAP nanoantibody complex (E3-2RNF4, E4-2RNF4, E8-2RNF4) can degrade YAP protein in cells, change intracellular signaling pathways, and alleviate the progression of tumor development; the nanoantibody complex can also directly target and degrade YAP protein, with high efficiency and thoroughness that are incomparable to small molecule drugs, and has excellent research value and development prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a diagram showing the screening results of anti-YAP nanobodies provided in the Examples of the present application;

[0024] FIG2 is a graph showing the affinity detection results of the anti-YAP nanobody provided in the examples of the present application;

[0025] Figure 3 is a schematic diagram of the anti-YAP nanobody-2RNF4 and its ubiquitination process provided in the examples of the present application;

[0026] FIG4 is a graph showing the results of the anti-YAP nanobody complex provided in the examples of the present application inhibiting tumor growth;

[0027] FIG5 is a graph showing the results of the anti-YAP nanobody complex provided in the examples of the present application inhibiting tumor cell migration;

[0028] FIG6 is a graph showing the results of the anti-YAP nanobody complex provided in the examples of the present application inhibiting tumor growth in vivo;

[0029] FIG7 is a graph showing the results of inhibiting tumor growth by in vitro delivery of the E8-2RNF4 plasmid provided in the Examples of the present application. DETAILED DESCRIPTION

[0030] Below, the present application is further described in conjunction with the accompanying drawings and specific implementation methods. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0031] Through extensive and in-depth research and extensive screening, this application successfully obtained nanobodies NbE3, NbE4, and NbE8. Experimental results show that nanobodies NbE3, NbE4, and NbE8 all have high binding affinity to YAP. These antibodies can be used to target the YAP protein, facilitating the development of drugs related to YAP nanobodies and achieving targeted treatment for YAP-related diseases, with great clinical application value.

[0032] The term "affinity" refers to the binding ability between a macromolecule and its bound antigen, in particular the binding ability between a nanobody and its bound antigen, such as the binding ability between the nanobodies NbE3, NbE4, NbE8 and YAP protein of the present application.

[0033] The binding capacity of the Nanobodies NbE3, NbE4 and NbE8 of the present application can be measured in vitro by several methods, including surface plasmon resonance or by ELISA, as described in the Examples.

[0034] As known to those skilled in the art, immunoconjugates and fusion expression products include conjugates formed by binding of drugs, toxins, cytokines, radionuclides, enzymes, and other diagnostic or therapeutic molecules to the antibodies or fragments thereof of the present application. The present application also includes cell surface markers or antigens bound to the Nanobodies NbE3, NbE4, and NbE8 or fragments thereof.

[0035] The present application provides a nanobody targeting YAP, which comprises three complementary determining regions and four framework regions, the three complementary determining regions being CDR1, CDR2, and CDR3, and the four framework regions being FR1, FR2, FR3, and FR4; the amino acid sequence of CDR1 is shown in SEQ ID NO.1, the amino acid sequence of CDR2 is shown in SEQ ID NO.2, and the amino acid sequence of CDR3 is shown in SEQ ID NO.3 or SEQ ID NO.4; the amino acid sequence of FR1 is shown in SEQ ID NO.5, the amino acid sequence of FR2 is shown in SEQ ID NO.6 or SEQ ID NO.7, the amino acid sequence of FR3 is shown in SEQ ID NO.8 or SEQ ID NO.9, and the amino acid sequence of FR4 is shown in SEQ ID NO.10 or SEQ ID NO.11. The sequences are shown in Table 1.

[0036] Table 1

[0037] In this application, the term "framework region," "framework," or "FR" refers to the amino acid sequence interposed between CDRs.

[0038] In a specific embodiment of the present application, the amino acid sequence of Nanobody NbE3 is shown in SEQ ID NO. 12. Wherein, SEQ ID NO. 12 is:

[0039] In a specific embodiment of the present application, the amino acid sequence of Nanobody NbE4 is shown in SEQ ID NO. 13. Wherein, SEQ ID NO. 13 is:

[0040] In a specific embodiment of the present application, the amino acid sequence of Nanobody NbE8 is shown in SEQ ID NO. 14. Wherein, SEQ ID NO. 14 is:

[0041] On the other hand, the present application provides a nucleic acid molecule comprising a nucleotide sequence encoding the nanobody of the present application.

[0042] In a specific embodiment, the nucleotide sequence encoding the Nanobody NbE3 is the nucleotide sequence shown in SEQ ID NO. 15. Wherein, SEQ ID NO. 15 is:

[0043] In a specific embodiment, the nucleotide sequence encoding the Nanobody NbE4 is the nucleotide sequence shown in SEQ ID NO. 16. Wherein, SEQ ID NO. 16 is:

[0044] In a specific embodiment, the nucleotide sequence encoding Nanobody NbE8 is the nucleotide sequence shown in SEQ ID NO. 17. Wherein, SEQ ID NO. 17 is:

[0045] Typically, the nucleic acid molecule is a DNA or RNA molecule, which can be contained in any suitable vector, such as a plasmid, cosmid, episome, artificial chromosome, phage, or viral vector.

[0046] The terms "vector," "cloning vector," and "expression vector" refer to vehicles that can introduce DNA or RNA sequences into a host cell in a manner that transforms the host and promotes expression (eg, transcription and translation) of the introduced sequence.

[0047] Therefore, the present application provides, in one aspect, a vector comprising the nucleic acid of the present application.

[0048] Non-limiting examples of plasmid vectors include pQE 12, pUC series, pBluescript (Stratagene), pET series expression vectors (Novagen) or pCRTOPO (Invitrogen), λgt11, pJOE, pBBR1MCS series, pJB861, pBSMuL, pBC2, pUCPKS, pTACT1, pTRE, pCAL n EK, pESP 1, pOP13CAT, E 027 pCAG Kosak Cherry (L45a) vector system, pREP (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stra tagene), pXT1 (Stra tagene), pSG5 (Stra tagene), EBO pSV2neo, pBPV 1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2 dhfr, pIZD35, Okayama Berg cDNA expression vectors pcDV1 (Pharmacia), pRc / CMV, pcDNA1, pcDNA3 (Invitrogen), pcDNA3.1, pSPORT1 (GIBCO BRL), pGEMHE (Promega), pLXIN, pSIR (Clontech), pIRES EGFP (Clontech), pEAK 10 (EdgeBiosystems) pTriEx Hygro (Novagen) and pCINeo (Promega). Non-limiting examples of plasmid vectors suitable for Pichia pastoris include, for example, plasmids pAO815, pPIC9K and pPIC3.5K (all Invitrogen). Another vector suitable for expressing proteins in Xenopus embryos, zebrafish embryos, and a variety of mammalian and avian cells is the multipurpose expression vector pCS2+.

[0049] Typically, the vector may contain one or more origins of replication (ori) and genetic systems for cloning or expression, one or more markers for selection in a host (e.g., antibiotic resistance), and one or more expression cassettes. In addition, the coding sequence contained in the vector may be linked to transcriptional regulatory elements and / or to other amino acid coding sequences using established methods. Such regulatory sequences are well known to those skilled in the art and include, but are not limited to, regulatory sequences that ensure transcription initiation, internal ribosome entry sites (IRES), and optional regulatory elements that ensure transcription termination and transcript stability. Non-limiting examples of such regulatory elements that ensure transcription initiation include promoters, translation initiation codons, enhancers, insulators, and / or regulatory elements that ensure transcription termination, which are included downstream of the nucleic acid molecules of the present application. Further examples include Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing, nucleotide sequences encoding secretion signals, or signal sequences depending on the expression system used, which are capable of directing the expressed protein to a cell compartment or culture medium. The vector may also contain additional expressible polynucleotides encoding one or more protein chaperones to promote correct protein folding.

[0050] Other examples of viral vectors include adenovirus, retrovirus, herpes virus and AAV vectors. Such recombinant viruses can be produced by techniques well known to those skilled in the art, such as by transfection of packaging cells or by transient transfection with helper plasmids or viruses. Typical examples of viral packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, 293 cells, etc.

[0051] Therefore, the present application provides, on the other hand, host cells transfected, transduced or transformed according to the nucleic acid and / or vector of the present application. The term "transformation" refers to the introduction of an "exogenous" (i.e., external or extracellular) gene or DNA or RNA sequence into a host cell so that the host cell expresses the introduced gene or sequence to produce a substance of interest, typically a protein encoded by the gene or introduced sequence. A host cell that receives and expresses the introduced DNA or RNA has been "transformed."

[0052] The nucleic acid molecules and / or vectors of the present application can be designed to be introduced into cells by, for example, chemical-based methods (polyethyleneimine, calcium phosphate, liposomes, DEAE dextran, nuclear transfection), non-chemical methods (electroporation, sonoporation, photofection, gene electrotransfer, fluid delivery, or transformation that occurs naturally when cells are in contact with the nucleic acid molecules of the present application), particle-based methods (gene gun, magnetofection, puncture transfection), phage vector-based methods, and viral methods. For example, expression vectors derived from, for example, retroviruses, vaccinia viruses, adeno-associated viruses, herpes viruses, Semliki viruses, or bovine papilloma viruses can be used to deliver nucleic acid molecules to targeted cell populations. In addition, baculovirus systems can also be used as vectors in eukaryotic expression systems for the nucleic acid molecules of the present application.

[0053] The nucleic acids according to the present application can be used to produce the nanobodies of the present application in a suitable expression system. The term "expression system" refers to a host cell and a vector that are compatible under appropriate conditions, for example, for expressing a protein encoded by the exogenous DNA carried by the vector and introduced into the host cell.

[0054] Conventional expression systems include Escherichia coli host cells and plasmid vectors, insect host cells and baculovirus vectors, and mammalian host cells and carriers thereof. Other embodiments of host cells include prokaryotic cells (e.g., bacteria) and eukaryotic cells (e.g., yeast cells, mammalian cells, insect cells, plant cells, etc.). Specific embodiments include but are not limited to Escherichia coli, Kluyveromyces or Saccharomyces yeast, mammalian cell lines (e.g., Vero cells, Chinese hamster ovary syndrome (CHO) cells, 3T3 cells, COS cells, BHK cells, Bowes melanoma cells, HeLa cells, 911 cells, AT1080 cells, A549 cells, HEK293 cells and HEK293T cells, etc.) and primary or established mammalian cell cultures (e.g., produced by lymphoblasts, fibroblasts, epithelial cells, neurons, adipocytes, etc.).

[0055] In the present application, any appropriate host cell / vector system can be used for the expression of the DNA sequence encoding the antibody molecule of the present application. Bacteria (e.g., E. coli) and other microbial systems can be used, or eukaryotic (e.g., mammalian) host cell expression systems can also be used. The above-mentioned cells include (but are not limited to) mammalian cells, plant cells, insect cells, fungal cells, or cells of bacterial origin. As mammalian cells, one selected from the group consisting of (but not limited to) CHO cells, F2N cells, CSO cells, BHK cells, Bowes melanoma cells, HeLa cells, 911 cells, AT1080 cells, A549 cells, HEK293 cells, and HEK293T cells can be preferably used as a host cell. Any cell known to those skilled in the art that can be used as a mammalian host cell can be used in the art.

[0056] The present application also relates to Nanobodies bound to a detectable label.

[0057] By "Nanobody bound to a detectable marker" is meant herein that the detectable marker is directly or indirectly bound to the Nanobody, for example via a cleavable or non-cleavable linker peptide, or incorporated into the Nanobody. The detectable marker may in particular be bound to the Nanobody by substitution (for example by replacing H with I at the level of tyrosine residues), by complexation or by chelation.

[0058] The term "detectable marker" as used herein means a compound that produces a detectable signal. When it is attached to a tracer, it can monitor what the tracer becomes in the body. Detectable markers can be MRI contrast agents, scintigraphy contrast agents, X-ray imaging contrast agents, ultrasound contrast agents, optical imaging contrast agents. Examples of detectable markers include radioactive elements, fluorophores such as fluorescein, Alexa or cyanine; chemiluminescent compounds such as luminol; bioluminescent compounds such as luciferase or alkaline phosphatase; and contrast agents such as nanoparticles or gadolinium.

[0059] The nano antibodies targeting YAP described herein can also be conjugated to therapeutic agents to form immunoconjugates, such as antibody drug conjugates (ADCs). Suitable therapeutic agents include antimetabolites, alkylating agents, DNA minor groove binders, DNA intercalators, DNA cross-linking agents, histone deacetylase inhibitors, nuclear export inhibitors, proteasome inhibitors, topoisomerase I or II inhibitors, heat shock protein inhibitors, tyrosine kinase inhibitors, antibiotics and anti-mitotic agents. In ADC, the antibody and therapeutic agent are preferably conjugated via a cleavable linker (e.g., a peptidyl, disulfide or hydrazone linker).

[0060] The present application also provides other polypeptides, such as fusion proteins comprising Nanobodies or fragments thereof. In addition to nearly full-length polypeptides, the present application also includes fragments of the Nanobodies of the present application. Typically, the fragment has at least about 50 consecutive amino acids of the antibody of the present application, preferably at least about 50 consecutive amino acids, more preferably at least about 80 consecutive amino acids, and most preferably at least about 100 consecutive amino acids.

[0061] The Nanobodies according to the present application can be administered to a patient using any method of administration known to a person skilled in the art. In particular, Nanobodies can be administered, for example, orally, by inhalation or parenterally (in particular by intravenous injection).

[0062] The amount of Nanobody administered naturally depends on the route of administration, the height and / or weight of the patient, and the detection technique used.

[0063] The term "patient" refers to a human who presents with symptoms associated with a YAP-associated disease. Depending on the YAP-associated disease, the disease may include solid tumors or hematological malignancies, inflammatory diseases, and the like.

[0064] Non-limiting examples of cancers for treatment include primary liver cancer (PLC), non-small cell lung cancer (NSCLC), gastric cancer, colon cancer, ovarian cancer, prostate cancer. The methods described herein can also be used to treat metastatic cancer, unresectable cancer, refractory cancer and / or recurrent cancer.

[0065] The present application also relates to the use of Nanobodies for the preparation of medicaments intended for the treatment of YAP-related diseases and / or the prevention of YAP-related diseases in patients who may develop YAP-related diseases.

[0066] The present application also relates to a method for treating a YAP-associated disease and / or preventing a YAP-associated disease in a patient in need thereof, comprising administering to a patient in need thereof a therapeutically effective amount of a Nanobody as defined above.

[0067] Nanobodies according to the present application can be administered, for example, orally, by inhalation, parenterally (particularly by intravenous injection) in a suitable form. When a parenteral route is envisaged, Nanobodies can be in the form of injectable solutes and suspensions packaged in vials or bottles. Typically, the form of parenteral administration is obtained by mixing Nanobodies with buffers, stabilizers, preservatives, solubilizers, isotonic agents and suspending agents. According to known techniques, these mixtures are subsequently sterilized and then packaged in the form of intravenous injections. By way of buffer, those skilled in the art can use buffers based on organophosphates. Examples of suspending agents include methylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, gum arabic and sodium carboxymethylcellulose. In addition, the stabilizers used according to the present application are sodium sulfite and sodium metabisulfite, while sodium p-hydroxybenzoate, sorbic acid, cresol and chlorocresol can be mentioned as preservatives. The present application also relates to pharmaceutical compositions comprising a combination of Nanobody B12 and a pharmaceutically acceptable carrier.

[0068] The terms "pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic or otherwise troublesome reactions when administered to mammals, particularly humans.

[0069] In the context of this application, the expression "pharmaceutically acceptable carrier" includes any solvent, dispersion medium, coating, antibacterial or antifungal agent, isotonic or absorption delaying agent, etc. The use of such media and agents for pharmaceutically active substances is well known to those skilled in the art. Except in cases where conventional media or agents are incompatible with the active ingredient, their use in pharmaceutical compositions is contemplated. Additional active ingredients may also be incorporated into the composition.

[0070] The present application also relates to the use of nanobodies for detecting YAP in samples in vitro.

[0071] The term "sample" as used herein means a portion of a larger element. Preferably, a sample is a substance of biological origin. It contains cells and / or other molecular entities to be characterized and / or identified based on, for example, physical, biochemical, chemical and / or physiological characteristics. For example, the phrase "disease sample" or its variants refers to any sample obtained from a subject of interest that is expected or known to contain cells and / or molecular entities to be characterized. Samples include, but are not limited to, tissue samples (e.g., tumor tissue samples), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous humor, lymphatic fluid, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysates, and tissue culture medium, tissue extracts such as homogenized tissue, tumor tissue, cell extracts, and combinations thereof.

[0072] The present application will be further described in detail below with reference to the accompanying drawings and examples. The following examples are only used to illustrate the present application and are not intended to limit the scope of the present application.

[0073] Example:

[0074] 1. Screening and affinity verification of anti-YAP nanoantibodies

[0075] 1) Expression and purification of anti-YAP nanobody

[0076] The YAP-GST gene was designed and synthesized, and the protein was expressed and purified for nanobody screening. The expression and purification steps were as follows: a) To prevent inclusion body formation and protein degradation, induction conditions were explored using different concentrations of IPTG at 16°C; b) Based on the pre-experimental induction conditions, large-scale expression was induced using an autoclave at 1000W; c) centrifugation was performed at 17,000g for 30 minutes at 4°C, and the supernatant was incubated with Ni filler at 4°C for 1 hour; d) the target protein was eluted using a gradient of imidazole concentrations; e) after Ni column purification, molecular sieve separation was performed to remove contaminants, with the AKTA parameters set at a flow rate of 0.5 mL / min and 1 mL collected per column; f) the target protein purity was determined based on electrophoresis results, and the protein concentration was determined by BCA assay.

[0077] 2) Nanobody screening and preliminary ELISA verification of positive clones

[0078] The natural alpaca-derived phage display nanoantibody library was screened using the immunotube method. The selected phage display library had a capacity of 2x10 9 The screening steps were as follows: a) the target protein was coated on an immunotube at a concentration of 40 μg / mL and three rounds of enrichment screening were performed; b) the phage eluate from the third round was used for plate-based screening, and 192 monoclonal clones were randomly selected for ELISA verification. The 96-well ELISA plate was simultaneously coated with YAP / GST, GST, and BSA. A positive standard was defined as an ELISA reading that was three times greater than the corresponding GST and BSA readings and a reading greater than 0.5; c) the positive monoclonal clones identified by the two phage ELISA tests were sequenced to determine the sequence information, and the sequence was extracted to obtain the nanobody protein sequence. The sequences were then compared and analyzed to obtain the distribution frequency of the positive sequences.

[0079] 3) Purification and expression of nanobodies

[0080] The nanobody gene sequence was cloned into the pColdII vector, and the hemagglutinin HA tag and 6×His tag were fused for subsequent detection. The expression and purification steps were as follows: a) To prevent the formation of inclusion bodies and protein degradation, 0.2mM IPTG was used for induction at 16°C; b) According to the pre-experimental induction conditions, a large amount of expression was induced, and the bacteria were broken by autoclaving at 1000W; c) Centrifuged at 17000g at 4°C for 30min, the supernatant was taken and incubated with Ni filler at 4°C for 1 hour; g) After Ni column purification, molecular sieve separation was performed, and the AKATA parameters were set to 0.5mL / min, and every 1mL was collected once.

[0081] 4) ELISA experiment of nanoantibodies

[0082] This experiment is used to verify whether nanobodies expressed and purified in vitro can directly interact with antigen proteins purified in vitro. The steps are as follows: a) dilute the antigen protein to 5ug / ml with PBS, and the GST protein to 2.5μg / ml, both at 100μl / well, coat the plate, and incubate at 4°C overnight; b) block the plate with 3% PBS / BSA at room temperature for 2h, 200ug / well; c) prepare different concentrations of nanobodies in 1% BSA / PBST, 100ug / well, and incubate at room temperature for 1h; d) incubate with secondary antibody anti-HA HRP (1:3000) at room temperature for 1h; e) develop color with TMB; e) terminate the reaction with stop solution; g) measure the absorbance at 450nm using a microplate reader, and develop a curve based on the absorbance value.

[0083] 5) Surface plasmon resonance (SPR)

[0084] This experiment further validates the binding of antigens and nanobodies and calculates their equilibrium constant. Purified antigen protein is immobilized on the chip, and nanobodies of varying concentrations are sequentially added to analyze their affinity for the antigen protein. The reaction signal is recorded over 360 seconds, and a kinetic curve is generated to calculate relevant parameters.

[0085] 2. Cell lines

[0086] Human uveal melanoma cell lines (92.1 and OMM2.3) were provided by Dr. Martine Jager (Leiden University). Human mesothelioma cell lines (MSTO-211H, NCI-H2052, and NCI-H2373), human gastric cancer cell lines (AGS, IM95, N-87, and TMK-1), human gastric epithelial cell line (NCI-H2373), and human mesothelioma cell line (MSTO-211H) were also provided. Gastric epithelial cell line (GES-1), human breast cancer cell line (MDA-MB-231), HEK293A, and HEK293T were all obtained from ATCC. 92.1, OMM2.3, MSTO-211H, NCI-H2052, NCI-H2373, AGS, N-87, and TMK-1 were cultured in RPMI 1640 (Thermo Fisher Scientific). IM95, GSE-1, HEK293A, HEK293T, and MDA-MB-231 cells were cultured in DMEM (Thermo Fisher Scientific). The culture medium was supplemented with 10% fetal bovine serum (Gemini) and 1% penicillin-streptomycin solution (Invitrogen). Cell lines were authenticated by STR and tested for mycoplasma-free status prior to cell viability assays and in vivo studies.

[0087] 3. Viral infection, exogenous gene expression, and RNA interference

[0088] Lentivirus is produced in HEK293T cells using a second-generation lentiviral system. Transgenic gene expression in this cell line is mediated by lentiviral infection. Briefly, HEK293T cells are co-transfected with the packaging plasmids psPAX2 and pMD2.G, along with a lentiviral transfer vector. Crude virus obtained from the culture supernatant is purified by centrifugation and then filtered through a 0.45 μm filter. This crude virus is then added to the target cells along with 5 μg / ml of polybrene. 48 hours after infection, 1-2 μg / ml of puromycin is added to the culture medium for positive selection.

[0089] All transient transfections were performed using PolyJet Reagent (Signagen Laboratories) according to the manufacturer's protocol.

[0090] For doxycycline (Dox)-inducible expression assays, cell lines are infected with a lentivirus encoding an integrated construct containing a tetracycline-controlled transposon (TetR) and expression of the gene of interest driven by a tandem Tet operator.

[0091] To generate a cell line stably expressing doxycycline-inducible human YAP shRNA, the pLKO.1-TetOn-puro vector was used. Two shRNAs were used, designated shYAP#1 and shYAP#2. The nucleotide sequence of shYAP#1 is shown in SEQ ID NO. 18, and the nucleotide sequence of shYAP#2 is shown in SEQ ID NO. 19.

[0092] shYAP#1-5'-CCGGCTGGTCAGAGATACTTCTTAACTCGAGTTAAGAAGTATCTGACCA GTTTTTC-3';

[0093] shYAP#2-5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGATGTCAGAACTCAAAGCTTTTTTTC-3'.

[0094] 4. HA pull-down experiment

[0095] To analyze the binding ability of nanobody E8 to intracellular YAP protein, we further constructed inducible YAP knockdown cell lines (OMM2.3sh YAP#1 / #2, IM95 sh YAP#1 / #2) on OMM2.3 and IM95. The intracellular YAP content before and after induction was used as a standard to verify whether the nanobody could bind to the YAP protein in the cells before knockdown. OMM2.3#1 / #2 was subjected to inducible YAP knockdown under Dox 500ng / mL conditions, and protein lysates were collected after 24 hours (four groups). The above lysate was quantified to 5μg / mL, and then 20μg of nanobody E8 was added. The cells were rotated and incubated at 4°C for 2 hours to allow the nanobody to fully bind to intracellular YAP. The above lysate was then divided into two parts, one of which was used for western blotting detection of VHH tag (to verify the amount of nanobody added was consistent) and β-actin (to verify the concentration of the lysate was consistent). Another portion was added with anti-HA tag magnetic beads (Thermo Fisher, 88837) and incubated with rotation at 4°C for 2 hours. The beads were then collected and heated in 1× loading medium for western blotting analysis. The YAP antibody was then used for incubation. The same experiment was performed on IM95 sh YAP#1 / #2.

[0096] 5. Colony formation assay

[0097] Appropriate numbers of cells were plated in 12-well plates. After culturing for 10-14 days, colonies were stained with 0.1% crystal violet and counted.

[0098] 6. RNA Extraction and Reverse Transcription Quantitative Real-Time PCR

[0099] Cells were harvested using the RNAsimple Total RNA Kit (RE-03113, FOREGENE) to extract RNA. RNA samples were reverse transcribed into complementary DNA (cDNA) using PrimeScript RT Master Mix (RR036A, Takara). Real-time PCR was performed using GoTaq qPCR Master Mix (A6002, Promega) and an Applied LightCycler 480 real-time PCR system. Relative mRNA levels were determined by normalization to endogenous GAPDH mRNA. The primers used included primer CYR61, primer CTGF, primer CDC6, primer FGF-1, and primer GAPDH. The specific sequences are shown in Table 2.

[0100] Table 2

[0101] 7. Annexin V staining for cell apoptosis analysis

[0102] After treatment, cells were trypsinized and rinsed with pre-cold PBS, then stained with Annexin V-FITC and PI (Annexin V-FITC Apoptosis Detection Kit, Dojindo) according to the manufacturer's protocol. Stained cells were analyzed by flow cytometry (BD LSRFortessa X-20) within 1 hour.

[0103] 8. Transwell cell migration assay.

[0104] Cell migration assays were performed using BD Falcon cell culture inserts (24-well plates with 8 μm pore size filters). The bottom filter was pre-coated with fibronectin (20 μg / ml). Cells were treated with or without doxycycline (200 ng / ml, 48 hours). Subsequently, 5 × 10 4 Cells were seeded into the upper chamber of the insert. The lower chamber was filled with complete culture medium. After 10 hours, the cells were fixed and stained with 0.1% crystal violet. The cells in the upper chamber were carefully removed, and the number of cells that migrated through the filter was assessed by photography.

[0105] 9. Antibodies

[0106] Antibodies against YAP (14074, 1:1000), HA-tag (3724, 1:1000), and HA-tag HRP conjugate (14031, 1:1000) were purchased from Cell Signaling Technology. Anti-GAPDH (sc-25778, 1:10,000) was purchased from Santa Cruz Biotechnology. Anti-His-tag (ab18184, 1:1000) was purchased from Abcam. Antibody against beta-actin (66009-1-Ig, 1:5000) was purchased from Proteintech. Antibody against VHH (A02019, 1:1000) was purchased from Genscript. Antibody against EGFP (GTX113617, 1:5000) was purchased from GeneTex.

[0107] 10. Immunohistochemistry

[0108] Immunohistochemistry was performed on paraffin-embedded tissues. Antigens in tissue sections were retrieval in 10 mM sodium citrate buffer (pH 6). After antigen retrieval, endogenous peroxidases were inhibited and the samples were immersed in blocking buffer (PV-6000) for 30 minutes. The samples were then probed with primary antibodies against YAP (1:200), Ki67 (Cell Signaling Technology, 9449, 1:200), and HA-tag (Cell Signaling Technology, 3724, 1:500) and incubated overnight at 4°C. Antigen-antibody complexes were detected using a DAB peroxidase substrate kit (ZSGB-BIO).

[0109] 11. Nanoparticle (NPs) packaging

[0110] After extracting pIRES2-EGFP-E8-2RNF4 and pIRES2-EGFP-C3-2RNF4 plasmid DNA using an endotoxin-free large-scale extraction kit (TIANGEN DP117), a PEI-DNA mixture was first prepared in Hepes buffer (pH 8.0) at a ratio of 1:3 (1 μg:3 μL). PGA was then added according to the specified ratio, mixed thoroughly, and allowed to stand for 30 minutes.

[0111] 12. Animal Experimentation

[0112] All animal experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee of Southern Medical University (2015-0056).

[0113] Male nude mice (6 weeks old) were purchased from Guangdong Medical Laboratory Animal Center (Guangzhou, China), and NCG mice (6 weeks old) were purchased from Kingfa Science & Technology (Jiangsu, China). 6 )、MDA-MB-231E8-2RNF4(3*10 6 ) and 92.1E8-2RNF4(5*10 6 ) were subcutaneously implanted into the right posterior flank of nude mice. Once the tumor was palpable, the mice were randomly assigned to a control treatment group (water) or a doxycycline treatment group. Mice in the doxycycline treatment group received 0.5 mg / ml of doxycycline (Sigma-Aldrich) in their drinking water and 5% sucrose. The doxycycline water was changed every two days. Tumor height and width were measured with a caliper, and tumor volume (= width) was calculated. 2 *High*0.5). 92.1 tumor xenografts were excised, recorded, and fixed for subsequent experiments. Growth curves for MDA-MB-231, MSTO-211H, and IM95 tumors were terminated when tumor volume reached 1500 mm 3 When the survival curve was drawn, the final tumor growth size of each group of mice was set to 2000mm. 3 .

[0114] For in vivo plasmid delivery therapy, the animal model was established according to the above method. Once the tumor reached an appropriate size, the mice were given plasmid delivery therapy via intraperitoneal injection (IM95) or para-cancer injection (MSTO-211H).

[0115] Wild-type AB zebrafish were obtained from the Chinese Zebrafish Resource Center (Wuhan). Zebrafish embryos were cultured under standard conditions at 28°C. Before injection into the embryonic eyeball (48 hours after fertilization), cells were fluorescently labeled with 5 μM CM-DiI (Thermo Fisher Scientific) at 37°C for 20 minutes. Transplanted embryos were sorted to remove embryos that could not meet the injection requirements and then treated with or without doxycycline (1 μg / ml) and maintained at 34°C. Four days after injection, transplanted embryos were examined using an Olympus MVX10 zoom fluorescence macro system microscope. Tumor cells that spread from the original injection site (eye) to distal areas (head, trunk, and tail) were manually counted and defined as infiltrating cells.

[0116] Result analysis:

[0117] 1. Screening of anti-YAP nanobodies

[0118] By cloning a fusion peptide of a YAP protein truncation and GST protein and purifying the recombinant protein from E. coli, a highly pure, approximately 70 kDa soluble YAP-GST protein and a negative control GST protein were obtained, as shown in Figure 1A.

[0119] The two purified proteins were then used for nanobody screening using phage display technology. After three rounds of screening, the second round of sub-library was enriched about 100 times compared with the first round of sub-library (the titer of the first round of screening was 4×10 7 pfu, the titer of the second round of screening was 3.2×10 9 Because the first two rounds of screening used YAP-GST protein, there were some false positive monoclonal clones that bound to GST. Therefore, in the third round of screening, GST protein was used as an antigen for reverse screening to remove the false positive monoclonal clones. After that, the supernatant of negative screening was incubated with YAP-GST protein for screening. The titer of the third round of screening dropped to 3.2×10 8 pfu (3.2×10 9 The pfu decreased to 3.2×10 8 pfu), and the final eluted monoclonal clone is the phage monoclonal clone that can bind to YAP protein. For the results of the three rounds of screening, please refer to Figure 1B.

[0120] Preliminary phage ELISA identified 72 positive binders (YAP-GST / GST reading ≥ 3) that bound to YAP from 192 phage clones, as shown in Figure 1C and Figure 1D. A total of 12 nanobody sequences were obtained after sequencing. Further analysis determined that the 12 nanobody sequences obtained by screening had only two different complementary determination CDR3 regions (ALLEGTTWFSISPFDY (11 / 12) ALLEGITWFSISPFDY (1 / 12). The CDR3 region is the most important part of the nanobody that specifically binds to the antigen. The highly enriched sequence also indicates that the nanobody obtained in this screening has good binding ability, as shown in Figure 1E.

[0121] 2. Affinity detection of anti-YAP nanobodies

[0122] In order to detect the in vitro binding ability of nanobodies, we cloned the 12 nanoantibody sequences obtained above into the pColdII vector, and fused HA and His tags in the constructed sequence for subsequent purity testing. The 12 soluble nanoantibodies were purified using the E. coli expression system and further confirmed with HA tag antibodies and His tag antibodies. The molecular weight of these 12 nanoantibodies is approximately 15 kDa, and the results are shown in Figure 2A. The binding ability of the 12 nanoantibodies screened to YAP-GST was subsequently confirmed by ELISA, and GST protein was coated as a negative control. All nanoantibodies involved in the experiment were able to bind to YAP-GST and showed a good binding curve, while the nanoantibodies did not show any binding activity to the GST protein, as shown in Figure 2B. The binding affinity was then measured using surface plasmon resonance (SPR). Consistent with the ELISA results, all nanoantibodies involved in the experiment showed good binding ability, and the equilibrium dissociation constant K D All are at the nanomolar level, with the top three being E3, E4, E8, and K D The results are shown in Figure 2C .

[0123] This application also verifies whether the nanoantibodies obtained by screening by HA pull down can bind to the natural, full-length YAP protein in the cell. First, uveal melanoma cells are clear YAP-dependent cells, and the YAP protein in their cells can be used as a standard full-length protein to judge the binding ability of nanoantibodies. The two shRNAs targeting YAP knockdown, namely shYAP#1 and shYAP#2, were cloned into the PLKO.1-teton-puro vector, and the inducible knockdown YAP cell lines OMM2.3shYAP#1 and #2 were constructed by lentiviral packaging infection. After DOX-induced knockdown of YAP, nanoantibody E8 (NbE8) was added, and the mixture was divided into two parts. One part was used for VHH and internal reference detection to ensure the consistency of other conditions, and the other part was added with anti-HA magnetic beads to immunoprecipitate the anti-YAP nanoantibody and YAP protein complex. The results showed that the nanoantibody can co-precipitate the YAP protein in the cell line that was not infected with the YAP shRNA virus, while no obvious YAP protein was detected in the cell line after knocking down YAP, as shown in Figure 2D. Similarly, in order to observe whether nanobodies can show similar effects in other cell lines, gastric cancer cells IM95 were also subjected to similar experiments and obtained the same results, that is, anti-YAP nanobodies can co-precipitate endogenous YAP protein. In summary, the results show that the screened nanobodies can specifically recognize the natural, full-length YAP protein in cells and show similar binding ability on different cell lines. The binding ability shown in vitro and in vivo provides a strong basis for the subsequent construction of targeted protein degradation chimeras (PROTACs).

[0124] 3. Construction and intracellular degradation verification of PROTAC targeting YAP, while inhibiting the growth of multiple tumors

[0125] The E3 ubiquitin ligase RNF4 contains an N-terminus and a C-terminus. The N-terminal region contains four SUMO interaction motifs (SIMs), which allow the E3 ubiquitin ligase to bind to substrates containing multiple SUMOs, while the C-terminus has a key RING domain that is responsible for binding to the E2 ligase loaded with ubiquitin so that the latter can transfer ubiquitin to the target substrate, that is, the substrate protein carrying the SUMO unit. In short, RNF4 is a mediator that can target ubiquitin to be connected to a SUMO tag. In order to achieve precise ubiquitination of YAP protein, the substrate recognition domain of RNF4 is replaced with the screened nanoantibody, and the RING domain is connected to the nanoantibody to obtain a complex that targets ubiquitinated YAP protein. The RING domains of RNF4 can only activate their function and initiate the ubiquitination process by contacting each other. In order to improve the efficiency of ubiquitination, the present application constructs a nanoantibody complex with two RING domains, namely nanoantibody-2RNF4. This nanoantibody complex improves the activation efficiency of RNF4 and accelerates the ubiquitination process. Among them, Figure 3 shows a schematic diagram of the nanobody-2RNF4 and its ubiquitination process. YAP protein is a nuclear transcription factor that plays a major role in the cell nucleus. Therefore, when constructing the nanobody complex, the nuclear localization signal (NLS) is retained in all constructs, so that it can simultaneously degrade the YAP protein in the cell nucleus. At the same time, the HA tag is retained as a visual indicator of the intracellular expression of the nanobody complex.

[0126] In uveal melanoma cells (92.1 and OMM2.3), mesothelioma cells (MSTO-211H, NCI-2373 and NCI-H2052) and breast cancer cells (MDA-MB-231), YAP is constitutively activated due to mutations in core components or upstream regulatory factors of the Hippo pathway, as shown in Figure 4A. Importantly, these cell lines have been shown to be YAP-dependent. In addition, by investigating multiple gastric cancer cell lines, AGS and IM95 were found to be YAP-dependent. In order to evaluate whether the anti-YAP nanobody-2RNF4 can effectively degrade endogenous YAP through the ubiquitin-proteasome system, a stable cell line expressing the anti-YAP nanobody-2RNF4 induced by doxycycline (DOX) was constructed using the above-mentioned YAP-dependent cancer cells. After DOX treatment, the expression of HA-tagged irrelevant control nanoantibody (C3)-2RNF4 or anti-YAP nanoantibody (E3, E4 and E8)-2RNF4 in OMM2.3 cells was effectively induced. In addition, the induction of expression of E3-2RNF4, E4-2RNF4 or E8-2RNF4 resulted in a sharp decrease in endogenous YAP levels, while the control C3-2RNF4 did not affect the expression of YAP in OMM2.3 cells. The results are shown in Figure 4B. In addition, as shown in Figure 4C, downregulation of YAP protein levels was also seen after DOX-induced expression of E8-2RNF4 in another uveal melanoma cell line 92.1. Theoretically, YAP protein, as a nuclear transcription factor, regulates downstream target genes related to cell growth. The qPCR results were consistent with expectations. After YAP protein was degraded by the inducible E8-2RNF4, its downstream genes (Cyr61 / CTGF / CDC6 / FGF-1) were downregulated to varying degrees, and the quantitative analysis results were also the same, as shown in Figure 4D for details.

[0127] To confirm the dependent pathway of YAP protein degradation, Dox induction was performed in the presence of the autophagy inhibitor chloroquine (CQ) and the proteasome inhibitor MG132. Western blotting showed that YAP degradation was not affected by CQ but was blocked by MG132, as shown in Figure 4E. This confirmed that the nanobody complex-mediated YAP protein degradation was carried out through the ubiquitin-proteasome pathway, which is the main mode of RNF4-mediated protein degradation.

[0128] To further confirm the inhibitory effect of the constructed anti-YAP nanobody-2RNF4 system on the growth of YAP-dependent tumors, DOX-induced stable cell lines expressing E8-2RNF4 and C3-2RNF4 fusion proteins were constructed for uveal melanoma cells (92.1 and OMM2.3), mesothelioma cells (MSTO-211H, NCI-2373, and NCI-H2052), breast cancer cells (MDA-MB-231), and gastric cancer cells (AGS, IM95). As shown in Figures 4F to 4I, the induction of E8-2RNF4 significantly inhibited colony formation in all tested cell lines, while the control C3-2RNF4 had no effect. In addition, as shown in Figure 4J, after DOX-induced E8-2RNF4 expression, significant cell apoptosis in 92.1 and OMM2.3 was also observed using PI / Annexin V flow cytometry. These data suggest that E8-RNF4 has general applicability in promoting YAP degradation and inhibiting YAP-dependent survival in various cancer cell lines.

[0129] 4. Nanoantibody complexes can inhibit tumor cell migration

[0130] Zebrafish embryos are transparent and immune-privileged, meaning that there are specific areas where, even in the presence of antigens, they cannot be recognized and eliminated by the immune system. Therefore, it is possible to directly observe the migration, metastatic invasion, and extravasation of single human cancer cells in vivo. Uveal melanoma often undergoes migration, forming refractory and drug-resistant metastatic lesions, which affects clinical prognosis and treatment. To investigate the inhibitory effect of E8-2RNF4 on tumor migration, a Transwell assay was first performed in vitro. As shown in Figure 5A, E8-2RNF4 was expressed under Dox induction and significantly inhibited the migration efficiency of uveal melanoma cell lines (OMM2.3, 92.1), with a significant decrease in the number of cells passing through the chamber. After OMM2.3 (E8-2RNF4 / C3-2RNF4) and 92.1 (E8-2RNF4 / C3-2RNF4) cells were injected into 2-day-old zebrafish embryos and cultured in water containing DOX to simulate the Dox-induced link in in vitro cell culture, the tumor cells in the zebrafish were induced to express the nanoantibody complex, and the migration of the cells in vivo was observed. The spread of tumor cells from the original injection site (eye) to the distal area (head and trunk) was measured. Please refer to Figure 5B and Figure 5C. Compared with the control C3-2RNF4, E8-2RNF4 significantly inhibited the spread of OMM2.3 and 92.1 cells from the eye to distant sites after Dox-induced expression. These results indicate that the nanoantibody complex constructed in the present application significantly inhibits tumor cell migration after degrading YAP protein.

[0131] 5. In vivo, YAP degradation induced by the nanobody complex can inhibit tumor growth and prolong survival

[0132] In summary, nanobody complex (E8-2RNF4)-mediated YAP degradation resulted in significant phenotypic changes (growth rate, migration efficiency) in YAP-dependent cells. Furthermore, we investigated whether E8-2RNF4 could inhibit solid tumors in vivo. Stable cell lines of breast cancer (MDA-MB-231), gastric cancer (IM95), and mesothelioma (MSTO-211H) cells were inoculated into a series of immunodeficient mice to establish xenograft models. These mice were then given DOX-containing drinking water and a normal diet in vitro, mimicking the control and DOX-induced treatments used in the in vitro experiments. As shown in Figures 6A to 6C, DOX-induced E8-2RNF4 expression significantly inhibited tumor growth, whereas C3-2RNF4 had no tumor-suppressing effect. Furthermore, E8-2RNF4 significantly improved the quality of life and prolonged the survival of the mice, as shown in Figures 6D to 6F. Uveal melanoma, a well-established YAP-dependent tumor, was also generated by generating a stable cell line 92.1 expressing E8-2RNF4 induced by DOX. Treatment of drinking water with DOX inhibited the growth of these solid tumors in immunodeficient mice (see Figures 6G to 6I). Further demonstrating that the in vivo tumor suppression effect is associated with YAP degradation, see Figures 6J and 6K. Immunohistochemistry of in vitro tumor tissue sections also revealed intracellular expression of HA-tagged E8-2RNF4, accompanied by downregulation of YAP protein and decreased levels of the nuclear proliferation marker Ki67.

[0133] 6. In vitro delivery of E8-2RNF4 plasmid inhibits tumor growth

[0134] Gene therapy involves the use of efficient nucleic acid delivery vectors to transfer large, negatively charged DNA / RNA molecules across natural barriers such as the plasma membrane, releasing them from endocytic organelles into the cell to achieve therapeutic effects. Delivery vectors are categorized into non-viral and viral gene delivery vectors. The former primarily include polymer nanoparticles and liposomes. We further explored the possibility of using polymers to deliver plasmids encoding E8-2RNF4 or the control C3-2RNF4 to tumor sites and reduce YAP expression.

[0135] The gene delivery vector used in this study is the most common, highly electropositive polyethyleneimine (PEI). PEI can complex with negatively charged nucleic acids (DNA or RNA) through electrostatic interactions, thereby achieving gene delivery. Not only can efficient transfection be achieved in vitro, but PEI-based nanocarriers have also been developed for tumor treatment. However, due to their strong electropositivity, gene complexes constructed based on PEI can exhibit significant cytotoxicity in vivo. Therefore, we introduced polyglutamic acid (PGA), an anionic polymer, to construct PEI / PGA / DNA hybrid nanoparticles (NPs), which can reduce the positive charge to a certain extent and improve safety. In addition, PGA has also been shown to promote cellular uptake of NPs.

[0136] The genes encoding E8-2RNF4 or C3-2RNF4 were cloned into the pIRES2-EGFP vector. EGFP was expressed alongside the target gene, and EGFP served as an indicator for fluorescence microscopy and flow cytometry, allowing for intuitive assessment of transfection efficiency. In the construction of the NPs, the PEI:DNA ratio was 1:3 (1 μg:3 μL). Furthermore, a PGA / DNA (w / w) mixture was introduced to find a suitable mixing system that would reduce charge and improve safety while still allowing for observation of YAP protein degradation. When the NPs were incubated with MSTO-211H cells at a PGA / DNA ratio of 0.5, YAP protein degradation was also observed in vitro, with the extent of degradation comparable to that observed with the PEI-positive control (Figure 7A). NPs derived from this ratio were used for in vitro therapeutic delivery. After tumors were established in immunodeficient mice using the MSTO-211H xenograft model, the NPs were then injected adjacent to the tumor for drug delivery. As shown in Figures 7B and 7C, E8-2RNF4 nanoparticles significantly inhibited the growth of solid tumors compared to C3-2RNF4, and there was no significant difference in the body weight of mice in the treatment groups, which indirectly reflects the good safety characteristics of these NPs. More importantly, as shown in Figure 7D, in vitro tumor tissue western blotting showed that the E8-2RNF4 group was more able to cause YAP protein degradation than the PBS group and the C3-2RNF4 group. At the same time, the apoptosis indicator (Caspased-3 splice) in the E8-2RNF4 group was significantly increased compared to the other two groups, indicating that cancer cell apoptosis increased after YAP degradation.

[0137] To further explore the multi-tumor applicability of this plasmid system, we conducted similar experiments with gastric cancer cells in vitro and in vivo. At a PGA / DNA ratio of 0.5, the in vitro transfection efficiency of NPs for IM95 cells was similar to the YAP protein degradation effect of PEI (see Figure 7E). Because IM95 cells grow slowly in immunodeficient mice, we treated IM95 xenograft tumors using intraperitoneal injection. As shown in Figures 7F and 7G, NPs encapsulated with E8-2RNF4 significantly inhibited tumor growth compared to the PBS group, demonstrating that this method can efficiently deliver DNA to tumors.

[0138] Therefore, the nanoantibodies NbE3, NbE4, and NbE8 provided in this application all have a high binding affinity to YAP, and the antibodies can be targeted to the YAP protein, which is conducive to the development of drugs related to nanoantibodies for YAP, and to achieve targeted treatment of YAP-related diseases, which has a very large clinical application value. In addition, the anti-YAP nanoantibody complex (E3-2RNF4, E4-2RNF4, E8-2RNF4) can degrade YAP protein in cells, change intracellular signaling pathways, and alleviate the progression of tumor development; the nanoantibody complex can also directly target YAP protein and degrade it, with high efficiency and thoroughness that are incomparable to small molecule drugs, and has excellent research value and development prospects.

[0139] The above-mentioned embodiments are only preferred embodiments of the present application and cannot be used to limit the scope of protection of the present application. Any non-substantial changes and replacements made by technicians in this field based on the present application shall fall within the scope of protection required by the present application.

Claims

1. A nanobody targeting YAP, characterized in that The nanobody comprises three complementary determining regions and four framework regions, the three complementary determining regions are CDR1, CDR2 and CDR3, and the four framework regions are FR1, FR2, FR3 and FR4; Wherein, the amino acid sequence of the CDR1 is shown as SEQ ID NO.1, the amino acid sequence of the CDR2 is shown as SEQ ID NO.2, and the amino acid sequence of the CDR3 is shown as SEQ ID NO.3 or SEQ ID NO.4; the amino acid sequence of the FR1 is shown as SEQ ID NO.5, the amino acid sequence of the FR2 is shown as SEQ ID NO.6 or SEQ ID NO.7, the amino acid sequence of the FR3 is shown as SEQ ID NO.8 or SEQ ID NO.9, and the amino acid sequence of the FR4 is shown as SEQ ID NO.10 or SEQ ID NO.

11.

2. The nanobody targeting YAP according to claim 1, characterized in that The nanobody includes the nanobody NbE3, and the amino acid sequence of the nanobody NbE3 is shown in SEQ ID NO.

12.

3. The nanobody targeting YAP according to claim 1, characterized in that The nanobody includes the nanobody NbE4, and the amino acid sequence of the nanobody NbE4 is shown in SEQ ID NO.

13.

4. The nanobody targeting YAP according to claim 1, characterized in that The nanobody includes the nanobody NbE8, and the amino acid sequence of the nanobody NbE8 is shown in SEQ ID NO.

14.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleotide sequence encoding the Nanobody according to any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleotide sequence encoding the nanobody is the nucleotide sequence shown in SEQ ID NO.15 or SEQ ID NO.16 or SEQ ID NO.

17.

7. A carrier, characterized in that The vector comprises the nucleic acid molecule according to claim 5 or 6.

8. A host cell, characterized in that The host cell comprises the nucleic acid molecule according to claim 5 or 6, or comprises the vector according to claim 7.

9. A drug conjugate, characterized in that: The drug conjugate contains: The Nanobody according to any one of claims 1 to 4, and The conjugated moiety is selected from the group consisting of a detectable label, a drug, a toxin, a cytokine, or an enzyme.

10. A nanobody complex, characterized in that The nanobody complex comprises the nanobody according to any one of claims 1 to 4 and an E3 ubiquitin ligase.

11. The nanobody complex according to claim 10, characterized in that The nanobody complex contains two of the E3 ubiquitin ligases.

12. The nanobody complex according to claim 10 or 11, characterized in that The E3 ubiquitin ligase is RNF4.

13. A composition, characterized in that The composition comprises the Nanobody according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5 or 6, the vector according to claim 7, the host cell according to claim 8, the drug conjugate according to claim 9, or the Nanobody complex according to any one of claims 10 to 12.

14. Use of the Nanobody according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5 or 6, the vector according to claim 7, the host cell according to claim 8, the drug conjugate according to claim 9, the Nanobody complex according to any one of claims 10 to 12, or the composition according to claim 13 in the preparation of a drug targeting YAP protein.

15. Use of the Nanobody according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5 or 6, the vector according to claim 7, the host cell according to claim 8, the drug conjugate according to claim 9, the Nanobody complex according to any one of claims 10 to 12, or the composition according to claim 13 in in vitro non-diagnostic and non-therapeutic detection of YAP protein activity levels.

Citation Information

Patent Citations

  • Protein degradation

    CN115885039A

  • Nanometer antibody targeting Yes related protein as well as preparation method and application of nanometer antibody

    CN116178535A

  • Bifunctional fusion proteins for ubiquitin-mediated degradation

    WO2023215839A1

Cited By

  • Nano antibody Nb DX-6F capable of specifically recognizing doxycycline and application of nano antibody Nb DX-6F

    CN120737205A