Long-read and short-read co-sequencing device and bioinformatics sequencing method
By combining long and short read sequencing equipment and bioinformatics sequencing methods, and integrating long and short read sequencing technologies, the problems of low sequencing accuracy and high cost in existing technologies have been solved, achieving efficient and low-cost genome sequence identification and structural variation detection.
Patent Information
- Application Number
- PCT/CN2024/079156
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-28
- Publication Date
- 2026-03-26
AI Technical Summary
Existing long-read sequencing technologies have low accuracy and high cost, while short-read sequencing is time-consuming and computationally resource-intensive, making it difficult to accurately identify genomic structural variations.
Using a combined long and short read sequencing device and bioinformatics sequencing method, long base sequences are obtained through long read sequencing, and bioinformatics analysis is performed in conjunction with short read sequencing to correct differential sequences, thereby obtaining accurate target base sequences.
While reducing the number of sequencing attempts, consumable costs, and time, it improves the accuracy and efficiency of genome sequence identification and can effectively identify structural variations in the genome.
Smart Images

Figure CN2024079156_26032026_PF_FP_ABST
Abstract
Description
Long and short read length co-sequencing device and bioinformatics sequencing method TECHNICAL FIELD
[0001] The present application relates to the technical field of gene detection, in particular to a long and short read length co-sequencing device and a bioinformatics sequencing method. BACKGROUND
[0002] In order to obtain and study the genetic information sequence of DNA (DeoxyriboNucleic Acid), DNA sequencing is an essential link; in the prior art, long read length sequencing technology or short read length sequencing technology can be used to realize DNA sequencing operation to meet the demand for obtaining a super-long base sequence of DNA.
[0003] However, the accuracy of the super-long base sequence obtained by DNA sequencing through long read length sequencing technology is low, and the actual base sequence of DNA cannot be effectively reflected; in the existing long read length sequencing technology, multiple cycles of sequencing of the same long base sequence are often required, and multiple repeated sequencing is used to compensate for the accuracy problem, which greatly increases the time cost and resource cost of sequencing.
[0004] The sequence result of short read length sequencing is too short compared to the sequence of genome of ten million or even several billion, and a very high depth of repeated sequencing (at least 30x) is required to identify and assemble the super-long gene sequence, which not only causes long time and high cost of short read length sequencing, but also puts high requirements on the memory and calculation time of de novo bioinformatics. At the same time, due to the length limitation, short read length sequencing has great difficulty in identifying structural variations such as translocation, inversion, duplication, deletion and insertion and copy number variation in the genome. The conventional short read length sequencing and matching bioinformatics method is difficult to confirm the specific sequence of the above structural variation sites, and even whether the deletion variation has occurred.
[0005] SUMMARY
[0006] Therefore, it is necessary to provide a long and short read length co-sequencing device and a bioinformatics sequencing method which can accurately obtain a super-long base sequence with lower sequencing times, lower consumable costs, shorter sequencing time and less bioinformatics calculation investment.
[0007] In a first aspect, the present application provides a long and short read length co-sequencing device, which comprises a device input component, a device sequencing component and a device output component.
[0008] An apparatus input component configured to obtain a base sequence sample of a to-be-detected object;
[0009] An apparatus sequencing component configured to perform base sequencing processing on the base sequence sample to obtain a base target sequence corresponding to the to-be-detected object; wherein the base sequencing processing comprises first base sequencing processing and second base sequencing processing;
[0010] An apparatus output component configured to output the base target sequence determined by the apparatus sequencing component.
[0011] In one of the embodiments, the apparatus sequencing component comprises a first sample extraction and purification library construction apparatus, a first sequencing apparatus, a second sample extraction and purification library construction apparatus, and a second sequencing apparatus.
[0012] The first sample extraction and purification library construction apparatus and the first sequencing apparatus are configured to perform the first base sequencing processing on the base sequence sample.
[0013] The second sample extraction and purification library construction apparatus and the second sequencing apparatus are configured to perform the second base sequencing processing on the base sequence sample.
[0014] In a second aspect, the present application provides a bioinformatics sequencing method. The method comprises:
[0015] Obtaining a base sequence sample of a to-be-detected object;
[0016] Performing first base sequencing processing on the to-be-detected object according to the base sequence sample to obtain a base long sequence of the to-be-detected object;
[0017] Performing second base sequencing processing on the to-be-detected object according to the base sequence sample to obtain at least one base short sequence of the to-be-detected object;
[0018] Determining a base target sequence corresponding to the to-be-detected object according to the base long sequence and the at least one base short sequence.
[0019] In one of the embodiments, determining the base target sequence corresponding to the to-be-detected object according to the base long sequence and the at least one base short sequence comprises:
[0020] Performing bioinformatics analysis on the base long sequence according to the at least one base short sequence to obtain a difference sequence in the base long sequence;
[0021] Correcting the difference sequence by using the at least one base short sequence to obtain the base target sequence corresponding to the to-be-detected object.
[0022] In one of the embodiments, performing bioinformatics analysis on the base long sequence according to the at least one base short sequence to obtain a difference sequence in the base long sequence comprises:
[0023] determining the reference sequence corresponding to each base short sequence from the base long sequence;
[0024] performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain an analysis result of each reference sequence;
[0025] determining the difference sequence in the base long sequence from each reference sequence according to the analysis result.
[0026] In one embodiment, determining the difference sequence in the base long sequence from each reference sequence according to the analysis result includes:
[0027] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding base short sequence, the reference sequence is taken as the difference sequence in the base long sequence.
[0028] In one embodiment, determining the reference sequence corresponding to each base short sequence from the base long sequence includes:
[0029] For each base short sequence, determining the sequence start position from the base long sequence according to the first second base information contained in the base short sequence;
[0030] determining the sequence end position from the base long sequence according to the last second base information contained in the base short sequence;
[0031] determining the reference sequence corresponding to the base short sequence from the base long sequence according to the sequence start position and the sequence end position.
[0032] In one embodiment, determining the reference sequence corresponding to the base short sequence from the base long sequence according to the sequence start position and the sequence end position includes:
[0033] taking the sequence between the sequence start position and the sequence end position in the base long sequence as the reference sequence corresponding to the base short sequence.
[0034] In one embodiment, the first base information corresponding to the sequence start position in the base long sequence corresponds to the first second base information, and the first base information corresponding to the sequence end position in the base long sequence corresponds to the last second base information.
[0035] In one embodiment, correcting the difference sequence by using at least one base short sequence to obtain the base target sequence corresponding to the object to be detected includes:
[0036] obtaining the base short sequence corresponding to the difference sequence from each base short sequence;
[0037] The difference sequence is updated by using a short base sequence corresponding to the difference sequence, to obtain a base target sequence corresponding to the to-be-detected object.
[0038] In one of the embodiments, the difference sequence is updated by using a short base sequence corresponding to the difference sequence, to obtain a base target sequence corresponding to the to-be-detected object, including:
[0039] The first base information corresponding to the difference sequence is replaced by second base information of the short base sequence corresponding to the difference sequence, to obtain the base target sequence corresponding to the to-be-detected object.
[0040] In one of the embodiments, the first base sequencing processing is performed on the to-be-detected object, to obtain a long base sequence of the to-be-detected object, including:
[0041] The long base sequencing is performed on the base sequence sample, to obtain the long base sequence of the to-be-detected object.
[0042] In one of the embodiments, the second base sequencing processing is performed on the to-be-detected object, to obtain at least one short base sequence of the to-be-detected object, including:
[0043] The short base sequencing is performed on the base sequence sample, to obtain the at least one short base sequence of the to-be-detected object.
[0044] In a third aspect, the present application further provides a bioinformatics sequencing device. The device includes:
[0045] The acquisition module is configured to acquire a base sequence sample of a to-be-detected object;
[0046] The first determination module is configured to perform first base sequencing processing on the to-be-detected object according to the base sequence sample, to obtain a long base sequence of the to-be-detected object;
[0047] The second determination module is configured to perform second base sequencing processing on the to-be-detected object according to the base sequence sample, to obtain at least one short base sequence of the to-be-detected object;
[0048] The third determination module is configured to determine a base target sequence corresponding to the to-be-detected object according to the long base sequence and the at least one short base sequence.
[0049] In one of the embodiments, the analysis module includes:
[0050] The analysis unit is configured to perform bioinformatics analysis on the long base sequence according to the at least one short base sequence, to obtain a difference sequence in the long base sequence;
[0051] The correction unit is configured to correct the difference sequence by using the at least one short base sequence, to obtain the base target sequence corresponding to the to-be-detected object.
[0052] In a fourth aspect, the present application provides a computer device. The computer device comprises a memory and a processor. The memory stores a computer program. The processor implements the following steps when executing the computer program:
[0053] obtaining a base sequence sample of the to-be-detected object;
[0054] performing first base sequencing processing on the to-be-detected object according to the base sequence sample, to obtain a base long sequence of the to-be-detected object;
[0055] performing second base sequencing processing on the to-be-detected object according to the base sequence sample, to obtain at least one base short sequence of the to-be-detected object;
[0056] determining a base target sequence corresponding to the to-be-detected object according to the base long sequence and the at least one base short sequence.
[0057] In a fifth aspect, the present application provides a computer readable storage medium. The computer readable storage medium stores a computer program. The computer program is executed by a processor to implement the following steps:
[0058] obtaining a base sequence sample of the to-be-detected object;
[0059] performing first base sequencing processing on the to-be-detected object according to the base sequence sample, to obtain a base long sequence of the to-be-detected object;
[0060] performing second base sequencing processing on the to-be-detected object according to the base sequence sample, to obtain at least one base short sequence of the to-be-detected object;
[0061] determining a base target sequence corresponding to the to-be-detected object according to the base long sequence and the at least one base short sequence. BRIEF DESCRIPTION OF DRAWINGS
[0062] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed in the embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0063] FIG. 1 is a schematic diagram of a bioinformatics sequencing method provided by an embodiment of the present application;
[0064] FIG. 2 is a schematic diagram of another bioinformatics sequencing method provided by an embodiment of the present application
[0065] FIG. 3 is a schematic diagram of a base long sequence and a base short sequence provided by an embodiment of the present application;
[0066] FIG. 4 is a flowchart of a method for determining a difference sequence according to an embodiment of the present application;
[0067] FIG. 5 is a flowchart of a method for determining a base target sequence according to an embodiment of the present application;
[0068] FIG. 6 is a flowchart of a method for determining a base long sequence and at least one base short sequence according to an embodiment of the present application;
[0069] FIG. 7 is a schematic diagram of another bioinformatics sequencing method according to an embodiment of the present application;
[0070] FIG. 8 is a structural block diagram of a first bioinformatics sequencing device according to an embodiment of the present application;
[0071] FIG. 9 is a structural block diagram of a second bioinformatics sequencing device according to an embodiment of the present application;
[0072] FIG. 10 is a structural block diagram of a third bioinformatics sequencing device according to an embodiment of the present application;
[0073] FIG. 11 is a structural block diagram of a fourth bioinformatics sequencing device according to an embodiment of the present application;
[0074] FIG. 12 is a structural block diagram of a fifth bioinformatics sequencing device according to an embodiment of the present application;
[0075] FIG. 13 is a diagram of an internal structure of a computer device according to an embodiment of the present application. DETAILED DESCRIPTION
[0076] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and should not be used to limit the present application.
[0077] It should be understood that the specific embodiments described herein are only used to explain the present application and should not be used to limit the present application. In the description of the present application, the description of the terms “one embodiment”, “some embodiments”, “an example”, “a specific example”, or “some examples” means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.
[0078] In one embodiment, as shown in FIG. 1, a long short read co-sequencing device and bioinformatics sequencing method are provided. This embodiment is exemplified by the method applied to a terminal. It can be understood that the method can also be applied to a server, and can also be applied to a system including a terminal and a server, and can be realized through the interaction of the terminal and the server. The terminal can be, but is not limited to, various personal computers, notebook computers, smart phones, tablet computers, Internet of Things devices, and portable wearable devices. The Internet of Things device can be a smart speaker, a smart television, a smart air conditioner, a smart vehicle device, etc. The portable wearable device can be a smart watch, a smart bracelet, a head-mounted device, etc. The server can be realized by an independent server or a server cluster composed of multiple servers. In this embodiment, the method includes the following steps:
[0079] S101, obtaining a base sequence sample of a to-be-detected object;
[0080] The base sequence sample refers to a sample that can be extracted by a conventional method (such as throat swab collection or blood collection). The base sequence sample can be a throat swab or blood, etc.
[0081] S102, performing first base sequencing processing on the to-be-detected object according to the base sequence sample to obtain a base long sequence of the to-be-detected object.
[0082] It should be noted that the first base sequencing processing refers to base sequencing of the to-be-detected object by a sequencing technology capable of obtaining the base long sequence of the to-be-detected object. Therefore, when the first base sequencing processing of the to-be-detected object is required, the long read sequencing technology (third generation sequencing technology) can be used to perform base sequencing on the to-be-detected object to obtain the base long sequence of the to-be-detected object.
[0083] The first base sequencing processing can be a long read sequencing method or third generation sequencing. For example, the first base sequencing processing can be nanopore single molecule sequencing. In summary, there are many sequencing methods corresponding to the first base sequencing processing, which are not specified and limited herein.
[0084] In one embodiment of the present application, the base sequence sample of the to-be-detected object can be obtained, the sample extraction, purification, and library construction steps of the adaptive long sequence sequencing scheme are performed on the to-be-detected object to obtain a base sequence sample library of the to-be-detected object for first base sequencing, the first base sequencing is performed on the base sequence sample to obtain a base long sequence of the to-be-detected object.
[0085] S103, performing second base sequencing processing on the to-be-detected object according to the base sequence sample to obtain at least one base short sequence of the to-be-detected object.
[0086] It should be noted that the second base sequencing processing refers to base sequencing of the to-be-detected object by a sequencing technology capable of obtaining a short base sequence of the to-be-detected object. The second base sequencing processing can be a short read sequencing scheme or a second-generation sequencing. In this case, the second base sequencing processing is not specified and limited. Therefore, when the second base sequencing processing of the to-be-detected object is required, the sample extraction, purification, and library construction steps of the short read sequencing scheme can be performed on the to-be-detected object. The library of the to-be-detected object is subjected to the second base sequencing by the short read sequencing technology (second-generation sequencing technology), and at least one short base sequence of the to-be-detected object is obtained.
[0087] In an embodiment of the present application, an input sample of a to-be-detected object can be obtained. The base sequence sample of the to-be-detected object is extracted to obtain a base sequence sample of the to-be-detected object for the second base sequencing. The base sequence sample is subjected to the second base sequencing to obtain at least one short base sequence of the to-be-detected object.
[0088] Further, the present application can integrate different sequencing devices or modules into an instrument to realize the first base sequencing processing of the to-be-detected object and the second base sequencing processing of the to-be-detected object. Specifically, as shown in FIG. 2, the first sample extraction, purification, and library construction device A-1 and the first sequencing device A-2 are used to perform the first base sequencing processing of the to-be-detected object. The second sample extraction, purification, and library construction device B-1 and the second sequencing device B-2 are used to perform the second base sequencing processing of the to-be-detected object.
[0089] Among them, the sample processing, library construction, and sequencing device A series can realize the first base sequencing of the base sequence sample of the to-be-detected object. The sample processing, library construction, and sequencing device B series can realize the second base sequencing of the base sequence sample of the to-be-detected object.
[0090] Further, the present application can also realize the first base sequencing processing of the to-be-detected object and the second base sequencing processing of the to-be-detected object by the same sequencing device. Specifically, the sequencing device C is used to perform the first base sequencing processing of the to-be-detected object and the second base sequencing processing of the to-be-detected object.
[0091] Among them, the sequencing device C can realize both the first base sequencing of the base sequence sample of the to-be-detected object and the second base sequencing of the base sequence sample of the to-be-detected object.
[0092] S103, determining the base target sequence corresponding to the to-be-detected object according to the long base sequence and the at least one short base sequence.
[0093] In an embodiment of the present application, when the base target sequence corresponding to the to-be-detected object needs to be determined, the bioinformatics analysis is performed on the base long sequence according to the at least one base short sequence, to obtain a difference sequence in the base long sequence; the difference sequence is corrected using the at least one base short sequence, to obtain the base target sequence corresponding to the to-be-detected object.
[0094] The difference sequence refers to a sequence in which the first base information in the base long sequence is different from the corresponding second base information in the base short sequence.
[0095] The base target sequence can be the entire base sequence of the to-be-detected object, or can be the strain type, bacterial species, pathogenic gene, etc. obtained by comparing the base sequence of the to-be-detected object with a reference sequence.
[0096] In an embodiment of the present application, the present application can integrate a device through different sequencing devices in combination or modularization, to realize the first base sequencing processing on the to-be-detected object and the second base sequencing processing on the to-be-detected object. Specifically, as shown in FIG. 2, the sample extraction, purification and library construction device A-1 and the sequencing device A-2 are used to perform the first base sequencing processing on the to-be-detected object, to obtain a base long sequence; the sample extraction, purification and library construction device B-1 and the sequencing device B-2 are used to perform the second base sequencing processing on the to-be-detected object, to obtain at least one base short sequence. According to the base long sequence and the at least one base short sequence, the base target sequence corresponding to the to-be-detected object is determined; the base target sequence is displayed through a test result display module. The base target sequence can be an accurate base full sequence, a virus type, a bacterial species, a pathogenic gene result, a drug resistance gene detection result, etc.
[0097] The sample processing, library construction and sequencing device A series can realize the first base sequencing on the base sequence sample of the to-be-detected object; the sample processing, library construction and sequencing device B series can realize the second base sequencing on the base sequence sample of the to-be-detected object.
[0098] The above bioinformatics sequencing method determines the base target sequence corresponding to the to-be-detected object according to the base long sequence and the base short sequence by determining the base long sequence and the base short sequence. According to the above content, it can be known that, in the process of obtaining the base target sequence, the base target sequence is obtained according to the base long sequence and the base short sequence. Since the base information contained in the base short sequence has high accuracy, when determining the base target sequence corresponding to the to-be-detected object, the base information in the base short sequence is relied on, which has high accuracy, so that the base information accuracy of the base short sequence is combined under the premise of maintaining the base detection efficiency of the base long sequence, the base target sequence with accuracy is obtained under the premise of ensuring the base detection efficiency, so that the base target sequence can meet the actual situation of the to-be-detected object.
[0099] In an embodiment, when DNA sequencing is performed by a long-read sequencing technology, although the requirement for obtaining a super-long base sequence of DNA can be met, the accuracy of the super-long base sequence obtained by sequencing is low, and the actual base sequence of DNA cannot be effectively reflected. To solve the above problem, as shown in FIG. 2, the base target sequence corresponding to the to-be-detected object is determined according to the base long sequence and at least one base short sequence, which can specifically include the following content:
[0100] S301, determining a base long sequence and at least one base short sequence of a to-be-detected object.
[0101] It should be noted that the base long sequence refers to a base sequence obtained by performing a base sequencing operation on a to-be-detected object by a long-read sequencing technology; the base short sequence refers to a base sequence obtained by performing a base sequencing operation on a to-be-detected object by a short-read sequencing technology, wherein the number of base information contained in the base long sequence is greater than the number of base information contained in the base short sequence.
[0102] In an embodiment of the present application, when it is necessary to determine the base long sequence of the to-be-detected object, an input sample of the to-be-detected object can be obtained, and the input sample is processed by a long-read sequencing technology to obtain the base long sequence of the to-be-detected object.
[0103] The long-read sequencing technology can be a third-generation sequencing technology or a nanopore sequencing technology, and the type of the third-generation sequencing technology is not limited herein.
[0104] The input sample can include but is not limited to saliva of the to-be-detected object, blood of the to-be-detected object, etc.
[0105] In an embodiment of the present application, when it is necessary to determine the base short sequence of the to-be-detected object, an input sample of the to-be-detected object can be obtained, and the input sample is processed by a short-read sequencing technology to obtain the base short sequence of the to-be-detected object.
[0106] Further, in order to further ensure the sequence accuracy of the long base sequence of the to-be-detected object and the at least one short base sequence, nucleic acid extraction, purification, enrichment and library construction are required before the input sample is subjected to sequencing processing, so as to ensure the accuracy of the sequencing processing result corresponding to the input sample.
[0107] Specifically, a sample receiving and placing device is arranged to receive the base sequence sample input by the tester, such as blood, throat swab, etc. In the same test, the base sequence sample is subjected to long sequencing sample processing and short sequencing sample processing respectively. The sample with long read length is subjected to library construction process of long read length sequencing to obtain a long read length sequencing library, and the sample with short read length is subjected to library construction process of short read length sequencing to obtain a short read length sequencing library. Then, the base sequence sample is subjected to long base sequencing (long base sequencing can be third-generation sequencing) according to the long read length sequencing library to obtain the long base sequence of the to-be-detected object, and the base sequence sample is subjected to short base sequencing (short base sequencing can be second-generation sequencing) according to the short read length sequencing library to obtain the at least one short base sequence of the to-be-detected object. According to the above bioinformatics algorithm process, the sequencing result required by the tester is output, including but not limited to: full sequencing base sequence, virus type, pathogenic gene type, drug resistance result, etc.
[0108] S302, performing bioinformatics analysis on the long base sequence according to the at least one short base sequence to obtain a difference sequence in the long base sequence.
[0109] It should be noted that, since the difference sequence refers to the sequence in which the first base information in the long base sequence is different from the corresponding second base information in the short base sequence, when the difference sequence in the long base sequence is required, the following content can be included: determining the reference sequence corresponding to each short base sequence from the long base sequence, and then judging whether the first base information in the reference sequence is the same as the second base information in the corresponding short base sequence, and determining the difference sequence in the long base sequence according to the judgment result.
[0110] Wherein, the first base information refers to the base information contained in the long base sequence; the second base information refers to the base information contained in the short base sequence; further, the base information refers to deoxyadenylate, deoxythymine nucleotide, deoxycytidine and deoxyguanine nucleotide.
[0111] Specifically, if the first base information in a reference sequence is the same as the second base information in the corresponding base short sequence, it is determined that the reference sequence is not a difference sequence; if the first base information in a reference sequence is not the same as the second base information in the corresponding base short sequence, the reference sequence is taken as a difference sequence in the base long sequence.
[0112] In S303, the difference sequence is corrected by using at least one base short sequence to obtain a base target sequence corresponding to the to-be-detected object.
[0113] In an embodiment of the present application, in order to ensure that the base target sequence corresponding to the to-be-detected object can accurately reflect the real base information of the to-be-detected object, the first base information corresponding to the difference sequence can be replaced by the second base information of the base short sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the to-be-detected object, so as to correct the difference sequence by using at least one base short sequence.
[0114] For example, as shown in FIG. 4, if the first base information in the base long sequence can be represented as: ATCCCGTAGCTTTGGAACTCGATCATGCACC… (wherein A represents deoxyadenine nucleotide, T represents deoxythymine nucleotide, C represents deoxycytidine nucleotide, and G represents deoxyguanine nucleotide); and the base long sequence contains two base short sequences, which are base short sequence a and base short sequence b, respectively, wherein the second base information of the base short sequence a can be represented as: ATCGCGTAGC, and the second base information of the base short sequence b can be represented as: ATCATGGACC, and further, it is determined that the base short sequence a is in reference sequence a corresponding to the base long sequence, and the base short sequence b is in reference sequence b corresponding to the base long sequence; wherein it is determined that the first base information in the reference sequence a is not the same as the second base information in the corresponding base short sequence, and therefore, the reference sequence a is taken as a difference sequence, and the first base information corresponding to the difference sequence is replaced by the second base information of the base short sequence a corresponding to the difference sequence to obtain a base target sequence corresponding to the to-be-detected object.
[0115] In the process of obtaining the base target sequence, the base short sequence is used to correct the difference sequence, so that the base information in the base long sequence can be corrected to correct base information, thereby ensuring the accuracy of the base information in the base target sequence. In the process of determining the base target sequence, the base information accuracy of the base short sequence is combined to ensure the base detection efficiency, so that the base target sequence can meet the actual situation of the object to be detected.
[0116] In one embodiment, the base long sequence can be analyzed according to at least one base short sequence to obtain a difference sequence in the base long sequence, as shown in FIG. 5. Specifically, the following steps can be included:
[0117] S501, determining the reference sequence corresponding to each base short sequence from the base long sequence.
[0118] It should be noted that when the reference sequence corresponding to each base short sequence is to be determined, it can be verified whether the base long sequence and the base short sequence are obtained by sequencing the same base information of the object to be detected; if so, the base information is taken as the reference sequence corresponding to the base short sequence; if not, it is determined that the base information is not the reference sequence corresponding to the base short sequence.
[0119] Further, when the reference sequence corresponding to each base short sequence is to be determined, the following steps can be included: for each base short sequence, determining the sequence start position from the base long sequence according to the first second base information included in the base short sequence; wherein the first base information corresponding to the base long sequence at the sequence start position corresponds to the first second base information; determining the sequence end position from the base long sequence according to the last second base information included in the base short sequence.
[0120] Wherein, the first base information corresponding to the base long sequence at the sequence end position corresponds to the last second base information; determining the reference sequence corresponding to the base short sequence from the base long sequence according to the sequence start position and the sequence end position.
[0121] Specifically, the sequence between the sequence start position and the sequence end position in the base long sequence is taken as the reference sequence corresponding to the base short sequence.
[0122] S502, performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain an analysis result of each reference sequence.
[0123] It should be noted that the base similarity analysis is used to detect whether the first base information in each reference sequence is same as the second base information in the corresponding base short sequence. Therefore, when the base similarity analysis is needed to be performed on the first base information in each reference sequence and the second base information in the corresponding base short sequence, it can be verified whether the first base information in each reference sequence is same as the second base information in the corresponding base short sequence, and then, according to the verification result, the analysis result of each reference sequence is determined.
[0124] It should be noted that the base similarity analysis is used to detect whether the first base information in each reference sequence is same as the second base information in the corresponding base short sequence. Therefore, when the base similarity analysis is needed to be performed on the first base information in each reference sequence and the second base information in the corresponding base short sequence, it can be verified whether the first base information in each reference sequence is same as the second base information in the corresponding base short sequence, and then, according to the verification result, the analysis result of each reference sequence is determined.
[0125] S503, determining the difference sequence in the base long sequence from each reference sequence according to the analysis result.
[0126] In an embodiment of the present application, for each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is not same as the second base information in the corresponding base short sequence, the reference sequence is taken as the difference sequence in the base long sequence.
[0127] For example, if the first base information of the reference sequence is represented as: TCGCG (T represents deoxythymine nucleotide, C represents deoxycytidine nucleotide, and G represents deoxyguanine nucleotide), and the second base information in the corresponding base short sequence is represented as: TCGCA (A represents deoxyadenine nucleotide), wherein each first base information contained in the reference sequence is verified in sequence whether it is same as the second base information in the corresponding base short sequence, when the sixth first base information "G" of the reference sequence is verified, it is determined that the first base information "G" is not same as the second base information "A" in the corresponding base short sequence, and then the reference sequence in which the first base information "G" is located is taken as the difference sequence in the base long sequence.
[0128] In another embodiment of the present application, for each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is same as the second base information in the corresponding base short sequence, it is determined that the reference sequence is not the difference sequence in the base long sequence.
[0129] The bioinformatics sequencing method determines the reference sequence corresponding to each base short sequence, realizes that the reference sequence in which the first base information is different from the second base information in the corresponding base short sequence is a difference sequence in the base long sequence, provides a data basis for subsequent determination of the base target sequence according to the difference sequence, and guarantees the accuracy of subsequent determination of the base target sequence.
[0130] In an embodiment, as shown in FIG. 6, when it is necessary to determine the base target sequence corresponding to the to-be-detected object, the following content can be specifically included:
[0131] S601, obtaining the base short sequence corresponding to the difference sequence from each base short sequence.
[0132] It should be noted that, since the base short sequence corresponding to the difference sequence is needed in the process of correcting the difference sequence, the base short sequence corresponding to the difference sequence needs to be obtained from each base short sequence before the base target sequence corresponding to the to-be-detected object is obtained.
[0133] S602, updating the difference sequence by using the base short sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the to-be-detected object.
[0134] In an embodiment of the present application, when it is necessary to update the difference sequence, the following content can be specifically included: replacing the first base information corresponding to the difference sequence with the second base information of the base short sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the to-be-detected object.
[0135] The bioinformatics sequencing method determines the base short sequence corresponding to the difference sequence, realizes determination of the base target sequence according to the base short sequence corresponding to the difference sequence, and makes the base target sequence meet the actual situation of the to-be-detected object.
[0136] In an embodiment, as shown in FIG. 7, when it is necessary to perform first base sequencing processing on the to-be-detected object to obtain the base long sequence of the to-be-detected object, the following content can be specifically included:
[0137] S701, obtaining the base sequence sample of the to-be-detected object;
[0138] In an embodiment of the present application, the input sample of the to-be-detected object can be obtained in advance, the base sequence sample extraction is performed on the input sample to obtain the base sequence sample used for performing the first base sequencing processing on the to-be-detected object.
[0139] It should be noted that, since the input sample can include but is not limited to saliva of the to-be-detected object, blood of the to-be-detected object, etc., when the input sample of the to-be-detected object is needed, different input sample acquisition methods need to be used according to different input sample types. Further, there are many methods for acquiring the input sample of the to-be-detected object, and the way of acquiring the input sample of the to-be-detected object is not limited herein.
[0140] S702, base sequencing is performed on the base sequence sample to obtain a base long sequence of the to-be-detected object.
[0141] Further, before determining the base sequence sample, the following content is further included: pre-processing the input sample to obtain a target sample; sample splitting the target sample to obtain the base sequence sample. The pre-processing includes at least one of extraction processing, purification processing, enrichment processing, and library construction processing.
[0142] In an embodiment of the present application, after the input sample is acquired, the input sample needs to be extracted, purified, enriched, and library constructed to obtain a target sample, so as to ensure the accuracy of subsequent determination of the base long sequence; according to the sequencing scheme corresponding to the base long sequence, a base sequence sample for determining the base long sequence is prepared, and then base sequencing is performed on the base sequence sample to obtain the base long sequence of the to-be-detected object.
[0143] The bioinformatics sequencing method described above realizes obtaining the base long sequence of the to-be-detected object according to the base sequence sample by determining the base sequence sample, and provides a data basis for subsequent obtaining of the base target sequence.
[0144] In an embodiment, as shown in FIG. 8, when the second base sequencing processing of the to-be-detected object is needed to obtain at least one base short sequence of the to-be-detected object, the following content can be specifically included:
[0145] S801, acquiring a base sequence sample of a to-be-detected object.
[0146] In an embodiment of the present application, after the input sample is acquired, the input sample needs to be extracted, purified, enriched, and library constructed to obtain a target sample, so as to ensure the accuracy of subsequent determination of the base short sequence; according to the sequencing scheme corresponding to the base short sequence, a base sequence sample for determining the base short sequence is prepared, and then base sequencing is performed on the base sequence sample to obtain the base short sequence of the to-be-detected object.
[0147] S802, base sequencing is performed on the base sequence sample to obtain at least one base short sequence of the to-be-detected object.
[0148] In an embodiment of the present application, after the input sample is obtained, the input sample needs to be extracted, purified, enriched, and library constructed to obtain a target sample, so as to ensure the accuracy of determining the base short sequence. According to the sequencing scheme corresponding to the base short sequence, a base sequence sample for determining the base short sequence is prepared, and then the base sequence sample is subjected to base sequencing to obtain at least one base short sequence of the to-be-detected object.
[0149] The bioinformatics sequencing method determines the base sequence sample, obtains the base short sequence of the to-be-detected object according to the base sequence sample, and provides a data basis for obtaining the base target sequence.
[0150] In an embodiment, as shown in FIG. 9, when it is necessary to determine the base target sequence corresponding to the to-be-detected object, the following content can be specifically included:
[0151] S901, obtaining a base sequence sample of a to-be-detected object.
[0152] S902, performing base sequencing on the base sequence sample to obtain a base long sequence of the to-be-detected object.
[0153] S903, obtaining a base sequence sample of a to-be-detected object.
[0154] S904, performing base sequencing on the base sequence sample to obtain at least one base short sequence of the to-be-detected object.
[0155] S905, determining a reference sequence corresponding to each base short sequence from the base long sequence.
[0156] S906, performing base similarity analysis on first base information in each reference sequence and second base information in the corresponding base short sequence to obtain an analysis result of each reference sequence.
[0157] S907, determining a difference sequence in the base long sequence from each reference sequence according to the analysis result.
[0158] S908, obtaining a base short sequence corresponding to the difference sequence from each base short sequence.
[0159] S909, replacing first base information corresponding to the difference sequence with second base information of the base short sequence corresponding to the difference sequence to obtain a base target sequence corresponding to the to-be-detected object.
[0160] The above bioinformatics sequencing method determines the base target sequence corresponding to the to-be-detected object according to the base long sequence and the base short sequence by determining the base long sequence and the base short sequence. According to the above content, in the process of obtaining the base target sequence, the base target sequence is obtained according to the base short sequence and the base long sequence. Since the base information in the base short sequence is accurate, the base target sequence corresponding to the to-be-detected object is determined by relying on the characteristic that the base information in the base short sequence is accurate. The base detection efficiency of the base long sequence is maintained, the base information accuracy of the base short sequence is combined, the base target sequence with accuracy is obtained under the premise of ensuring the base detection efficiency, and the base target sequence can meet the actual situation of the to-be-detected object.
[0161] Further, the application also discloses a long-short read co-sequencing device, which comprises a device input component, a device sequencing component and a device output component.
[0162] Specifically, the device input component is used to obtain a base sequence sample of a to-be-detected object; the device sequencing component is used to determine a base target sequence corresponding to the to-be-detected object according to the base sequence sample; and the device output component is used to output the base target sequence determined by the device sequencing component.
[0163] It should be noted that the comparison unit in the device output component should also exist to adapt to different application result outputs, and the output result should include but is not limited to full gene sequence, strain type, bacterial type, pathogenic gene and any tester demand related to sequencing sequence. In order to achieve this purpose, the comparison unit should contain all known reference sequences corresponding to the tester demand result. After comparing the sequencing sequence information to be concerned with the reference sequence, the tester needs the above-mentioned any sequencing result is directly output. For example, in the application of sequencing new coronavirus strains, after obtaining the complete sequence information of the sample, the comparison result sequence and the reference sequence are compared according to the existing strain reference base sequence information in the comparison unit, and the strain type (such as Alpha B1.1.7; Beta B1.351, etc.) is directly output.
[0164] The present application synchronously combines two sequencing schemes, so that long and short read sequencing methods are integrated in the same product scheme and implemented simultaneously, including sample processing, library construction, sample preparation, sequencing process, algorithm calculation and result output, complete sequencing results are obtained at one step, avoiding complex and time-consuming sample pretreatment steps, and the bioinformatics system is built in the product system, without time-consuming deep processing of sequencing data, and the bioinformatics splicing algorithm with shorter time consumption is matched, the long data is used as the framework, and the short read data is used as the correction, to quickly reassemble the genomic sketch, reduce the waste of computing resources, and reduce the cost of funds and time. According to the needs, the bioinformatics analysis software required by the user can be loaded in the calculation software, and the sequencing results required by the user can be directly output, such as tumor target gene screening, prenatal detection screening, etc., directly outputting tumor types / infant genetic defect types, etc., to provide whole genome sequences or results required by customers for customers with different result requirements.
[0165] It should be understood that, although each step in the flowchart involved in the above embodiments is displayed in sequence according to the arrow, these steps are not necessarily executed in the order indicated by the arrow. Unless otherwise specified herein, the execution of these steps is not strictly limited in sequence, and these steps can be executed in other orders. Moreover, at least part of the steps in the flowchart involved in the above embodiments can include multiple steps or stages, which are not necessarily executed at the same time, but can be executed at different times, and the execution order of these steps or stages is not necessarily sequential, but can be executed alternately or alternately with at least part of other steps or steps or stages in other steps.
[0166] Based on the same inventive concept, the present application also provides a bioinformatics sequencing device for implementing the bioinformatics sequencing method described above. The implementation scheme for solving the problem provided by the device is similar to the implementation scheme described in the above method, so the specific limitations in one or more bioinformatics sequencing device embodiments provided below can refer to the limitations of the bioinformatics sequencing method described above, which will not be repeated here.
[0167] In one embodiment, as shown in FIG. 9, a bioinformatics sequencing device is provided, comprising: an acquisition module 10, a first determination module 20, a second determination module 30 and a third determination module 40, wherein:
[0168] The acquisition module 10 is configured to acquire a base sequence sample of the to-be-detected object.
[0169] The first determination module 20 is configured to perform first base sequencing processing on the to-be-detected object to obtain a long base sequence of the to-be-detected object.
[0170] The first determining module is specifically configured to obtain a base sequence sample of the to-be-detected object; and perform base sequencing on the base sequence sample to obtain a base long sequence of the to-be-detected object.
[0171] The second determining module 30 is configured to perform a second base sequencing process on the to-be-detected object to obtain at least one base short sequence of the to-be-detected object.
[0172] The second determining module is specifically configured to obtain a base sequence sample of the to-be-detected object; and perform base sequencing on the base sequence sample to obtain at least one base short sequence of the to-be-detected object.
[0173] The third determining module 40 is configured to determine a base target sequence corresponding to the to-be-detected object according to the base long sequence and the at least one base short sequence.
[0174] The bioinformatics sequencing device is configured to determine a base target sequence corresponding to the to-be-detected object according to the base long sequence and the at least one base short sequence. According to the above content, it can be known that, in the process of obtaining the base target sequence, the base target sequence is obtained according to the base short sequence and the base long sequence. Since the base information contained in the base short sequence is accurate, the base target sequence corresponding to the to-be-detected object is determined by relying on the characteristic that the base information in the base short sequence is accurate. In this way, the base information accuracy of the base short sequence is combined under the premise of maintaining the base detection efficiency of the base long sequence, so that the base target sequence can meet the actual situation of the to-be-detected object.
[0175] In one embodiment, as shown in FIG. 10, a bioinformatics sequencing device is provided, and the third determining module 30 in the bioinformatics sequencing device includes an analysis unit 31 and a correction unit 32, wherein:
[0176] The analysis unit 31 is configured to perform bioinformatics analysis on the base long sequence according to the at least one base short sequence to obtain a difference sequence in the base long sequence.
[0177] The correction unit 32 is configured to correct the difference sequence by using the at least one base short sequence to obtain a base target sequence corresponding to the to-be-detected object.
[0178] The correction unit is specifically configured to obtain a base short sequence corresponding to the difference sequence from each base short sequence; and update the difference sequence by using the base short sequence corresponding to the difference sequence to obtain a base target sequence corresponding to the to-be-detected object. Specifically, the first base information corresponding to the difference sequence is replaced by the second base information of the base short sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the to-be-detected object.
[0179] In one embodiment, as shown in FIG. 11, a bioinformatics sequencing device is provided, and the analysis unit 31 in the bioinformatics sequencing device comprises: a first determining sub-unit 311, a second determining sub-unit 312, and a third determining sub-unit 313, wherein:
[0180] The first determining sub-unit 311 is configured to determine, from the long-base sequence, the reference sequence corresponding to each short-base sequence.
[0181] The first determining sub-unit is specifically configured to, for each short-base sequence, determine, from the long-base sequence, a sequence start position according to the first second-base information contained in the short-base sequence; determine, from the long-base sequence, a sequence end position according to the last second-base information contained in the short-base sequence; and determine, from the long-base sequence, the reference sequence corresponding to the short-base sequence according to the sequence start position and the sequence end position. Specifically, the sequence between the sequence start position and the sequence end position in the long-base sequence is taken as the reference sequence corresponding to the short-base sequence.
[0182] The first base information corresponding to the sequence start position in the long-base sequence corresponds to the first second-base information, and the first base information corresponding to the sequence end position in the long-base sequence corresponds to the last second-base information.
[0183] The second determining sub-unit 312 is configured to perform base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding short-base sequence, to obtain an analysis result of each reference sequence.
[0184] The third determining sub-unit 313 is configured to determine, from each reference sequence, a difference sequence in the long-base sequence according to each analysis result.
[0185] The third determining sub-unit is specifically configured to, for each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short-base sequence, take the reference sequence as the difference sequence in the long-base sequence.
[0186] Each module in the above device can be realized by software, hardware, and a combination thereof, in whole or in part. Each module described above can be embedded in or independent of a processor in a computer device in hardware form, or can be stored in a memory in a computer device in software form, so as to be called and executed by a processor to perform the operations corresponding to each module.
[0187] In one embodiment, a computer device is provided, which can be a terminal, and its internal structure diagram can be as shown in FIG. 12. The computer device includes a processor, a memory, an input / output interface, a communication interface, a display unit and an input device. Among them, the processor, the memory and the input / output interface are connected through a system bus, and the communication interface, the display unit and the input device are connected to the system bus through the input / output interface. Among them, the processor of the computer device is used to provide computing and control capabilities. The memory of the computer device includes a non-volatile storage medium and an internal memory. The non-volatile storage medium stores an operating system and a computer program. The internal memory provides an environment for the operating system and the computer program in the non-volatile storage medium to run. The input / output interface of the computer device is used to exchange information between the processor and external devices. The communication interface of the computer device is used to communicate with external terminals in a wired or wireless manner, and the wireless manner can be achieved through WIFI, mobile cellular network, NFC (near field communication) or other technologies. The computer program is executed by the processor to implement a bioinformatics sequencing method. The display unit of the computer device is used to form a visually visible picture, which can be a display screen, a projection device or a virtual reality imaging device. The display screen can be a liquid crystal display screen or an electronic ink display screen, and the input device of the computer device can be a touch layer overlaid on the display screen, or a key, trackball or touchpad arranged on the shell of the computer device, or an external keyboard, touchpad or mouse, etc.
[0188] Those skilled in the art can understand that the structure shown in FIG. 12 is only a block diagram of part of the structure related to the scheme of the present application, and does not constitute a limitation on the computer device to which the scheme of the present application is applied. A specific computer device can include more or fewer components than those shown in the figure, or combine certain components, or have a different component arrangement.
[0189] In one embodiment, a computer device is provided, which includes a memory and a processor, the memory stores a computer program, and the processor executes the computer program to implement the following steps:
[0190] Obtaining a base sequence sample of the to-be-detected object;
[0191] According to the base sequence sample, performing first base sequencing processing on the to-be-detected object to obtain a base long sequence of the to-be-detected object;
[0192] According to the base sequence sample, performing second base sequencing processing on the to-be-detected object to obtain at least one base short sequence of the to-be-detected object;
[0193] According to the base long sequence and the at least one base short sequence, determining a base target sequence corresponding to the to-be-detected object.
[0194] In an embodiment, bioinformatics analysis is performed on the base long sequence according to at least one base short sequence to obtain a difference sequence in the base long sequence.
[0195] The difference sequence is corrected using the at least one base short sequence to obtain a base target sequence corresponding to the to-be-detected object.
[0196] In an embodiment, the processor, when executing the computer program, further implements the following steps:
[0197] From the base long sequence, a reference sequence corresponding to each base short sequence is determined.
[0198] Base similarity analysis is performed on first base information in each reference sequence and second base information in the corresponding base short sequence to obtain an analysis result of each reference sequence.
[0199] According to the analysis results, a difference sequence in the base long sequence is determined from each reference sequence.
[0200] In an embodiment, the processor, when executing the computer program, further implements the following steps:
[0201] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding base short sequence, the reference sequence is taken as the difference sequence in the base long sequence.
[0202] In an embodiment, the processor, when executing the computer program, further implements the following steps:
[0203] For each base short sequence, a sequence start position is determined from the base long sequence according to a first second base information contained in the base short sequence.
[0204] A sequence end position is determined from the base long sequence according to a last second base information contained in the base short sequence.
[0205] A reference sequence corresponding to the base short sequence is determined from the base long sequence according to the sequence start position and the sequence end position.
[0206] In an embodiment, the processor, when executing the computer program, further implements the following steps:
[0207] A sequence between the sequence start position and the sequence end position in the base long sequence is taken as the reference sequence corresponding to the base short sequence.
[0208] In an embodiment, the processor, when executing the computer program, further implements the following steps:
[0209] The first base information corresponding to the sequence starting position of the long base sequence corresponds to the first second base information, and the first base information corresponding to the sequence ending position of the long base sequence corresponds to the last second base information.
[0210] In one embodiment, the processor, when executing the computer program, also implements the following steps:
[0211] Obtaining the short base sequence corresponding to the difference sequence from each short base sequence;
[0212] Using the short base sequence corresponding to the difference sequence to update the difference sequence, to obtain the target base sequence corresponding to the object to be detected.
[0213] In one embodiment, the processor, when executing the computer program, also implements the following steps:
[0214] Replacing the first base information corresponding to the difference sequence with the second base information of the short base sequence corresponding to the difference sequence, to obtain the target base sequence corresponding to the object to be detected.
[0215] In one embodiment, the processor, when executing the computer program, also implements the following steps:
[0216] Performing long base sequencing on the base sequence sample to obtain the long base sequence of the object to be detected.
[0217] In one embodiment, the processor, when executing the computer program, also implements the following steps:
[0218] Performing short base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.
[0219] In one embodiment, a computer readable storage medium is provided, which stores a computer program, and the computer program, when executed by a processor, implements the following steps:
[0220] Obtaining a base sequence sample of an object to be detected;
[0221] Performing first base sequencing processing on the object to be detected according to the base sequence sample, to obtain a long base sequence of the object to be detected;
[0222] Performing second base sequencing processing on the object to be detected according to the base sequence sample, to obtain at least one short base sequence of the object to be detected;
[0223] Determining a target base sequence corresponding to the object to be detected according to the long base sequence and the at least one short base sequence. In one embodiment, the computer program, when executed by the processor, also implements the following steps:
[0224] According to at least one base short sequence, the bioinformatics analysis is performed on the base long sequence, and a difference sequence in the base long sequence is obtained.
[0225] The difference sequence is corrected by using at least one base short sequence, and a base target sequence corresponding to the to-be-detected object is obtained.
[0226] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0227] From the base long sequence, a reference sequence corresponding to each base short sequence is determined.
[0228] The base similarity analysis is performed on the first base information in each reference sequence and the second base information in the corresponding base short sequence, and an analysis result of each reference sequence is obtained.
[0229] According to the analysis result, a difference sequence in the base long sequence is determined from each reference sequence.
[0230] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0231] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding base short sequence, the reference sequence is taken as the difference sequence in the base long sequence.
[0232] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0233] For each base short sequence, according to the first second base information contained in the base short sequence, a sequence start position in the base long sequence is determined.
[0234] According to the last second base information contained in the base short sequence, a sequence end position in the base long sequence is determined.
[0235] According to the sequence start position and the sequence end position, a reference sequence corresponding to the base short sequence is determined from the base long sequence.
[0236] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0237] The sequence between the sequence start position and the sequence end position in the base long sequence is taken as the reference sequence corresponding to the base short sequence.
[0238] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0239] The first base information corresponding to the sequence start position of the long base sequence corresponds to the first second base information, and the first base information corresponding to the sequence end position of the long base sequence corresponds to the last second base information.
[0240] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0241] Obtaining the base short sequence corresponding to the difference sequence from each base short sequence;
[0242] Updating the difference sequence by using the base short sequence corresponding to the difference sequence, to obtain the base target sequence corresponding to the to-be-detected object.
[0243] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0244] Replacing the first base information corresponding to the difference sequence with the second base information of the base short sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the to-be-detected object.
[0245] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0246] Performing long base sequencing on the base sequence sample to obtain the long base sequence of the to-be-detected object.
[0247] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0248] Performing short base sequencing on the base sequence sample to obtain at least one base short sequence of the to-be-detected object.
[0249] In one embodiment, a computer program product is provided, comprising a computer program, which, when executed by a processor, implements the following steps:
[0250] Obtaining a base sequence sample of a to-be-detected object;
[0251] Performing first base sequencing processing on the to-be-detected object according to the base sequence sample to obtain a long base sequence of the to-be-detected object;
[0252] Performing second base sequencing processing on the to-be-detected object according to the base sequence sample to obtain at least one base short sequence of the to-be-detected object;
[0253] Determining a base target sequence corresponding to the to-be-detected object according to the long base sequence and the at least one base short sequence.
[0254] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0255] According to at least one base short sequence, the bioinformatics analysis is performed on the base long sequence, and a difference sequence in the base long sequence is obtained.
[0256] The difference sequence is corrected by using at least one base short sequence, and a base target sequence corresponding to the to-be-detected object is obtained.
[0257] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0258] From the base long sequence, a reference sequence corresponding to each base short sequence is determined.
[0259] The first base information in each reference sequence and the second base information in the corresponding base short sequence are subjected to base similarity analysis, and an analysis result of each reference sequence is obtained.
[0260] According to the analysis results, a difference sequence in the base long sequence is determined from each reference sequence.
[0261] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0262] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding base short sequence, the reference sequence is taken as the difference sequence in the base long sequence.
[0263] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0264] For each base short sequence, according to the first second base information contained in the base short sequence, a sequence start position in the base long sequence is determined.
[0265] According to the last second base information contained in the base short sequence, a sequence end position in the base long sequence is determined.
[0266] According to the sequence start position and the sequence end position, a reference sequence corresponding to the base short sequence is determined from the base long sequence.
[0267] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0268] The sequence between the sequence start position and the sequence end position in the base long sequence is taken as the reference sequence corresponding to the base short sequence.
[0269] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0270] The first base information corresponding to the sequence start position of the long base sequence corresponds to the first second base information, and the first base information corresponding to the sequence end position of the long base sequence corresponds to the last second base information.
[0271] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0272] Obtaining the base short sequence corresponding to the difference sequence from each base short sequence;
[0273] Updating the difference sequence by using the base short sequence corresponding to the difference sequence, to obtain the base target sequence corresponding to the object to be detected.
[0274] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0275] Replacing the first base information corresponding to the difference sequence with the second base information of the base short sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.
[0276] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0277] Performing long base sequencing on the base sequence sample to obtain the long base sequence of the object to be detected.
[0278] In one embodiment, the computer program, when executed by the processor, further implements the following steps:
[0279] Performing short base sequencing on the base sequence sample to obtain at least one base short sequence of the object to be detected.
[0280] Those skilled in the art can understand that all or part of the processes in the above-mentioned embodiment methods can be completed by instructing the relevant hardware through a computer program. The computer program can be stored in a non-volatile computer readable storage medium, and when the computer program is executed, the processes of the above-mentioned embodiments of the methods can be included. Any reference to memory, database or other medium used in the embodiments provided in the present application can include at least one of non-volatile and volatile memory. The non-volatile memory can include read-only memory (Read-Only Memory, ROM), magnetic tape, floppy disk, flash memory, optical storage, high-density embedded non-volatile memory, resistive memory (ReRAM), magnetoresistive random access memory (Magnetoresistive Random Access Memory, MRAM), ferroelectric memory (Ferroelectric Random Access Memory, FRAM), phase change memory (Phase Change Memory, PCM), graphene memory, etc. The volatile memory can include random access memory (Random Access Memory, RAM) or external cache memory, etc. As an illustration but not limitation, the RAM can be in various forms, such as static random access memory (Static Random Access Memory, SRAM) or dynamic random access memory (Dynamic Random Access Memory, DRAM), etc. The database involved in the embodiments provided in the present application can include at least one of a relational database and a non-relational database. The non-relational database can include a distributed database based on a block chain, etc., without being limited thereto. The processor involved in the embodiments provided in the present application can be a general-purpose processor, a central processing unit, a graphics processing unit, a digital signal processor, a programmable logic device, a data processing logic device based on quantum computing, etc., without being limited thereto.
[0281] Any combination of the technical features of the above embodiments can be made. In order to make the description simple, all possible combinations of the technical features in the above embodiments are not described, however, as long as the combination of the technical features does not exist contradictory, it should be considered as the scope of the present application.
[0282] The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent of the present application. It should be noted that for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the present application should be subject to the appended claims.
Claims
1. A long and short read co-sequencing device, comprising a device input component, a device sequencing component, and a device output component; the device input component is configured to obtain a base sequence sample of a to-be-detected object; The device comprises a sequencing component configured to perform base sequencing on the base sequence sample to obtain a base target sequence corresponding to the to-be-detected object. the base sequencing process comprises a first base sequencing process and a second base sequencing process; the device output component is configured to output the base target sequence determined by the device sequencing component.
2. The method of claim 1, wherein, the device sequencing component comprises a first sample extraction and purification library construction device, a first sequencing device, a second sample extraction and purification library construction device, and a second sequencing device; the first sample extraction and purification library construction device and the first sequencing device are configured to perform a first base sequencing process on the base sequence sample; the second sample extraction and purification library construction device and the second sequencing device are configured to perform a second base sequencing process on the base sequence sample.
3. A method of sequencing by synthesis, comprising: The method is applied to the device sequencing component in claim 1, and the method comprises: obtaining a base sequence sample of a to-be-detected object; performing a first base sequencing process on the to-be-detected object according to the base sequence sample to obtain a long base sequence of the to-be-detected object; performing a second base sequencing process on the to-be-detected object according to the base sequence sample to obtain at least one short base sequence of the to-be-detected object; determining a base target sequence corresponding to the to-be-detected object according to the long base sequence and the at least one short base sequence.
4. The method of claim 3, wherein, The determination of the base target sequence corresponding to the to-be-detected object according to the long base sequence and the at least one short base sequence comprises: performing bioinformatics analysis on the long base sequence according to the at least one short base sequence to obtain a difference sequence in the long base sequence; correcting the difference sequence using the at least one short base sequence to obtain the base target sequence corresponding to the to-be-detected object.
5. The method of claim 4, wherein, The bioinformatics analysis on the long base sequence according to the at least one short base sequence to obtain a difference sequence in the long base sequence comprises: determining a reference sequence corresponding to each short base sequence from the long base sequence; performing base similarity analysis on first base information in each reference sequence and second base information in the corresponding short base sequence to obtain an analysis result of each reference sequence; determining the difference sequence in the long base sequence from each reference sequence according to the analysis result.
6. The method of claim 5, wherein, The determination of the difference sequence in the long base sequence from each reference sequence according to the analysis result comprises: for each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is taken as the difference sequence in the long base sequence.
7. The method of claim 5, wherein, The determination of the reference sequence corresponding to each short base sequence from the long base sequence comprises: for each short base sequence, determining a sequence start position from the long base sequence according to a first second base information contained in the short base sequence; determining a sequence end position from the long base sequence according to a last second base information contained in the short base sequence; According to the sequence start position and the sequence end position, a reference sequence corresponding to the short base sequence is determined from the long base sequence.
8. The method of claim 7, wherein, The determining of the reference sequence corresponding to the short base sequence from the long base sequence according to the sequence start position and the sequence end position comprises: The sequence between the sequence start position and the sequence end position in the long base sequence is taken as the reference sequence corresponding to the short base sequence.
9. The method of claim 7, wherein, The first base information corresponding to the sequence start position in the long base sequence corresponds to the first second base information; and the first base information corresponding to the sequence end position in the long base sequence corresponds to the last second base information.
10. The method of claim 5, wherein, The correcting of the difference sequence by using the at least one short base sequence to obtain the target base sequence corresponding to the to-be-detected object comprises: The short base sequence corresponding to the difference sequence is obtained from each short base sequence; The updating of the difference sequence by using the short base sequence corresponding to the difference sequence to obtain the target base sequence corresponding to the to-be-detected object.
11. The method of claim 10, wherein, The updating of the difference sequence by using the short base sequence corresponding to the difference sequence to obtain the target base sequence corresponding to the to-be-detected object comprises: The first base information corresponding to the difference sequence is replaced by the second base information of the short base sequence corresponding to the difference sequence to obtain the target base sequence corresponding to the to-be-detected object.
12. The method of claim 3, wherein, The first base sequencing processing of the to-be-detected object to obtain the long base sequence of the to-be-detected object comprises: The long base sequence of the to-be-detected object is obtained by performing long base sequencing on the base sequence sample.
13. The method of claim 3, wherein, The second base sequencing processing of the to-be-detected object to obtain at least one short base sequence of the to-be-detected object comprises: The at least one short base sequence of the to-be-detected object is obtained by performing short base sequencing on the base sequence sample.
14. A bio-sequencing device, comprising: The apparatus comprises: An obtaining module configured to obtain a base sequence sample of a to-be-detected object; A first determining module configured to perform first base sequencing processing on the to-be-detected object according to the base sequence sample to obtain a long base sequence of the to-be-detected object; A second determining module configured to perform second base sequencing processing on the to-be-detected object according to the base sequence sample to obtain at least one short base sequence of the to-be-detected object; A third determining module configured to determine a target base sequence corresponding to the to-be-detected object according to the long base sequence and the at least one short base sequence.
15. The apparatus of claim 14, wherein, The third determining module comprises: An analyzing unit configured to perform bioinformatics analysis on the long base sequence according to the at least one short base sequence to obtain a difference sequence in the long base sequence; A correcting unit configured to correct the difference sequence by using the at least one short base sequence to obtain the target base sequence corresponding to the to-be-detected object.
16. A computer device comprising a memory and a processor, the memory storing a computer program, characterized in that, The processor executes the computer program to implement the steps of the method in any one of claims 3 to 13.
17. A computer readable storage medium having stored thereon a computer program, characterized in that The computer program is executed by the processor to implement the steps of the method in any one of claims 3 to 13. The computer program is executed by the processor to implement the steps of the method in any one of claims 3 to 13.