Compositions and methods for delivery of therapeutic compounds

A chimeric lipid bilayer with SM-CSS-Chol conjugation stabilizes liposomes, addressing cholesterol exchange issues and enhancing therapeutic delivery and efficacy in diverse disease models.

WO2025184543A1PCT designated stage Publication Date: 2025-09-04THE ARIZONA BOARD OF REGENTS ON BEHALF OF THE UNIV OF ARIZONA
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/017897
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-01
Filing Date
2025-02-28
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

Existing liposome-based drug delivery systems face challenges with cholesterol exchange between biomembranes, leading to instability, premature payload leakage, and systemic adverse effects, limiting therapeutic efficacy.

Method used

Development of a chimeric lipid bilayer comprising cholesterol covalently conjugated to sphingomyelin via a disulfide bond and a longer linker (SM-CSS-Chol) to prevent cholesterol exchange and enhance bilayer stability, encapsulating active agents such as drugs and nucleic acids.

Benefits of technology

The SM-CSS-Chol bilayer improves pharmacokinetics, enhances drug delivery, and increases therapeutic efficacy in various disease models, including improved tumor reduction and survival rates, while reducing systemic toxicities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025017897_04092025_PF_FP_ABST
    Figure US2025017897_04092025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are lipid compositions and uses thereof. In particular, provided herein are modified lipid bilayers for use, for example, in therapeutic delivery of active agents.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] COMPOSITIONS AND METHODS FOR DELIVERY OF THERAPEUTIC COMPOUNDS

[0002] Statement of Related Applications

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 560,368, filed March 1, 2024, the entire contents of which are incorporated herein by reference for all purposes.

[0004] Statement of Government Support

[0005] This invention was made with government support under Grant Nos. GM 147002, and CA272487 awarded by National Institutes of Health. The government has certain rights in the invention.

[0006] Field

[0007] Provided herein are lipid compositions and uses thereof. In particular, provided herein are modified lipid bilayers for use, for example, in therapeutic delivery of active agents.

[0008] Background

[0009] Liposome (Lipo), composed of lipid bilayer(s) comprising phospholipid(s) and cholesterol (Choi), has been successful for packaging and delivering therapeutic agents due to its intrinsic biocompatibility and biodegradability '- . While most FDA-approved liposomal nanotherapeutics can improve pharmacokinetics and ameliorate side effects, improvements in therapeutic efficacy and overall survival are limited even for the best nanoformulations and completely missing for majority- -, underscoring the urgent need of an improved platform for enhanced therapeutic delivery.

[0010] Choi plays a critical role in fortifying membrane packing and reducing bilayer fluidity and permeability through promoting the liquid condensed state in lipid membranes, enhancing bilayer rigidity and strength:.

[0011] Lipid bilayers with a high percentage of Choi are generally more stable than those with less ChoFJ. Nevertheless, Choi can be readily transferred between biomembranes and lipoproteins under physiological conditions '- -, which sabotages liposomal stability and results in premature contents leakage, subsequent fast blood clearance and unwanted systemic adverse effects, resulting in disappointing therapeutic efficacy in clinic . To tackle this key bottleneck in liposomal drug delivery, an improved lipid bilayer that forms Lipo but cannot shuttle between biomembranes to cement drug packaging and therapeutic delivery is needed.

[0012] Summary

[0013] Provided herein are lipid compositions and uses thereof. In particular, provided herein are modified lipid bilayers for use, for example, in therapeutic delivery of active agents.

[0014] To address the common challenge of Choi exchange between biomembranes under physiological conditions facing liposome-based drug delivery, experiments described herein resulted in a chimeric lipid bilayer comprising a Chol-derived SM. It was determined that covalently attaching Choi to SM securely confined Choi in the bilayer and retained the membrane condensing capability of Choi. Systemic SAR screening demonstrated that disulfide-bonded SM-Chol with a longer linker (SM-CSS-Chol) was superior to other SM-Chol conjugates, previous SMLs and many commonly used traditional phospholipids / Chol mixtures on blocking the Choi exchange and preventing payload leakage, indicating the linker chemistry played a significant role in defining the physicochemical properties of SM-Chol membrane. Furthermore, Lipo-SM-CSS-Chol improved the payload’s pharmacokinetics and enhanced therapeutic delivery of various drugs that have distinct molecular structures (VCR, IRI, DOX, DEX) and nucleic acid therapeutics (P-gp siRNA) in diverse disease animal models (DLBCL, Kras / Trp53-mutated metastatic PDAC, metastatic TNBC, lung inflammation, and CRC) in comparison to SM / Chol, PChcPC, SML-SS and SML-CSS and / or respective FDA-approved nanomedicines or lipid compositions.

[0015] The results described herein support that the SM-Chol can serve as a universal platform for improved drug and gene delivery to enhance the therapy and prevention of various human diseases.

[0016] For example, in some embodiments, provided herein is a composition, comprising: a lipid vesicle comprising cholesterol covalently conjugated to sphingomyelin. In some embodiments, the cholesterol is conjugated to said sphingomyelin via a disulfide bond and a linker. The present disclosure is not limited to particular linkers. Examples include but are not limited to

[0017] In some embodiments, the lipid vesicle encapsulates an active agent. The present disclosure is not limited to particular active agents. Examples include but are not limited to small molecules, peptides, polypeptides, and nucleic acids. In some embodiments, the active agent is a drug (e.g., chemotherapeutic agent, antinflammatory agent, etc.). In some embodiments, the nucleic acid encodes a therapeutic polypeptide. In some embodiments, the nucleic acid is an siRNA, an miRNA, an antisense oligonucleotide, or a guide RNA.

[0018] In some embodiments, the lipid vesicle comprises a liposome (e.g., a lipid bilayer or a multilamellar vesicle). The present disclosure is not limited to particular lipids. In some embodiments, the lipid is a phospholipid and / or glycerophospholipid. In some embodiments, the phospholipid comprises D-Lin-MC3-DMA. In some embodiments, the lipid is one or more of SPC, DSPC, DOPC, HSPC, DOPC, DOPE, lecithin, DPPC, DOPG, PI, PS, DPPG, DSPG, DPPA, DPPE, DOPS, DLPC, DMPE, DMPS, DPPS, PG, DLPG, DMPC, POPE, DOTAP, DOTMA, LPO1, CL1, CKK-E12, 306OilQ, SM-102, or ALC- 0315.

[0019] Also provided is a method of delivering an active agent, comprising contacting a composition described herein with a cell. In some embodiments, the cell is in vivo, ex vivo, or in vitro. In some embodiments, the active agent treats a disease or condition.

[0020] Further provided is a method of treating a disease or condition is a subject, comprising: delivering a composition described herein to a subject in need thereof.

[0021] Additional embodiments provide the use of a composition described herein to deliver an active agent to a cell and / or treat a disease or condition in a subject.

[0022] Additional embodiments are described herein.

[0023] Brief Description of the Drawings

[0024] Fig. 1, Development of SM-derived Choi Lipo (Lipo-SM-Chol). a, Synthesis of SM-Chol conjugate with a carbonate ester bond (SM-C-Ester-Chol), an ester bond (SM- Ester-Choi), a glycine bond (SM-Glycine-Chol), a disulfide bond (SM-CSS-Chol) with a longer linker or thioketal bond (SM-SCS-Chol) with a longer linker, b, A table depicting the physicochemical characterizations of Lipo composed of sterol-modified phospholipids (SMLs) from Avanti Polar Lipids with equivalent (eq.) 66.7 mol % Choi, SM / Chol or five SM-Chol with equivalent (eq.) 35 mol % Choi, d.nm, diameter values in nanometres, c, DLS size distribution by intensity for Lipo-SM / Chol and Lipo-SM-Chol, DLS: dynamic light scattering, d, The monitoring of the DLS size by intensity over time in 5% dextrose at 4 °C. e, The percentage of remaining SM-CSS-Chol measured by LC-MS / MS after incubated Lipo-SM-CSS-Chol with or without the presence of GSH at 37 °C. f,g, Leakage profiles for calcein-loaded Lipo (eq. 40 mol % Choi) in high osmotic gradient (f) or 30% fetal bovine serum (g) at 37 °C. h, Relative Choi exchange rates at 37 °C with eq. 40 mol % Choi in the Lipo., i-1 Thermotropic phase transition behavior determined by differential scanning calorimetry (DSC). DSC thermograms of Lipo-SM / Chol (i) and Lipo-SM-CSS- Chol (j) at various eq. mol % Choi. The effects of Choi or SM-CSS-Chol on transition temperature (k) and enthalpy (1). m-o Atomic force microscopy (AFM) to assess the height of Lipo-SM / Chol (m) and Lipo-SM-CSS-Chol (n) and the lipid bilayer rigidity was shown as by the ratio of height / diameter (H / D) value (o) ' (n = 3 independent experiments, similar results were observed). Data in b, d, e-h, o are expressed as mean ± s.d. (n = 3 independent experiments). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test, two-tailed, unpaired Student’s Mest for e.

[0025] Fig. 2, VCR-laden Lipo-SM-Chol increased the maximum tolerated dose (MTD) of VCR without systemic toxicities in healthy mice, a, A table delineating the physicochemical characterizations of various VCR / Lipo with eq. 35 mol % Choi (40% Choi for Lipo-SM / Chol to match the ratio used in Marqibo) and 5% DSPE-PEG2K. DLC: drug loading capacity; DLE: drug loading efficiency, b, Cryo-electron microscopy (cryo- EM) of Lipo-SM / Chol or Lipo-SM-CSS-Chol with or without VCR encapsulation. Scale bar: 100 nm, (n = 3 independent experiments, similar results were observed), c, The mice weight monitoring in MTD study of free VCR, VCR / SML Lipo (Lipo-PChcPC), VCR / Lipo-SM / Chol and VCR / Lipo-SM-CSS-Chol at various doses as indicated in healthy C57BL / J mice following a single i.v. administration via tail vein; Mice body weight and survival were monitored for 2 weeks, d-g, On day 14 post i.v. injection, blood was withdrawn for comprehensive thrombocytes (d), erythrocytes (e), leukocytes (f), and serum chemistry (g) analysis. Data in a (right portion, n = 3 independent experiments), c-g (n = 6 mice) are expressed as mean ± s.d. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test.

[0026] Fig. 3, Improved circulation time, tumor delivery and therapeutic efficacy of VCR / Lipo-SM-CSS-Chol. a-c, Blood kinetics (a), biodistribution (b, at 48 h post i.v. injection) and pharmacokinetic parameters (c) of free VCR and VCR / Lipo in orthotopic MC38 colorectal cancer (CRC) mouse model (n = 3 mice; tumour: -400 mg) following a single i.v. administration at 2 mg VCR / kg. d-g, Therapeutic effects of VCR / Lipo in subcutaneous (s.c.) SU-DHL-4 diffuse large B-cell lymphoma xenograft model (n = 5 mice, tumours: -200 mm3) in severe combined immunodeficient CB17 / Icr- Prkdcsc,d / IcrlcoCA mice i.v. injected once at 2 mg VCR / mg. d, Individual tumour growth curve, e, Average tumour growth curve, f, Mice bearing s.c. lymphoma image taken on day 27. g, Kaplan-Meier survival curves. Data in a-c (n = 3 mice), e (n = 5 mice) are expressed as mean ± s.d. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test; survival curves were compared using the log-rank Mantel-Cox test.

[0027] Fig. 4, Lipo-SM-CSS-Chol enhanced the therapeutic effects of 1R1 in late-stage metastatic orthotopic KPC-Luc pancreatic ductal adenocarcinoma (PDAC). a, A table showing the physicochemical characterizations of various IRI / Lipo with eq. 35 mol % Choi (eq. 64.4 mol % Choi for IRI / Lipo-PChcPC)iS nand 5 mol % DSPE-PEG2K(n = 3 independent experiments), b-g, Therapeutic efficacy in metastatic orthotopic PDAC tumour mouse model. On day 11, the primary tumors reached -400 mg with noticeable metastasis (b) and mice were intravenously injected by various IRI / Lipo or Onivyde at 40 mg IRI / kg on day 11, 14, and 17. c, Mice Lago bioluminescence imaging (BLI) on day 11, 18 and 25. Two mice in group A died on day 20 and 24, respectively, d, Representative ex vivo BLI (upper panel) and photographs (lower panel) for various organs on day 25. e, Normalized BLI for whole mice tumour burden. Normalized BLI in various organs (f) and a heatmap summarizing tumour metastatic rate (g) on day 25. Data in a (right portion), e, f (n = 6 mice) are expressed as mean ± s.d. Statistical significance was determined by oneway ANOVA followed by Tukey’s multiple comparisons test.

[0028] Fig. 5, Lipo-SM-CSS-Chol fortified the therapeutic delivery of DOX in orthotopic 4T1-Luc2 triple negative breast cancer (TNBC). a, A table delineating the physicochemical characterizations of DOX / Lipo with eq. 35 mol % Choi (eq. 64.4 mol % Choi for DOX / Lipo-PChcPC) and 5 mol % DSPE-PEG2K (n = 3 independent experiments), b-f, anti- TNBC effects in metastatic orthotopic 4T1-Luc2 tumour mouse model. On day 15, the mice with primary tumors -200 mm3(b) received an i.v. administration of various DOX / Lipo or Doxil at 15 mg DOX / kg. c, Average tumour growth curves measured by a digital caliper, d, mice BLI on day 15, 20, 29 and 35 by Lago optical imaging. Ex vivo lung metastasis BLI from all 5 mice in each group (e) and tumour-bearing mice images (f) were taken on day 35. Data in a (right portion), c (n = 5 mice) are expressed as mean ± s.d. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test; survival curves were compared using the log-rank Mantel-Cox test.

[0029] Fig. 6, Therapeutic efficacy of DEX-laden / Lipo-SM-Chol in lipopolysaccharide (LPS)-induced lung inflammation model (a-f), and improved gene delivery efficiency of siRNA-encased LNP— SM-Chol in silencing the multi-drug resistant P-gp gene in colorectal cancer (CRC) tumor model (g-k). a, a table showing the physicochemical characterizations of diverse DEX-laden Lipo with eq. 30 mol % Choi (eq. 64.4 mol % Choi for DEX / Lipo-PChcPC) and 5 mol % DSPE-PEGZK (n = 3 independent experiments), b, the lung inflammation model was established by inoculating LPS (30 pL, 400 pg / mL) into the trachea of mice : 6 h later, mice (n = 5 mice) were intravenously administered with one dose of free DEX or various DEX / Lipo at 1 mg DEX / kg. 12 h after treatment, 5 independent lung tissues were collected for pro-inflammatory cytokines: interleukin-6 (IL- 6) (c), tumor necrosis factor-a (TNF-a) (d) and interleukin- 1 (IL-i ) (e) examination . Representative hematoxylin and eosin staining images from 5 independent lung tissues in each group (f). Scar bar = 100 pm, (n = 5 independent experiments, similar results were observed), g. Serum stability analysis of free siRNA or siRNA / LNP (mixed with PBS, v / v=l:l, incubated at 37 °C) by gel retardation assay with 1% agarose gel electrophoresis '3, (n = 3 independent experiments, similar results were observed), h, CT26 CRC tumor model (n = 3 mice) was established by s.c. injection of 1 x 10scells to mice, i- k, in another parallel efficacy study, mice-bearing CT26 tumours (n = 5 mice; tumours: -100 mm3) received three i.v. injections (on day 10, 12, and 14) of IRI / Lipo-SM-CSS- Chol or its combination with siRNA / LNP-DMA / SM-CSS-Chol. i, individual tumour growth curves, j, average tumour growth curves, k, on day 15, tumours were isolated for HPLC analysis to measure the IRI intratumoral uptake levels. Data in a (right portion), c-e, h, j, k are expressed as mean ± s.d. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparison test for c-e, h, k or two-tailed, unpaired Student’s t-test for j.

[0030] Fig. 7, Synthetic route for SM-derived Choi with carbonate ester bond (SM-C- Ester-Chol). Fig. 8, Synthetic route for SM-derived Choi with ester bond (SM-Ester-Chol).

[0031] Fig. 9, Synthetic route for SM-derived Choi with glycine bond (SM-Glycine-Chol).

[0032] Fig 10, Synthetic route for SM-derived Choi with disulfide bond and longer linker (SM-CSS-Chol).

[0033] Fig. 11, Synthetic route for SM-derived Choi with thioketal bond and longer linker (SM-SCS-Chol).

[0034] Fig. 12, Possible intermediates released from SM-CSS-Chol by breaking the carbonate ester (a), disulfide (b), the ester (c, in the middle of the linker) and the ester (d, connected to SM) bond.

[0035] Fig. 13, Synthetic route for SM-CSS-OH

[0036] Fig. 14, The synthesis of SM-SH.

[0037] Fig. 15, Synthetic route for Chol-CSS-COOH.

[0038] Fig. 16, Synthetic route for SML-SS.

[0039] Fig.17, Synthetic route for SML-CSS.

[0040] Fig. 18,]H NMR (a) and13C NMR (b) spectra for SM-C-Ester-Chol.

[0041] Fig. 19, ’H NMR (a) and13C NMR (b) spectra for SM-Ester-Chol.

[0042] Fig. 20,]H NMR and13C NMR spectra for Chol-Glycine-Boc (a, b) and SM- Glycine-Chol (c, d).

[0043] Fig. 21,1H NMR and13C NMR spectra for Chol-CSS-OH (a, b) and SM-CSS-Chol (c, d).

[0044] Fig. 22, ’H NMR and13C NMR spectra for HOOC-SCS-COOH (a, b), HO-SCS-OH (c, d), Chol-SCS-OH (e, f) and SM-SCS-Chol (g, h).

[0045] Fig. 23, ’H NMR and13C NMR spectra for SM-CSS-OH (a, b), SM-SH (c, d) and Chol-CSS-COOH (e, f).

[0046] Fig. 24, ’H NMR and13C NMR spectra for SML-SS (a, b).

[0047] Fig. 25,]H NMR and13C NMR spectra for SML-CSS (a, b).

[0048] Fig. 26, a, A table depicting the physicochemical characterizations of various Lipo composed of SMLs (PChcPC, PChemsPC, OChemsPC, DCemsPC). d.nm: diameter values in nanometres, b, DLS size distribution by intensity. DLS: dynamic light scattering, c, The monitoring of the DLS size over time in 5% dextrose at 4 °C. Data in a (right portion), c are expressed as mean ± s.d. (n = 3 independent experiments).

[0049] Fig. 27, The release kinetics of calcein from calcein / Lipo-SM-CSS-Chol under different conditions at 37 °C. Data are expressed as mean ± s.d. (n=3 independent experiments). Statistical significance was determined by two-tailed, unpaired Student’s t- test.

[0050] Fig. 28, The LC-MS / MS method development for SM-CSS-Chol concentration measurement in stability studies. Representative LC-MS / MS chromatogram (a), and standard curve (b) for SM-CSS-Chol. SM-Glycine-Chol was used as the internal standard (IS).

[0051] Fig. 29, TLC (a) and high-resolution LC-MS (HRMS) (b) to study the possible intermediates generated (c) after incubating Lipo-SM-CSS-Chol in PBS and GSH (10 mM) for 24 h under 37 °C.

[0052] Fig. 30, Zeta potential monitoring for various Lipo over a 15-day period in 5% dextrose at 4 °C. Data are represented as mean ± s.d. (n = 3 independent experiments).

[0053] Fig. 31, Thermotropic phase transition behavior examined by differential scanning calorimetry (DSC). DSC thermograms of Lipo-SM-C-Ester-Chol (a), Lipo-SM-Ester-Chol (b), Lipo-SM-Glycine-Chol (c) and Lipo-SM-SCS-Chol (d) at various eq. mol % Choi, (e) The effects of SM-Chol on transition temperature (e) and enthalpy (f).

[0054] Fig. 32, The standard curve for Choi was determined by the Choi assay described in Choi exchange method section.

[0055] Fig. 33, The H / D (height / diameter) ratio for various Lipo measured by atomic force microscopy (AFM). Data are represented as mean ± s.d. (n = 3 independent experiments). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test.

[0056] Fig. 34, The cytotoxicity of different Lipo-SM-Chol and Lipo composed of various conventional phospholipid / Chol mixtures in 4T1-Luc2 cells. Cells were treated for 72 h and cell viability was determined by MTT assay. DOX was used as the positive control. Data are represented as mean ± s.d. (n = 3 samples).

[0057] Fig. 35, The western blot to study the effects of various Lipo on sterol regulatory element-binding protein 1 (SREBP-1), and Niemann Pick Cl (NPC1) and Niemann Pick C2 (NPC2) levels in 4T1 cells, (n = 3 experiments, similar results were observed).

[0058] Fig. 36, Confocal laser scanning microscopy (CLSM) to study the effects of various Lipo on lipid rafts levels on 4T1 cells. (Scale bar 50 pm) (a, n = 3 independent experiments, similar results were observed). The fluorescence signal of CT-B-488 was quantified by Imaged software (Version.1.53q), (b). Data in b are represented as mean + s.d. (n = 3 independent experiments). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test. Fig. 37, CLSM to study the effects of various Lipo on SM levels on 4T1 cells. (Scale bar 50 pm) (a, n = 3 independent experiments, similar results were observed). The fluorescence signal was quantified by ImageJ software (Version.1.53q) (b). Data in b are represented as mean ± s.d. (n = 3 independent experiments). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test.

[0059] Fig. 38, The Analytic Reverse-phase High Performance Liquid Chromatography (HPLC) method development for VCR concentration measurement in pharmacokinetics and biodistribution studies. Representative HPLC chromatogram, standard curve, and HPLC instrumentation and chromatographic conditions for VCR.

[0060] Fig. 39, (a) The DLC and DLE of various VCR / Lipo from 3 independent samples. The representative DLS size distribution by intensity (b) for VCR / Lipo-PChcPC, VCR / Lipo-SM / Chol and various VCR / Lipo-SM-Chol, and the DLS Size (c) and zeta potential (d) monitoring over a 15-day period at 4 °C. Data in c, d are represented as mean + s.d. (n = 3 independent experiments).

[0061] Fig. 40, The detailed body weight loses vs the day 1 after iv injection of VCR / Lipo- SM / Chol and the statistical analysis (n = 6 mice). Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test on day 2, 4, and 6, and two-tailed, unpaired Student’s t-test (for 3 and 4 mg / kg as there were 3 mice deaths in 5 mg / kg group on day 8) on day 8, 10, 12, and 14.

[0062] Fig. 41, Statistical significance comparison of the PK parameters (VS VCR / Lipo- SM-CSS-Chol, n = 3 mice) in Fig. 3c. Statistical significance was determined by two- tailed, unpaired Student’s t-test.

[0063] Fig. 42, Mice body weight monitoring in therapeutic efficacy study presented in Fig. 3d-f. Data are represented as mean ± s.d. (n = 5 mice).

[0064] Fig. 43, Improved the stability in circulation, tumor delivery and drug release of MU-P / DiD / Lipo-SM-CSS-Chol. a, A table showing the physicochemical characterizations of various MU-P / DiD / Lipo (n = 3 independent samples), b-f, Blood kinetics (b), the AUCMU-P / AUCDiD ratio (c), pharmacokinetic parameters (d), biodistribution (e) and release ratio of MU-P in tumor (f) of free MU-P and MU-P / DiD / Lipo in orthotopic KPC- Luc pancreatic ductal adenocarcinoma (PDAC) mouse model (n=3; tumour: -400 mg) following a single i.v. administration at 20 mg MU-P / kg, 0.25 mg DiD / kg. Data are represented as mean + s.d. (n = 3 mice). Statistical significance in e was determined by two-tailed, unpaired Student’s t-test. Fig. 44, Representative immunofluorescence staining for P-tubulin. (Yellow arrow: filiform microtubules; red arrow: bipolar mitotic divisions, scale bar: 50 pm) and IHC staining for CC-3, TUNEL and Ki67, scale bar: 100 pm of SU-DHL-4 diffuse large B-cell lymphoma from an independent efficacy study after receiving the same treatments as Fig. 3e.

[0065] Fig. 45, The Analytic Reverse-phase High Performance Liquid Chromatography (HPLC) method development for IRI concentration measurement in pharmacokinetics and biodistribution studies. Representative HPLC chromatogram, standard curve, and HPLC instrumentation and chromatographic conditions for IRI.

[0066] Fig. 46, The DLC and DLE of various IRI / Lipo (n =3 independent samples).

[0067] Fig. 47, Representative IHC staining for y-H2AX, CC-3, TUNEL and Ki67 in orthotopic KPC-Luc tumors from Fig. 4c-e. (n = 6 mice, scale bar: 100 pm, similar results were observed).

[0068] Fig. 48, IRI / Lipo-SM-CSS-Chol outperformed all IRI / Lipo-SMLs on therapeutic efficacy in late-stage metastatic orthotopic KPC-Luc PDAC mouse model, a, A table showing the physicochemical characterizations of various IRI / Lipo with 95 mol% SML and 5 mol% DSPE-PEG2K (eq. 64.4 mol% Choi for IRI / Lipo-SML, except eq. 97.4 mol% Choi for IRI / Lipo-DChemsPC since two Choi molecules were consisted in DChemsPC) according to the previous report4,7,l 1, to keep consistent, eq. 35 mol% Choi was used for IRI / Lipo-SM-CSS-Chol (n =3 independent samples), b-d, Blood kinetics (b), biodistribution (c, at 48 h post i.v. injection) and pharmacokinetic parameters (d) of IRI / Lipo in orthotopic KPC-Luc PDAC mouse model (n = 3 mice; tumour: -400 mg) following a single i.v. administration at 40 mg IRI / kg. e-i, Therapeutic efficacy in metastatic orthotopic PDAC tumour mouse model. 2 x 106cells were injected into the pancreas of B6129SF1 / J mice (n = 6 mice). On day 11, the primary tumors reached -400 mg with noticeable metastasis and mice were intravenously injected by various IRI / Lipo at 40 mg IRI / kg on day 11, 14, and 17. e, Mice Lago bioluminescence imaging (BLI) on day 11, 18 and 25. Two mice in group A died on day 24. f, Representative ex vivo BLI (upper panel) and photographs (lower panel) for various organs on day 25. g, Normalized BLI for whole mice tumour burden. Normalized BLI in various organs (h) and a heatmap summarizing tumour metastatic rate (i) on day 25. j, Representative IHC staining for y- H2AX, CC-3, and Ki67 in orthotopic KPC-Luc tumors from e, scale bar - 100pm (n = 6 tumours, similar results were observed). Data in a (right portion), b-d,g,h are expressed as mean ± s.d. Statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test.

[0069] Fig. 49, Fluorescence intensity standard curves for DiD (a, excitation 644 nm, emission 664 nm) and MU-P (b, excitation 320 nm, emission 385 nm) concentration measurement in pharmacokinetics studies in Supplementary Figure 37.

[0070] Fig. 50, The Analytic Reverse-phase High Performance Liquid Chromatography (HPLC) method development for MU-P, MU and MU-G concentration measurement in biodistribution studies. Representative HPLC chromatogram, standard curves, and HPLC instrumentation and chromatographic conditions for MU-P, MU and MU-G. Hydroxycoumarin was used as the internal standard.

[0071] Fig. 51, The DLC and DLE of various DOX / Lipo (n = 3 independent samples).

[0072] Fig. 52, Individual tumor growth curve (a), mice body weight (b) and tumour weight on day 35 (c) in therapeutic efficacy study presented in Fig. 5. Data in b, c are represented as mean + s.d. (n = 5 mice). Statistical significance was determined by oneway ANOVA followed by Tukey’s multiple comparisons test.

[0073] Fig. 53, Representative IHC staining for y-H2AX, CC-3, TUNEL and Ki67 in orthotopic 4T1-Luc2 tumours from Fig. 5c-f. (n = 5 tumours, scale bar: 100 pm, similar results were observed).

[0074] Fig. 54, The Analytic Reverse-phase High Performance Liquid Chromatography (HPLC) method development for DEX concentration measurement in drug loading studies. Representative HPLC chromatogram, standard curve, and HPLC instrumentation and chromatographic conditions for DEX.

[0075] Fig. 55, (a) The DLC and DLE of various DEX / Lipo (n = 3 independent samples). DLS Size (b) and Zeta potential (c) monitoring for DEX / Lipo-PChcPC, DEX / Lipo- SM / Chol and various DEX / Lipo-SM-Chol over a 15-day period at 4 °C. Data are represented as mean ± s.d. (n = 3 independent experiments).

[0076] Fig. 56, Development, and physicochemical characterizations of siRNA-laden LNP. (a) A table showing the physicochemical characterizations of siRNA-laden LNP with regards to size, zeta potential and PDI. DLS size (b) and zeta potential (c) monitoring over a 15-day period at 4 °C. Mice body weight monitoring (d) in therapeutic efficacy study presented in Fig. 6 g,h. Data are represented as mean ± s.d. (n = 3 independent experiments for a-c; n = 5 mice for d).

[0077] Definitions Throughout the present disclosure relevant terms are to be understood consistently with their typical meanings established in the relevant art, i.e. the art of pharmaceutical chemistry, medicine, biology, biochemistry and physiology.

[0078] As used herein, a “peptide”, “protein”, or “protein or fragment thereof’ comprises a string of at least three amino acids linked together by peptide bonds. The terms “protein” and “peptide” may be used interchangeably. Peptide may refer to an individual peptide or a collection of peptides. Also, one or more of the amino acids in a presently disclosed peptide may be modified, for example, by the addition of a chemical entity, such as a carbohydrate group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, and the like.

[0079] As used herein, a “carbohydrate” is a biological molecule comprising carbon (C), hydrogen (H) and oxygen (O) atoms, usually with a hydrogemoxygen atom ratio of 2:1. As used herein, “polysaccharides” are polymeric carbohydrate molecules composed of long chains of monosaccharide units bound together by glycosidic linkages. They range in structure from linear to highly branched. Some examples include storage polysaccharides such as starch and glycogen, and structural polysaccharides such as cellulose and chitin. As used herein, the term “sugar” refers to short-chain, soluble carbohydrates, many of which are used in food.

[0080] The term “EP A” refers to eicosapentaenoic acid.

[0081] The term “DHA” refers to docosahexaenoic acid.

[0082] EPA and DHA, as used herein in connection with the compositions of the invention, refers to the fatty acid chain that can be bound to a lipid backbone, such as to phospholipids, lysophospholipids, triacylglycerides, diacylglycerides, monoacylglyceride or any other lipid backbone, or it can exist in the compositions as a free fatty acid or ethyl ester.

[0083] As used herein, "phospholipid" refers to an organic compound that has two fatty acid moieties attached at the sn-1 and sn-2 positions of glycerol, and contains a head group linked by a phosphate residue at the sn-3 position of the glycerol. Exemplary headgroup moieties include choline, ethanolamine, serine and inositol. Phospholipids include phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, and phosphatidic acid. The fatty acid moiety is the portion of the fatty acid molecule that is bound at the sn-1 or sn-2 position, for example by an ester or ether linkage. When the fatty acid moiety is a fatty acyl, the aliphatic chain of the fatty acyl is attached via an ester linkage and when the fatty acid moiety is an aliphatic chain of a fatty acid, the aliphatic chain is attached via an ether linkage. When a particular fatty acid is mentioned in connection with a phospholipid of the invention (e.g., EPA or DHA) it should therefore be taken as a reference to the relevant fatty acyl group or to its aliphatic chain.

[0084] Used herein, the term "pharmaceutically acceptable salt" refers to pharmaceutically acceptable salts derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, and tetraalkylammonium, and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, and oxalate. Suitable salts include those described in P. Heinrich Stahl, Camille G. Wermuth (Eds.), Handbook of pharmaceutical salts properties, Selection, and Use; 2002.

[0085] The term “prophylaxis” means measures taken to prevent, rather than treat, diseases or conditions.

[0086] The term "therapeutically effective amount" is an art-recognized term. In certain embodiments, the term refers to an amount of the composition disclosed herein that produces some desired effect at a reasonable benefit / risk ratio applicable to the medical treatment. In certain embodiments, the term refers to that amount necessary or sufficient to eliminate, reduce or alleviate medical symptoms for a period of time. The effective amount may vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art may empirically determine the effective amount of a particular composition without necessitating undue experimentation.

[0087] The term "treating" is art-recognized and includes preventing a disease, disorder or condition from occurring in a subject which may be predisposed to the disease, disorder and / or condition but has not yet been diagnosed as having it; inhibiting the disease, disorder or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease or condition includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject relative to a subject which does not receive the composition.

[0088] Unless specifically defined herein, all technical and scientific terms used have the same meaning as commonly understood by a skilled artisan in the fields of medicine, pharmacology, pharmaceutical chemistry, biology, biochemistry and physiology. All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail.

[0089] Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and sub ranges within a numerical limit or range are specifically included as if explicitly written out.

[0090] Headings have been used for organizational purposes and should not be construed as limiting the subject-matter herein.

[0091] Detailed Description

[0092] Provided herein are lipid compositions and uses thereof. In particular, provided herein are modified lipid bilayers for use, for example, in therapeutic delivery of active agents.

[0093] To improve the therapeutic delivery efficiency of Lipo and better mimic the cell membrane composition, described herein is an improved lipid bilayer obtained through covalently conjugating sphingomyelin (SM) that has a double aliphatic chain and is one of the core phospholipids in the cell membrane to Choi. SM was chosen as the model phospholipid because 1) it is a naturally occurring phospholipid in mammalian cell membrane and has a hydroxyl group (Fig. la) that enables its conjugation with ChoH;;A and 2) it is a backbone component in liposomal vincristine (VCR) nanomedicine, MarqibO"-. The SM-Chol would impart several advances over prior SMLs and conventional phospholipids / Chol systems through enhancing lipid bilayer cohesion property and subsequently improving drug encapsulation and delivery. First, the amide linkage in SM is less susceptible to physiological degradation compared to the ester bonds in lysophospholipids in SMLs and other double aliphatic chain phospholipids, leading to enhanced bilayer stability25. Second, the amide bond in SM-Chol provides hydrogen bond donor, which enables formation of the intermolecular and intramolecular hydrogen bonding, boosting the bilayer stability. In stark contrast, this cannot be achieved in SMLs as which do not possess free hydrogen bond donor. Third, the double aliphatic chain SM- Chol increases bilayer compressibility and decreases permeability to water in comparison to single aliphatic chain SML25’55. Fourth, to control and selectively trigger the bilayer dissociation for timely drug release, apart from the ester and carbonate ester bonds used in SMLs, varied stimuli-responsive bonds (e.g., cathepsin B (glycine bond), glutathione (disulfide bonds), and reactive oxygen species (ROS, thioketal bond) present in inflammatory diseases and cancers) with distinct linker chemistry to bridge SM with Choi were used (Fig. l ).

[0094] In this work, SM-Chol well retains the membrane condensing ability of Choi (Fig. li-1 Fig. 30). Systemic structure activity relationship screening revealed that Lipo composed of SM-Chol with a disulfide bond and longer linker (SM-CSS-Chol) perform better than other conjugates, SMLs and traditional phospholipids / Chol Lipo on blocking Choi transfer and preventing pay load leakage (Fig. If-h); and increase maximum tolerated dose (MTD) of vincristine while diminishing systemic toxicities (Fig. 2), improve pharmacokinetics and tumor delivery efficiency, and boost tumor reduction and prolong mice survival in SU-DHL-4 diffuse large B-cell lymphoma xenograft model (Fig. 3). Further, SM-CSS-Chol bilayer fortifies drug packaging and therapeutic delivery of other therapeutic agents (irinotecan (IRI), doxorubicin (DOX), dexamethasone (DEX)) with diverse chemical structures in late-stage metastatic orthotopic KPC-Luc pancreas cancer, 4T1-Luc2 triple negative breast cancer, and lung inflammation mouse models in comparison with respective FDA-approved nanotherapeutics (Onyvide, Doxil, Figs. 4-6) and SML Lipo. In addition to small molecule drugs, SM-CSS-Chol can also enhance the gene delivery efficiency of the siRNA targeting p-glycoprotein (P-gp), the common drug efflux pump, compared to SM / Chol and SML when both integrating the FDA-approved ionizable lipid, Dlin-MC3-DMA (DMA, Fig. 6h-k) ''. These findings substantiate that SM- Chol boasts favorable and improved biophysicochemical properties over conventional phospholipids / Chol and SML systems, revealing its use in improved liposome-based therapeutic delivery.

[0095] For example, in some embodiments, provided herein is a composition, comprising: a lipid vesicle comprising cholesterol covalently conjugated to sphingomyelin. In some embodiments, the cholesterol is conjugated to said sphingomyelin via a disulfide bond and a linker. The present disclosure is not limited to particular linkers. Examples include but are not limited to

[0096] In some embodiments, the lipid vesicle encapsulates an active agent. The present disclosure is not limited to particular active agents. Examples include but are not limited to small molecules, peptides, polypeptides, and nucleic acids. In some embodiments, the active agent is a drug (e.g., chemotherapeutic agent, antinflammatory agent, etc.). In some embodiments, the nucliec acid encodes a therapeutic polypeptide.

[0097] In some embodiments, the active agent is a chemotherapeutic drug. As used herein, the term “chemotherapeutic” or “anti-cancer drug” includes any small molecule or other drug used in cancer treatment or prevention. Chemotherapeutics include, but are not limited to, cyclophosphamide, methotrexate, 5 -fluorouracil, doxorubicin, docetaxel, daunorubicin, bleomycin, vinblastine, dacarbazine, cisplatin, paclitaxel, raloxifene hydrochloride, tamoxifen citrate, abemacicilib, afinitor (Everolimus), alpelisib, anastrozole, pamidronate, anastrozole, exemestane, capecitabine, epirubicin hydrochloride, eribulin mesylate, toremifene, fulvestrant, letrozole, gemcitabine, goserelin, ixabepilone, emtansine, lapatinib, olaparib, megestrol, neratinib, palbociclib, ribociclib, talazoparib, thiotepa, toremifene, methotrexate, and tucatinib.

[0098] In some embodiments, the anti-cancer agents comprise a checkpoint inhibitor, a receptor tyrosine kinase inhibitor, or a combination thereof. Immune checkpoint molecules are negative regulators of immune responses which prevent the immune system from attacking cells indiscriminately. Known immune checkpoint molecules include, for example, CTLA-4, PD-1, PD-L1 (programmed Cell death-ligand 1), PD-L2 (programmed Cell death-ligand 2), LAG-3 (lymphocyte activation gene 3), TIM3 (T-Cell immunoglobulin and mucin-3), BTLA (B and T-lymphocyte attenuators), B7H3, B7H4, CD160, CD39, CD73, A2aR (adenosine A2a receptor), KIR (killer inhibitory receptor), VISTA (V-domain Ig-containing inhibitor of T-Cell activation), IDO1 (indoleamine 2, 3- dioxygenase), arginase I, TIGIT (T-Cell immunoglobulin and ITIM domain 2015), and CD115. The immune checkpoint inhibitors useful in the methods disclosed herein are substances that inhibit the function of immune checkpoint molecules. For example, CTLA4 checkpoint inhibitors include, without limitation, monoclonal antibodies such as ipilimumab and tremelimumab and PD-1 / PD-L1 checkpoint inhibitors include, without limitation, monoclonal antibodies against PD-1 such as nivolumab, pembrolizumab, atezolizumab, and pidilizumab, anti-PD-1 fusion proteins such as AMP-224 (composed of the extracellular domain of PD-L2 and the Fc region of human IgGl), and monoclonal antibodies against PD-L1 such as BMS-936559 (MDX-1105), atezolizumab, durvalumab, and avelumab.

[0099] Tyrosine kinase inhibitors are compounds that inhibit or block the activity of tyrosine kinase enzymes. These enzymes can phosphorylate many regulatory proteins in the cell and can activate signal transduction cascades, triggering many cellular functions involving cell growth and proliferation. There are two types of tyrosine kinases: cell surface receptor protein kinases (RTKs) and non-receptor protein kinases (NRTKs). Receptor tyrosine kinases belong to the family of cell surface receptors that transduce a response upon binding to a ligand. They are transmembrane proteins that pass through the biological membrane and have an extracellular domain (ectodomains) where ligands can bind. Examples of RTKs include, but are not limited to, Vascular Endothelial Growth Factor Receptor (VEGFR), Epidermal Growth Factor Receptor (EGFR), Platelet-Derived Growth Factor Receptor (PDGFR), and Fibroblast Growth Receptor (FGR). Non-receptor tyrosine kinases are located within the cytosol, they are activated upon binding to an already activated receptor tyrosine kinase receptor and are accountable for the activation of receptor by phosphorylation without the presence of a ligand. Examples of NRTKs include, but are not limited to, v-SRC (Rous sarcoma virus), Bcr-Abl (Abelson protooncogene- breakpoint cluster region) fusion.

[0100] Receptor tyrosine kinase inhibitors can either be monoclonal antibodies that compete for the receptor’s extracellular domain or small molecules that inhibit the tyrosine kinase domain and prevent conformational changes that activate RTKs. In some embodiments, the receptor tyrosine kinase inhibitor may be an antibody including, for example, a monoclonal antibody. Monoclonal antibodies may include, but are not limited to cetuximab, panitumumab, zalutumumab, nimotuzumab, bevacizumab, or matuzumab. In other embodiments, the receptor tyrosine kinase inhibitor is a small molecule inhibitor. Small molecule inhibitors may include, but are not limited to, sorafenib, lenvatinib, regorafenib, sunitinib, apatinib, donfenib, anlotinib, and cabozantinib. In some embodiments, the nucliec acid is an siRNA, an miRNA, an antisense oligonucleotide, or a guide RNA. For example, ss used herein, the term "nucleic acid" refers to any chain of two or more nucleotides covalently bonded together, including, without limitation, ribonucleic acid (RNA), e.g. i) RNAs involved in protein synthesis, such as messenger RNA (mRNA), e.g. Zinc-finger nuclease (ZFN)-encoding mRNA, Transcription activator-like effector nuclease (TALEN)-encoding mRNA, or CRISPR / Cas9-encoding mRNA, transfer RNA (tRNA), transfer-messenger RNA (tmRNA), Ribosomal RNA (rRNA); ii) RNAs involved in post-transcriptional modification or DNA replication, such as small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), SmY RNA, small Cajal body-specific RNA (scaRNA), Guide RNA (gRNA), Ribonuclease P (RNase P), Ribonuclease MRP (RNase MRP), Y RNA, Telomerase RNA Component (TERC), Spliced Leader RNA (SL RNA); iii) regulatory RNAs, such as Antisense RNA (aRNA or asRNA), Cis-natural antisense transcript (cis- NAT), CRISPR RNA (crRNA), Long noncoding RNA (IncRNA), MicroRNA (miRNA), Piwi-interacting RNA (piRNA), Small interfering RNA (siRNA), Short hairpin RNA (shRNA), Trans-acting siRNA (tasiRNA), Repeat associated siRNA (rasiRNA), 7SK RNA, Enhancer RNA (eRNA); Deoxyribonucleic acid (DNA), such as plasmids or such as Zinc- finger nuclease (ZFN)-encoding DNA, Transcription activator-like effector nuclease (TALEN)-encoding DNA, or CRISPR / Cas9-encoding DNA, Genomic DNA (gDNA), complementary DNA (cDNA), Mitochondrial DNA (mtDNA), scaffold / matrix attachment region DNA (S / MAR DNA), Antisense DNA (asDNA); or DNA / RNA hybrids. Preferred RNAs are mRNA, siRNAs, miRNA and asRNA, most preferably mRNA. Preferred DNAs are plasmid DNA and asDNA. In a preferred embodiment, the nucleic acid is a mRNA or a DNA plasmid. In a particular embodiment, the nucleic acid is a mRNA. In another particular embodiment, the nucleic acid is a DNA plasmid.

[0101] A class of nucleic acids are antisense nucleic acids, i.e. nucleic acids that can bind to and inactivate mRNA produced from a gene in a subject.

[0102] The nucleic acid may be composed of naturally occurring nucleotides, or it may comprise synthetic nucleotides (also known as nucleotide analogues). Examples of the latter nucleotides are 2'-O-methyl nucleotides, locked nucleotides (LNA), bridged nucleotides (BNA), morpholinos, and peptide nucleotides (PNA).

[0103] The nucleic acids may be linear (e.g. mRNA), circular (e.g. DNA plasmids) or branched. Preferred linear nucleic acids are oligonucleotides, i.e. nucleic acids made up of 6 to 200, such as of 10 to 30, nucleotides or nucleotide pairs (if oligonucleotide double stranded).

[0104] The nucleic acids may be single-stranded, or partially or completely doublestranded. When double stranded, the nucleic acid may adopt an A-, B-, Z- or P- configuration. In a preferred embodiment of the invention, the nucleic acid is singlestranded, and is more preferably single-stranded RNA. In another preferred embodiment of the invention, the nucleic acid is double-stranded, and is more preferably double-stranded DNA.

[0105] In some embodiments, the lipid vesicle comprises a liposome (e.g., a lipid bilayer or a multilamellar vesicle). The present disclosure is not limited to particular lipids. While the disclsoure is exemplified with SM, additional or alternative lipids can be utilized. In some embodiments, the lipid is a phospholipid and / or glycerophospholipid. In some embodiments, the phospholipid comprises D-Lin-MC3-DMA. Further lipid are described in Nsairat et al. Heliyon 8 (2022) e09394 and Liu et al., Molecules 2022, 27, 1372; each of which is herein incorporated by reference in its entirety. In some embodiments, the lipid is one or more of SPC, DSPC, DOPC, HSPC, DOPC, DOPE, lecithin, DPPC, DOPG, Pl, PS, DPPG, DSPG, DPPA, DPPE, DOPS, DLPC, DMPE, DMPS, DPPS, PG, DLPG, DMPC, POPE, DOTAP, DOTMA, LPO1, CL1, CKK-E12, 306000, SM-102, or ALC-0315.

[0106] Also provided is a method of delivering an active agent, comprising contacting a composition described herein with a cell. In some embodiments, the cell is in vivo, ex vivo, or in vitro. In some embodiments, the active agent treats a disease or condition.

[0107] Further provided is a method of treating a disease or condition is a subject, comprising: delivering a composition described herein to a subject in need thereof.

[0108] Additional embodiments provide the use of a composition described herein to deliver an active agent to a cell and / or treat a disease or condition in a subject.

[0109] The present disclosure is not limited to the treatment of a particular disease or condition. Examples include but are not limited to, cancer, inflammtory disease, cardiac disease, genetic disorders, etc.

[0110] Examples

[0111] Example 1:

[0112] Methods Cell culture

[0113] CT26 (Cat. ATCC CRL-2638) and 4T1 (Cat. CRL-2539) cell lines were obtained from UACC; 4T1-Luc2 (Cat. CRL-2539-LUC2) cells were purchased from ATCC; SU-DHL-4 (Cat. CRL-2957) cell was provided by Professor Catharine Smith at The University of Arizona; these cell lines were cultured in complete RPMI-1640 medium. MC38 (Cat. ENH204-FP) was purchased from Kerafast; KPC-Luc (Cat. 153474) was provided by Professor Gregory Beatty at University of Pennsylvania; these cell lines were cultured in complete DMEM medium. All the cell lines were cultured in the corresponding medium containing 10% FBS, 100 U / mL penicillin, 100 pg / mL streptomycin, and 2 mM L-glutamine at 37 °C in a CO2 incubator.

[0114] Animal assay

[0115] CB 17 / Icr-P / %Fc’"%[crIcoCrl (Charles Rivers, 6 weeks old, female), and BALB / c, C57BL / 6 and B6129SF1 / J mice (Jackson laboratory, ~6 weeks old, female) were used. Standard Individually Ventilated Caging (IVC) system was used to maintain the mice under pathogen-free conditions. The animal house was kept at the temperature of 68°-72°F and indoor humidity of 30-70% to abide by the NIH Guide and in accordance with the guidelines of 12 hours light / 12 hours dark by 7am on-7pm off. Digital caliper was utilized to measure the length and width of the tumour, and the formula = 0.5 x length x width2was used to calculate the tumour size. The maximal permitted tumour size was 2000 mm3according to the animal ethics guidelines of IACUC and animal welfare regulations, and the mice were sacrificed once the tumour volume grew to > 2000 mm3or the status of the mice became moribund. Nevertheless, the tumour size of some mice has grown greater than 2000 mm3by the final day of measurement, and the mice were sacrificed subsequently.

[0116] Preparation of Lipo-SM-ChoI

[0117] SM, Choi, SM-Chol conjugate or sterol-modified phospholipids (SMLs: PChcPC, PChemsPC, OChemsPC, DChemsPC), were dissolved in ethanol with a 100 mL round bottom glass flask. The solvent was evaporated under a rotatory evaporator (RV 10 digital, IKA®) to generate a thin film, which was further dried under ultra-high vacuum (MaximaDry, Fisherbrand) for 0.5 h. The film was hydrated with 5% dextrose at 60 °C for 30 min, and then sonicated for 12 min at 4 °C by using a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). The size, zeta potential and PDI, and morphology were determined by DLS and Cryo-EM, respectively. The molar ratio of Choi % was calculated according to the following equation (1) or equation (2): mole of (SM — Choi conjugate) equation (1) = — ; - - - : - — - : — ; - - x 100% mole of SM + 2 x mole of (SM — Choi conjugate) mole of SMLs equation (2) = — - : — — — : — : —:— — — - — - : —r„>J, x 100%

[0118] 0.5 * mole of single chain lipid + 1.5 x mole of SMLs

[0119] Differential scanning calorimetry (DSC)

[0120] MicroCai VP-capillary DSC (Malvern Panalytical) was utilized to measure the DSC data. By using DI water as the reference samples, the program of temperature range was set up as 10-90 °C at the rate of 60 °C / h. To measure the DSC data, the lipid film was generated as above and hydrated in DI water (2 mg lipid / mL) under 60 °C for 0.5 hour via fitful vortex and then sonicated for 12 min at 4 °C. After that, the liposomes were placed in a water bath at ambient temperature of ~25 °C for 30 min. After degassing, 400 pL of liposome solution was extracted and subjected to DSC analysis. To convert the raw data into molar heat capacity (MHC), VPViewer 2000 and Microcal (LLC Cap DSC Version: Origin70-L3) package software was utilized to collect and analyze the data, respectively.

[0121] Loading calcein into Lipo

[0122] The encapsulation of calcein into Lipo followed the reported method. Briefly, calcein (4 mmol, 2.49 g) was dissolved in Tris-HCl buffer (10 mM, 6 mL, pH 7.5,) following adding 50% sodium hydroxide (13.2 mmol, 695 pL). Afterwards, this stock solution was loaded into a Sephadex LH-20 column and eluted using Tris-HCl buffer (10 mM, pH 7.5). The pooled fraction of calcein’s concentration was evaluated through measuring the absorbance (494 nm) of the diluted samples at pH 9. Free phospholipids (SM, HSPC, SPC, DSPC, or DOPC) Choi, SMLs (PChcPC, PChemsPC, OChemsPC and DChemsPC, eq. 40 mol % Choi) and / or SM-Chol conjugate (eq. 40 mol % Choi) were dissolved in ethanol with a 100 mL round bottom glass flask. The solvent was evaporated under a rotatory evaporator (RV 10 digital, IKA) to generate a thin film, which was further dried under ultra-high vacuum (MaximaDry, Fisherbrand) for 0.5 h. The film was then hydrated with purified calcein (56 mM) solution at 60 °C for 30 min, and then sonicated for 12 min at 4 °C by using a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). The unencapsulated calcein was removed by a PD-10 column (Sephadex G-25, GE Healthcare) using the corresponding isosmotic eluent as eluent.

[0123] Leakage triggered by osmotic stress

[0124] The investigation of osmotic stress-induced leakage was performed following the reported method. ~ Briefly, free phospholipids, Choi, SMLs (PChcPC, PChemsPC, OChemsPC and DChemsPC) and / or SM-Chol conjugate at eq. 40 mol % Choi were dissolved in ethanol with a 100 mL round bottom glass flask. The solvent was evaporated under a rotatory evaporator (RV 10 digital, IKA®) to generate a thin film, which was further dried under ultra-high vacuum (MaximaDry, Fisherbrand) for 0.5 h. The film was hydrated using a mixed solution (56 mM calcein, 10 mM Tris, and 711 mM NaCl), at 60 °C for 30 min, and then sonicated for 12 min at 4 °C by using a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). The unencapsulated calcein was removed by using a PD-10 column (Sephadex G-25, GE Healthcare) with isosmotic buffer (50 mM HEPES, 775 mM NaCl) as eluent. Lipo (SMLs (PChcPC, PChemsPC, OChemsPC and DChemsPC), SM / Chol, HSPC / Chol, SPC / Chol, DSPC / Chol or DOPC / Chol) with eq. 40 mol % Choi were used as controls. Different osmotic concentrations solutions were made by mixing the calcein free isosmotic buffer (50 mM HEPES, 775 mM NaCl, set as 1600 mOsm) and a 50 mOsm dilution buffer (50 mM HEPES). Afterwards, Lipo were placed in solutions with varied osmotic concentrations through mixing Lipo (10 pL) with testing buffer (990 pL) at 37 °C. After 5 min equilibration, fluorescence signal (excitation: 494 nm; emission: 517 nm) was detected using a SpectraMax M3 reader (SoftMax Pro (v. 7.1.0), Molecular Devices). Via lysing the Lipo using 10% Triton X-100 (100 pL), the total calcein in the Lipo was obtained. The fluorescence of which was determined and set as Fioo%. The fluorescence intensity of the sample in various osmotic concentrations and in the isosmotic buffer was set as FSampie and Fbiank, respectively. The fraction of calcein left in Lipo after osmotic stress-induced leakage was calculated as follows:

[0125] , . equation

[0126] Fetal bovine serum (FBS)-induced leakage

[0127] Calcein-laden Lipo was prepared as described above. Lipo (SMLs (PChcPC, PChemsPC, OChemsPC and DChemsPC), SM / Chol, HSPC / Chol, SPC / Chol, DSPC / Chol or DOPC / Chol) containing eq. 40 mol % Choi were used as controls. Lipo samples (an aliquot of 50 pL) were diluted by 30% FBS to reach 2 mL in volume, which were subsequently placed in clean tubes and incubated at 37 °C. At various time points, and the remaining calcein portion in the Lipo was assessed by monitoring the fluorescence intensity as depicted above.

[0128] Preparation of VCR / Lipo-SM-Chol

[0129] The remote loading of VCR into Lipo was accomplished according to the reported method.22’"-- Briefly, SM, Choi, PChcPC and / or SM-Chol conjugate with 5 mol % DSPE- PEG2K (for Lipo-SM / Chol, 40 mol % Choi; for Lipo-PChcPC, 64.4 mol %; for Lipo-SM- Chol, 35 mol %) were dissolved in ethanol in a 100 mL round bottom glass flask. The solvent was evaporated under a rotatory evaporator (RV 10 digital, IKA®) to produce a thin film, which was further dried under ultra-high vacuum (MaximaDry, Fisherbrand) for 0.5 h. The lipid film was then hydrated with citrate buffer (300 mM, pH = 4.0) at 60 °C for 30 min, and was then sonicated for 12 min at 4 °C by using a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). The unloaded citrate buffer was removed by running through a PD-10 column (Sephadex G-25, GE Healthcare) using HBS buffer (20 mM HEPES, 150 mM NaCl, pH 7.5) as the eluent. The remotely encapsulate VCR, citrate buffer-laden Lipo-SM-Chol was incubated with 2 mg / mL VCR (VCR / total lipids = 0.1 / 1 (w / w)) at 60 °C for 15 min. Afterwards, the samples were left at 4 °C for 30 min; and the unencapsulated VCR was removed by running through a PD-10 column using HBS buffer as eluent. The size, zeta potential and PDI, morphology, and drug content of the VCR / Lipo-SM-Chol were determined by DLS, Cryo-EM and HPLC, respectively. The VCR drug loading capacity [DLC, equation (4)] and drug loading efficiency [DLE, equation (5)] were calculated using the formulas shown below: weight of encapsulated drug equation (4) = — — — — - - - - — - - x 100% weight of (total lipids + encapsulated drug) weight of encapsulated drug equation (5) = - : - - - - x 100% weight of input drug

[0130] Cryo-EM

[0131] Liposomal suspensions (eq. 35% molar ratio of Choi in the bilayer for the liposomes; ~2.0 mg VCR / mL for loading VCR, -9% VCR DLC) were prepared for imaging by applying 3 microliters to the surface of a C-Flat 1.2 / 1.3 engineered TEM grid (Protochips, Morrisville NC.) immediately followed by either a 3 or 6 second blot at 100% RH in a FEI Vitrobot (Hillsboro, OR.) prior to rapid emersion into liquid nitrogen cooled liquid ethane. Grids were transferred into a Phillips TF20 (Eindhoven NL.) operating at 120 KeV with a Gatan CT3500 side entry cryoholder (Pleasantville, CA.) maintained at - 180 °C. Images were recorded on a TVIPS XF416 CMOS camera at the indicated and measurements were performed within the EMMenu software package provided by TVIPS (Gauting, DE) for the operation of the XF416 camera.

[0132] Preparation of DOX / Lipo-SM-Chol

[0133] Phospholipid, Choi and DSPE-PEGZK at the indicated molar ratio in Figure 5a were completely dissolved by ethanol in a 100 mL round bottom glass flask. The thin lipid film was generated through evaporating the organic solvent via a rotatory evaporator (RV 10 digital, IKA®) under ultra-high vacuum (MaximaDry, Fisherbrand) for half hour. (NH^SCh buffer (125 mM) was added into the flask to hydrate the lipid film under 60 °C and rotated for half hour. The suspension solution was transferred to a tube and sonicated via a probe under 4 °C through a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). To remove the unencapsulated (NH4)2SO4, the primary liposomal solution was gone through a PD-10 column (Sephadex G-25, GE Healthcare) via using PBS buffer as eluent. Afterwards, the (NH4)2SO4 laden liposomes were incubated with 6 mg / mL DOX by the ratio of DOX / total lipid = 0.1 / 1 (w / w) under 60 °C for 1 hour. The liposomal solutions were transferred to an ice bath and cooled to ~4 °C for half hour. To get rid of the unloaded DOX, the liposomes were passed through a PD-10 column (Sephadex G-25, GE Healthcare) via using PBS buffer as eluent. DLS and HPLC were utilized to measure the size, zeta potential, PDI, and drug content of the liposome samples, respectively. The DEC [equation (4)] and DLE [equation (5)] of DOX in the liposomes were calculated using the formulas as above.

[0134] Preparation of IRI / Lipo-SM-Chol

[0135] The remote loading of IRI into Lipo was prepared based on the reported method.-- Sucrose octasulfate (TEAsSOS) were obtained from commercially available NasSOS based on ion-exchange chromatography using the resin (Dowex 50Wx8-200) in the H+form, which was immediately titrated by neat triethylamine (TEA) to reach a pH of 5.5-6.0. The TEAsSOS concentration was then adjusted to ~200 mM. SM, Choi, SMLs and / or SM-Chol conjugate with 35 mol % Choi and 5 mol % DSPE-PEG K (for Lipo-SMLs, eq. 64.4 mol% Choi, except eq. 97.4 mol% Choi for IRI / Lipo-DChemsPC since two Choi molecules were consisted in DChemsPC) were dissolved in ethanol in a 100 mL round bottom glass flask. The solvent was evaporated under a rotatory evaporator (RV 10 digital, IKA®) to generate a thin film, which was further dried under ultra-high vacuum (MaximaDry, Fisherbrand) for 0.5 h. The film was then hydrated with TEAgSOS buffer at 60 °C for 30 min, and followed by sonication for 12 min at 4 °C by using a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). The unloaded TEAgSOS was removed by a PD-10 column (Sephadex G-25, GE Healthcare) with HEPES -buffered dextrose (5% dextrose, 5 mmol / L HEPES, pH 6.5) as the eluent. For IRI remote loading, TEAsSOS- loaded Lipo-SM-Chol was incubated with 10 mg / mL IRI (IRI / total lipid - 0.1 / 1 (w / w)) at 60 °C for 30 min. After cooling the samples down at 4 °C for 30 min, the unencapsulated IRI was removed by running through a PD-10 column using HEPES -buffered saline (145 mM NaCl, 5 mM HEPES, pH 6.5) as the eluent. The size, zeta potential and PDI, morphoilogy, and drug content of the IRI / Lipo-SM-Chol were determined by DLS, cryo- EM, and HPLC, respectively. The IRI DLC [equation (4)] and DLE [equation (5)] were calculated based on the formulas described above.

[0136] Preparation of DEX / Lipo-SM-Chol

[0137] SM, Choi, PChcPC and / or SM-Chol conjugate with 35 mol % Choi and 5 mol % DSPE-PEG2K (for Lipo-PChcPC, eq. 64.4 mol % Choi) were dissolved in ethanol with a 100 mL round bottom glass flask. DEX (5% (w / w) of the total lipids) was well mixed in the solution. The solvent was evaporated under a rotatory evaporator (RV 10 digital, IKA®) to generate a thin film, which was further dried under ultra-high vacuum (MaximaDry, Fisherbrand) for 0.5 h. The film was hydrated with 5% dextrose at 60 °C for 30 min, and then sonicated for 12 min at 4 °C by using a pulse 3 / 2 s on / off at a power output of 60 W (VCX130, Sonics & Materials Inc). The unencapsulated DEX was removed by a PD-10 column (Sephadex G-25, GE Healthcare) by using 5% dextrose as the eluent. The size, zeta potential and PDI, morphology, and drug content of the DEX / Lipo-SM-Chol were determined by DLS, cryo-EM and HPLC, respectively. The DEX DLC [equation (4)] DLE [equation (5)] was calculated using the formula provided above.

[0138] Preparation of siRNA / LNP

[0139] To efficiently encapsulate siRNA, ionizable lipid DLin-MC3-DMA (DMA, WuXi App Tec) used in FDA-approved siRNA nanotherapeutic, Onpattro-1-, was also used. Briefly, DMA, DSPC, Choi and PEG2K-C-DMG (BOC Sciences, NY, USA) at the molar ratio of 49.3 / 10.2 / 39.0 / 1.5 as in Onpattro were used as the control lipid bilayer and dissolved in ethanol, this same lipid ratio was used for LNP-DMA / SM / Chol. For LNP- DMA / SM-CSS-Chol, the lipid molar ratio is 49.3 / 10.2 / 39.0 / 1.5 (DMA / SM / SM-CSS- Chol / PEG2K-C-DMG), for LNP-DMA / PChcPC, the lipid molar ratio is 49.3 / 10.2 / 39.0 / 1.5 (DMA / l-palmitoyl-2-hydroxy-sn-glycero-3-phosphocholine / PChcPC / PEG2K-C-DMG). The lipid solution was added subsequently in 1.85 -fold volumes of citrate buffer (25 mmol / L, pH 4.0) containing P-gp siRNA with vigorous stirring. The siRNA sequence (5’- 3’ : GGAUCCAGUCUAAUAAGAAtt; Antisense: UUCUUAUUAGACUGGAUCCtg) targeting the Abcbla gene (Assay ID 156774, #AM16704, Ambion, USA) was included at a ratio of 0.056 mg / pmol (N / P=6: l) to total lipids. The solution was incubated at room temperature for 30 minutes and subsequently dialyzed overnight in 5% dextrose at 4 °C. For serum stability analysis11, naked siRNA or different siRNA-loaded LNP were mixed with FBS (v:v = 1:1) and incubated at 37 °C for various times (0, 1, 2, 4, 8, 12 and 24 h). The siRNA stability was then analyzed by 1% agarose gel electrophoresis (100V, 30 min).

[0140] Therapeutic efficacy of drug-laden Lipo

[0141] Subcutaneous SU-DHL-4 DLBCL xenograft tumour model

[0142] CB 17 / Icr-PrWc'"d / IcrIcoCrl mice (n = 5 mice, female) were subcutaneously injected with 1 x 107SU-DHL-4 cells in 100 pL RPMI-1640 medium with Matrigel (Corning, Discovery labware Inc.) (3 / 1, v / v). When tumours grew to -200 mm3in size, the mice received one i.v. dose of 5% dextrose (vehicle control), or VCR / Lipo (2 mg VCR / kg). Tumour development, mice body weight and survival were closely monitored as indicated. In an independent study, after the tumour-bearing mice received the same treatments, the tumours were dissected and subjected to immunofluorescence (IF), immunohistochemistry (IHC) and TUNEL staining.

[0143] Orthotopic metastatic 4T1-Luc2 (luciferase-expressing) TNBC tumour model

[0144] To establish the 4T1-Luc2 orthotopic model -- , BALB / c mice (n = 5 mice, female) were anesthetized by isoflurane. The hair / fur in the abdominal area of mice were removed by a shaver. Then the surgical area underwent three alternating scrubs of betadine / povidone iodine followed by 70% ethanol. Buprenorphine SR (1.0 mg / kg) was subcutaneously administered to mice before surgery. Then, a -1 cm abdominal incision was created with a sterile disposable scalpel and the 4thmammary fat pad was exposed. 2 x 1054T1-Luc2 cells in 50 pL of RPMI-1640 medium with Matrigel (Corning, Discovery labware Inc.) (3 / 1, v / v) were inoculated into the 4thmammary fat pad by using a 26-gauge needle (BD precisionGlide™). After sterilizing the injection site with 70% ethanol (to kill cancer cells that may have leaked out), the mammary fat pad was then replaced into the s.c. cavity. The skin was then closed with wound clip (BD Diagnostic). Surgical glue was also applied to allow good apposition of skin. During and after surgery, animals were placed on the heating pad and were closely monitored until ambulatory; and then mice were returned to a clean cage. At indicated time points, tumour size was measured by a digital caliper and tumour burden of a whole mouse body was determined by bioluminescence radiance intensity using Lago optical imaging after mice were intraperitoneally injected with 150 mg / kg D-Luciferin (GoldBio, MO, USA). When tumours grew to -200 mm3in size on day 15, the mice received one dose of intravenously administered 5% dextrose (vehicle control), DOX / Lipo (15 mg DOX / kg). On day 35, following injection of D-Luciferin, mice were dissected, and lungs were quickly obtained and then subject to ex vivo Lago imaging to investigate the tumour metastasis. The tumours were dissected and subjected to 1HC and TUNEL staining.

[0145] Lung Inflammation

[0146] To establish the lipopolysaccharide (LPS)-induced lung inflammation model-- --, Balb / c mice (n = 5 mice, female) were first anesthetized with isoflurane and kept at a heating pad (37 °C). The neck of mice was extended in a 90° angle relative to the pad, and the tongue of mice was held with forceps to straighten throat to facilitate intubation conditions. The No. 22 gauge (G) catheter was cut to a length of 20 mm and gently inserted the catheter vertically along the base of the tongue and about 10 mm into the trachea. LPS (30 pL) was then slowly injected into the trachea using a syringe and the tube was slowly removed after injection. The upper body of the mouse was kept upright for 30 seconds to avoid fluid leakage from the trachea. In sham animals, 30 pL sterile 5% dextrose was injected intratracheally instead of LPS. The mice were kept on a heating pad (37 °C) until full consciousness was restored. 6 h after the challenge, 1 mg / kg (200 pL, 100 pg / mL) of free DEX, or DEX / Lipo was injected intravenously to mice. 12 hours after treatment, lungs were collected and cut into two parts, and weighted. One part of lung tissues was homogenized and the homogenates were centrifuged at 6000 g, and then the supernatants were collected for measuring the IL-6 levels using a mouse IL-6 ELISA kit (Abcam222503), TNF-a levels using mouse TNF-a ELISA kit (Thermo Fisher, BMS607- 3) and IL-ip levels using mouse IL-ip ELISA kit (Thermo Fisher, BMS6002) according to the manufacturer’s protocol. Another part of lung tissues was fixed in 4% paraformaldehyde overnight and then sent to the Tissue Acquisition and Cellular / Molecular Analysis Shared Resource (TACMASR) at UArizona Cancer Center (UACC) for H & E staining analysis. Histology images were obtained using a Leica DMI6000B microscope, with a Leica DFC450 color camera and the Leica LAS X 3.7 software. The images were analyzed by LAS X 3.7 software (v. 3.7.3.23245 ).

[0147] Subcutaneous CT26 CRC tumor model

[0148] BALB / c mice (n = 5 mice, female) were subcutaneously injected with 1 x 106CT26 cells in 100 pL of serum-free RPMI-1640 medium. When tumours grew to -100 mm3in size on day 10, the mice were intravenously administered by 5% dextrose (vehicle control), IRI / Lipo-PChcPC (40 mg IRI / kg), IRI / Lipo-CSS-Chol (40 mg IRI / kg), combination of IRI / Lipo-PChcPC (40 mg IRI / kg) and siRNA / LNP-DMA / PChcPC (200 pg siRNA / kg) or combination of IRI / Lipo-CSS-Chol (40 mg IRI / kg) and siRNA / LNP- DMA / SM-CSS-Chol (200 pg siRNA / kg) every 2 days for 3 times. Tumour growth and mice body weight were closely monitored as indicated. 24 h after the last drug injection, the mice were euthanized and tumour tissues were collected, weighed, and then homogenized in acidified methanol (0.075 M HC1, 900 pL per 100 mg tissue) prior to the IRI content measurement by the established HPLC method (Fig. 45). For P-gp gene (full gene name: ATP-binding cassette, sub-family B (MDR / TAP), member 1 A Abcbld)} knockdown, BALB / c mice (n = 3 mice) were subcutaneously injected with 1 x 106cells per mouse in 100 pL of serum-free RPMI-1640 medium. When tumours reached -100 mm3in size, siRNA / LNP-DMA / DSPC / Chol, siRNA / LNP-DMA / PChcPC, siRNA / LNP- DMA / SM / Chol, siRNA / LNP-DMA / SM-CSS-Chol was intravenously injected to mice at 200 pg siRNA / kg every 2 days for 3 times. On day 15, the mice were euthanized, and tumour tissues were isolated and processed for qRT-PCR (the reverse transcription polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qPCR) combined technique) to measure the P-gp mRNA levels (Abcbla mouse qPCR primer pair (Gene ID, 18671), forward sequence: TCCTCACCAAGCGACTCCGATA, reverse sequence: ACTTGAGCAGCATCGTTGGCGA, #MP201132, OriGene, USA ) following the published method'-.

[0149] Statistical analysis The level of significance in all statistical analyses was set at P < 0.05. Data are presented as mean ± s.d. and were analysed using the two-tailed, unpaired Student’s t-test for two groups or one-way analysis of variance (ANOVA) for three or more groups followed by Tukey’s multiple comparisons test using Prism 8.0 (GraphPad Software). Kaplan-Meier survival curves were compared with the log-rank Mantel-Cox test.

[0150] Results

[0151] Development of the Chol-derived SM delivery platform

[0152] To prevent the Choi exchange and investigate the impact of diverse linker chemistry bridging SM and Choi, five different SM-Chol conjugates were designed and synthesized (Fig. la and Figs. 7-11) — one with an carbonate ester bond (SM-C-Ester- Chol), one with ester bond (SM-Ester-Chol), one with glycine bond (SM-Glycine-Chol), one with disulfide bond and a longer linker (SM-CSS-Chol), and one with thioketal bond with a longer linker (SM-SCS-Chol), which can be cleaved by high levels of hydrolase, cathepsin B, glutathione (GSH), or reactive oxygen species, respectively, in cancers and inflammatory diseases---1-. The synthesized SM-Chol conjugates were verified by1H NMR,13C NMR, and ESI-MS (Figs. 7-12). Four SMLs (PChcPC, PChemsPC, OChemsPC and DChemsPC purchased from Avanti Polar Lipids) were used as controls. The Lipo formed by SM-Chol chimeric membrane were similar to SM / Chol Lipo (Lipo-SM / Chol) concerning the dynamic light scattering (DLS) size, zeta potential and stability (Fig. Ib-d and Fig. 26, 30). To evaluate the impact of disulfide exchange on Choi release from the SM-CSS-Chol and the release of encapsulated drugs at the tumor / disease sites, payload release kinetics were assessed using calcein (a fluorescent dye) and SM-CSS-Chol remained in Lipo-SM-CSS-Chol over time in PBS or glutathione (GSH)-. The calcein release was very low and well controlled in PBS (pH = 7.4), which was readily accelerated in the presence of GSH (Fig. 27). SM-CSS-Chol was quite stable in PBS (pH = 7.4) while being degraded rapidly when GSH was present (Fig. le, Fig. 27-28). Further studies demonstrated that the sulfide linked sphingomyelin (intermediate 7, Fig. 29) was produced and was confirmed by high-resolution LC-MS (HRMS) in the presence of GSH, which corroborated that Lipo-SM-CSS-Chol was GSH-responsive due to the disulfide linkage. To assess the osmotic stress-induced bilayer structural deformation, the leakage profiles of SM-Chol was measured under a high osmotic gradient in comparison to various conventional phospholipids (SM, HSPC, SPC, DSPC, or DOPC) / Chol and SMLs (PChcPC, PChemsPC, OChemsPC and DChemsPC) by using calcein as a model payload. CSS and SCS bridged SM-Chol performed better than other SM-Chol counterparts, SMLs controls and other phospholipid / Chol systems particularly in Lipo-SM-CSS-Chol (Fig. If). To evaluate the impact of physiological environment (biomembranes) to extract free Choi to induce content leakage, the payload retention in Lipo-SM-Chol was determined in 30% fetal bovine serum (FBS). SM-CSS-Chol outperformed other SM-Chol, SMLs and various phospholipid / Chol systems in content retention with minimal leakage (Fig. 1g). Additionally, the Choi exchange study unveiled that SM-Chol bridged by CSS or SCS bonds had much lower Choi transfer than SMLs and phospholipid / Chol mixtures, corroborating Chol-derived SM can block the Choi exchange between biomembranes more efficiently (Fig. Ih). Adding free Choi into the bilayer composed of phospholipids has proven to modify the thermotropic phase behavior of the bilayer and the phase transition can be eliminated at certain mol % Choi, yielding a solid lipid phase--5. To define the influence of SM-Chol on the phase transition of SM, differential scanning calorimetry (DSC) was used. DSC thermograms showed the thermotropic phase transition of SM was eliminated when mixed with 30 mol % free Choi. SM-Chol exhibited similar pattern as free Choi, rendered the phase transition of SM disappeared at eq. 30 mol % Choi (40 mol % for SM-SCS-Chol) and decreased transition temperature (Tm) and enthalpy (A / ) in a SM-Chol-dependent manner (Fig. li-1 and Fig. 31), substantiating covalently attaching Choi to SM retained the Choi membrane condensing ability. Further, atomic force microscopy (AFM) revealed that SM-Chol bilayer had a much higher degree of stiffness than SM / Chol membrane as evidenced by higher height / diameter (H / D) ratio (Fig. Io and Fig. 33).--- Given the importance of cholesterol and sphingomyelin in biological membranes and in cells, it was investigated whether intracellular delivery of Lipo-SM- Chol affects Choi and SM trafficking via evaluating the sterol regulatory element-binding protein 1 (SREBP1, a key transcriptional factor that controls lipogenesis and lipid uptake)--’4-, and Niemann Pick C (NPC) proteins (responsible for intracellular Choi transport)--, as well as cell membrane lipid rafts formation and SM levels"""-. Our western blot proved that Lipo-SM-Chol had no effect on SREBP1 and NPC1 and NPC2 proteins compared with the vehicle control (Fig. 35). Moreover, confocal laser scanning microcopy showed that the levels of lipid rafts--1-- and SM ' were not significantly altered on cells treated with Lipo-SM-Chol compared to vehicle control (Figs. 36,37). Taken together, these data demonstrated that Lipo-SM-Chol did not affect intracellular trafficking of Choi and SM. To elucidate if the unique structure of SM-Chol causes toxicity, its cytotoxicity was evaluated in 4T1 triple negative breast cancer cells. All Lipo-SM-Chol had no significant cell-killing activity at up to 1 mM and were as well-tolerated as diverse other phospholipid / Chol mixtures (Fig. 34).

[0153] MTD, pharmacokinetics and anti-lymphoma effects of VCR-laden Lipo

[0154] Given SM / Chol Lipo is used to deliver VCR in Marqibo, the efficiency of SM-Chol in delivering VCR was examined. Using the same lipids ratio and remote loading strategy with citrate buffer as the pH gradient as in Marqibo1-, the in-house made VCR / Lipo- SM / Chol well resembled that of commercial Marqibo regarding the drug loading capacity (DLC) / efficiency (DLE) (Fig. 39), in which the VCR content was determined by High Performance Liquid Chromatography (HPLC, Fig. 38), nanoparticle size, zeta potential, polydispersity (PDI) and morphology (Fig. 2a, b)--’2-; Our VCR / Lipo-SM-Chol with Ester, CSS, or SCS linkage showed similar characterizations as SM / Chol. Of note, C-Ester and Glycine bonded SM-Chol displayed much lower DLC and DLE compared to SM / Chol and other SM-Chol conjugates (Fig. 2a, b), which is attributable to their relatively poor leakage profiles (Fig. 1 f,g), indicating the linker chemistry played a significant role in defining the physicochemical properties of SM-Chol membrane. Then, the MTD of VCR / Lipo-SM- CSS-Chol and VCR / Lipo-SM / Chol, both of which had similar DLC / DLE with identical drug / lipids ratio (wt / wt = 0.099, Fig. 2a and Fig. 39), were evaluated in comparison to free VCR and VCR / Lipo-PChcPC in heathy C57BL / J mice. Different does of free VCR and VCR Lipo at a single intravenous (i.v.) injection were investigated. Consistent with literature1124, free VCR had the MTD at 2 mg / kg. VCR / Lipo-PChcPC increased the MTD to 3 mg / kg, while Lipo-SM / Chol further elevated it to 4 mg / kg (Fig. 40). Lipo-SM-CSS- Chol also exerted the VCR MTD to 4 mg / kg. Of note, VCR / Lipo-SM / Chol caused abnormal alkaline phosphatase (ALP), alanine transaminase (ALT), total protein, creatinine, red cell distribution width, heamoglobin concentration, and mean corpuscular volume levels and VCR / Lipo-PChcPC exhibited abnormal red cell distribution width, heamoglobin concentration and glucose, however, these were not seen in VCR / Lipo-SM- CSS-Chol (Fig. 2c-g). These findings substantiate the excellent in vivo safety profile of VCR / Lipo-SM-CSS-Chol and the ability to maximize the therapeutic potential.

[0155] To delve deeper into the in vivo stability and therapeutic delivery efficiency of SM- Chol, the blood kinetics and biodistribution was explored in orthotopic MC38 colorectal cancer (CRC) tumor model. The data have shown that within 5 min, -90% free VCR was cleared from the blood stream. In sharp contrast, VCR / Lipo-SM-Chol markedly extended the circulation half-life of VCR and delivered 6.5- to 13.9-fold more VCR into tumor. These effects were more significant in Lipo-SM-CSS-Chol that was also superior to Lipo- SM / Chol and Lipo-PChcPC (Fig. 3a-c). Notably, Lipo-SM-CSS-Chol has significantly less distribution to heart, lung, and kidney than VCR / Lipo-SM / Chol, allowing it to further minimize the systemic adverse effects (Fig. 3b). In addition, the in vivo stability and payload release in tumors of various Lipo was evaluated in orthotopic KPC-Luc pancreas tumor mouse model via encapsulating MU-P into the core of Lipo and incorporating DiD, a far-red fluorescent dye into the lipid bilayerL;, which enabled the tracking of the Lipo and its content (Fig. 43). The ratio of the total exposure of MU-P to the total exposure of lipid (AUCMU-P / AUCDID) can determine how stably Lipo retain the contents during circulation. The MU-P / DiD / Lipo-SM-CSS-Chol had greatly higher AUCMU-P / AUCDID ratio (0.86) than that of other MU-P / DiD / Lipo-SM-Chol (0.43-0.46), MU-P / DiD / Lipo-PChcPC (0.69), and MU-P / DiD / Lipo-SM / Chol (0.29), revealing its superior in vivo stability. It was confirmed that Lipo-SM-CSS-Chol showed a slower rate of content delivery in the liver, spleen, and kidney tissues compared to Lipo-SM / Chol, Lipo-PChcPC, and other Lipo-SM- Chol. It was also determined that Lipo-SM-CSS-Chol exhibited a much higher content release rate in tumors (higher conversion of MU-P to the MU and MU-G) ’ than Lipo- PChcPC, Lipo-SM / Chol and other Lipo-SM-Chol counterparts. This may be attributed to the higher GSH levels in tumor cells ' . which triggered the efficient dissociation of the lipid bilayer to allow rapid cargo release. The improved pharmacokinetics and tumor delivery, and increased payload release in tumors are crucial for enhanced therapeutic activity.

[0156] Since VCR is approved for treating diffuse large B-cell lymphoma (DLBCL)---, the therapeutic efficacy of VCR / Lipo was investigated in a human SU-DHL-4 DLBCL xenograft model in CB 1 'll cr-Prkdcsc ,£ / / IcrIcoCrl mice' (Fig. 3d-g) with an aim to see whether the Lipo-SM-Chol works better than Lipo-SM / Chol on controlling lymphoma development. Mice bearing lymphoma were intravenously injected once by various VCR / Lipo at 2 mg VCR / kg when s.c. tumour reached -200 mm3. S.c. DLBCL tumours grew rapidly in vehicle control-treated mice, reflecting its aggressive attribute. VCR / Lipo- SM / Chol was able to significantly reduce the tumor burden, demonstrating the advantage of using Lipo-SM / Chol as the drug carrier (Fig. 3d-f). VCR / Lipo-SM-Ester-Chol and VCR / Lipo-SM-SCS-Chol exhibited a similar level of lymphoma suppression as VCR / Lipo-SM / Chol (Fig. 3d-f). Piggybacked by the higher improvements on pharmacokinetics and tumor delivery efficiency, VCR / Lipo-SM-CSS-Chol further enhanced the lymphoma tumour growth inhibition and eradicated 2 out of 5 lymphoma tumours in mice (Fig. 3d-f). Similar results were discerned for the mice survival, where VCR / Lipo-SM-CSS-Chol imparted the longest mice survival rate (Fig. 3g). Since VCR works by binding to tubulin, P-tubulin was measured via immunofluorescence imaging in SU-DHL-4 diffuse large B-cell lymphoma treated by various VCR-loaded Lipo in an independent study (Fig. 44). It was observed that the microtubule network was characterized by regularly assembled, normal filiform microtubules wrapped around the cell nucleus and the well-organized and bipolar mitotic divisions were detected in tumor cells treated by vehicle control (Fig. 44). In contrast, the microtubule spindles shrunk around the center of cells and the multipolarization of the spindle and multinucleation phenomena were suppressed after VCR / Lipo therapies, among which VCR / Lipo-SM-CSS- Chol showed the strongest effects. Moreover, VCR / Lipo-SM-CSS-Chol exerted the highest level of enhancing apoptosis (cleaved caspase-3, CC-3) and DNA breaks (terminal deoxynucleotidyl transferase dUTP nick end labeling, TUNEL) as well as reducing cell proliferation (Ki67) (Fig. 44).

[0157] Lipo-SM-CSS-ChoI fortifies therapeutic delivery of IRI and DOX in metastatic PDAC and TNBC

[0158] To elucidate whether Lipo-SM-Chol can efficiently encapsulate and deliver drugs with different chemical structures and polarity, IRI or DOX were packaged into the core of Lipo-SM-Chol and compared to Lipo-SM / Chol and Lipo-PChcPC following the remote loading approaches used in corresponding FDA-approved liposomal nanotherapeutics Onivyde (TEAsSOS solution as the pH gradient)66or Doxil (ammonia sulfate as the pH gradient)67. Their anti-tumour activity was compared with Onivyde or Doxil in late-stage metastatic orthotopic PDAC or TNBC model, respectively.

[0159] It was observed that IRI-laden Lipo-SM-Chol with C-Ester or Ester bonds had similar DLC and DLE (Fig. 46) as those of Lipo-SM / Chol and Lipo-PChcPC (the IRI content was measured by HPLC, Fig. 45), which were further increased in Lipo-SM-Chol with CSS or SCS linkages, particularly in Lipo-SM-CSS-Chol (Fig. 4a). Since IRI is approved for treating PDAC in clinic, a stringent Kras and Trp53 mutated metastatic orthotropic KPC-Luc (LSL-KrasG12D / +;LSL-Trp53R172H / +;Pdx-l-Cre, with luciferase expression) murine PDAC model was established to mimic the human PDAC because KPC-Luc reproduces many of the key features of the tumor microenvironment as seen in human PDAC68,69. Within 11 days post inoculating KPC-Luc cells into the pancreas of mice, the primary tumors grew to -400 mg with significant metastasis to other organs (Fig. 4b). Vehicle control (VC, 5% dextrose) had no effect on controlling the tumor development and two mice died on day 20 and 24 (Fig. 4c), respectively, demonstrating the aggressiveness and invasiveness of this tumor type. IRI / Lipo-SM / Chol showed some tumor reduction and reduced the metastasis compared to VC, revealing the benefit of using a nanocarrier for the therapeutic delivery of IRI; Onivyde, the FDA-approved liposomal IRI, was able to further heighten the therapeutic effects (Fig. 4c-g). IRI / Lipo-SM-CSS- Chol outperformed against Onivyde, IRI / Lipo-SM / Chol, IRI / Lipo-PChcPC and other IRT / Lipo-SM-Chol counterparts and produced the highest level of KPC-Luc tumor inhibition with drastically diminished tumor metastasis to other organs (Fig. 4c-g).

[0160] Furthermore, to decipher the importance of the disulfide linkage, a SML in which the Choi is anchored to the sphingosine via a disulfide bond (SML-SS, Fig. 16) was used as an additional control. Furthermore, to accomplish a more stringent comparison, a SML with the same disulfide linker (CSS) used in SM-CSS-Chol was also synthesized (SML-CSS, Fig. 17) and used as another SML control. In addition, all the commercially available SMLs (PChcPC, PChemsPC, OChemsPC, and DChemsPC, purchased from Avanti Polar Lipids) were included as additional controls. The data showed that IRl / Lipo-SMLs markedly reduced tumor growth with mitigated metastasis compared to vehicle control, especially in IRI / SML-SS, corroborating the advantage of using a disulfide bond linker (Fig. 48). SML-CSS performed better than SML-SS on therapeutic delivery of IRI, which is attributed to the longer circulation time and higher tumor distribution (Fig. 48b-d). Notably, IRI / Lipo-SM-CSS-Chol was superior to all sterol-modified lipids controls on antitumor efficacy by garnering significant more tumor reduction and minimizing the tumor metastasis. The enhanced efficacy of IRI / Lipo-SM-CSS-Chol may be due to the improved pharmacokinetics and tumor delivery, and upregulated intratumoral y-H2AX, CC-3 and attenuated Ki67 levels (Fig. 48j).

[0161] Like Lipo-SM / Chol and Lipo-PChcPC, Lipo-SM-Chol enabled efficient packaging of DOX as evidenced by similar physicochemical characterizations concerning the DLC and DLE (Fig. 50, the DOX content was determined by HPLC as published)37, size, PDI, etc (Fig. 5a). Given that DOX is the standard of care for metastatic breast cancer treatment, the anti-tumor efficacy of diverse DOX / Lipo was investigated in metastatic orthotopic 4T1-Luc2 TNBC, which closely resembles human breast cancer and is an ideal animal model for stage IV human breast cancer70. On day 15 after injecting 4T1-Luc2 cells into the 4thmammary fat pad, mice developed primary tumors -200 mmm3and were intravenously administered by a single dose of DOX / Lipo. Doxil, the FDA-approved liposomal DOX, was used as the control. Tumor in VC-treated mice grew rapidly and metastasized to lung severely on day 35 (Fig. 5c-f and Fig. 51). While DOX / Lipo-SM- Ester-Chol significantly reduced tumour burden and mitigated the lung metastasis compared to VC, DOX / Lipo-SM / Chol and DOX / Lipo-SM-SCS-Chol further boosted the therapeutic efficacy. However, these anti-TNBC effects were further augmented by Doxil treatment, reflecting the effectiveness of this clinically used nanoformulation. Strikingly, DOX / Lipo-SM-CSS-Chol was superior to Doxil, DOX / Lipo-PChcPC and other groups on controlling tumor growth by shrinking tumor mass to around half of its starting point and prevented lung metastasis completely (Fig. 5c-f).

[0162] Through inhibiting topoisomerase I (IRI) or topoisomerase II (DOX), IRI and DOX can induce DNA damage. Based on the established literature, yH2AX, a sensitive molecular marker of DNA damage, was investigated via immunohistochemistry (IHC)71-75. Compared with vehicle control, IRI / Lipo or DOX / Lipo upregulated the y-H2AX signal, especially in IRI / Lipo-SM-CSS-Chol or DOX / Lipo-SM-CSS-Chol treated groups in KPC- Luc and 4T1-Luc2 tumors, respectively (Figs. 47, 53). Additionally, CC-3, TUNEL and Ki67 were evaluated and Lipo-SM-CSS-Chol markedly outperformed other Lipo-SM-Chol, Lipo-SM / Chol, Lipo-PChcPC, and Onivyde or Doxil on augmenting apoptosis and DNA breaks, as well as inhibiting cell proliferation when delivering IRI or DOX.

[0163] Lipo-SM-CSS-Chol enhances the delivery of DEX to inflamed lung

[0164] In addition to packaging chemotherapeutics (VCR, IRI, DOX) in the lumen, it was investigated whether Lipo-SM-Chol can enhance the therapeutic delivery for hydrophobic drugs via direct encapsulation into the lipid bilayer through thin-film hydration method'7. To test this hypothesis, DEX, a potent anti-inflammatory drug, was utilized as the model hydrophobic payload. It was demonstrated that all Lipo-SM-Chol can improve the DLE for DEX (Fig. 55a, the DEX content was measured by HPLC, Fig. 54), particularly with Ester, CSS and SCS-bonded SM-Chol, which resulted in 4 to 5.2-fold increase for DLE (Fig. 6a). The DEX / Lipo remained stable within a 2-week monitoring period (Fig. 55b-c). In order to test the anti-inflammatory effects of DEX / Lipo, a murine lung inflammation model was established through intratracheally administering LPS into the lungs of BALB / c mice (Fig. 6b)~’-~. 6 h after injecting LPS to mice, the mice were then intravenously treated with one dose of free DEX or DEX / Lipo. 12 h later, the lung tissues were isolated and processed for determining the IL-6, TNF-a and IL-ip levels using enzyme-linked immunosorbent assay (ELISA). As depicted in Fig. 6c-e, no treatment group (with LPS injection) markedly elevated IL-6, TNF-a and IL-ip levels as compared to the sham group (no LPS injection), manifesting the successful establishment of the inflamed lung model. Free DEX had no discernable effect on attenuating the IL-6, TNF-a and IL- 1 P cytokines, while DEX delivered by Lipo-SM / Chol or Lipo-PChcPC exhibited significant IL-6, TNF-a and IL-ip reduction in lungs, proving the advantage of using Lipo to boost the therapeutic delivery to inflamed tissue-1. Strikingly, DEX / Lipo-SM-CSS-Chol further alleviated lung inflammation by diminishing IL-6, TNF-a and IL-ip to the next level (Fig. 6c-e). Apart from increased pro-inflammatory cytokines, peribronchial thickening and leukocyte recruitment are hallmarks in inflamed lungs- . To dive deeper into the efficacy of DEX / Lipo on these histopathological alterations in lung inflammation, lung sections were stained with hematoxylin and eosin (Fig. 6f). Mice treated with Lipo encapsulated DEX, particularly DEX / Lipo-SM-CSS-Chol, drastically inhibited the leukocyte recruitment and peribronchial thickening whereas mice treated with non-capsulated DEX did not prevent the peribronchial thickening and leukocyte recruitment into the lungs (Fig. 6f). These findings uphold that Lipo-SM-CSS-Chol worked better than Lipo-SM / Chol and Lipo- PChcPC system in delivering DEX to inflamed lungs.

[0165] SM-CSS-Chol boosts the gene delivery efficiency of P-gp siRNA

[0166] In addition to small molecule therapeutic agents, it was investigated whether SM- Chol can also improve gene delivery efficiency in vivo. An siRNA targeting the P-gp gene (Abcbld) was tested because P-gp is a formidable drug efflux pump in a variety of diseases including cancers and inflammatory diseases and has been plaguing a wide array of small molecule drugs (e.g., IRI, VCR, DOX, etc), yielding multi-drug resistance and poor therapeutic efficacy in the long run-1---. To deliver siRNA, the ionizable lipid, Dlin-MC3- DMA (DMA) used in FDA-approved siRNA lipid nanoparticle (LNP), Onpattro-1- was used, along with SM-CSS-Chol, PChcPC or SM / Chol. The lipid compositions / ratio (DMA / DSPC / Chol) used in Onpattro - were utilized as the control system for P-gp siRNA delivery. Using gel retardation assay, it was found that free siRNA rapidly degraded after 8 h in serum; nonetheless, siRNA packaged in LNP-DMA / SM / Chol, LNP-DMA / PChcPC or LNP-DMA / SM-CSS-Chol entailed siRNA serum stability for up to 24 h, which was in line with the siRNA / LNP-DMA / DSPC / Chol control (Fig. 6g). Afterwards, the in vivo P-gp gene knockdown efficiency of siRNA / LNP was assayed in CT26 CRC murine tumor model that has high expression of P-gp--. Via qRT-PCR, it was found that siRNA / LNP- DMA / DSPC / Chol control decreased the P-gp mRNA level significantly in tumors, which was comparable to that of siRNA / LNP-DMA / SM / Chol and siRNA / LNP-DMA / PChcPC (Fig. 6h). Noteworthily, the gene silencing efficiency was further prominently enhanced in siRNA / LNP-DMA / SM-CSS-Chol. To elucidate if the improved P-gp siRNA delivery has real impact on intratumoural drug uptake and antitumor efficacy, mice bearing CT26 tumors were treated with IRI / Lipo-SM-CSS-Chol plus siRNA / LNP-DMA / SM-CSS-Chol in comparison to IRI / Lipo-SM-CSS-Chol alone. 3 i.v. injections of IRI / Lipo-SM-CSS-Chol led to marked tumor reduction, which was further increased when it was combined with siRNA / LNP-DMA / SM-CSS-Chol (Fig. 6i,j). While IRI / Lipo-PChcPC plus siRNA / LNP- DMA / PChcPC also enhanced the anticancer efficacy compared to IRI / Lipo-PChcPC, the effect was markedly outperformed by the combination of IRI / Lipo-SM-CSS-Chol plus siRNA / LNP-DMA / SM-CSS-Chol. The improved anticancer efficacy over IRI / Lipo alone was attributed to the enhanced drug delivery efficiency to tumors as combing siRNA / LNP significantly heightened IRI concentrations in tumors (Fig. 6k).

[0167] References

[0168] 1. Akinc A, et al. The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs. Nat Nanotechnol, 14, 1084-1087 (2019).

[0169] 2. Allen TM, Cullis PR. Liposomal drug delivery systems: from concept to clinical applications. Adv Drug Deliv Rev, 65, 36-48 (2013).

[0170] 3. Slingerland M, Guchelaar HJ, Gelderblom H. Liposomal drug formulations in cancer therapy: 15 years along the road. Drug Discovery Today, 17, 160-166 (2012).

[0171] 4. Hou X, Zaks T, Langer R, Dong Y. Lipid nanoparticles for mRNA delivery. Nat Rev Mater, 6, 1078-1094 (2021).

[0172] 5. de Lazaro I, Mooney DJ. A nanoparticle's pathway into tumours. Nat Mater, 19, 486-487 (2020).

[0173] 6. Petersen GH, Alzghari SK, Chee W, Sankari SS, La-Beck NM. Meta-analysis of clinical and preclinical studies comparing the anticancer efficacy of liposomal versus conventional non-liposomal doxorubicin. J Control Release, 232, 255-264 (2016).

[0174] 7. McIntosh TJ, Simon SA. Roles of bilayer material properties in function and distribution of membrane proteins. Annu Rev Biophys Biomol Struct, 35, 177-198 (2006).

[0175] 8. Sugahara M, Uragami M, Yan X, Regen SL. The structural role of cholesterol in biological membranes. J Am Chem Soc, 123, 7939-7940 (2001).

[0176] 9. McConnell HM, Vrljic M. Liquid-liquid immiscibility in membranes. Annu Rev Biophys Biomol Struct, 32, 469-492 (2003). 10. Park JH, et al. Genetically engineered cell membrane-coated nanoparticles for targeted delivery of dexamethasone to inflamed lungs. Sci Adv, 7, (2021).

[0177] 11. Torchilin VP. Recent advances with liposomes as pharmaceutical carriers. Nat Rev Drug Discov, 4, 145-160 (2005).

[0178] 12. Phillips MC, Johnson WJ, Rothblat GH. Mechanisms and consequences of cellular cholesterol exchange and transfer. Biochimica Et Biophysica Acta, 906, 223-276 (1987).

[0179] 13. Hamilton JA. Fast flip-flop of cholesterol and fatty acids in membranes: implications for membrane transport proteins. Curr Opin Lipidol, 14, 263-271 (2003).

[0180] 14. Kan CC, Yan J, Bittman R. Rates of spontaneous exchange of synthetic radiolabeled sterols between lipid vesicles. Biochemistry , 31, 1866-1874 (1992).

[0181] 15. Huang Z, Szoka FC, Jr. Sterol-modified phospholipids: cholesterol and phospholipid chimeras with improved biomembrane properties. J Am Chem Soc, 130, 15702-15712 (2008).

[0182] 16. Francis C. Szoka J, Huang Z, inventors; Liposomal compositions of epoxyketone- based proteasome inhibitors. United States patent US20150209282A1. 2011.

[0183] 17. Kohli AG, Kieler-Ferguson HM, Chan D, Szoka FC. A robust and quantitative method for tracking liposome contents after intravenous administration. J Control Release, 176, 86-93 (2014).

[0184] 18. Sergelius C, Yamaguchi S, Yamamoto T, Slotte JP, Katsumura S. N-cholesteryl sphingomyelin-A synthetic sphingolipid with unique membrane properties. Biochimica Et Biophysica Acta, 1808, 1054-1062 (2011).

[0185] 19. Pungente MD, et al. Synthesis and preliminary investigations of the siRNA delivery potential of novel, single-chain rigid cationic carotenoid lipids. Molecules, Yl, 3484-3500 (2012).

[0186] 20. Goyal K, Huang L. Gene Therapy Using Dc-Chol Liposomes. Journal of Liposome Research, 5, 49-60 (1995).

[0187] 21. Christensen D, Korsholm KS, Andersen P, Agger EM. Cationic liposomes as vaccine adjuvants. Expert Rev Vaccines, 10, 513-521 (2011).

[0188] 22. Gao X, Huang L. A novel cationic liposome reagent for efficient transfection of mammalian cells. Biochem Biophys Res Commun, 179, 280-285 (1991).

[0189] 23. Ju J, et al. Novel Cholesterol-Based Cationic Lipids as Transfecting Agents of DNA for Efficient Gene Delivery. International journal of molecular sciences', 2015. pp. 5666-5681. 24. Stevens PJ, Sekido M, Lee RJ. A folate receptor-targeted lipid nanoparticle formulation for a lipophilic paclitaxel prodrug. Pharm Res, 21, 2153-2157 (2004).

[0190] 25. Qin Y, et al. Liposome formulated with TAT-modified cholesterol for enhancing the brain delivery. International Journal of Pharmaceutics, 419, 85-95 (2011).

[0191] 26. Tang J, et al. A detachable coating of cholesterol-anchored PEG improves tumor targeting of cell-penetrating peptide-modified liposomes. Acta Pharmaceutica Sinica B, 4, 67-73 (2014).

[0192] 27. Tang J, et al. Synergistic targeted delivery of payload into tumor cells by dualligand liposomes co-modified with cholesterol anchored transferrin and TAT.

[0193] International Journal of Pharmaceutics, 454, 31-40 (2013).

[0194] 28. Sharma SC. Implications of sterol structure for membrane lipid composition, fluidity and phospholipid asymmetry in Saccharomyces cerevisiae. FEMS yeast research, 6, 1047-1051 (2006).

[0195] 29. Li J, et al. A review on phospholipids and their main applications in drug delivery systems. Asian J Pharm Sci, 10, 81-98 (2015).

[0196] 30. Martinez-Beamonte R, Lou-Bonafonte JM, Martinez-Gracia MV, Osada J. Sphingomyelin in high-density lipoproteins: structural role and biological function. Int J Mol Sci, 14, 7716-7741 (2013).

[0197] 31. Wang Z, et al. Sphingomyelin-derived nanovesicles for the delivery of the IDO1 inhibitor epacadostat enhance metastatic and post-surgical melanoma immunotherapy. Nat Commun, 14, 7235 (2023).

[0198] 32. Wang Z, et al. Camptothesome-based combination nanotherapeutic regimen for improved colorectal cancer immunochemotherapy. Biomaterials, 306, 122477 (2024).

[0199] 33. Silverman JA, Deitcher SR. Marqibo(R) (vincristine sulfate liposome injection) improves the pharmacokinetics and pharmacodynamics of vincristine. Cancer Chemother Pharmacol, 71, 555-564 (2013).

[0200] 34. Slotte JP. The importance of hydrogen bonding in sphingomyelin's membrane interactions with co-lipids. Biochim Biophys Acta, 1858, 304-310 (2016).

[0201] 35. Food U, Administration D. Silver Spring, Maryland, USA. Proprietary name: OnpattroTM (patisiran). Center For Drug Evaluation and Research Application Number: 2109220rigls000. 2018 [cited]Available from:

[0202] 36. Nakano K, Tozuka Y, Yamamoto H, Kawashima Y, Takeuchi H. A novel method for measuring rigidity of submicron-size liposomes with atomic force microscopy. Int J Pharm, 355, 203-209 (2008). 37. Wang Z, et al. Immunogenic camptothesome nanovesicles comprising sphingomyelin-derived camptothecin bilayers for safe and synergistic cancer immunochemotherapy. Nat Nanotechnol, 16, 1130-1140 (2021).

[0203] 38. Zhou L, Zhang P, Wang H, Wang D, Li Y. Smart Nanosized Drug Delivery Systems Inducing Immunogenic Cell Death for Combination with Cancer Immunotherapy. Acc Chem Res, 53, 1761-1772 (2020).

[0204] 39. Su Z, et al. Antibody-drug conjugates: Recent advances in linker chemistry. Acta Pharmaceutica Sinica B, 11, 3889-3907 (2021).

[0205] 40. Rautio J, Meanwell NA, Di L, Hageman MJ. The expanding role of prodrugs in contemporary drug design and development. Nat Rev Drug Discov, 17, 559-587 (2018).

[0206] 41. Rautio J, et al. Prodrugs: design and clinical applications. Nat Rev Drug Discov, 1, 255-270 (2008).

[0207] 42. Gu F, et al. Tumour microenvironment-responsive lipoic acid nanoparticles for targeted delivery of docetaxel to lung cancer. Sci Rep, 6, 36281 (2016).

[0208] 43. Mabrey S, Mateo PL, Sturtevant JM. High-sensitivity scanning calorimetric study of mixtures of cholesterol with dimyristoyl- and dipalmitoylphosphatidylcholines.

[0209] Biochemistry, 17, 2464-2468 (1978).

[0210] 44. Nakano K, Tozuka Y, Yamamoto H, Kawashima Y, Takeuchi H. A novel method for measuring rigidity of submicron- size liposomes with atomic force microscopy.

[0211] International Journal of Pharmaceutics, 355, 203-209 (2008).

[0212] 45. Sun Y, et al. SREBP1 regulates tumorigenesis and prognosis of pancreatic cancer through targeting lipid metabolism. Tumor Biology , 36, 4133-4141 (2015).

[0213] 46. Bertolio R, et al. Sterol regulatory element binding protein 1 couples mechanical cues and lipid metabolism. Nature communications , 10, 1326 (2019).

[0214] 47. Pfeffer SR. NPC intracellular cholesterol transporter 1 (NPCl)-mediated cholesterol export from lysosomes. Journal of Biological Chemistry, 294, 1706-1709 (2019).

[0215] 48. Jacobson K, Mouritsen OG, Anderson RGW. Lipid rafts: at a crossroad between cell biology and physics. Nature cell biology, 9, 7-14 (2007).

[0216] 49. Simons K, Ehehalt R. Cholesterol, lipid rafts, and disease. The Journal of clinical investigation, 110, 597-603 (2002).

[0217] 50. Simons K, Toomre D. Lipid rafts and signal transduction. Nature reviews Molecular cell biology, 1, 31-39 (2000). 51. Li YC, Park MJ, Ye S-K, Kim C-W, Kim Y-N. Elevated levels of cholesterol-rich lipid rafts in cancer cells are correlated with apoptosis sensitivity induced by cholesterol- depleting agents. The American journal of pathology, 168, 1107-1118 (2006).

[0218] 52. Kavishwar A, Medarova Z, Moore A. Unique sphingomyelin patches are targets of a beta-cell-specific antibody. Journal of lipid research, 52, 1660-1671 (2011).

[0219] 53. Tallima H, Azzazy HME, El Ridi R. Cell surface sphingomyelin: Key role in cancer initiation, progression, and immune evasion. Lipids in Health and Disease, 20, 1-12 (2021).

[0220] 54. Lu J, et al. PEG-derivatized embelin as a nanomicellar carrier for delivery of paclitaxel to breast and prostate cancers. Biomaterials, 34, 1591-1600 (2013).

[0221] 55. Webb MS, Harasym TO, Masin D, Bally MB, Mayer LD. Sphingomyelincholesterol liposomes significantly enhance the pharmacokinetic and therapeutic properties of vincristine in murine and human tumour models. Br J Cancer, 72, 896-904 (1995).

[0222] 56. Sedighi M, et al. Rapid optimization of liposome characteristics using a combined micro fluidics and design-of-experiment approach. Drug Deliv Transl Res, 9, 404-413 (2019).

[0223] 57. Mao W, Wu F, Lee RJ, Lu W, Wang J. Development of a stable single-vial liposomal formulation for vincristine. Int J Nanomedicine, 14, 4461-4474 (2019).

[0224] 58. Kato J, et al. Disulfide cross-linked micelles for the targeted delivery of vincristine to B-cell lymphoma. Mol Pharm, 9, 1727-1735 (2012).

[0225] 59. Cristian L, Lear JD, DeGrado WF. Use of thiol-disulfide equilibria to measure the energetics of assembly of transmembrane helices in phospholipid bilayers. Proc Natl Acad Sci U S A, 100, 14772-14777 (2003).

[0226] 60. Gamcsik MP, Kasibhatla MS, Teeter SD, Colvin OM. Glutathione levels in human tumors. Biomarkers, 17, 671-691 (2012).

[0227] 61. Xiong Y, Xiao C, Li Z, Yang X. Engineering nanomedicine for glutathione depletion-augmented cancer therapy. Chem Soc Rev, 50, 6013-6041 (2021).

[0228] 62. Han H, et al. Theranostic reduction-sensitive gemcitabine prodrug micelles for near-infrared imaging and pancreatic cancer therapy. Nanoscale, 8, 283-291 (2016).

[0229] 63. Shah NN, et al. Vincristine Sulfate Liposomes Injection (VSLI, Marqibo(R)): Results From a Phase I Study in Children, Adolescents, and Young Adults With Refractory Solid Tumors or Leukemias. Pediatr Blood Cancer, 63, 997-1005 (2016). 64. Hicks SW, et al. The Antitumor Activity of IMGN529, a CD37-Targeting Antibody-Drug Conjugate, Is Potentiated by Rituximab in Non-Hodgkin Lymphoma Models. Neoplasia, 19, 661-671 (2017).

[0230] 65. Zeng L, Li W, Chen CS. Breast cancer animal models and applications. Zool Res, 41, 477-494 (2020).

[0231] 66. Drummond DC, et al. Development of a highly active nanoliposomal irinotecan using a novel intraliposomal stabilization strategy. Cancer Res, 66, 3271-3277 (2006).

[0232] 67. Barenholz Y. Doxil(R)— the first FDA-approved nano-drug: lessons learned. J Controlled Release, 160, 117-134 (2012).

[0233] 68. Lu J, et al. Nano-enabled pancreas cancer immunotherapy using immunogenic cell death and reversing immunosuppression. Nat Commun, 8, 1811 (2017).

[0234] 69. Liu M, et al. Metabolic rewiring of macrophages by CpG potentiates clearance of cancer cells and overcomes tumor-expressed CD47-mediated 'don't-eat-me' signal. Nat Immunol, 20, 265-275 (2019).

[0235] 70. Bao L, et al. Increased expression of P-glycoprotein is associated with doxorubicin chemoresistance in the metastatic 4T1 breast cancer model. American Journal of Pathology, 178, 838-852 (2011).

[0236] 71. Lyu YL, et al. Topoisomerase Ilbeta mediated DNA double-strand breaks: implications in doxorubicin cardiotoxicity and prevention by dexrazoxane. Cancer Res, 67, 8839-8846 (2007).

[0237] 72. Liu Y, Wang M, Liu W, Jing I, Ma H. Olaparib and Doxorubicin Co-Loaded Polypeptide Nanogel for Enhanced Breast Cancer Therapy. Front Bioeng Biotechnol, 10, 904344 (2022).

[0238] 73. Petitprez A, et al. Acquired irinotecan resistance is accompanied by stable modifications of cell cycle dynamics independent of MSI status. Int J Oncol, 42, 1644- 1653 (2013).

[0239] 74. Huang HC, et al. Mechanism-informed Repurposing of Minocycline Overcomes Resistance to Topoisomerase Inhibition for Peritoneal Carcinomatosis. Molecular Cancer Therapeutics, 17, 508-520 (2018).

[0240] 75. Mah LJ, El-Osta A, Karagiannis TC. gammaH2AX: a sensitive molecular marker of DNA damage and repair. Leukemia, 24, 679-686 (2010).

[0241] 76. Zhang CY, et al. pH-Responsive Nanoparticles Targeted to Lungs for Improved Therapy of Acute Lung Inflammation / Injury. ACS Appl Mater Interfaces, 11, 16380-16390 (2019). Myerson JW, et al. Supramolecular arrangement of protein in nanoparticle structures predicts nanoparticle tropism for neutrophils in acute lung inflammation. Nat Nanotechnol, 17, 86-97 (2022).

[0242] 78. Li W, Liu D, Wang Q, Hu H, Chen D. Self-assembled CaP-based hybrid nanoparticles to enhance gene transfection efficiency in vitro and in vivo: beneficial utilization of PEGylated bisphosphate and nucleus locating signal. J Mater Chem B, 6, 3466-3474 (2018).

[0243] 79. Tsotas V A, Mourtas S, Antimisiaris SG. Dexamethasone incorporating liposomes: effect of lipid composition on drug trapping efficiency and vesicle stability. Drug Deliv, 14, 441-445 (2007).

[0244] 80. Nehoff H, Parayath NN, Domanovitch L, Taurin S, Greish K. Nanomedicine for drug targeting: strategies beyond the enhanced permeability and retention effect. Int J Nanomedicine, 9, 2539-2555 (2014).

[0245] 81. Balayssac D, et al. Patterns of P-glycoprotein activity in the nervous system during vincristine-induced neuropathy in rats. J Peripher Nerv Syst, 10, 301-310 (2005).

[0246] 82. Zhang CG, et al. Novel polymer micelle mediated co-delivery of doxorubicin and P-glycoprotein siRNA for reversal of multidrug resistance and synergistic tumor therapy. Sci Rep, 6, 23859 (2016).

[0247] 83. Riera P, et al. ABCB1 Genetic Variants as Predictors of Irinotecan-Induced Severe Gastrointestinal Toxicity in Metastatic Colorectal Cancer Patients. Front Pharmacol, 11, 973 (2020).

[0248] 84. Nanayakkara AK, et al. Targeted inhibitors of P-glycoprotein increase chemotherapeutic-induced mortality of multidrug resistant tumor cells. Sci Rep, 8, 967 (2018).

[0249] 85. Liu J, et al. Co-delivery of IOX1 and doxorubicin for antibody-independent cancer chemo-immunotherapy. Nat Commun, 12, 2425 (2021).

[0250] 86. Zhigaltsev IV, et al. Liposome-encapsulated vincristine, vinblastine and vinorelbine: a comparative study of drug loading and retention. J Control Release, 104, 103-111 (2005).

[0251] 87. Ehrentraut H, Weisheit CK, Frede S, Hilbert T. Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation. J Vis Exp, (2019).

Claims

CLAIMSWe claim:

1. A composition, comprising:A lipid vesicle comprising cholesterol covalently conjugated to sphingomyelin.

2. The composition of claim 1 , wherein said cholesterol is conjugated to said sphingomyelin via a disulfide bond and a linker.

3. The composition of claim 2, wherein said linker is selected from the group consisting of4. The composition of any of the preceding claims, wherein said lipid vesicle encapsulates an active agent.

5. The composition of claim 4, wherein said active agent is a small molecule.

6. The composition of claim 4, wherein said active agent is a drug.

7. The composition of claim 5, wherein said drug is a chemotherapeutic agent.

8. The composition of claim 5, wherein said active agent is a nucleic acid.

9. The composition of claim 8, wherein said nucleic acid encodes a therapeutic polypeptide.

10. The composition of claim 8, wherein said nucleic acid is selected from the group consisting of an siRNA, an miRNA, an antisense oligonucleotide, and a guide RNA.

11. The composition of any of the preceding claims, wherein said lipid vesicle comprises a liposome.

12. The composition of any of the preceding claims, wherein said lipid vesicle is a lipid bilayer or a multilamellar vesicle.

13. The composition of any of the preceding claims, wherein said lipid bilayer comprises a phospholipid or glycerophospholipid.

14. The composition of claim 13, wherein said phospholipid further comprises D-Lin- MC3-DMA.

15. The composition of claim 13, wherein said lipid is selected from the group consisting of In some embodiments, the lipid is one or more of sphingosylphosphorylcholine (SPC), l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), Dipalmitoylphosphatidylcholine (DOPC), Hydrogenated Soybean Phosphatidylcholine (HSPC), l,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), lecithin, 1,2- Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), l,2-Dioleoyl-sn-glycero-3-PG (DOPG), Phosphatidylinositol (PI), Phosphatidylserine (PS), 1,2-Dipalmitoyl-sn-glycero- 3 -phosphoglycerol (DPPG), l,2-Distearoyl-sn-glycero-3-phosphoglycerol, (DSPG), 1,2- Dipalmitoyl-sn-glycero-3-phosphate (DPP A), Dipalmitoylphosphatidylcholine (DPPE),1.2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), 1 ,2-dilauroyl-sn-glycero-3- phosphocholine (DLPC), 1 ,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE),1.2-Dimyristoyl-sn-glycero-3-phospho-L-serine (DMPS), 1 ,2-Dipalmitoyl-sn-glycero-3- phosphoserine (DPPS), Phosphatidylglycerol (PG), l,2-Dilauroyl-sn-glycero-3- phosphoglycerol (DLPG), l,2-Dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1- Palmitoyl-2-Oleoyl-sn-glycero-3-PE (POPE), Dioleoyl-3-trimethylammonium propane (DOTAP), l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), LPO1, CL1, CKK-E12, 3060il0, SM-102, and ALC-0315.

16. A method of delivering an active agent, comprising contacting the composition of any of the preceding claims with a cell.

17. The method of claim 16, wherein said cell is in vivo, ex vivo, or in vitro.

18. The method of claim 17, wherein said active agent treats a disease or condition.

19. A method of treating a disease or condition is a subject, comprising:Delivering the composition of any one of claims 1 to 15 to a subject in need thereof.

20. The use of the composition of any one of claims 1 to 15 to deliver an active agent to a cell.

21. The use of the composition of any one of claims 1 to 15 to treat a disease or condition in a subject.

Citation Information

Patent Citations

  • Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto

    US20230073819A1

  • Cell-targeted nanoparticles to inhibit RNA cargo

    US20230120162A1

  • Immunogenic nanovesicles for cancer immunotherapy

    US20240009321A1