Prognosis and prediction markers and method in malignant melanoma to guide clinical decision making

BRAF V600 mutated protein and immunoproteasome proteins serve as biomarkers to predict treatment response in melanoma, addressing the lack of predictive markers and enhancing treatment efficacy by classifying patient likelihood for targeted or immunotherapy.

WO2025190963A1PCT designated stage Publication Date: 2025-09-18SANCHEZ PUENTE ANIEL +4
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/056651
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-13
Filing Date
2025-03-11
Publication Date
2025-09-18

AI Technical Summary

Technical Problem

There is a lack of efficient predictive markers for BRAF V600 mutated melanomas to guide the right treatment for the right patient, and insufficient markers for melanoma immunotherapy, leading to inadequate responses and resistance in treatments like targeted therapy and immunotherapy.

Method used

The use of BRAF V600 mutated protein and immunoproteasome proteins (PSME1, PSME2, PSMB8, PSMB9, PSMB10) as biomarkers to determine the efficacy of drug treatments by detecting their presence and quantity in biological samples, classifying patients as high or low likelihood responders.

Benefits of technology

This approach accurately predicts patient response to targeted therapy or immunotherapy, guiding personalized treatment decisions and improving treatment efficacy by identifying appropriate therapies for BRAF V600 mutated melanomas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000016_0001
    Figure IMGF000016_0001
  • Figure IMGF000017_0001
    Figure IMGF000017_0001
  • Figure IMGF000017_0002
    Figure IMGF000017_0002
Patent Text Reader

Abstract

The present invention relates to a method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of: (i) evaluation of the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of at least one BRAF V600 mutated protein and at least one immunoproteasome protein is detected in said biological sample, and wherein in case the genetic alteration in the BRAF gene is not present, the presence and / or quantity of at least one immunoproteasome protein is detected in said biological sample.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Prognosis and prediction markers and method in Malignant

[0002] Melanoma to guide clinical decision making

[0003] Technical field of the invention

[0004] The present invention related to the field of diagnosis of melanoma by means of using a protein based biomarker which is expressed in tumor tissue samples and biological fluids. More specifically, the present invention relates to the use of the BRAF V600 mutated protein as a suitable marker for prognosis in melanoma, assessing the disease aggressiveness and responsiveness to immunotherapy / immune check point inhibitor treatment.

[0005] Additionally, the present invention related to the field of diagnosis of melanoma by means of using protein based biomarkers which are expressed in tumor tissue samples and biological fluids. Furthermore, the present invention relates to the use of gene expression of at least one subunit / member of the immunoproteasome (11S proteasome) being protein or fragment thereof, or a combination of PSME1 (Proteasome activator subunit 1); PSME2 (Proteasome activator subunit 2); PSMB8 (Proteasome 20S subunit beta 8); PSMB9 (Proteasome 20S subunit beta 9); and PSMB10 (Proteasome 20S subunit beta 10); or a fragment thereof, as a marker suitable for prognosis in melanoma, and to predict the outcome of melanoma immunotherapy.

[0006] Background

[0007] Melanoma represents the most lethal type of skin cancer. Metastatic malignant melanoma carries a poor prognosis; however surgical intervention of the primary melanoma is curative in most patients, which underlines the importance of early diagnosis. Incidence of melanoma has increased dramatically over the past three decades, outpacing almost all other cancers 2-4. In 2020, Globocan reported 324,635 new cases and 57,043 deaths (https: / / gco.iarc.fr / ) from melanoma worldwide.

[0008] In many European countries, melanoma is increasing at a rate of 3-7% and this figure is expected to rise further 2-4. Approximately 120,000 new cases in the United States were expected to be diagnosed in 2020, with about 7,000 patients dying from the disease. The skin exposure to environmental UV light, combined with low levels of skin pigment, large number of pigmented nevi, other genetic and environmental factors, and with a compromised immune system, are considered the most important factors in the development of the disease.

[0009] The main prognostic factor for melanoma, the histopathological staging, has remained unaltered for several decades. It focuses primarily on tumor thickness, ulceration and metastases to lymph nodes and other organs; and it is a major estimate of the clinical behavior of primary melanoma.

[0010] BRAF:

[0011] BRAF is a human gene that encodes for the protein serine / threonine-protein kinase B-Raf. This protein plays a role in regulating the MAP kinase / ERK signaling pathway, which affects cell division, differentiation, and secretion. About 50 % of melanomas harbor activating BRAF mutations. Among the BRAF mutations observed in melanoma, over 90 % are at codon 600, and among these, over 90 % are a single nucleotide mutation resulting in substitution of glutamic acid for valine BRAFV600E. This mutation has also been identified in various other cancers as well, including non-Hodgkin lymphoma, colorectal cancer, thyroid carcinoma, non-small cell lung carcinoma, hairy cell leukemia and adenocarcinoma of lung (https: / / www.ncbi.nlm.nih.gov / gene / 673).

[0012] The development of kinase inhibitors targeting the mutated serine / threonine-protein kinase BRAF, such as vemurafenib, dabrafenib, and encorafenib, have provided significant improvement. Mutations located at BRAF position 600, where the V600E accounts for 90% of the cases, have been associated with increased tumor proliferation, mainly by dysregulation of MEK / ERK receptors 10- 12. The BRAF inhibitors have been combined with cobimetinib, trametinib, and binimetinib that target MEK, another member of the mitogen-activated protein kinase (MAPK) signaling pathway. This treatment modality is called targeted therapy, and it this treatment modality has led to improved overall and progression-free survival 13-16.

[0013] Although these agents prolong life, all patients inevitably develop resistance and their cancer progresses (Cancers (Basel). 2020 Oct; 12(10): 2801). It is well known that the presence of a gene variant at DNA or transcript levels (mutated or not) does not guarantee the expression of the protein it encodes for. Even mRNA levels have low to modest correlation with protein expression due to additional post-transcription and post-translation regulations. Strikingly, the melanoma targeted therapy is directed towards the mutated protein and not the corresponding gene. Often, there is no knowledge as to whether the BRAF V600 mutated gene is actually translated into the protein and; at there is no link between the levels of the target protein and subsequent drug efficacy.

[0014] Alternatively, BRAF V600 mutated melanomas can also be treated along or in combination with immunotherapy. The best-known examples are monoclonal antibodies that block CTLA-4 and PD- 1, i.e. the so called immune check point inhibitors, which improve the overall survival for patients with long-term, durable tumor regression becoming a reality for some patients. Nevertheless about 50% of patients show lack of response to this approach and / or develop resistance.

[0015] Recent clinical studies has suggested: 1) the use of immunotherapy as a first line treatment and the need of correlative studies on the tumor and / or blood to identify patients for whom earlier application of BRAF-targeted therapy might be beneficial; or 2) a sequential treatment of targeted therapy followed by combination of Immune checkpoint Inhibitors to improve response and longterm benefit in patients with rapidly progressing disease, Michael B. Atkins et al, and Paolo A. Ascierto et al.

[0016] Immunoproteasome:

[0017] Advances in the understanding of molecular mechanisms of T cell activation and inhibition and immune homeostasis allowed for the development of checkpoint inhibitors 17,18. The therapy targets key regulators of the immune system that restrain T cells from full and persistent activation and proliferation under normal physiologic conditions, but are used by cancer cells to evade the immune response. The best-known examples are monoclonal antibodies that block CTLA-4 and PD- 1, i.e. the so called immune check point inhibitors. These were the first class of therapies shown to improve the overall survival for patients with advanced melanoma, with long-term, durable tumor regression becoming a reality for some patients 19.

[0018] The immunoproteasome, derived from the constitutive proteasome, is a substantial proteolytic apparatus that plays a critical role in maintaining homeostasis and contributing to immune responses.

[0019] The constitutive proteasome is expressed ubiquitously in the body, where it degrades ubiquitinated proteins including transcriptional factors and proteins required for cell cycle progression. The primary role of the immunoproteasome is to process antigens for presentation on major histocompatibility complex (MHC) class I molecules to CD8+ T lymphocytes. The expression of the immunoproteasome is induced by interferon-y (IFN-y) and tumor necrosis factor-a (TNF-a). The immunoproteasome is composed by 5 subunits: 1) ipi, known as large multifunctional peptidase 2 (LMP2) or proteasome subunit beta type 9 (PSMB9); 2) ip2 known as LMP10, multicatalytic endopeptidase complex-like-1 (MECL-1), or PSMB10; 3) ips7known as LMP7 or PSMB8; and the 11S regulator composed of Proteasome Activator 4) PA28a and 5) PA28P encoded by PSMEl, PSME2, respectively.

[0020] Elevated expression levels of PSMEl, PSME2, PSMB8 and PSMB9 have been associated with favorable survival outcomes in melanoma, observed at both protein and transcript levels, Betancourt et al, Wang Qand Kalaora, S., Lee, J.S., Barnea, E. et al. In melanoma the overexpression of PSMEl, PSMB8, PSMB9 and PSMB10 has been associated or suggested to enhance responsiveness to immunotherapies, In melanoma, the overexpression of PSMEl, PSMB8, PSMB9, and PSMB10 has been associated or suggested to enhance responsiveness to immunotherapies. Harel M et al and Kalaora, S., Lee, J.S., Barnea, E. et al. Furthermore the overexpression of immunoproteasomes subunits PSMB8 and PSMB9 in human melanoma cell lines led to the generation of more immunogenic repertoire of tumor peptides and better lysis of tumor cells by co-cultured autologous tumor-infiltrating lymphocytes Kalaora, S., Lee, J.S., Barnea, E. et al.

[0021] While the evolution of contemporary of contemporary drugs that modulate immune responses or targeting specific cellular signaling events has prolonged patient survival, there remains a subset of patients who do not achieve a complete response to these therapies. Moreover, a significant majority of patients experience relapse, primarily attributed to both insufficient initial response and the emergence of resistance.

[0022] Resistance may develop through various mechanisms, including tumor cells evading inhibition by promoting alternative survival pathways, mutational events, and changes in the tumor microenvironment 22-25.

[0023] WO2018 / 114953A1 appear to disclose a method to determine BRAF mutations and wild type BRAF protein by mass spectrometry.

[0024] Kuras, M (2023), "Proteogenomic profiling of metastatic melanoma. From protein expression to patient stratification", Doctoral Thesis (compilation), Department of Translational Medicine, Lund University, Faculty of Medicine, appear to disclose profiling of metastatic malignant melanoma. WO2016 / 069928A1 appear to disclose a method of detecting BRAF in cancer. of the invention

[0025] Clearly, there is an unmet need of information guiding the treatment of patients, more specifically the lack of efficient predictive markers for BRAF V600 mutated melanomas able to indicate the right treatment for the right patient beyond the presence of the mutation.

[0026] Additionally, there is an unmet need of information guiding the daily treatment of patients, more specifically the lack of efficient predictive markers in Melanoma immunotherapy.

[0027] According to an aspect, the invention concerns a method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of:

[0028] (i) evaluation of the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of at least one BRAF V600 mutated protein and at least one immunoproteasome protein is detected in said biological sample, and wherein in case the genetic alteration in the BRAF gene is not present, the presence and / or quantity of at least one immunoproteasome protein is detected in said biological sample.

[0029] Evaluation of the presence or absence of a genetic alternation may be done by for example a gene test or by evaluation of the BRAF protein status.

[0030] According to an aspect, the invention concerns a method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of: a. providing a biological sample, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and c. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker.

[0031] According to another aspect, the invention concerns a method for performing a diagnosis of a BRAF gene mutation in the position corresponding to amino acid position 600 in wild-type BRAF protein, wherein said method comprises the steps of a. Providing a biological sample, b. Quantitative analysis of the expression of BRAF V600 mutated protein in said biological sample, and c. Providing a diagnosis of based said quantitative analysis.

[0032] According to another aspect, the invention concerns a method of prognostication of the response to a drug therapy comprising the method according to the invention.

[0033] According to another aspect, the invention concerns a method of prognostication of survival of a subject comprising the method according to the invention.

[0034] According to another aspect, the invention concerns a kit for predicting the response to a drug treatment for malignant melanoma, comprising a. a reagent suitable for detecting the presence and / or quantity of at least one biomarker in a biological sample, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein.

[0035] According to another aspect, the invention concerns an in vitro diagnostic kit configured to perform the method according to the invention.

[0036] According to another aspect, the invention concerns an assay for performing the method according to the invention.

[0037] According to another aspect, the invention concerns a method of treatment of malignant melanoma, wherein said treatment comprises use of the method, the kit or the assay according to the invention.

[0038] Detailed description of the invention

[0039] The invention will hereafter be described by way of the following non-limiting embodiments. According to an embodiment, the invention concerns a method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of: a. providing a biological sample, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and c. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker.

[0040] According to another embodiment, the invention concerns the method according to the invention, wherein said method comprises the steps of: a. providing a biological sample, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is BRAF V600 mutated protein, and c. classifying the subject as having a high likelihood of responding to targeted therapy if said biomarker is higher or equal to a reference value, and classifying the subject as having a high likelihood of responding to immunotherapy if said biomarker is lower compared to a reference value.

[0041] According to another embodiment, the invention concerns the method according to the invention, wherein said method comprises the steps of: a. providing a biological sample, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is at least one immunoproteasome protein, and c. classifying the subject as having a high likelihood of responding to immunotherapy if said biomarker is higher or equal to a reference value, and classifying the subject as having a low likelihood of responding to immunotherapy if said biomarker is lower compared to a reference value. According to an embodiment, the reference value may be a value determined based on at least one subject that does not respond to a specific drug therapy.

[0042] According to another embodiment, the invention concerns the method according to the invention, wherein said method comprises a step of:

[0043] (i) detecting the presence or absence of a genetic alteration in the BRAF gene, preferably, wherein said step (i) is preformed before step a.

[0044] According to another embodiment, the invention concerns a method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of:

[0045] (i) evaluation of the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of 6 biomarkers is detected in said biological sample, wherein said biomarkers are BRAF V600 mutated protein and immunoproteasome protein, and wherein in case the genetic alteration in the BRAF gene is not present, the presence and / or quantity of 5 biomarkers is detected in said biological sample, wherein said biomarkers are immunoproteasome protein.

[0046] According to another embodiment, the invention concerns a method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of:

[0047] (i) evaluation of the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of at least one BRAF V600 mutated protein and at least one immunoproteasome protein is detected in said biological sample, and wherein in case the genetic alteration in the BRAF gene is not present, the presence and / or quantity of at least one immunoproteasome protein is detected in said biological sample, and wherein if said BRAF V600 mutated protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with targeted therapy compared to a subject having lower BRAF V600 mutated protein expression, and wherein if said BRAF V600 mutated protein expression is lower compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having a higher BRAF V600 mutated protein expression, and wherein if said at least one immunoproteasome protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, said immunoproteasome protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having lower immunoproteasome protein expression.

[0048] According to another embodiment, the invention concerns the method according to the invention, wherein the presence and / or quantity of at least two, at least three, at least four, at least five, at least six or preferably wherein at least seven biomarkers is detected, and / or combinations of these biomarkers is detected.

[0049] According to another embodiment, the invention concerns the method according to the invention, wherein the step of detecting the presence and / or quantity of said biomarker comprises use of Trypsin enzyme, and / or any other protease or chemical reagent able to hydrolyze peptide bonds.

[0050] According to another embodiment, the invention concerns the method according to the invention, wherein the step of detecting the presence and / or quantity of said biomarker does not comprise use of protease.

[0051] According to another embodiment, the invention concerns the method according to the invention, wherein the step of detecting the presence and / or quantity of said biomarker is a measurement of intact protein, intact proteoform or a derived proteoform.

[0052] According to another embodiment, the invention concerns the method according to the invention, wherein the method does not comprise measurement of WT BRAF protein. According to another embodiment, the invention concerns the method wherein one or more biomarkers are assigned specific weight relative to each other.

[0053] According to another embodiment, the invention concerns the method, wherein said biological sample is a biological sample obtained from said subject.

[0054] According to another embodiment, the invention concerns the method, wherein said biological sample is selected among a tumor sample, a fluid sample, a blood sample, a plasma sample, a serum sample and a urine sample.

[0055] According to another embodiment, the invention concerns the method, wherein said genetic alteration is a BRAF V600 gene mutation.

[0056] According to another embodiment, the invention concerns the method, wherein in case the genetic alteration is present, the presence and / or quantity of BRAF V600 mutated protein is detected in said biological sample.

[0057] According to another embodiment, the invention concerns the method, wherein said BRAF V600 mutated protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, and wherein said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with targeted therapy compared to a subject having lower BRAF V600 mutated protein expression.

[0058] BRAF V600E mutated protein expression is significantly higher in patients living less than 3 years, i.e. patients having an aggressive tumor.

[0059] According to another embodiment, the invention concerns the method, wherein said BRAF V600 mutated protein expression is lower compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, and wherein said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having a higher BRAF V600 mutated protein expression.

[0060] According to another embodiment, the invention concerns the method, wherein said reference value is determined from a multitude of samples from subjects with BRAF V600 mutation.

[0061] According to another embodiment, the invention concerns the method, wherein said genetic alteration in the BRAF gene is not present. According to another embodiment, the invention concerns the method, wherein said biological sample comprises a wild-type BRAF gene.

[0062] According to another embodiment, the invention concerns the method, wherein the presence and / or quantity of at least one immunoproteasome protein, or a combination thereof is detected in said biological sample.

[0063] According to another embodiment, the invention concerns the method, wherein said at least one immunoproteasome protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, and wherein said immunoproteasome protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having lower immunoproteasome protein expression.

[0064] Immunoproteasome protein expression is significantly higher in less aggressive tumor bearing the BRAF V600E mutation.

[0065] According to another embodiment, the invention concerns the method, wherein said method is performed before administration of a drug therapy to said subject and / or before treatment for malignant melanoma is initiated.

[0066] According to another embodiment, the invention concerns the method, wherein said method is performed after said subject has received at least one type of drug therapy.

[0067] According to another embodiment, the invention concerns the method, wherein said method is performed both before a drug treatment for malignant melanoma is administered, and performed after a drug therapy for malignant melanoma is administered to said subject.

[0068] According to another embodiment, the invention concerns the method, wherein said method is performed before and after said subject has received at least one type of drug therapy, and wherein a change in the BRAF V600 mutated protein expression and / or a change in the immunoproteasome protein expression is indicative for an increased efficacy to treatment with immunotherapy.

[0069] According to another embodiment, the invention concerns the method, wherein said steps are performed in said order. According to another embodiment, the invention concerns the method, wherein said analysis of the expression of the BRAF V600 mutated protein is a quantitative analysis.

[0070] According to another embodiment, the invention concerns the method, wherein said immunoproteasome protein is at least one, at least two, at least three, at least 4 or all of the biomarkers PSMEl (SEQ ID No. 1), PSME2 (SEQ ID No. 2), PSMB8 (SEQ ID No. 3), PSMB9 (SEQ ID No. 4) and / or PSMB10 (SEQ ID No. 5).

[0071] According to another embodiment, the invention concerns the method, wherein said BRAF V600 mutated protein is selected among BRAF V600E (SEQ ID No. 6), V600D (SEQ ID No. 9), V600R (SEQ ID No. 8), and / or V600K (SEQ ID No. 7).

[0072] According to an embodiment the BRAF V600 mutated protein may be a variant of a BRAF V600 mutated protein.

[0073] According to another embodiment, the invention concerns the method, wherein said measuring of the expression of the BRAF V600 mutated protein comprise the analysis of a polypeptide fragment / protein region comprising the mutation.

[0074] According to another embodiment, the invention concerns the method, wherein said biological sample is a sample from a primary tumor.

[0075] According to another embodiment, the invention concerns the method, wherein said biological sample is a metastatic tumor sample.

[0076] According to an embodiment, the method according to the invention comprises a step of communicating the result to the patient.

[0077] According to another embodiment, the invention concerns the method, wherein said drug therapy is targeted therapy and / or immunotherapy.

[0078] According to another embodiment, the invention concerns the method, wherein said targeted therapy is a kinase inhibitor, such as Vemurafenib, Dabrafenib or Sorafenib or a combination thereof.

[0079] According to another embodiment, the invention concerns the method, wherein said immunotherapy is an immune checkpoint inhibitor. According to another embodiment, the invention concerns the method, wherein said method comprises a step of administering said drug therapy to said subject.

[0080] According to an embodiment, the method according to the invention is an in vitro or ex vivo method.

[0081] According to another embodiment, the invention concerns a method for performing a diagnosis of a BRAF gene mutation in the position corresponding to amino acid position 600 in wild-type BRAF protein, wherein said method comprises the steps of a. Providing a biological sample, b. Quantitative analysis of the expression of BRAF V600 mutated protein in said biological sample, and c. Providing a diagnosis of based said quantitative analysis.

[0082] According to another embodiment, the invention concerns a method of prognostication of the response to a drug therapy comprising the method according to the invention.

[0083] According to another embodiment, the invention concerns a method of prognostication of survival of a subject comprising the method according to the invention.

[0084] According to another embodiment, the invention concerns a kit for predicting the response to a drug treatment for malignant melanoma, comprising a. a reagent suitable for detecting the presence and / or quantity of at least one biomarker in a biological sample, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein.

[0085] According to another embodiment, the invention concerns an in vitro diagnostic kit configured to perform the method according to the invention.

[0086] According to another embodiment, the invention concerns an assay for performing the method according to the invention.

[0087] According to another embodiment, the invention concerns a method of treatment of malignant melanoma, wherein said treatment comprises use of the method, the kit or the assay according to the invention. According to another embodiment, the invention concerns the method of treatment, wherein said method comprises targeted therapy, wherein said therapy comprises use of a kinase inhibitor, such as Vemurafenib, Dabrafenib or Sorafenib or a combination thereof.

[0088] According to another embodiment, the invention concerns the method of treatment, wherein said method comprises immunotherapy, wherein said immunotherapy comprises an immune checkpoint inhibitor.

[0089] According to another embodiment, the invention concerns the method of treatment, wherein a subject's response to a given drug treatment is monitored pre- and post-treatment, using the method according to the invention.

[0090] According to another embodiment, the invention concerns the method of treatment, wherein a post-treatment change in the BRAF V600 mutated protein expression and / or a change in the immunoproteasome protein expression is indicative for an increased efficacy to a given drug treatment, preferably wherein said drug treatment is immunotherapy.

[0091] According to an embodiment, the method according to the invention may be used for the prediction of the outcome of melanoma target therapy and / or immunotherapy, and the prognosis of patient outcome of malignant melanoma.

[0092] According to an embodiment, the method comprises a step of comparing the BRAF V600 mutated protein expression with a reference value of BRAF V600 mutated protein expression and variant thereof determined from a diverse set of samples from subjects carrying the BRAF V600 mutation and expected to be susceptible to the specified drug treatment or its variants.

[0093] According to an embodiment, the method comprises a step of determining the subjects susceptibility to a given drug treatment, based on said step of comparing the expression of a BRAF V600 mutated protein expression with a reference value.

[0094] BRAF V600 mutated protein expression below a reference value may be indicative for an increased susceptibility to another drug treatment (Immunotherapy).

[0095] BRAF V600 mutated protein expression above a reference value may be indicative for an increased susceptibility to a given drug treatment (targeted therapy). According to an embodiment, if the patient is found susceptibility to a given drug treatment, administer the drug of said drug treatment at a prescribed or defined daily dose (DDD) for a prescribed treatment period, or if the patient if found not to be susceptibility to a given drug treatment, start alternative treatments instead, such as surgery, radiation therapy, chemotherapy, and / or other treatments beneficial for said BRAF related disease.

[0096] According to an embodiment, said tumor sample comprises a wild-type-BRAF V600 gene or a BRAF V600 gene mutation.

[0097] According to an embodiment, the BRAF V600 gene mutation may be in the position corresponding to amino acid position 600 in the wild type BRAF protein, said position being occupied by valine in the WT BRAF.

[0098] Sequences

[0099] Table 1. Name and amino acid sequences of immunoproteasome members

[0100] Table 2. Name and amino acid sequences of BRAF V600 mutated protein

[0101] Description of the figures

[0102] In an ROC analysis, an AUC=1 is an ideal result displaying complete discrimination; while the line with AUC=0.5 representing no discrimination abilities at all. AUC and ROC denote area under the curve receiver operating characteristic, respectively.

[0103] Figure 1: BRAF V600E mutation status (mutated or WT) could be determined by quantitative measurement of BRAF V600E mutated protein expression. Here 48 samples comprising WT BRAF (32) and BRAF V600 mutated (16) melanomas that were verified at mRNA levels (see experimental) were analyzed by mass spectrometry, and the relative abundance of the mutated BRAF V600E protein was determined. The AUC was 0.992 (95% Cl, 0.976 to 1.00) .

[0104] Figure 2: Spearman rank correlation between BRAF V600E mutated protein abundance for 16 melanoma metastases and corresponding tumor histological immune related parameters.

[0105] BRA_mut: BRAF V600E mutated protein expression

[0106] Adj. lymph. node: Adjacent lymph node content lymph. density: lymphocyte density lymph. distribution: lymphocyte distribution

[0107] Lymph. score: lymphocyte score.

[0108] Figure 3: Violin plots comparison of BRAF V600E protein expression in less aggressive (from patients who survived more than 3 years) and aggressive (patients who survived less than 3 years) melanoma metastases.

[0109] Figure 4: Violin plots comparison of PSME1 protein expression in less aggressive (from patients who survived more than 3 years) and aggressive (patients who survived less than 3 years) BRAF V600 mutated melanoma metastases.

[0110] Figure 5: Violin plots comparison of PSME2 protein expression in less aggressive (from patients who survived more than 3 years) and aggressive (patients who survived less than 3 years) BRAF V600 mutated melanoma metastases.

[0111] Figure 6: Violin plots comparison of PSMB8 protein expression in less aggressive (from patients who survived more than 3 years) and aggressive (patients who survived less than 3 years) BRAF V600 mutated melanoma metastases.

[0112] Figure 7: Violin plots comparison of PSMB9 protein expression in less aggressive (from patients who survived more than 3 years) and aggressive (patients who survived less than 3 years) BRAF V600 mutated melanoma metastases.

[0113] Figure 8: Violin plots comparison of PSMB10 protein expression in less aggressive (from patients who survived more than 3 years) and aggressive (patients who survived less than 3 years) BRAF V600 mutated melanoma metastases. Figure 9: The prognostic power of combined immunoproteasome protein expression for BRAF V600 mutated melanomas. The figure shows the ROC analysis for 49 melanoma metastases based on relative abundance expression of immunoproteasome members (PSMEl, PSME2, PSMB8, PSMB9 and PSMB10) and patient three-year survival data. AUC value was 0.946 (95% Cl, 0.871 to 1.021).

[0114] Figure 10: Heatmap of Spearman rank correlation in melanoma metastases between BRAF V600E mutated protein expression, all the immunoproteasome member protein expression (PSMEl, PSME2, PSMB8, PSMB9 and PSMB10) and the easier score (REF).

[0115] Figure 11: The immunoproteasome and BRAF V600 expressions are predictors of the antitumor immune response and prognostic biomarker for BRAF V600 mutated melanomas. The figure shows the ROC for 16 melanoma metastases were the AUC value was 1.

[0116] This is the result of combination of BRAF V600E and PSMEl (ratio PSMEl / BRAF V600E). Figure 12: The predictive power of combined protein expression of immunoproteasome members for anti PDL-1 immunotherapy in BRAF V600 mutated melanomas, by discriminating between responders and no responders to therapy. The figure shows the ROC analysis for anti-PDLl immunotherapy response data based on combined protein expression of PSMEl, PSME2, PSMB8, PSMB9 or PSMB10 in 24 melanoma metastases which were removed before therapy. AUC values was 0.985 (95% Cl, 0.938 to 1.032).

[0117] Figure 13: The prognostic power of combined protein expression of immunoproteasome members for progression free survival (PFS) of BRAF V600 mutated melanoma after immunotherapy. It discriminates the patient living <1 year or >1 year after therapy.

[0118] The figure shows the ROC analysis based on one-year progression free survival (PFS) data after immunotherapy considering the combined protein expression of all immunoproteasome members (PSMEl, PSME2; PSMB8, PSMB9 and PSMB10) in 24 melanoma distant metastases bearing BRAF V600 mutation, which were collected prior to the therapy. AUC value was 0.893 (95% Cl, 0.803 to 0.983).

[0119] Figure 14: Kaplan-Meier estimates of PFS (from immunotherapy treatment date to death or censoring) in melanoma patients. The two PFS groups were generated from the ROC analysis which discriminates between patients living <1 year or >1 year after therapy based on combined protein expression of all immunoproteasome members (PSMEl, PSME2; PSMB8, PSMB9 and PSMB10). The Immunoproteasome as biomarker for all tumors (with or without the BRAF V600 mutation):

[0120] Figure 15: The prognostic power of individual protein expression of immunoproteasome members. The figure shows the ROC analysis for 142 melanoma metastases based on protein expression of immunoproteasome members (PSME1, PSME2, PSMB8, PSMB9 and PSMB10) and patient two-year survival data.

[0121] AUC values were: 0.729 (95% Cl, 0.630 to 0.829, pvalue<0.0005), 0.721 (95% Cl, 0.622 to 0.819, pvalue<0.001), 0.673 (95% Cl, 0.566 to 0.779, pvalue=0.001), 0.633 (95% Cl, 0.526 to 0.741, pvalue=0.015), and 0.673 (95% Cl, 0.569 to 0.777, pvalue=0.001) for PSME1, PSME2, PSMB8, PSMB9 and PSMB10, respectively.

[0122] Figure 16: Kaplan-Meier estimates of survival in melanoma patients after metastasis excision. The two groups were generated from the ROC analysis based on protein expression of immunoproteasome members (PSME1, PSME2, PSMB8, PSMB9 and PSMB10) and patient two-year survival data.

[0123] Figure 17. The predictive power of individual immunoproteasome members and their combination for anti PDL-1 immunotherapy response in BRAF V600 mutated melanomas, by discriminating between responders and no responders to therapy.

[0124] The figure shows resultant ROC for anti-PDLl immunotherapy response data based on individual and the combined protein expression of all immunoproteasome members. The analyses were performed on 74 melanoma metastases which were collected prior to the therapy . AUC values were: 0.802 (95% Cl, 0.680 to 0.923, pvalue<0.0005), 0.644 (95% Cl, 0.497 to 0.791, pvalue=0.081), 0.623 (95% Cl, 0.470 to 0.776, pvalue=0.137), 0.691 (95% Cl, 0.545 to 0.837, pvalue=0.021), 0.764 (95% Cl, 0.632 to 0.896, pvalue=0.001), and 0.827 (95% Cl, 0.713 to 0.942 pvalue<0.0005) for PSME1, PSME2, PSMB8, PSMB9, PSMB10,and the combination of all members, respectively.

[0125] Figure 18. Violin plots comparison of PSME1 protein expression between responders and nonresponders to immunotherapy.

[0126] Figure 19. Violin plots comparison of PSME2 protein expression between responders and nonresponders to immunotherapy. Figure 20. Violin plots comparison of PSMB8 protein expression between responders and nonresponders to immunotherapy.

[0127] Figure 21. Violin plots comparison of PSMB9 protein expression between responders and nonresponders to immunotherapy.

[0128] Figure 22. Violin plots comparison of PSMB10 protein expression between responders and nonresponders to immunotherapy.

[0129] Figure 23. The combination of four members of the immunoproteasome i.e. PSME2, PSMB10, PSMB8 and PSMB9 and BRAF V600 expressions are predictors of the antitumor immune response and prognostic biomarker for BRAF V600 mutated melanomas. The figure shows the ROC for 20 melanoma metastases were AUC value was: 0.99 (95% Cl, 0.958 to 1, pvalue=0.0002)

[0130] Figure 24. The combination of three members of the immunoproteasome i.e. PSMB10, PSMB8 and PSMB9 and BRAF V600 expressions are predictors of the antitumor immune response and prognostic biomarker for BRAF V600 mutated melanomas. The figure shows the ROC for 20 melanoma metastases were AUC value was: 0.95 (95% Cl, 0.847 to 1, pvalue=0.0007)

[0131] Figure 25. The combination of three members of the immunoproteasome i.e. PSMB8 and PSMB9 and BRAF V600 expressions are predictors of the antitumor immune response and prognostic biomarker for BRAF V600 mutated melanomas. The figure shows the ROC for 20 melanoma metastases were AUC value was: 0.929 (95% Cl, 0.815 to 1, pvalue=0.0012)

[0132] The accompanying Figures and Examples are provided to explain rather than limit the present invention.

[0133] When describing the embodiments of the present invention, the combinations of all possible embodiments have not been explicitly described. Nevertheless, the mere fact that certain measures are recited in mutually different dependent claims or described in different embodiments does not indicate that a combination of these measures cannot be used to advantage. The present invention envisages all possible combinations and permutations of the described embodiments.

[0134] Unless specifically defined herein, all technical and scientific terms used have the same meaning as commonly understood by a skilled artisan in the field. All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein.

[0135] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail.

[0136] Further, the materials, methods, and examples are illustrative only and are not intended to be limiting, unless otherwise specified.

[0137] Examples

[0138] Example 1

[0139] Characteristics and results of the study

[0140] The data came from a proteomic study comprising extraction, detection and quantification of >10,000 proteins from melanoma metastases.

[0141] It is a naive-treated cohort where the natural progression of the melanoma were studied. The patients were never treated with immunotherapy or targeted therapy.

[0142] Prognostic biomarkers in patients that fought the disease even without therapy, just through natural antitumor immune response, were found.

[0143] These prognostic biomarkers were discovered while studying the BRAF V600 mutated metastases of the cohort and later they were extended to the whole cohort including the WT-BRAF metastases (WT = Wild type).

[0144] Innovative invention

[0145] The natural antitumor immune response (defined here by the biomarker expression) correlates to / resembles / matches the response to immunotherapy. Therefore the prognostic biomarkers for treatment-naive melanomas could be used as predictive biomarkers for therapy and as prognostic biomarkers after therapy.

[0146] Confirmation Biomarkers were tested in an independent cohort of metastasis (biopsies) that were taken before the treatment.

[0147] EXPERIMENTAL

[0148] METHOD DETAILS

[0149] Sample acquisition

[0150] Melanoma tissue specimens were snap-frozen, or alternatively put on dry ice, within 30 minutes of collection, most samples were frozen within 15 minutes upon surgery, with a small amount of isopentane in liquid nitrogen. Multiple pieces were collected from most of the tumor specimens. The samples were then stored at -80 °C in the Melanoma biobank, BioMEL, Region Skane, Sweden.

[0151] BRAF DNA sequencing

[0152] Two cell lines, SK-MEL-2 and SK-MEL-28 (ATCC®, Manassas, USA), were used as reference BRAF wild type and V600E respectively. Total RNA was extracted from the cell lines or frozen tissues from the malignant melanoma patients using RNeasy mini kit (Qiagen, Venlo, The Netherlands). The extracted RNA were reverse transcribed to cDNA by using Superscript III First Strand Synthesis System kit (ThermoFisher, Waltham, MA) according to the manufacturer's instructions. The cDNA was amplified with a set of primers that produced a PCR product including BRAF mutation at the position V600; 5'-(AGCCTTACAGAAATCTCCAGGACC)-3' and 5'-(TTGGGGAAAGAGTGGTCTCTCATC)- 3'. The PCR conditions were 95 °C for 5 min, followed by 36 cycles of 95 °C for 30 sec, 62 °C for 30 sec, and 72 °C for 2.5 min with a final incubation of 72 °C for 7 min. A portion of the PCR product was amplified a second time using the same condition as the first PCR, and the amplification was 24 cycles, instead of 36 cycles. The PCR products were run on a 1% agarose gel, and DNA was extracted from the gel using a QIAquick Gel Extraction kit (Qiagen) according to the manufacturer's instruction. The purified PCR products were sequenced using a primer 5'- (TTCCACAAAGCCACAACTGG)-3' by Eurofins Genomics (Ebersberg, Germany).

[0153] Histopathological analysis

[0154] Stepwise sectioning of the tissues was performed, and on average, three sections were evaluated for each tumor. Frozen tissue sections were placed on glass slides, stained with hematoxylin and eosin, and then placed in an automated slide scanner system (Zeiss Mirax). The tissue content was then evaluated in terms of tumor cells, necrosis, connective tissue, and adjacent background tissue, and features that could be further captured based on morphology were considered. For deeper evaluation, we assessed the properties of the tumor cells (primary pattern, size) and the infiltration of lymphocytes in the tumor mass (an immunoscore was given representing tumor-infiltrating lymphocytes both in the dimension of intensity and extent). All variables were scored on a scale of 0-3.

[0155] Sample preparation for mass spectrometry

[0156] Protein extraction was performed on sectioned (30 x 10 pm), fresh-frozen melanoma tissues using the Bioruptor plus, model UCD-300 (Dieagenode). In total, 142 melanoma samples were lysed in 100 pL lysis buffer containing 4 M urea and 100 mM ammonium bicarbonate. After a brief vortex, samples were sonicated in the Bioruptor for 40 cycles at 4°C. Each cycle consisted of 15 s at high power and 15 s without sonication. The samples were then centrifuged at 10,000 xg for 10 min at 4°C. The protein content in the supernatant was determined using a colorimetric micro-BCA Protein Assay kit (Thermo Fisher Scientific).

[0157] Urea in-solution protein digestion was performed on the AssayMAP Bravo (Agilent Technologies) micro-chromatography platform using the digestion v2.0 protocol. Protein concentrations were adjusted to 2.5 pg / pL and 100 pg of protein from each sample were reduced with 10 mM DTT for 1 h at room temperature (RT) and sequentially alkylated with 20 mM iodoacetamide for 30 min in the dark at RT. To decrease the urea concentration, the samples were diluted approximately seven times with 100 mM ammonium bicarbonate. Digestion was performed in two steps at RT. Proteins were first incubated with Lys-C at a 1:50 (w / w) ratio (enzyme / protein) for 5 h, and then trypsin was added at a 1:50 (w / w) ratio (enzyme / protein) and the mixture was incubated overnight. The reaction was quenched by adding 20% TFA to a final concentration of ~1%. Peptides were desalted on the AssayMAP Bravo platform using the peptide cleanup v2.0 protocol. C18 cartridges (Agilent, 5 pL bed volume) were primed with 100 pL 90% acetonitrile (ACN) and equilibrated with 70 pL 0.1% TFA at a flow rate of 10 pL / min. The samples were loaded at 5 pL / min, followed by an internal cartridge wash with 0.1% TFA at a flow rate of 10 pL / min. Peptides were eluted with 30 pL 80% ACN, 0.1% TFA, and dried in a Speed-Vac (Eppendorf) prior to TMT labeling.

[0158] TMT 11 plex labeling The peptide amount in each sample was estimated using a quantitative colorimetric peptide assay kit (Thermo Fisher Scientific). Within each batch, equal amounts of peptides were labelled with TMT11 plex reagents, using a ratio of 0.8 mg reagent to 100 pg peptides. The TMT labeling was performed according to the manufacturer's instructions. Peptides were resuspended in 100 pL of 200 mM TEAB and individual TMT11 plex reagents were dissolved in 41 pL of anhydrous ACN and mixed with the peptide solution. The internal reference sample, a pool consisting of aliquots from protein lysates from 40 melanoma patient samples, was labeled in channel 126 in each batch. After one hour of incubation, the reaction was quenched by adding 8 pL of 5% hydroxylamine and incubated at room temperature for 15 minutes. The labeled peptides were mixed in a single tube, the volume was reduced in a Speed-Vac and then the peptides were cleaned up using a Sep-Pak C18 96-well Plate (Waters). The eluted peptides were dried in a Speed-Vac and finally resuspended in water prior to high pH RP-HPLC fractionation. The samples were distributed among 15 batches, using TMT tag 126 as the internal reference sample as described in Table SIC.

[0159] High pH RP-HPLC fractionation

[0160] The TMT11 batches were fractionated using an Aeris Widepore XB-C8 (3.6 pm, 2.1 x 100 mm) column (Phenomenex) on an 1100 Series HPLC (Agilent) operating at 80 pL / min. The mobile phases were solvent A: 20 mM ammonium formate pH 10, and solvent B: 80% ACN and 20% water containing 20 mM ammonium formate pH 10. An estimated amount of 200 pg was separated using the following gradient: 0 min 5% B; 1 min 20% B; 60 min 40% B; 90 min 90% B; 120 min 90% B. The column was operated at RT and the detection wavelength was 220 nm. Then, 96 fractions were collected at 1 min intervals and further concatenated to 24 or 25 fractions (by combining 4 fractions that were 24 fractions apart so that #1, #25, #49, and #73; and so forth, were concatenated), and dried in a Speed-Vac.

[0161] Mass spectrometry data acquisition by nLC-MS / MS analysis

[0162] The nLC-MS / MS analysis was performed on an Ultimate 3000 HPLC coupled to a Q Exactive HF-X mass spectrometer (Thermo Scientific). Each fraction (1 pg) was loaded onto a trap column (Acclaiml PepMap 100 pre-column, 75 pm, 2 cm, C18, 3 mm, 100 A, Thermo Scientific) and then separated on an analytical column (EASY-Spray column, 25 cm, 75 pm i.d., PepMap RSLC C18, 2 mm, 100A, Thermo Scientific) using solvent A: 0.1% formic acid in water and solvent B: 0.1% formic acid in ACN, at a flow rate of 300 nL / min and a column temperature of 45°C. An estimated peptide amount of 1 pg was injected into the column and the following gradient was used: 0 min 4% B; 3 min 4% B; 109 min 30% B; 124 min 45% B; 125 min 98% B; 130 min 98% B. The TMT node was utilized as follows: full MS scans at m / z 350-1,400 with a resolution of 120,000 at m / z 200, a target AGC value of 3x106 and IT of 50 ms, DDA selection of the 20 most intense ions for fragmentation in HCD collision cell with an NCE of 34 and MS / MS spectra acquisition in the Orbitrap analyzer at a resolution of 45,000 (at m / z 200) with a maximum IT of 86 ms, fixed first mass of 110 m / z, isolation window of 0.7 Da and dynamic exclusion of 30 s.

[0163] QUANTIFICATION AND STATISTICAL ANALYSIS

[0164] TMT 11 plex identification and quantification of protein data

[0165] The raw files that were processed with Proteome Discoverer 2.3 (Thermo Fisher Scientific) using the Sequest HT search engine. The search was performed against the Homo sapiens UniProt revised database (downloaded 2018-10-01) with isoforms. Cysteine carbamidomethylation (+57.0215 Da) and TMT6 plex (+229.1629 Da) at peptide N-terminus and lysine were set as fixed modifications while methionine oxidation (+15.9949 Da), N-terminal acetylation (+42.0105 Da) and were set as variable modifications; peptide mass tolerance for the precursor ions and MS / MS spectra were 10 ppm and 0.02 Da, respectively. A maximum of two missed cleavage sites was accepted and a maximum false discovery rate (FDR) of 1% was used for identification at peptide and protein levels. The Proteome Discoverer software allowed the introduction of reporter ion interferences for each batch of TMT11 plex reagents as isotope correction factors in the quantification method. The peptides that could be uniquely mapped to a protein were used for relative protein abundance calculations.

[0166] These search results were imported into the Perseus software v. 1.6.6.0 124. Protein intensities were Iog2 transformed and centered around zero by subtracting the median intensity in each sample. To allow for the comparison of relative protein abundances between the different batches of TMT11 plex the protein intensities from the pooled references sample (in channel 126 in each batch) were subtracted from each channel in the corresponding batch to obtain the final relative protein abundance values.

[0167] Independent t-test, ROC curve, Kaplan-Meier survival analysis, and figures including box plots showing p-values, quartile values, mean values, and 95% confidence intervals were produced by GraphPad IBM SPSS statistics package (version 26.0). P < 0.05 was considered statistically significant.

[0168] References

[0169] 1) Proietti I, Skroza N, Bernardini N, Tolino E, Balduzzi V, Marchesiello A, Michelini S, Volpe S, Mambrin A, Mangino G, Romeo G, Maddalena P, Rees C, Potenza C. Mechanisms of Acquired BRAF Inhibitor Resistance in Melanoma: A Systematic Review. Cancers (Basel). 2020 Sep 29;12(10):2801. doi: 10.3390 / cancersl2102801. PMID: 33003483; PMCID: PMC7600801.

[0170] 2) Michael B. Atkins et al., Combination Dabrafenib and Trametinib Versus Combination Nivolumab and Ipilimumab for Patients With Advanced BRAF-Mutant Melanoma: The DREAMseq Trial — ECOG-ACRIN EA6134. JCO 41, 186-197(2023). DOI:10.1200 / JC0.22.01763.

[0171] 3) Paolo A. Ascierto et al., Sequencing of Ipilimumab Plus Nivolumab and Encorafenib Plus Binimetinib for Untreated BRAF-Mutated Metastatic Melanoma (SECOMBIT): A Randomized, Three-Arm, Open-Label Phase II Trial. JCO 41, 212-221(2023). DOI:10.1200 / JCO.21.02961.

[0172] 4) Kalaora, S., Lee, J.S., Barnea, E. et al. Immunoproteasome expression is associated with better prognosis and response to checkpoint therapies in melanoma. Nat Commun 11, 896 (2020). https: / / doi.org / 10.1038 / s41467-020-14639-9.

[0173] 5) Betancourt et al (Sci Rep. 2019 Mar 26;9(1):5154.) J Cancer. 2019;10(10):2205-2219.

[0174] 6) Wang Q, Pan F, Li S, Huang R, Wang X, Wang S, Liao X, Li D, Zhang L. The prognostic value of the proteasome activator subunit gene family in skin cutaneous melanoma. J Cancer 2019;

[0175] 10(10):2205-2219. doi:10.7150 / jca.30612. https: / / www.icancer.org / yl0p2205.htm.

[0176] 7) Harel M, Ortenberg R, Varanasi SK, Mangalhara KC, Mardamshina M, Markovits E, Baruch EN, Trippie V, Arama-Chayoth M, Greenberg E, Shenoy A, Ayasun R, Knafo N, Xu S, Anafi L, Yanovich- Arad G, Barnabas GD, Ashkenazi S, Besser MJ, Schachter J, Bosenberg M, Shadel GS, Barshack I, Kaech SM, Markel G, Geiger T. Proteomics of Melanoma Response to Immunotherapy Reveals Mitochondrial Dependence. Cell. 2019 Sep 19;179(l):236-250.el8. doi: 0.1016 / j. cell.2019.08.012.

[0177] Epub 2019 Sep 5. PMID: 31495571; PMCID: PMC7993352.

Claims

Claims1. A method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of:(i) evaluation of the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of at least one BRAF V600 mutated protein and at least one immunoproteasome protein is detected in said biological sample, and wherein in case the genetic alteration in the BRAF gene is not present, the presence and / or quantity of at least one immunoproteasome protein is detected in said biological sample.

2. A method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of:(i) detecting the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of BRAF V600 mutated protein is detected in said biological sample.

3. A method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of: a. providing a biological sample obtained from said subject, b. detecting the presence and / or quantity of at least two biomarkers in said biological sample, wherein said biomarkers are at least one BRAF V600 mutated protein and at least one immunoproteasome protein, and c. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker.

4. A method for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of: a. providing a biological sample obtained from said subject, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and c. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker.

5. The method according to any of the previous claims, wherein said method comprises the steps of: a. providing a biological sample obtained from said subject, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is BRAF V600 mutated protein, and c. classifying the subject as having a high likelihood of responding to targeted therapy if said biomarker is higher or equal to a reference value, and classifying the subject as having a high likelihood of responding to immunotherapy if said biomarker is lower compared to a reference value.

6. The method according to any of the previous claims, wherein said method comprises the steps of: a. providing a biological sample obtained from said subject, b. detecting the presence and / or quantity of at least one biomarker in said biological sample, wherein said biomarker is at least one immunoproteasome protein, and c. classifying the subject as having a high likelihood of responding to immunotherapy if said biomarker is higher or equal to a reference value, and classifying the subject as having a low likelihood of responding to immunotherapy if said biomarker is lower compared to a reference value.

7. The method according to any of the previous claims, wherein said method comprises a step of:(i) detecting the presence or absence of a genetic alteration in the BRAF gene, preferably, wherein said step (i) is preformed before step a.

8. The method according to any of the previous claims, wherein said method is for determining the efficacy of a drug treatment for a subject suffering from malignant melanoma, wherein said method comprises the steps of:(i) evaluation of the presence or absence of a genetic alteration in a BRAF gene, a. detecting the presence and / or quantity of at least one biomarker in a biological sample obtained from said subject, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein, and b. classifying the subject as having a high or low likelihood of responding to a drug treatment, based on the presence and / or quantity of said at least one biomarker, wherein in case the genetic alteration in the BRAF gene is present, the presence and / or quantity of at least one BRAF V600 mutated protein and at least one immunoproteasome protein is detected in said biological sample, and wherein in case the genetic alteration in the BRAF gene is not present, the presence and / or quantity of at least one immunoproteasome protein is detected in said biological sample, and wherein if said BRAF V600 mutated protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with targeted therapy compared to a subject having lower BRAF V600 mutated protein expression, and wherein if said BRAF V600 mutated protein expression is lower compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having a higher BRAF V600 mutated protein expression, and wherein if said at least one immunoproteasome protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, said immunoproteasome protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having lower immunoproteasome protein expression.

9. The method according to any of the previous claims, wherein the presence and / or quantity of at least two, at least three, at least four, at least five, at least six or preferably wherein at least seven biomarkers is detected, and / or combinations of these biomarkers is detected.

10. The method according to any of the previous claims, wherein the step of detecting the presence and / or quantity of said biomarker comprises use of Trypsin enzyme, and / or any other protease or chemical reagent able to hydrolyze peptide bonds.

11. The method according to any of the previous claims, wherein the step of detecting the presence and / or quantity of said biomarker does not comprise use of protease.

12. The method according to any of the previous claims, wherein the step of detecting the presence and / or quantity of said biomarker is a measurement of intact protein, intact proteoform or a derived proteoform.

13. The method according to any of the previous claims, wherein the method does not comprise measurement of WT BRAF protein.

14. The method according to any of the previous claims, wherein one or more biomarkers are assigned specific weight relative to each other.

15. The method according to any of the previous claims, wherein said biological sample is a biological sample obtained from said subject.

16. The method according to any of the previous claims, wherein said biological sample is selected among a tumor sample, a fluid sample, a blood sample, a plasma sample, a serum sample and a urine sample.

17. The method according to any of the previous claims, wherein said genetic alteration is a BRAF V600 gene mutation.

18. The method according to any of the previous claims, wherein in case the genetic alteration is present, the presence and / or quantity of BRAF V600 mutated protein is detected in said biological sample.

19. The method according to any of the previous claims, wherein said BRAF V600 mutated protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, and wherein said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with targeted therapy compared to a subject having lower BRAF V600 mutated protein expression.

20. The method according to any of the previous claims, wherein said BRAF V600 mutated protein expression is lower compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, and wherein said BRAF V600 mutated protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having a higher BRAF V600 mutated protein expression.

21. The method according to any of the previous claims, wherein said reference value is determined from a multitude of samples from subjects with BRAF V600 mutation.

22. The method according to any of the previous claims, wherein said genetic alteration in the BRAF gene is not present.

23. The method according to any of the previous claims, wherein said biological sample comprises a wild-type BRAF gene.

24. The method according to any of the previous claims, wherein the presence and / or quantity of at least one immunoproteasome protein, or a combination thereof is detected in said biological sample.

25. The method according to any of the previous claims, wherein said at least one immunoproteasome protein expression is higher compared to a reference value and / or compared to a subject that does not respond to a specific drug therapy, and wherein said immunoproteasome protein expression is indicative of increased efficacy to the treatment with immunotherapy compared to a subject having lower immunoproteasome protein expression.

26. The method according to any of the previous claims, wherein said method is performed before administration of a drug therapy to said subject and / or before treatment for malignant melanoma is initiated.

27. The method according to any of the previous claims, wherein said method is performed after said subject has received at least one type of drug therapy.

28. The method according to any of the previous claims, wherein said method is performed both before a drug treatment for malignant melanoma is administered, and performed after a drug therapy for malignant melanoma is administered to said subject.

29. The method according to any of the previous claims, wherein said method is performed before and after said subject has received at least one type of drug therapy, and wherein a change in the BRAF V600 mutated protein expression and / or a change in the immunoproteasome protein expression is indicative for an increased efficacy to treatment with immunotherapy.

30. The method according to any of the previous claims, wherein said steps are performed in said order.

31. The method according to any of the previous claims, wherein said analysis of the expression of the BRAF V600 mutated protein is a quantitative analysis.

32. The method according to any of the previous claims, wherein said immunoproteasome protein is at least one, at least two, at least three, at least 4 or all of the biomarkers PSMEl (SEQ ID No. 1), PSME2 (SEQ ID No. 2), PSMB8 (SEQ ID No. 3), PSMB9 (SEQ ID No. 4) and / or PSMB10 (SEQ ID No. 5).

33. The method according to any of the previous claims, wherein said BRAF V600 mutated protein is selected among BRAF V600E (SEQ ID No. 6), V600D (SEQ ID No. 9), V600R (SEQ ID No. 8), and / or V600K (SEQ ID No. 7).

34. The method according to any of the previous claims, wherein said measuring of the expression of the BRAF V600 mutated protein comprise the analysis of a polypeptide fragment / protein region comprising the mutation.

35. The method according to any of the previous claims, wherein said biological sample is a sample from a primary tumor.

36. The method according to any of the previous claims, wherein said biological sample is a metastatic tumor sample.

37. The method according to any of the previous claims, wherein said drug therapy is targeted therapy and / or immunotherapy.

38. The method according to any of the previous claims, wherein said targeted therapy is a kinase inhibitor, such as Vemurafenib, Dabrafenib or Sorafenib or a combination thereof.

39. The method according to any of the previous claims, wherein said immunotherapy is an immune checkpoint inhibitor.

40. The method according to any of the previous claims, wherein said method comprises a step of administering said drug therapy to said subject.

41. A method for performing a diagnosis of a BRAF gene mutation in the position corresponding to amino acid position 600 in wild-type BRAF protein, wherein said method comprises the steps of a. Providing a biological sample, b. Quantitative analysis of the expression of BRAF V600 mutated protein in said biological sample, and c. Providing a diagnosis of based said quantitative analysis.

42. A method of prognostication of the response to a drug therapy comprising the method according to any of the previous claims.

43. A method of prognostication of survival of a subject comprising the method according to any of the previous claims.

44. A kit for predicting the response to a drug treatment for malignant melanoma, comprisinga. a reagent suitable for detecting the presence and / or quantity of at least one biomarker in a biological sample, wherein said biomarker is BRAF V600 mutated protein and / or at least one immunoproteasome protein.

45. An in vitro diagnostic kit configured to perform the method according to any of the previous claims.

46. An assay for performing the method according to any of the previous claims.

47. The method according to any of the previous claims, wherein said method is an in vitro method.

48. A method of treatment of malignant melanoma, wherein said treatment comprises use of the method, the kit or the assay according to any of the previous claims.

49. The method of treatment according to any of the previous claims, wherein said method comprises targeted therapy, wherein said therapy comprises use of a kinase inhibitor, such as Vemurafenib, Dabrafenib or Sorafenib or a combination thereof.

50. The method of treatment according to any of the previous claims, wherein said method comprises immunotherapy, wherein said immunotherapy comprises an immune checkpoint inhibitor.

51. The method of treatment according to any of the previous claims, wherein a subject's response to a given drug treatment is monitored pre- and post-treatment, using the method according to any of the previous claims.

52. The method of treatment according to any of the previous claims, wherein a posttreatment change in the BRAF V600 mutated protein expression and / or a change in the immunoproteasome protein expression is indicative for an increased efficacy to a given drug treatment, preferably wherein said drug treatment is immunotherapy.

Citation Information

Patent Citations

  • Methods of detecting BRAF in cancer

    WO2016069928A1

  • A method to determine BRAF mutations and wild type BRAF protein by mass spectrometry

    WO2018114953A1

  • Methods for enhancing cancer immunotherapy

    US20210386828A1