Identification of transcriptional hotspots in CHO cells
By integrating exogenous nucleotides into the chromosomal locus of contig NW_023276805.1 in CHO cells, the method enhances transcriptional activity and achieves superior protein expression, overcoming the productivity limitations of current SSI systems.
Patent Information
- Application Number
- PCT/SG2025/050254
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-12
- Filing Date
- 2025-04-11
- Publication Date
- 2025-10-16
AI Technical Summary
The biopharmaceutical industry faces challenges in achieving high and stable production of therapeutic proteins in CHO cells due to the lack of identified transcriptional hotspots for site-specific integration (SSI), leading to low transgene copy numbers and inefficient productivity in existing SSI cell lines.
Identifying and utilizing the chromosomal locus within contig NW_023276805.1 of chromosome X in CHO cells for site-specific integration of exogenous nucleotide sequences, enhancing transcriptional activity and promoting higher expression of proteins of interest.
This approach results in improved antibody production levels comparable to or exceeding those achieved by random integration, with potential titers of up to 8 g/L for monoclonal antibodies and 15 g/L in bioreactor culture, thereby addressing the limitations of existing SSI systems.
Smart Images

Figure IMGF000025_0001 
Figure IMGF000026_0001 
Figure IMGF000027_0001
Abstract
Description
IDENTIFICATION OF TRANSCRIPTIONAL HOTSPOTS IN CHO CELLSFIELD OF THE INVENTION
[0001] The present invention relates to a chromosomal locus that can be used to generate stable and high-producing host Chinese Hamster Overy (CHO) cells for site-specific integration of polynucleotide sequences of interest.BACKGROUND
[0002] Chinese Hamster Ovary (CHO) cells are the mainstay of the biopharmaceutical industry as a means of producing therapeutic proteins, such as monoclonal antibodies. Commercial CHO cell line construction typically uses a resource-intensive strategy based on random transgene integration (RI) to create high-producing host cell lines for biotherapeutics manufacturing. Site-specific integration (SSI) based on recombinase mediated cassette exchange (RMCE) offers a more efficient strategy with less clone screening. RMCE requires a host CHO cell line with pre-inserted DNA landing pad(s) at defined transcriptional hotspot(s) for transgene expression.
[0003] The FerlL4 locus is an example of a transcriptional hotspot capable of supporting industry-relevant antibody productivity in CHO cells with a single SSI site. The FerlL4 locus was identified using the CHO KI SV cell line as a strong hotspot and was used to create an SSI CHO cell line. Antibody transfectant pools generated using this cell line demonstrated an antibody production titre of ~1 g / L in shake-flask fed batch culture. Further improvements were made to develop a newer generation of SSI CHO cell line by engineering the insertion of a landing pad specifically into the FerlL4 locus using a new CHOK1SV GS-KO host cell line. Antibody -producing SSI CHO host clones that were so derived were subsequently shown to have monoclonal antibody (mAb) titres comparable to CHO cell lines developed by random integration (1.0 - 4.5 g / L) and had robust expression stability. There also exists a two-plasmid SSI system that allows multiple copies of proteins of interest to be introduced into a single SSI locus of a host cell by RMCE. Standard antibodies expressed using two-plasmid SSI RMCE process showed comparable or better productivity than their historical RI cell line average of ~ 3 g / L It is claimed to be capable of achieving a product titre of 8 g / L for bispecific antibody molecules and up to ~ 15 g / L in bioreactor culture for standard antibody molecules. Other SSI systems utilizing RMCE at multiple sites (multi-site SSI) to increase productivity with higher transgene copy number have also been reported, but the resultant mAb productivity remained low at milligram levels or similar to single site SSI in the case of a dual site SSI system. Theseresults suggest the importance of having a strong hotspot for DNA landing pads in SSI cell lines
[0004] Although SSI is more efficient than RI for the creation of high-producing CHO cell lines for biotherapeutics manufacturing, SSI has not been widely adopted in the industry due to the problems of limited knowledge of genuine hotspots and low productivity in SSI CHO host lines due to low transgene copy number in a ‘not-hot-enough’ SSI cell line. Many attempts have been carried out to identify hotspots for SSI in CHO cells, but to date only one SSI site, i.e. the FerlL4 locus, has been validated as a hotspot capable of supporting industry-relevant antibody productivity. Thus, there is a need for the identification of new hotspots for SSI in CHO cells that allow for improved production of proteins of interest, such as antibodies and other therapeutic proteins.SUMMARY
[0005] In one aspect, provided herein is a Chinese Hamster Ovary (CHO) cell comprising one or more exogenous nucleotide sequences, wherein the one or more exogenous nucleotide sequences is inserted into a chromosomal locus of the CHO cell, wherein the chromosomal locus is located within contig NW 023276805. 1 of chromosome X.
[0006] In another aspect, provided herein is a method of producing a Chinese Hamster Ovary (CHO) cell capable of expressing a sequence of interest, comprising inserting an exogenous nucleotide sequence encoding the sequence of interest into a chromosomal locus of the CHO cell, wherein the chromosomal locus is located within contig NW_023276805.1 of chromosome X to produce the CHO cell capable of expressing the sequence of interest.
[0007] In another aspect, provided herein is a method of expressing a sequence of interest comprising culturing the CHO cell described herein under conditions suitable for expressing the sequence of interest, wherein one or more target proteins of interest encoded by the sequence of interest is recovered from the CHO cell culture.
[0008] In another aspect, provided herein is a kit comprising a CHO cell described herein.DEFINITIONS
[0009] The following are some definitions that may be helpful in understanding the description of the present invention. These are intended as general definitions and should in no way limit the scope of the present invention to those terms alone but are put forth for a better understanding of the following description.
[0010] As used herein, the term “inserted” refers to the insertion of one or more nucleotides between two adjacent nucleotides. The term “inserted” as used herein may also refer to the insertion of one or more nucleotides between two non-adjacent nucleotides which would result in the deletion of nucleotides between the two non-adjacent nucleotides.
[0011] As used herein, the term “integrate” refers to the stable incorporation of a nucleic acid sequence into the chromosome of a host cell (for example, a mammalian cell), i.e., a nucleic acid sequence that is chromosomally integrated into the genomic DNA (gDNA) of a host cell. In some examples, a nucleic acid sequence that is integrated into the chromosome is stable. In some examples, a nucleic acid sequence that is chromosomally - integrated is not found on a plasmid or a vector. In some examples, an integrated nucleic acid sequence is not excised. In some examples, chromosomal integration is mediated by CRTSPR-Cas9 system or TALENs or ZFNs.
[0012] As used herein, the term “chromosomal locus” refers to a defined location or position on a chromosome. The term “genomic locus” refers to a defined location or position in the genome. A chromosomal locus or genomic locus may comprise one or more genes, genetic markers and / or non-coding sequences. The terms “chromosomal locus” and “genomic locus” may be used interchangeably.
[0013] As used herein, the term “contig” or “sequence contig” refers to a sequence that provides a contiguous representation of a genomic region, or a set of sequences that overlap in a way that provides a contiguous representation of a genomic region. A sequence contig provides the actual DNA sequence of a genomic region or of a chromosomal region. A genomic region may comprise a chromosomal region. The terms “contig” and “sequence contig” may be used interchangeably.
[0014] As used herein, the term “exogenous” refers to a nucleotide sequence that does not originate from a host cell and is introduced into a host cell via traditional delivery methods for delivering nucleic acids into a host cell, such as transformation, transfection, electroporation, lipid-based delivery, cationic polymers, and the like. An exogenous sequence may be a coding or a non-coding nucleotide sequence. It would be understood that a coding nucleotide sequence is a nucleotide sequence that encodes one or more amino acids and a non-coding nucleotide sequence do not encode amino acids. Non-coding nucleotide sequences may be functional in nature, regulating and modulating transcription and translation. Examples of such non-coding nucleotide sequences include promoters, enhancers, linker sequences and ribosomal binding sequences. Non-coding nucleotide sequences may also be non-functional. The term “endogenous” refers to a nucleotide sequence that originates from a host cell. An exogenousnucleotide sequence may have an endogenous counterpart that is identical in nucleotide composition, but where the exogenous sequence is a recombinant DNA and is introduced into the host cell. Unless otherwise specified, the term “exogenous sequence” as used herein refers to an exogenous nucleotide sequence, and the terms are used interchangeably
[0015] Unless the context requires otherwise or specifically stated to the contrary, integers, steps, or elements of the invention recited herein as singular integers, steps or elements clearly encompass both singular and plural forms of the recited integers, steps or elements.
[0016] Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers, but not the exclusion of any other step or element or integer or group of elements or integers. Thus, in the context of this specification, the term “comprising” means “including principally, but not necessarily solely”.
[0017] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0019] FIG. 1 shows flow cytometry analysis data of CHO cells after chromosomal insertion of the landing pad for successful recombinase-mediated cassette exchange (RMCE). FIG. 1A shows data from GFP-expressing landing pad (LP) cell lines LP035 and LP041 that were tested for RMCE using a mCherry-containing target vector. After negative selection with Ganciclovir, LP cell populations showed a high proportion of mCherry positive cells and negligible GFP & mCherry double positive cells FIG. IB shows results from digital droplet PCR (ddPCR) analysis to quantify the copy number of the sequence encoding for GFP in LP035 and LP041.
[0020] FIG. 2 shows flow cytometry data of selected LP cell lines after RMCE using a target vector encoding for an antibody. In this example, LP041 was selected for site-specific integration (SSI) using RMCE with a target vector encoding for trastuzumab. SSI poolsrecovered after positive selection with Hygromycin and negative selection with Ganciclovir were found to be ~ 100% GFP negative, indicating successful RMCE i.e., cells were no longer expressing EGFP because the expression cassette encoding EGFP (i.e., bound by the FRT and FRT5 RRS) had been excised and the target vector encoding trastuzumab was inserted at the target site.
[0021] FIG. 3 shows exemplary antibody productivity data of SSI antibody CHO cell pools, in duplicate. Two LP041 trastuzumab-producing pools were cultured using shake flask fed- batch culture and antibody production was measured. Cells were inoculated at a density of 0.3 x 106cells / ml in growth media comprising a 50:50 mix of CD CHO (Invitrogen) culture media and HyClone PF-CHO culture media. Cells were fed using EX-CELL® Advanced CHO Feed 1 at 7.5 % (v / v) on day 3 and 5, and at 10% (v / v) on day 7, 9, and 11. The cultures were harvested on day 15 and antibody productivity determined using IMMAGE 800® nephelometry (Table 1).
[0022] FIG. 4 shows the analysis of the insertion site in the LP041 cell line by Targeted Locus Amplification (TLA) technology (Ccrgcntis). FIG. 4A shows the identification of the integration site of the landing pad (encircled), i.e., the location where the landing pad was inserted into the CHO cell genome. FIG. 4B shows the identified breakpoint sequences on chromosome X marking the site of vector integration into chromosome X. The nucleotides underscored by a dashed line represent the native genomic sequence from the CHO cell chromosome X (i.e., from contig NW_023276805.1) and the nucleotides underscored by a solid line represent the inserted exogenous nucleotide sequence (i.e., the landing pad vector). The “GA” sequence immediately following the underlined sequence in the 3’ integration site also belongs to the vector. FIG. 4C is a schematic representation of the vector integration site on chromosome X in the LP041 cell line. This site is named herein as “Site X”.
[0023] FIG. 5 is a schematic drawing of CRTSPR-mediated homology-directed repair for sitespecific knock-in of the landing pad cassette at Site X. Junction PCR is used to screen for on- target insertion of the landing pad. The primer binding sites for junction PCT are indicated with left- and right-facing arrows in the vicinity of the left and right homology arms.
[0024] FIG. 6 is a contig map of Chinese hamster chromosome X covering the hotspot region (i.e., covering Site X).DETAILED DESCRIPTION OF THE INVENTION
[0025] One or more exogenous sequences may be inserted into the chromosomes of a CHO cell to enable expression of the exogenous sequence or other exogeneous sequences in the CHOcell. Exogenous sequences may be inserted at a random site in the chromosome (i.e., random integration, “RI”) or it may be inserted at a specific site in the chromosome (i.e , site-specific integration, “SSI”). The expression level of a coding exogenous sequence by said CHO cell depends in part on the location in the chromosome at which it is inserted. If a coding exogenous sequence is inserted at a location in the chromosome that is transcriptionally active (i.e., a “transcriptionally active site”), it will be expressed. However, if a coding exogenous sequence is inserted at a location in the chromosome that is transcriptionally silent or repressed, it may not be expressed or be expressed at undesirably low levels. Furthermore, transcriptionally active sites may differ in levels of transcriptional activity. Insertion of a coding exogenous sequence at a transcriptionally active site with high activity may result in significantly higher expression of the exogenous sequence relative to insertion at a transcriptionally active site with lower activity. Accordingly, the term “transcriptional hotspot” (or “hotspot” for short) may be used to refer to a transcriptionally active site that has higher activity relative to other transcriptionally active sites in a CHO cell. Thus, it is an object of the present invention to provide Chinese Hamster Ovary (CHO) cells capable of improved expression of a coding exogenous nucleotide sequence as a result of insertion of the exogenous nucleotide sequence, into a transcriptional hotspot.
[0026] In one aspect, provided herein is a Chinese Hamster Ovary (CHO) cell comprising one or more exogenous nucleotide sequences, wherein the one or more exogenous nucleotide sequences is inserted into a chromosomal locus of the CHO cell, wherein the chromosomal locus is located within contig NW 023276805. 1 of chromosome X.
[0027] A chromosomal locus may be identified as a specific nucleotide or a specific range of nucleotides in a contig of a chromosome in the CHO cell. A person skilled in the art may obtain the sequence of a contig by searching a repository of genomic sequences, such the U.S. National Institutes of Health (NTH) GenBank® database. Contigs in a database are typically referred to by an accession number. Accordingly, a contig sequence may be obtained from a database by searching the database using the accession number for said contig. Unless otherwise specified, the accession number for any contig described herein refers to the NIH GenBank® accession number.
[0028] In one example, the chromosomal locus is within or partially within nucleic acid position number 58, 124,084 to 58,124,098 of contig NW 023276805. 1 or located at nucleic acid position number 58,124,084 to 58,124,098 inclusive, of contig NW_023276805.1, or is located immediately adjacent to the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
[0029] In the context of the present invention, an exogenous sequence may be inserted into a chromosomal locus that is within nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1. This would be understood to mean that both 5’ and 3’ ends of the inserted exogenous sequence are located anywhere from nucleic acid position number 58,124,085 to nucleic position number 58,124,098 of contig NW_023276805.1.
[0030] In the context of the present invention, an exogenous sequence may also be inserted into a chromosomal locus that is partially within nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1. This would be understood to mean that either one of the 5’ or 3’ ends of the inserted exogenous sequence is located anywhere from nucleic acid position number 58,124,085 to nucleic position number 58,124,098 of contig NW_023276805.1, and the corresponding 3’ or 5’ end of the inserted exogenous sequence is located either 3’ from (i.e., downstream from) the 3’ end of or 5’ from (i.e., upstream from) the 5’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1, respectively.
[0031] In the context of the present invention, an exogenous sequence may also be inserted into a chromosomal locus that is inclusive of nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1. This would be understood to mean that the 5’ end of the inserted exogenous sequence is located immediately 3’ from nucleic acid position number 58,124,084 of contig NW_023276805. 1 and the 3’ end of the inserted exogenous sequence is located immediately 5’ from nucleic acid position number 58,124,098 of contig NW_023276805.1 (i.e., the 13 nucleotides from nucleic acid position number 58,124,085 to 58,124,097 of the native CHO cell chromosome X are deleted after insertion of the exogenous sequence. The exogenous sequence does not need to be of the same length as the deleted sequence.). Alternatively, the chromosomal locus can also be described as being located within nucleic acid position number 58,124,083 to 58,124,099 of contig NW_023276805.1 .
[0032] In the context of the present invention, an exogenous sequence may be inserted into a chromosomal locus that is immediately adjacent to the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1. This would be understood to mean either that (i) the 3’ end of the inserted exogenous sequence is immediately before (i.e., immediately 5’ from) the 5’ end of nucleic position number 58,124,084 of contig NW 023276805.1, or (ii) the 5’ end of the inserted exogenous sequence is immediately after (i.e., immediately 3’ from) the 3’ end of nucleic position number 58,124,098 of contig NW_023276805.1.
[0033] In some examples, one or more nucleotides are deleted from the native CHO cell genome after insertion of the exogenous nucleotide sequence (e g., as depicted in FIGs 1C or ID). In other examples, no nucleotides are deleted from the native CHO cell genome after insertion of the exogenous nucleotide sequence (e g., as depicted in FIGs. IB, IE, or 1G).
[0034] The exogenous nucleotide sequence may also be inserted at a chromosomal locus distal from nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1. For example, the chromosomal locus may be located within about 1-100, 100-200, 200-300, 300- 400, 400-500, 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000- 7000, 7000-8000, 8000-9000, 9000-10000, 10000-20000, 20000-30000, 30000-40000, 40000- 50000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
[0035] In one example, the chromosomal locus is within about lOOObp to about 10,000bp or within about 10,000 bp to about 50,000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
[0036] In another example, the chromosomal locus is within about 100 bp, about 250 bp, about 500 bp, or about 1000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1.
[0037] In another example, the chromosomal locus is within or partially within nucleic acid position number 58,122,950 to 58,125,250 of contig NW_023276805.1. Nucleic acid position number 58,122,950 to 58,125,250 of contig NW_023276805.1 is set forth in SEQ ID NO: 1.
[0038] The one or more exogenous nucleotide sequences may also be inserted into more than one chromosomal locus described herein. For example, one or more exogenous sequences are inserted into more than one chromosomal locus within, partially within, immediately adjacent to the 5’ end, immediately adjacent to the 3’ end, or distal to of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1 , or any combinations thereof. In some examples, the chromosomal locus distal to nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1 is within about 100 bp, within about 250 bp, within about 500 bp, within about 1000 bp, within about lOOObp to about 10,000bp or within about 10,000 bp to about 50,000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1. In other examples, one or more exogenous sequences are inserted into more than one chromosomal locus within, or partially within nucleic acid position number 58,122,950 to 58,125,250 of contig NW_023276805.1 .
[0039] Exogenous nucleotide sequences may also be inserted into a locus that is located within or partially within a region of a CHO cell chromosome X that is identical or homologous tonucleic acid position number 58,122,950 to 58,125,250 of contig NW 023276805.1. The sequence as set forth in SEQ ID NO: l is a segment of contig NW_023276805. 1 corresponding to nucleic acid position number 58,122,950 to 58,125,250 of contig NW 023276805.1. In one example, the region of the CHO cell chromosome X is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% homologous to nucleic acid position number 58,122,950 to58,125,250 of contig NW_023276805.1. In another example, the region of the CHO cell chromosome X is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% homologous to the sequence as set forth in SEQ ID NO: 1. In another example, the region of the CHO cell chromosome X is identical to nucleic acid position number 58,122,950 to58,125,250 of contig NW_023276805. 1 or identical to the sequence as set forth in SEQ ID NO: 1.
[0040] Accordingly, in one example, provided herein is a CHO cell comprising one or more exogenous nucleotide sequences, wherein nucleic acid position number 58,122,950 to58,125,250 of contig NW_023276805.1 is at least 80% homologous to the sequence as set forth in SEQ ID NO: 1.
[0041] It is contemplated that the CHO cell as described herein may comprise any number of exogenous nucleotide sequences inserted into any chromosomal locus or combinations of chromosomal locus described herein. For example, a first exogenous nucleotide sequence can be inserted into a first chromosomal locus and a second exogenous nucleotide sequence (same or different as the first exogenous nucleotide sequence) can be inserted into a second chromosomal locus in the same CHO cell. Accordingly in some examples, two or more exogenous nucleotide sequences can be inserted into at least two chromosomal loci described herein.
[0042] Site-specific integration of exogenous nucleotide sequences into the chromosome of a CHO cell can be achieved by a recombination recognition sequence (RRS) in combination with a recombinase that recognises the RRS. In general, a set of RRS (e g., two RRS) may be inserted into a chromosomal locus in a CHO cell, such as by insertion of an exogenous “landing pad” nucleotide sequence comprising a set of RRS into a chromosome in the CHO cell. Subsequently, another exogenous nucleotide sequence flanked by the same set of RRS may be introduced e g , via a plasmid vector, into the CHO cell together with a recombinase that recognises said set of RRS. Said recombinase will effect recombination-mediated cassette exchange (RMCE) between the landing pad on the CHO cell chromosome and the subsequently-introduced exogenous nucleotide sequence flanked by the same set of RRS. It will be appreciated that the insertion of a set of RRS at any given chromosomal locus mayenable subsequent insertion of exogenous nucleotide sequences via RMCE at the same chromosomal locus.
[0043] As such, in one example, the one or more exogenous nucleotide sequences comprises a nucleotide sequence that encodes one or more recombination recognition sequences (RRS). Examples of suitable RRS sequences include but is not limited to a LoxP sequence, a FRT sequence, an attB and attP sequence, and variants and combinations thereof
[0044] Thus, site-specific integration of an exogenous sequence can be achieved by the insertion of one or more recombination recognition sequences (RRS) at a desired chromosomal locus (i.e. at a target site) in a CHO cell. Accordingly, the CHO cells described herein may comprise one or more exogenous nucleotide sequences encoding recombination recognition sequences that are suitable for promoting site-specific integration.
[0045] In one example, the one or more exogenous nucleotide sequences comprises a nucleotide sequence that encodes one or more recombination recognition sequences (RRS). In some examples, the RRS is a LoxP sequence, FRT sequence, attB and attP sequence, or variants and combinations thereof.
[0046] In another example, the one or more RRS is recognized by a recombinase In some examples, the recombinase is a Cre recombinase, a FLP recombinase, a BxB 1 integrase, a pC31 integrase, or variants and combinations thereof.
[0047] Generally, a recombinase recognizes a specific RRS. Arecombinase may also recognize certain variant RRS sequences in addition to the specific RRS. For example, an FLP recombinase may recognise an FRT sequence and variants thereof, or a Cre recombinase may recognise a LoxP sequence and variants thereof. Examples of FRT variants include but are not limited to the F wildtype, F3, and F5 sequences. Examples of LoxP variants include but are not limited to the Lox P 2L, LoxP L3, Lox2272, and Lox2372 sequences.
[0048] In another example, the one or more exogenous nucleotide sequence comprises nucleotide sequences that encode two RRS.
[0049] The two RRS may be identical or non-identical RRS. For example, the two RRS may be two LoxP sequences, two FRT sequences, one LoxP sequence and one FRT sequence, or an FRT sequence and an FRT variant sequence. These examples are to be understood as non- exhaustive. The two RRS may be recognized by the same recombinase (e g , a Cre recombinase, an FLP recombinase, a BxBl integrase, etc.) or different recombinases (e.g., a Cre recombinase and a FLP recombinase, an FLP recombinase and a BxB 1 integrase, etc.)
[0050] It is contemplated that the CHO cell as described herein may comprise any number of recombination recognition sites inserted into any of the chromosomal loci described herein.For example, a first RRS or set of two RRS can be inserted into a first chromosomal locus and a second RRS or set of two RRS (same or different as the first RRS or set of RRS) can be inserted into a second chromosomal locus in the same CHO cell. Two or more RRS or sets of RRS can be inserted into at least two chromosomal loci described herein in order to enable multi-site SSI in the CHO cell.
[0051] The insertion of a coding exogenous nucleotide sequence into a transcriptional hotspot may promote or improve the transcription of said exogenous sequence compared to insertion at a chromosomal locus that is relatively less transcriptionally active. Promoting or improving the transcription of a coding exogenous sequence may in turn promote or increase expression of a polynucleotide (e.g., RNA molecule) and / or a polypeptide (e.g., proteins and peptides) encoded by said DNA sequence. Accordingly, it may be desirable to insert an exogenous nucleotide sequence comprising a sequence of interest (SOI) into the chromosomal locus described herein so as to promote or improve expression of a polynucleotide (e.g., RNA molecule) or polypeptide (e.g., protein) encoded by the sequence of interest.
[0052] Thus, in one example, the CHO cells described herein comprise one or more exogenous nucleotide sequences, wherein the one or more exogenous nucleotide sequence comprises a nucleotide sequence that encodes a sequence of interest.
[0053] In one example, the sequence of interest encodes one or more selection markers, one or more target proteins of interest, or combinations thereof.
[0054] Selection markers may be utilized as a means for confirming successful insertion of an exogenous nucleotide sequence into a chromosomal locus of a CHO cell. For example, successful insertion of an exogenous nucleotide sequence comprising a sequence of interest encoding a selection marker will lead to expression of said selection marker in said CHO cell. Thus, a CHO cell in which the exogenous nucleotide sequence had been successfully inserted into a chromosomal locus of the CHO cell can be identified by identifying CHO cells that express said selection marker. A CHO cell identified as having an exogenous nucleotide sequence successfully inserted into a chromosomal locus in the CHO cell can subsequently be selected and / or isolated for further use.
[0055] Accordingly, in one example, the one or more selection markers is a detectable label, an antibiotic selection marker, an enzyme, or combinations thereof.
[0056] A detectable label such as a fluorescent protein may be used as a selection marker in the CHO cell of the invention. CHO cells expressing a fluorescent protein as a result of insertion of a sequence of interest encoding the detectable label into a chromosomal locus may be identified and subsequently selected and / or isolated for further use using techniques andmeans for detecting fluorescence in cells and selecting / isolating said cells through means known in the art such as fluorescence flow cytometry or fluorescence-activated cell sorting (FACS). Examples of suitable detectable markers or labels include but are not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), mCherry, yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), and variants and combinations thereof (e.g., EGFP, TurboGFP, etc.). Any fluorescent, bioluminescence or chemiluminescence protein that can be expressed in a CHO cell may be used as a detectable label.
[0057] In one example, the detectable label is a fluorescent protein.
[0058] In some examples, the fluorescent protein is green fluorescent protein, red fluorescent protein, mCherry, yellow fluorescent protein, cyan fluorescent protein, or combinations thereof. In other examples, the detectable label is any fluorescent protein that can be encoded by a nucleotide sequence and expressed in a CHO cell.
[0059] A selection marker may also be an antibiotic selection marker. CHO cells expressing an antibiotic selection marker may be identified and subsequently selected and / or isolated for further use using techniques and means for detecting antibiotic resistance in cells and selecting / isolating said cells, such culturing the cell in the presence of an antibiotic. In positive selection, cells comprising an antibiotic resistance gene will be viable when cultured in the presence of the appropriate antibiotic and can be selected / isolated for further use, e g., by clonal dilution of viable cells. In negative selection, cells that do not comprise an antibiotic resistance gene will be viable when cultured in the presence of the appropriate antibiotic and can be selected / isolated for further use, e g., by clonal dilution of viable cells. Positive selection, negative selection, or a combination of positive and negative selection can be employed as desired. Examples of suitable antibiotic selection markers include but is not limited to hygromycin, puromycin, zeocin, neomycin, blasticidin, and combinations thereof.
[0060] It is to be understood that the term “antibiotic selection marker” when used in the context of selection of recombinant cells refers to the gene encoding for antibiotic resistance. For example, “puromycin selection marker” refers to a gene encoding for resistance to puromycin, such as the pac gene. In another example, “neomycin selection marker” refers to a gene encoding for resistance to neomycin, such as the weo-resi stance gene.
[0061] Accordingly, in one example, the antibiotic selection marker is hygromycin, puromycin, zeocin, neomycin, blasticidin, or combinations thereof. In other examples, the antibiotic selection marker is any antibiotic selection marker that can be encoded by a nucleotide sequence and expressed in a CHO cell.
[0062] A selection marker may also be an enzyme. CHO cells expressing an enzyme selection marker may be identified and subsequently selected and / or isolated for further use using techniques and means for identifying the expression of said enzyme selection marker in cells and selecting / isolating said cells. Examples of suitable enzymes include but is not limited to glutamine synthetase (GS), dihydrofoloate reductase (DHFR), a herpes simplex virus thymidine kinase (HSV-TK), and variants and combinations thereof.
[0063] In one general example of negative selection, a CHO cell may be engineered to comprise an enzyme capable of converting a prodrug into its active cytotoxic form, for example by chromosomal integration of an exogenous sequence encoding for said enzyme or by transient introduction of an expression vector encoding for said enzyme. Negative selection of said engineered CHO cells can be performed by introducing the prodrug to the cell culture medium. CHO cells comprising said enzyme will have decreased viability and / or be killed when the prodrug is present in the culture medium, as said enzyme will convert the prodrug into its active cytotoxic form. If such engineered CHO cells lose the said enzyme, for example, via RMCE or by serial passaging, the cell viability will not decrease in the presence of the prodrug. Such cells can be selected and / or isolated for further use. Thus, in this example, said enzyme functions as a selection marker of a CHO cell.
[0064] In one general example of positive selection, a CHO cell may be engineered to be deficient in an essential nutrient, such as an amino acid. Said CHO cell will experience reduced cell viability when grown in culture medium that is depleted in said essential nutrient (i.e., a selective culture medium). Subsequently, an exogenous nucleotide sequence encoding an enzyme that synthesizes said essential nutrient can be inserted into a transcriptionally active chromosomal locus of the CHO cell and expression of the enzyme in the CHO cell will improve cell viability when grown in the selective culture medium. Said CHO cell with improved viability can then be selected and / or isolated for further use. Thus, in this example, the enzyme that synthesizes the essential nutrient functions as a selection marker of a CHO cell.
[0065] Accordingly, in one example, the enzyme is a glutamine synthetase (GS), dihydrofoloate reductase (DHFR), a herpes simplex virus thymidine kinase (HSV-TK), or variants and combinations thereof. In other examples, the enzyme is any enzyme that can be encoded by a nucleotide sequence.
[0066] In some examples, the one or more selection markers may comprise more than one fluorescent protein, more than one antibiotic selection marker, or more than one enzyme In other examples, the one or more selection markers comprise at least one, at least two, or at least three of a fluorescent protein, an antibiotic selection marker, and an enzyme. The one or moreselection markers may comprise any number of fluorescent proteins, antibiotic selection markers, enzymes and combinations thereof
[0067] As discussed herein, insertion of an exogenous nucleotide sequence encoding a protein of interest, that is, a polypeptide, may promote or improve expression of said protein of interest. Accordingly, the exogenous nucleotide sequence described herein may also comprise a sequence of interest encoding a target protein of interest.
[0068] One example of a protein that can be expressed in the CHO cell of the invention is an antibody or an antibody fragment.
[0069] For example, the antibody or antibody fragment may comprise a monoclonal antibody, a bispecific antibody (e.g. a bi-specific T-cell engager), a multispecific antibody, an antibody fragment, a single chain antibody, an antibody light chain, an antibody heavy chain, a singlechain Fv fragment (scFv), or an Fc fusion protein.
[0070] Another example of proteins that can be expressed in the CHO cell of the present invention include but are not limited to recombinant enzymes, membrane proteins, growth factors, hormones, vaccine proteins (e.g., an antigenic peptide), and viral proteins.
[0071] Accordingly, in one example, the one or more target proteins of interest is a monoclonal antibody, a bispecific antibody, a multispecific antibody, an antibody fragments, a single chain antibody, an antibody light chain, an antibody heavy chain, a single-chain Fv fragment (scFv), an Fc fusion protein, a recombinant enzyme , a membrane protein, a growth factor, a hormone, a vaccine protein, a viral protein, any therapeutic protein, or combinations thereof.
[0072] The one or more exogenous nucleotide sequence may comprise a sequence of interest (SOI) that encodes any number and combinations of selection markers and / or proteins of interest as desired. For example, the SOI may encode one selection marker or one protein of interest. The SOI may also encode one selection marker and one protein of interest. The SOI may also encode one selection marker and two proteins of interest. The SOI may also encode two selection markers and one protein of interest. The SOI may also encode two selection markers and two proteins of interest. Any number of selection marker(s) and / or protein(s) of interest may be encoded by the SOI as desired.
[0073] Various features may also be included in the exogenous nucleotide sequence comprising the sequence of interest to modulate the transcription of the sequence of interest or to serve other desired functions in relation to the product encoded by the sequence of interest. For example, intervening sequences such linkers and / or spacers, transcriptional effectors or regulatory elements such as promoters, repressors, internal ribosome entry sites (IRES), among others, may be included.
[0074] Accordingly, in one example, the sequence of interest encoding the one or more selection markers, or the one or more target proteins of interest is operably linked to a promoter. Suitable promoters include but is not limited to a cytomegalovirus (CMV) promoter, a simian virus 40 (SV40) promoter, an elongation factor- 1 alpha (EFla) promoter, an elongation factor 2 (EF2) promoter, and variants and combinations thereof.
[0075] In one example, the promoter is a cytomegalovirus (CMV) promoter, a simian virus 40 (SV40) promoter, an elongation factor- 1 alpha (EFla) promoter, an elongation factor 2 (EF2) promoter, variants of said promoters, or combinations thereof.
[0076] The sequence of interest (SOI) may also be linked to other elements and features as desired, such as transcriptional repressors, sequences encoding RNA elements (for example a poly-A tail), sequences encoding polypeptide elements (e.g. self-cleaving peptides such as P2A, spacer peptides such as poly-glycine, fusion tags such as 6xHis, signal peptides, etc). The SOI may also be linked to a combination of promoters, repressors, and / or other regulatory element as desired.
[0077] The CHO cells described herein would be capable of expressing a sequence of interest, for example due to the insertion of an exogenous nucleotide sequence comprising a sequence of interest into one or more chromosomal locus described herein of a CHO cell . Thus, a method of producing a CHO cell capable of expressing a sequence of interest is also encompassed in the present invention.
[0078] Accordingly, in one aspect, provided herein is a method of producing a Chinese Hamster Ovary (CHO) cell capable of expressing a sequence of interest, comprising inserting an exogenous nucleotide sequence encoding the sequence of interest into a chromosomal locus of the CHO cell, wherein the chromosomal locus is located within contig NW 023276805. 1 of chromosome X to produce the CHO cell capable of expressing the sequence of interest.
[0079] In one example, the chromosomal locus is within or partially within nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1 or located at nucleic acid position number 58,124,084 to 58,124,098 inclusive, of contig NW_023276805.1, or is located immediately adjacent to the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1.
[0080] In some examples, the chromosomal locus may be located within about 1-100, 100- 200, 200-300, 300-400, 400-500, 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10000, 10000-20000, 20000-30000, 30000-40000, 40000-50000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
[0081] In one example, the chromosomal locus is within about lOOObp to about 10,000bp or within about 10,000 bp to about 50,000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1.
[0082] In another example, the chromosomal locus is within about 100 bp, about 250 bp, about 500 bp, or about lOOObp from the 5’ or 3’ end of nucleic acid position number 58, 124,084 to 58,124,098 of contig NW_023276805.1.
[0083] In another example, the chromosomal locus is within or partially within nucleic acid position number 58,122,950 to 58,125,250 of contig NW 023276805.1.
[0084] In another example, nucleic acid position number 58,122,950 to 58,125,250 of contig NW_023276805.1 is at least 80% homologous to the sequence as set forth in SEQ ID NO: I.
[0085] The exogenous nucleotide sequence may be inserted into one chromosomal locus or more than one chromosomal loci in the CHO cell. In one example, one or more exogenous sequences can be inserted into one chromosomal locus. In another example, one or more exogenous sequences can be inserted into more than one chromosomal loci. In another example, at least two identical exogenous sequences are inserted into the same chromosomal locus. In yet another example, at least two identical exogenous sequences are inserted separately into different chromosomal loci. In yet another example, at least two non-identical exogenous sequences are inserted into the same chromosomal locus. In yet another example, at least two non-identical exogenous sequences are inserted into different chromosomal loci. In yet another example, one or more exogenous nucleotide sequences are inserted into any number of chromosomal loci described herein in the CHO cell.
[0086] The method described herein may also comprise introducing endonucleases into the CHO cell for the purpose of site-specific integration of the exogenous nucleotide sequence into any one of the chromosomal loci described herein in the CHO cell. In brief, this is achieved by introducing a site-specific DNA strand break at a target site in the chromosome of a CHO cell, followed subsequently with insertion of an exogenous nucleotide sequence into the target site via DNA strand-repair. Site-specific DNA strand breaks may be facilitated by certain endonucleases and subsequently repaired by DNA ligases. During certain types of DNA strand repair, e.g., homology-directed repair (HDR), an exogenous nucleotide sequence may be inserted into the site of the DNA strand break by providing target vectors containing an exogenous nucleotide sequence flanked by homology arms designed for insertion into the target site. The resultant (i.e., repaired) target site will have the exogenous nucleotide sequence inserted into the site. Some examples of such methods for site-specific integration include the use of endonucleases such as the zinc-finger nuclease (ZFN), transcription activator-likeeffector nuclease (TALEN) and Cas9 endonuclease. Such methods are discussed in detail elsewhere (e.g. in TALENs: Methods and Protocols (Springer, 2016) and in Introduction to CRISPR-Cas9 Techniques: Strategies for the Laboratory and the Classroom (Springer, 2025)). Any method suitable for site-specific integration of exogenous nucleotide sequences into a chromosomal locus of a CHO cell may also be used.
[0087] Accordingly, in one example, the method described herein comprises introducing into the CHO cell: a) one or more deoxyribonucleic acid (DNA) endonucleases and one or more DNA binding agents that bind to the CHO cell chromosome within, partially within, upstream or downstream of the chromosomal locus; and b) a donor nucleotide sequence comprising the exogenous nucleotide sequence encoding the sequence of interest, wherein binding of the DNA binding agent to the CHO cell chromosome effects one or more single-stranded breaks (SSBs) or double-strand breaks (DSBs) in the chromosome, wherein the nucleotide sequence encoding the sequence of interest is inserted.
[0088] In one example, the exogenous nucleotide sequence encoding the sequence of interest in the donor nucleotide sequence is flanked by nucleotide sequences that are homologous to one or more nucleotide sequences adjacent to the insertion site.
[0089] The DNA endonuclease may be any DNA endonuclease or combination of DNA endonucleases that are suitable for introducing site-specific DNA strand breaks at a selected site (i.e., a target site) in the chromosome of the CHO cell. The target site may be any one of the chromosomal loci described herein.
[0090] In one example, the one or more DNA endonucleases is selected from the group comprising a Cas endonuclease, a zinc finger nuclease, a transcription activator-like effector nuclease, a homing endonuclease, a FokI endonuclease, a dCas9-Fokl nuclease or an engineered meganuclease.
[0091] In some examples, the Cas endonuclease is a Cas9 endonuclease, a Casl2a endonuclease, a dCas9 endonuclease, a Cas9 nickase, or combinations thereof.
[0092] The DNA-binding agent may comprise agents that facilitate the site-specific binding of the endonuclease at the target site so as to effect DNA strand breakage at the target site. For example, a DNA binding agent may be a DNA or RNA nucleotide sequence that is complementary to a DNA sequence at the target site in the chromosome of the CHO cell. TheDNA-binding agent may also be a protein that is capable or engineered to be capable of binding to a DNA sequence at the target site in the chromosome of the CHO cell
[0093] In one example, the one or more DNAbinding agents is a guide RNA (gRNA), a single guide RNA (sgRNA), a gRNA and a sgRNA, or a TAL protein.
[0094] In one example, the gRNA, sgRNA, or gRNA and sgRNA forms a ribonucleoprotein complex with the DNA endonuclease.
[0095] The donor nucleotide sequence may be introduced to the CHO cell via any standard method in molecular biology used to introduce nucleotide sequences to a host cell. The donor nucleotide sequence may be introduced into the CHO cell as a single-stranded DNA or RNA molecule, a double stranded DNA or RNA molecule, or as a DNA sequence on a cloning vector (e g., a plasmid). The donor nucleotide sequence may be introduced into the CHO cell by any method suitable for introducing a polynucleotide molecule into a cell. Suitable methods may include transfection, transformation, transduction (e g., viral transduction), electroporation, cationic polymers, lipid-based delivery, gymnotic delivery, etc. Such methods are well understood by those skilled in the art and are discussed in detail elsewhere (e.g., in Molecular Cloning: A Laboratory Manual (Forth Edition) (Cold Spring Harbor Laboratory Press, 2012)).
[0096] In one example, the donor nucleotide sequence is introduced into the CHO cell via a plasmid vector
[0097] As discussed herein, the insertion of one or more recombination recognition sequences (RRS) into a chromosomal locus in a CHO cell may enable subsequent recombination- mediated cassette exchange (RMCE) at said chromosomal locus.
[0098] Accordingly, in one example, the donor nucleotide sequence further comprises a nucleotide sequence that encodes one or more RRS recognizable by a recombinase.
[0099] In another example, the donor nucleotide sequence further comprises two nucleotide sequences each encoding a RRS recognizable by a recombinase flanking the sequence of interest.
[0100] In one example, the method described herein comprises: a) inserting into a CHO cell two exogenous nucleotide sequences, wherein at least one nucleotide of the two exogenous nucleotide sequences is integrated within, partially within, or immediately adjacent to the chromosomal locus, and wherein the two exogenous nucleotide sequences comprise RRS; b) introducing into the CHO cell of step a) a vector comprising two RRS matching the two RRS from step a) flanking a nucleotide sequence that encodes the sequence of interest; andc) introducing a recombinase that recognises the RRS into the CHO cell to effect a cross-over recombination event wherein the nucleotide sequence encoding the sequence of interest is inserted.
[0101] In one example, the recombinase is selected from the group consisting of a Cre recombinase, FLP recombinase, a BxB 1 integrase, a pC31 integrase and combinations thereof.
[0102] As discussed herein, the sequence of interest (SOI) may be any exogenous nucleotide sequence that is to be expressed in the CHO cell described herein. For example, the SOI may encode a marker that allows for selection of CHO cells that have the exogenous nucleotide sequence inserted into a chromosomal locus described herein. The SOI may also encode a protein of interest, for example a protein that allows for selection of CHO cells that have the exogenous nucleotide sequence inserted into a chromosomal locus described herein, or a therapeutic protein. The SOI may also encode a combination of selection markers and proteins of interest, as desired.
[0103] Accordingly, in one example, the sequence of interest encodes one or more selection markers, or one or more target proteins of interest, or a combination thereof.
[0104] In one example, the one or more selection markers is a detectable label, an antibiotic selection marker, an enzyme or combinations thereof.
[0105] Suitable detectable markers or labels include but are not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), mCherry, yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), and variants and combinations thereof (e g., EGFP, TurboGFP, etc ). Any fluorescent, protein that can be expressed in a CHO cell may be used as a detectable label.
[0106] In one example, the detectable label is a fluorescent protein.
[0107] In some examples, the fluorescent protein is green fluorescent protein, red fluorescent protein, mCherry, yellow fluorescent protein, cyan fluorescent protein, or combinations thereof. In other examples, the detectable label is any fluorescent protein that can be encoded by a nucleotide sequence and expressed in a CHO cell.
[0108] In one example, the antibiotic selection marker is hygromycin, puromycin, zeocin, neomycin, blasticidin, or combinations thereof.
[0109] In one example, the enzyme is a glutamine synthetase (GS), dihydrofoloate reductase (DHFR), a herpes simplex virus thymidine kinase (HSV-TK), or variants and combinations thereof.
[0110] As discussed herein, any number of sequences of interest (SOI) may be inserted into any chromosomal locus described herein in the CHO cell. In some examples, more than oneSOI may be inserted into one chromosomal locus or more than one chromosomal loci in the CHO cell as desired[oni] Accordingly in one example, the method described herein further comprises: a) introducing into the CHO cell a vector comprising two RRS matching the two RRS described herein flanking a nucleotide sequence that encodes a second sequence of interest, and b) introducing a recombinase that recognizes the RRS into the CHO cell to effect recombinase-mediated cassette exchange (RMCE), thereby replacing the sequence of interest with the second sequence of interest
[0112] In one example, the second sequence of interest encodes a second target protein of interest.
[0113] In one example, the target protein of interest is a monoclonal antibody, a bispecific antibody (e.g. a bi-specific T-cell engager), a multispecific antibody, an antibody fragments, a single chain antibody, an antibody light chain, an antibody heavy chain, a single-chain Fv fragment (scFv), an Fc fusion protein, a recombinant enzyme , a membrane protein , a growth factor, a hormone, a vaccine protein, a viral protein or any therapeutic protein.
[0114] As discussed herein, expression (i.e., transcription, translation, or transcription and translation) of the sequence of interest encoded by the exogenous nucleotide sequence may be modulated as desired e.g., by being under operable control of a regulatory element, such as a transcriptional promoter or transcriptional repressor.
[0115] Accordingly, in one example, the sequence of interest encoding the one or more selection markers, or the one or more target proteins of interest is operably linked to a promoter.
[0116] In some examples, the promoter is a CMV promoter, a SV40 promoter, an EFla promoter, an EF2 promoter, or variants of these promoters, or combinations thereof.
[0117] The CHO cells described herein are suitable for use in expressing a sequence of interest as a result of the sequence of interest being inserted into a chromosomal locus described herein in a CHO cell. Expression of the sequence of interest by the CHO cells described herein may be achieved by culturing said CHO cells under conditions suitable for expression of said sequence of interest. Suitable cell culture methods and cell culture conditions will vary and should be adapted based on the sequence of interest to be expressed. The product of expressing the sequence of interest may be recovered from the culture using standard methods according to what is to be recovered. Products such as proteins of interest (e.g., antibodies, antibody fragment, therapeutic proteins and enzymes, etc) and polynucleotides (e.g., RNA polynucleotides) are contemplated.
[0118] Accordingly, in one aspect, provided herein is a method of expressing a sequence of interest comprising culturing the CHO cell described herein under conditions suitable for expressing the sequence of interest, wherein one or more target proteins of interest encoded by the sequence of interest is recovered from the CHO cell culture.
[0119] The CHO cell described herein may also be preserved and packaged as part of a kit for use in expressing a sequence of interest, such as a protein of interest. It is contemplated that CHO cells comprising a sequence of interest that has been inserted into a chromosomal locus described herein in said CHO cells may be preserved (e.g., by cryopreservation) and packaged as a kit. The cryopreserved CHO cells may be recovered and cultured under suitable cell culture conditions to express the product encoded by said sequence of interest. Recovery of the product of expressing the sequence of interest, such as proteins of interest, polynucleotides etc , is also contemplated.
[0120] Accordingly, in another aspect, provided herein is a kit comprising a CHO cell described herein.
[0121] In one example, the kit further comprises one or more culture media, together with instructions for use.
[0122] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by specific embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0123] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0124] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, I, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0125] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.EXPERIMENTAL EXAMPLES
[0126] The following examples illustrate methods by which aspects of the invention may be practiced or materials suitable for practice of certain embodiments of the invention may be prepared.
[0127] Example 1: Identification of transcriptional hotspots in Chinese Hamster Ovary (CHO) cells
[0128] First, Chinese Hamster Ovary (CHO) cells were screened to identify transcriptional hotspots. A landing pad vector containing GFP, a selection marker and a HSV-TK marker flanked by heterospecific FRT sites was generated for insertion into the chromosome of CHO cells. CHO cells that had stably integrated with landing pad(s) were further evaluated via recombinase mediated cassette exchange (RMCE) using a target vector encoding either mCherry or an antibody. The landing pad vector was introduced into a CH0-K1 glutamine synthetase-knockout (GSKO) host cell line via the random integration method to create stable and high GFP-producing cell lines. Following selection and recovery of stably-transfected cells, the GFP-expressing cells were selected for single cell cloning.
[0129] Clonal cell lines were grown and assessed for their growth characteristics during routine 4-day subcultures. Cell lines that had stably integrated the landing pad were isolated. Out of- 70 landing pad (LP) cell lines isolated over 2 separate experiments, 27 cell lines were selected to be tested for their RMCE competency. Duplicate cultures of the 27 cell lines were cotransfected with a target vector plasmid encoding mCherry and a pOG44 plasmid whichencodes the Flp recombinase. Transfected cells were subjected to negative selection with 3nM Ganciclovir on day 9 post-transfection to select against cells with unexchanged landing pad(s). LP cell lines with landing pad in strong hotspots were selected based on the following two requirements: (1) a homogeneous population showing high mCherry Mean Fluorescence Intensity (MFI); and (2) negligible GFP & mCherry double-positive cells which would otherwise indicate either the presence of unexchanged GFP landing pads due to low RMCE efficiency or the presence of a high number of (i.e., multiple) GFP landing pads.
[0130] Based on the analysis of resultant mCherry -expressing pools (FIG. 1 A), 6 candidate LP cell lines were selected for further characterization. Two cell lines, LP035 and LP041 were chosen to determine vector copy number integration. Digital droplet PCR (ddPCR) analysis was carried out on genomic DNA using specific primers / probes to quantify GFP gene copies and normalised against a Chinese Hamster endogenous gene, COG1, which is known to be present in two copies. It was determined that LP041 contains one copy of GFP landing pad while LP035 contains two copies of GFP landing pads (FIG. IB).
[0131] Site-specific integration (SSI) productivity assessment of the LP035 and LP041 CHO cell lines was then carried out using RMCE with a target vector encoding heavy and light chains of the antibody trastuzumab. Cells transfected with the antibody target vector were subjected to positive selection with 400 pg / ml of Hygromycin on day 3 post-transfection and negative selection with 3pM Ganciclovir on day 9 post-transfection. Separate SSI pools were generated from two independent transfections each of the LP035 and LP041. Recovered pools were found to be GFP -negative (FIG. 2), indicating that RMCE was successful, and the target vector was now inserted into the CHO cell chromosome.
[0132] Antibody SSI pools of LP035 and LP041 were then analysed in an unoptimized 50ml shake flask fed batch culture. Both SSI pools of LP041 presented similar growth profiles and had a specific productivity for the antibody of ~ 1 .7 g / L and Qp of ~ 12 pg / cell / day (FIG 3 and Table 1). This is comparable or higher than published industry reports (e.g., Scarcelli et al., Biotechnol Prog. 2017;33(6): 1463-1467). On the other hand, pools of LP035 showed different titres of ~ Ig / L and ~ 2.3 g / L (Table 1). Cells also showed lower maximum viable cell concentration (VCC). Subsequently, LP041 was subjected to sequencing analysis to identify the flanking genomic sequences at the integration sites using the Targeted Locus Amplification (TLA) technology (Cergentis). Results confirmed that LP041 contains a single copy vector integration at a genomic location on chromosome X at position 58,124,084 to 58,124,098 (FIG. 4), based on the Chinese Hamster CriGri-PICRHl.O genome assembly GCF 003668045.3. This location was named “Site X”.Table 1. Productivity of trastuzumab-producing pools under fed batch culture conditionsVCC - viable cell concentration; 1VC - integral of Viable Cell Concentration
[0133] Example 2: Engineering a single copy landing pad at Site X in CHO cells
[0134] To generate an engineered CHO SSI cell line with a single copy of landing pad at Site X, genome editing technologies such as CRISPR / Cas9 or TALENs coupled with homology- directed repair (HDR) may be used. In one example, we used a CRISPR / Cas9 HDR method. A suitable single guide RNA (sgRNA) for CRISPR / Cas9 targeting the sequence GAATGATTTCTCTCTTGTGCTGG (reverse strand) at Site X was identified using an online tool (https: / / chopchop.cbu.uib.no / ). Guide RNA (gRNA) having the sequence GAAUGAUUUCUCUCUUGUGC was synthesized as TrueGuide Synthetic gRNA, and the TrueCut™ HiFi Cas9 Protein (ThermoFisher Scientific) together with donor plasmid were used for transfection of host CH0-K1 GS-KO cells. Alternatively, commercial vectors such as the GeneArt™ CRISPR Nuclease Vector Kit that expresses both sgRNA and Cas9 nuclease can also be used in a 1 : 1 ratio with donor plasmid for transfection of host CH0-K1 GS-KO cells.
[0135] Generation of Donor Plasmid containing left and right homology arms
[0136] Left and right homology arms each ~ 750 nt in length surrounding the CRISPR-cut site of Site X were generated by PCR using genomic DNA of host CHO or CH0-K1 GS-KO cells as a template with the primers listed in Table 2. These homology arms were then cloned into a donor plasmid containing the landing pad as shown in FIG. 5 using standard molecular biology techniques. Site-specific double strand DNA breakage at Site X catalysed by CRISPR / Cas9 was followed by homology-directed repair in presence of donor plasmid (FIG. 5) This resulted in specific knock-in of the landing pad. Successfully engineered SSI CHO cell lines contain a GFP landing pad at Site X comprising a promoter driving expression of a puromycin selection marker linked to GFP via a 2A peptide, and a strong CMV promoter driving the expression of a negative selection marker thymidine kinase from the Herpes Simplex Virus (HSV-TK). The cassette is flanked by a mutant FRT site (FRT5) and wild-type FRT as indicated (FIG. 5).Table 2. Primers used for generating Left and Right Homology Arms for HDR
[0137] sgRNA Transfection and selection of SSI CHO cell lines
[0138] CHO-K1 or CHO-K1 GSKO cells seeded at 1 million cells / ml in a 125 mL shake flask containing 10 ml CD CHO media (ThermoFisher Scientific) supplemented with 6 mM L- glutamine were co-transfected with 1.25 pg of sgRNA in GeneArt™ CRISPR Nuclease Vector with OFP (ThermoFisher Scientific) and 1.25 pg of donor plasmid using CHO ExpiFectamine™ Transfection Reagent (ThermoFisher Scientific) according to the manufacturer’s instructions. At 48 hours post-transfection and cells were left to recover from selection for ~2 weeks in 6-well plates with replacement of fresh selection media every 4-5days. Recovered cell pools were then subjected to single cell cloning by limiting dilution into 96-well plates or using FACS single cell sorting for GFP -positive cells. Individual clones were then screened by 2 separate sets of junction PCR on extracted genomic DNA using primers listed in Table 2. It is expected that a SSI CHO cell line with the landing pad correctly inserted into Site X will show a 926bp and 958bp band for left and right junction PCR respectively.Clones were further subjected to Digital droplet PCR (ddPCR) analysis using specific primers / probe to confirm GFP gene copy number. Potential SSI CHO cell lines were further evaluated by RMCE with an targeting vector encoding for an antibody and selected based on their growth and productivity in fed-batch culture. TLA analysis of selected clone(s) was also carried out to verify integration of the landing pad at site X.Table 3. List of primers used for junction PCR
[0139] In conclusion, a CHO cell that contains a single copy of a DNA landing pad inserted into a chromosomal locus in chromosome X (“Site X”) was obtained. The CHO cell (“SSI CHO cell line”) is suitable for use in recombinant protein production as exogenous nucleotide sequences encoding proteins of interest, such as antibodies and other therapeutic proteins, may be inserted into Site X in said CHO cell using site-specific integration.
Claims
ClaimsWhat is claimed is:
1. A Chinese Hamster Ovary (CHO) cell comprising one or more exogenous nucleotide sequences, wherein the one or more exogenous nucleotide sequences is inserted into a chromosomal locus of the CHO cell, wherein the chromosomal locus is located within contig NW_023276805.1 of chromosome X.
2. The CHO cell of claim 1, wherein the chromosomal locus is within or partially within nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1 or located at nucleic acid position number 58,124,084 to 58,124,098 inclusive, of contig NW_023276805.1, or is located immediately adjacent to the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
3. The CHO cell of claim 1, wherein the chromosomal locus is within about lOOObp to about 10,000bp or within about 10,000 bp to about 50,000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW 023276805.1.
4. The CHO cell of claim 1, wherein the chromosomal locus is within about 100 bp, about 250 bp, about 500 bp, or about 1000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
5. The CHO cell of any one of claims 1 to 4, wherein the chromosomal locus is within or partially within nucleic acid position number 58,122,950 to 58,125,250 of contig NW_023276805.1.
6. The CHO cell of claim 5, wherein nucleic acid position number 58,122,950 to 58,125,250 of contig NW 023276805.1 is at least 80% homologous to the sequence as set forth in SEQ ID NO: 1.
7. The CHO cell of claim 1, wherein the one or more exogenous nucleotide sequences comprises a nucleotide sequence that encodes one or more recombination recognition sequences (RRS).
8. The CHO cell of claim 7, wherein the RRS is a LoxP sequence, FRT sequence, attB and attP sequence, or variants and combinations thereof9. The CHO cell of claim 7, wherein the one or more RRS is recognized by a recombinase.
10. The CHO cell of claim 9, wherein the recombinase is a Cre recombinase, a FLP recombinase, a BxBl integrase, a pC31 integrase, or variants and combinations thereof.
11. The CHO cell of any one of claims 1 to 10, wherein the one or more exogenous nucleotide sequence comprises nucleotide sequences that encode two RRS.
12. The CHO cell of any one of claims 1 to 11, wherein the one or more exogenous nucleotide sequence comprises a nucleotide sequence that encodes a sequence of interest.
13. The CHO cell of claim 12, wherein the sequence of interest encodes one or more selection markers, one or more target proteins of interest, or combinations thereof14. The CHO cell of claim 13, wherein the one or more selection markers is a detectable label, an antibiotic selection marker, an enzyme, or combinations thereof.
15. The CHO cell of claim 14, wherein the detectable label is a fluorescent protein.
16. The CHO cell of claim 15, wherein the fluorescent protein is green fluorescent protein, red fluorescent protein, mCherry, yellow fluorescent protein, cyan fluorescent protein, or combinations thereof.
17. The CHO cell of claim 14, wherein the antibiotic selection marker is hygromycin, puromycin, zeocin, neomycin, blasticidin, or combinations thereof.
18. The CHO cell of claim 14, wherein the enzyme is a glutamine synthetase (GS), dihydrofoloate reductase (DHFR), a herpes simplex virus thymidine kinase (HSV-TK), or variants and combinations thereof.
19. The CHO cell of claim 13, wherein the one or more target proteins of interest is a monoclonal antibody, a bispecific antibody, a multispecific antibody, an antibody fragments, a single chain antibody, an antibody light chain, an antibody heavy chain, a single-chain Fv fragment (scFv), an Fc fusion protein, a recombinant enzyme , a membrane protein, a growth factor, a hormone, a vaccine protein, a viral protein, any therapeutic protein, or combinations thereof.
20. The CHO cell of claim 13 to 19, wherein the sequence of interest encoding the one or more selection markers, or the one or more target proteins of interest is operably linked to a promoter.
21. The CHO cell of claim 20, wherein the promoter is a cytomegalovirus (CMV) promoter, a simian virus 40 (SV40) promoter, an elongation factor-1 alpha (EFla) promoter, an elongation factor 2 (EF2) promoter, variants of said promoters, or combinations thereof.
22. A method of producing a Chinese Hamster Ovary (CHO) cell capable of expressing a sequence of interest, comprising inserting an exogenous nucleotide sequence encoding the sequence of interest into a chromosomal locus of the CHO cell, wherein the chromosomal locus is located within contig NW_023276805.1 of chromosome X to produce the CHO cell capable of expressing the sequence of interest.
23. The method of claim 22, wherein the chromosomal locus is within or partially within nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1 or located at nucleic acid position number 58,124,084 to 58,124,098 inclusive, of contig NW_023276805.1, or is located immediately adjacent to the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
24. The method of claim 22, wherein the chromosomal locus is within about lOOObp to about 10,000bp or within about 10,000 bp to about 50,000 bp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
25. The method of claim 22, wherein the chromosomal locus is within about 100 bp, about 250 bp, about 500 bp, or about lOOObp from the 5’ or 3’ end of nucleic acid position number 58,124,084 to 58,124,098 of contig NW_023276805.1.
26. The method of claim 22, wherein the chromosomal locus is within or partially within nucleic acid position number 58,122,950 to 58,125,250 of contig NW 023276805.1.
27. The method of claim 22, wherein nucleic acid position number 58, 122,950 to 58,125,250 of contig NW 023276805.1 is at least 80% homologous to the sequence as set forth in SEQ ID NO: 1.
28. The method of any one of claims 22 to 27, wherein the method comprises introducing into the CHO cell: a) one or more deoxyribonucleic acid (DNA) endonucleases and one or more DNA binding agents that bind to the CHO cell chromosome within, partially within, upstream or downstream of the chromosomal locus; and b) a donor nucleotide sequence comprising the exogenous nucleotide sequence encoding the sequence of interest, wherein binding of the DNA binding agent to the CHO cell chromosome effects one or more single-stranded breaks (SSBs) or double-strand breaks (DSBs) in the chromosome, wherein the nucleotide sequence encoding the sequence of interest is inserted.
29. The method of claim 28, wherein the exogenous nucleotide sequence encoding the sequence of interest in the donor nucleotide sequence is flanked by nucleotide sequences that are homologous to one or more nucleotide sequences adjacent to the insertion site.
30. The method of any one of claims 28 or 29, wherein the one or more DNA endonucleases is selected from the group comprising a Cas endonuclease, a zinc finger nuclease, a transcription activator-like effector nuclease, a homing endonuclease, a Fokf endonuclease, a dCas9-Fokl nuclease or an engineered meganuclease.
31. The method of claim 30, wherein the Cas endonuclease is a Cas9 endonuclease, a Casl2a endonuclease, a dCas9 endonuclease, a Cas9 nickase, or combinations thereof.
32. The method of any one of claims 28 to 31, wherein the one or more DNA binding agents is a guide RNA (gRNA), a single guide RNA (sgRNA), a gRNA and a sgRNA, or a TAL protein.
33. The method of any one of claims 28 to 32, wherein the donor nucleotide sequence further comprises a nucleotide sequence that encodes one or more RRS recognizable by a recombinase.
34. The method of any one of claims 28 to 32, wherein the donor nucleotide sequence further comprises two nucleotide sequences each encoding a RRS recognizable by a recombinase flanking the sequence of interest35. The method of claim 22, wherein the method comprises: a) inserting into a CHO cell two exogenous nucleotide sequences, wherein at least one nucleotide of the two exogenous nucleotide sequences is integrated within, partially within, or immediately adjacent to the chromosomal locus, and wherein the two exogenous nucleotide sequences comprise RRS; b) introducing into the CHO cell of step a) a vector comprising two RRS matching the two RRS from step a) flanking a nucleotide sequence that encodes the sequence of interest; and c) introducing a recombinase that recognises the RRS into the CHO cell to effect a cross-over recombination event wherein the nucleotide sequence encoding the sequence of interest is inserted.
36. The method of claims 33 to 35, wherein the recombinase is selected from the group consisting of a Cre recombinase, FLP recombinase, a BxB 1 integrase, a pC31 integrase and combinations thereof.
37. The method of any one of claims 22 to 35, wherein the sequence of interest encodes one or more selection markers, or one or more target proteins of interest, or a combination thereof.
38. The method of claim 37, wherein the one or more selection markers is a detectable label, an antibiotic selection marker, an enzyme or combinations thereof.
39. The method of claim 38, wherein the detectable label is a fluorescent protein.
40. The method of claim 38, wherein the antibiotic selection marker is hygromycin, puromycin, zeocin, neomycin, blasticidin, or combinations thereof41. The method of claim 38, wherein the enzyme is a glutamine synthetase (GS), dihydrofoloate reductase (DHFR), a herpes simplex virus thymidine kinase (HSV-TK), variants or combinations thereof.
42. The method of any one of claims 34 or 35, further comprising: a) introducing into the CHO cell a vector comprising two RRS matching the two RRS from claim 31 or 32 flanking a nucleotide sequence that encodes a second sequence of interest, and b) introducing a recombinase that recognizes the RRS into the CHO cell to effect recombinase-mediated cassette exchange (RMCE), thereby replacing the sequence of interest with the second sequence of interest.
43. The method of claim 42, wherein the second sequence of interest encodes a second target protein of interest.
44. The method of claim 37 or 43, wherein the target protein of interest is a monoclonal antibody, a bispecific antibody, a multispecific antibody, an antibody fragments, a single chain antibody, an antibody light chain, an antibody heavy chain, a single-chain Fv fragment (scFv), an Fc fusion protein, a recombinant enzyme , a membrane protein , a growth factor, a hormone, a vaccine protein, a viral protein or any therapeutic protein.
45. The method of claim 37 to 43, wherein the sequence of interest encoding the one or more selection markers, or the one or more target proteins of interest is operably linked to a promoter.
46. The method of claim 45, wherein the promoter is a CMV promoter, a SV40 promoter, an EFla promoter, an EF2 promoter, or variants of these promoters, or combinations thereof.
47. A method of expressing a sequence of interest comprising culturing the CHO cell of any one of claims 12 to 21 under conditions suitable for expressing the sequence of interest, wherein one or more target proteins of interest encoded by the sequence of interest is recovered from the CHO cell culture.
48. A kit comprising a CHO cell according to any one of claims 1 to 21.
49. The kit of claim 48, further comprising one or more culture media, together with instructions for use.
Citation Information
Patent Citations
Use of genomic NW_006882077.1 in CHO cell for stably expressing a protein
US20210238634A1
Method of introducing target-specific foreign gene
US20220170047A1
CHO cell modification
WO2022123242A1
Method of assessing protein production in CHO cells
WO2024046840A1
Chinese hamster ovary cell genomic hotspots for recombinant protein production
WO2024073464A2
Cited By
Method for efficiently expressing foreign protein based on NC048604-1 site in CHO cell genome
CN121022941A
Method for efficiently expressing foreign protein based on NC048599.1 site in CHO cell genome
CN121160802A