Biomarker for diagnosing thyroid-associated ophthalmopathy and use thereof

Biomarkers for thyroid ophthalmopathy, specifically targeting SOX6, Eya1, Six1, and Nfix genes, allow for precise diagnosis and treatment of extraocular muscle hypertrophy and fibrosis, overcoming limitations of current therapies by providing personalized treatment options.

WO2025239653A1PCT designated stage Publication Date: 2025-11-20SUNG KWANG MEDICAL FOUND +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/006484
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-14
Filing Date
2025-05-13
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

Current treatments for thyroid ophthalmopathy, such as high-dose steroids and radioactive iodine, have low cure rates and high recurrence rates, and primarily target adipose tissue hypertrophy, failing to effectively address extraocular muscle hypertrophy and fibrosis, which can lead to severe symptoms like strabismus and blindness.

Method used

The use of biomarkers, including SOX6, Eya1, Six1, and Nfix genes or their encoded proteins, for diagnosing thyroid ophthalmopathy, allowing for personalized treatment by measuring their expression levels to target extraocular muscle hypertrophy and fibrosis directly.

Benefits of technology

Enables early and accurate diagnosis of thyroid ophthalmopathy, facilitating personalized treatment approaches that reduce muscle hypertrophy and fibrosis, potentially preventing severe symptoms like strabismus and blindness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025006484_20112025_PF_FP_ABST
    Figure KR2025006484_20112025_PF_FP_ABST
Patent Text Reader

Abstract

An aspect relates to a biomarker for diagnosing thyroid-associated ophthalmopathy and use thereof. According to an aspect, by measuring the expression levels of: one or more genes selected from the group consisting of Sox6 gene, Eya1 gene, Six1 gene, and Nfix gene; a polynucleotide encoded by the gene; and a biomarker comprising a polypeptide or fragment thereof, it is possible to accurately and rapidly diagnose thyroid-associated ophthalmopathy. In addition, by using the biomarker, not only thyroid-associated ophthalmopathy but also muscle hypertrophy or muscle fibrosis caused by thyroid-associated ophthalmopathy can be diagnosed early, thereby preventing ocular proptosis, strabismus, diplopia, vision deterioration, blindness, or the like. Furthermore, a therapeutic agent for thyroid-associated ophthalmopathy can be screened by using the biomarker, and the biomarker can be used for treating thyroid-associated ophthalmopathy through adjustment of the expression level thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Biomarkers for diagnosing thyroid ophthalmopathy and their uses

[0001] This relates to a biomarker for diagnosing thyroid ophthalmopathy and its use.

[0002]

[0003] Thyroid ophthalmopathy (also known as thyroid ophthalmopathy) is a disease caused by thyroid dysfunction. This disease causes an increase in fibroblasts in the orbital fat and hypertrophy of the extraocular muscles, leading to symptoms such as proptosis, diplopia, or decreased vision. While proptosis can be treated with medication, extraocular muscle hypertrophy due to myopathy, which causes strabismus and diplopia, remains difficult to treat. However, research into the mechanisms underlying the myofibroblasts that drive extraocular muscle hypertrophy remains limited.

[0004] For thyroid ophthalmopathy, high-dose steroid and radioactive iodine therapy is commonly used. However, these treatments have a low cure rate of 37% and a high recurrence rate of 52%, and can cause side effects such as endocrine abnormalities and gastrointestinal problems. Furthermore, these treatments only temporarily reduce inflammation, making them limited as a fundamental treatment for thyroid ophthalmopathy.

[0005] Meanwhile, the main clinical symptoms of thyroid ophthalmopathy include proptosis, restrictive muscle hypertrophy, diplopia, or optic nerve compression, which can lead to decreased vision, and blindness occurs in 5% of cases. This symptom occurs when immune cells within the orbit are activated and secrete inflammatory cytokines and hyaluronic acid, which accumulate between the extraocular muscle fibers and cause edema, leading to hypertrophy of the extraocular muscles. Furthermore, in the later stages of thyroid ophthalmopathy, muscle cells differentiate into myofibroblasts, resulting in fibrosis. When these symptoms appear, systemic treatments are currently being attempted to control fat accumulation. However, controlling muscle hypertrophy is also difficult, and surgical treatment is currently being performed in the future.

[0006] Therefore, there was a need to elucidate the mechanism of extraocular muscle hypertrophy and to study new treatments and biomarkers that can reduce extraocular muscle hypertrophy as a direct treatment that is different from existing treatments that only target adipose tissue hypertrophy in thyroid ophthalmopathy and act systemically.

[0007]

[0008] One aspect is to provide a biomarker for diagnosing thyroid ophthalmopathy, comprising at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0009] Another aspect is to provide a composition for diagnosing thyroid ophthalmopathy, comprising an agent for measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0010] Another aspect is to provide a kit for diagnosing thyroid ophthalmopathy comprising the composition.

[0011] Another aspect provides a method for providing information for diagnosing thyroid ophthalmopathy, comprising the step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy.

[0012] Another aspect comprises the steps of treating a biological sample isolated from an individual with thyroid ophthalmopathy with a candidate substance; and

[0013] The present invention provides a method for screening a therapeutic agent for thyroid ophthalmopathy, comprising the step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in the biological sample.

[0014] Another aspect provides a pharmaceutical composition for preventing or treating thyroid ophthalmopathy, comprising at least one expression promoter selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0015] Another aspect provides a method for preventing or treating thyroid ophthalmopathy, comprising administering to a subject in need thereof at least one expression promoter selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0016] Another aspect provides the use of one or more expression promoters selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof for the manufacture of a medicament for preventing or treating thyroid ophthalmopathy.

[0017] Another aspect provides a pharmaceutical composition for preventing or treating thyroid ophthalmopathy, comprising at least one expression inhibitor selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof.

[0018] Another aspect provides a method for preventing or treating thyroid ophthalmopathy, comprising administering to a subject in need thereof at least one expression inhibitor selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof.

[0019] Another aspect provides the use of one or more expression inhibitors selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof for the manufacture of a medicament for preventing or treating thyroid ophthalmopathy.

[0020]

[0021] One aspect provides a biomarker for diagnosing thyroid ophthalmopathy, comprising at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0022] In one specific example, the biomarker is at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, and a polypeptide encoded by the Sox6 gene or a fragment thereof;

[0023] At least one selected from the group consisting of the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene, or a fragment thereof;

[0024] At least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, and a polypeptide encoded by the Six1 gene or a fragment thereof; and

[0025] It may include at least one selected from the group consisting of an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0026] Specifically, the biomarker comprises at least one selected from the group consisting of SOX6 (SRY-Box Transcription Factor 6) gene, Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, Six1 (SIX Homeobox 1) gene, and Nfix (Nuclear Factor I / X) gene;

[0027] or comprising at least one selected from the group consisting of a polynucleotide encoded by the Sox6 gene, a polynucleotide encoded by the Eya1 gene, a polynucleotide encoded by the Six1 gene, and a polynucleotide encoded by the Nfix gene;

[0028] It may include at least one selected from the group consisting of a polypeptide encoded by the Sox6 gene or a fragment thereof, a polypeptide encoded by the Eya1 gene or a fragment thereof, a polypeptide encoded by the Six1 gene or a fragment thereof, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0029] More specifically, the biomarker comprises the SOX6 (SRY-Box Transcription Factor 6) gene, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, the Six1 (SIX Homeobox 1) gene, and the Nfix (Nuclear Factor I / X) gene;

[0030] or comprising a polynucleotide encoded by the Sox6 gene, a polynucleotide encoded by the Eya1 gene, a polynucleotide encoded by the Six1 gene, and a polynucleotide encoded by the Nfix gene;

[0031] It may include a polypeptide encoded by the Sox6 gene or a fragment thereof, a polypeptide encoded by the Eya1 gene or a fragment thereof, a polypeptide encoded by the Six1 gene or a fragment thereof, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0032] The term "gene" may refer to any nucleic acid sequence or portion thereof that has a functional role in protein coding or transcription or in the regulation of other gene expression. A gene may consist of all nucleic acids that encode a functional protein or only a portion of a nucleic acid that encodes or expresses a protein. A nucleic acid sequence may include exons, introns, start or end regions, promoter sequences, other regulatory sequences, or other genetic sequences within a unique sequence adjacent to the gene.

[0033] The term "polynucleotide" refers to a deoxyribonucleotide (DNA) or ribonucleotide (RNA) in single- or double-stranded form, and may also include known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.

[0034] The term "polypeptide" refers to a polymer composed of two or more amino acids linked by amide bonds (or peptide bonds). Furthermore, a "fragment" of the polypeptide may be an immunogenic fragment. It may be a fragment that has one or more epitopes that can be recognized by antibodies directed against the polypeptide.

[0035] In one specific example, the Sox6 gene may include a DNA sequence encoding all or part of a SRY-Box Transcription Factor 6 protein, a DNA sequence encoding a protein or RNA that can help the SRY-Box Transcription Factor 6 protein function normally, a DNA sequence encoding a protein or RNA that can help the mRNA encoding the SRY-Box Transcription Factor 6 protein to be translated normally, and a DNA sequence encoding a protein or RNA that can help the Sox6 gene to be transcribed normally.

[0036] More specifically, the Sox6 gene may be a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_000011, or a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the base sequence described in Genbank Accession No: NC_000011.

[0037] In addition, the polynucleotide encoded by the Sox6 gene may include an RNA sequence (including mRNA) encoding all or part of the SRY-Box Transcription Factor 6 protein, an RNA sequence encoding a protein that can help the SRY-Box Transcription Factor 6 protein function normally, an RNA sequence encoding a protein that can help the mRNA encoding the SRY-Box Transcription Factor 6 protein to be translated normally, and an RNA sequence encoding a protein that can help the Sox6 gene to be transcribed normally, and specifically, may be composed of an RNA sequence encoded by a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_000011.

[0038] In one specific example, the Eya1 gene may include a DNA sequence encoding all or part of the EYA transcriptional coactivator and phosphatase 1 protein, a DNA sequence encoding a protein or RNA that can help the EYA transcriptional coactivator and phosphatase 1 protein to function normally, a DNA sequence encoding a protein or RNA that can help the mRNA encoding the EYA transcriptional coactivator and phosphatase 1 protein to be translated normally, and a DNA sequence encoding a protein or RNA that can help the Eya1 gene to be transcribed normally.

[0039] More specifically, the Eya1 gene may be a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_000008.11, or a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the base sequence described in Genbank Accession No: NC_000008.11.

[0040] In addition, the polynucleotide encoded by the Eya1 gene may include an RNA sequence (including mRNA) encoding all or part of the EYA transcriptional coactivator and phosphatase 1 protein, an RNA sequence encoding a protein that can help the EYA transcriptional coactivator and phosphatase 1 protein to function normally, an RNA sequence encoding a protein that can help the mRNA encoding the EYA transcriptional coactivator and phosphatase 1 protein to be translated normally, and an RNA sequence encoding a protein that can help the Eya1 gene to be transcribed normally, and specifically, may be composed of an RNA sequence encoded by a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_000008.11.

[0041] In addition, the polypeptide encoded by the Six1 gene or a fragment thereof may include all or part of the SRY-Box Transcription Factor 6 protein, a protein that can help the SRY-Box Transcription Factor 6 protein to function normally, a protein that can help the mRNA encoding the SRY-Box Transcription Factor 6 protein to be translated normally, and a protein that can help the Sox6 gene to be transcribed normally, and specifically, may be a polypeptide encoded by a polynucleotide consisting of the amino acid sequence of all or part of the SRY-Box Transcription Factor 6 protein, and may include all of the primary structure, secondary structure, tertiary structure, or quaternary structure forms, and more specifically, may be a polypeptide encoded by a polynucleotide consisting of the base sequence described in Genbank Accession No: NC_000011.

[0042] In addition, in one specific example, the Six1 gene may include a DNA sequence encoding all or part of the SIX Homeobox 1 protein, a DNA sequence encoding a protein or RNA that can help the SIX Homeobox 1 protein function normally, a DNA sequence encoding a protein or RNA that can help the mRNA encoding the SIX Homeobox 1 protein to be translated normally, and a DNA sequence encoding a protein or RNA that can help the Six1 gene to be transcribed normally.

[0043] More specifically, the Six1 gene may be a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_0.000014, or a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the base sequence described in Genbank Accession No: NC_0.000014.

[0044] In addition, the polynucleotide encoded by the Six1 gene may include an RNA sequence (including mRNA) encoding all or part of the SIX Homeobox 1 protein, an RNA sequence encoding a protein that can help the SIX Homeobox 1 protein function normally, an RNA sequence encoding a protein that can help the mRNA encoding the SIX Homeobox 1 protein to be translated normally, and an RNA sequence encoding a protein that can help the Six1 gene to be transcribed normally, and specifically, may be composed of an RNA sequence encoded by a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_0.000014.

[0045] In addition, the polypeptide encoded by the Six1 gene or a fragment thereof may include all or part of the SIX Homeobox 1 protein, a protein that can help the SIX Homeobox 1 protein to function normally, a protein that can help the mRNA encoding the SIX Homeobox 1 protein to be translated normally, and a protein that can help the Six1 gene to be transcribed normally, and specifically, may be a polypeptide encoded by a polynucleotide consisting of the amino acid sequence of all or part of the SIX Homeobox 1 protein, and may include all of the primary structure, secondary structure, tertiary structure, or quaternary structure forms, and more specifically, may be a polypeptide encoded by a polynucleotide consisting of the base sequence described in Genbank Accession No: NC_0.000014.

[0046] In one specific example, the Nfix gene may include a DNA sequence encoding all or part of a Nuclear Factor I / X protein, a DNA sequence encoding a protein or RNA that can help the Nuclear Factor I / X protein function normally, a DNA sequence encoding a protein or RNA that can help the mRNA encoding the Nuclear Factor I / X protein to be translated normally, and a DNA sequence encoding a protein or RNA that can help the Nfix gene to be transcribed normally.

[0047] More specifically, the Nfix gene may be a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_000019, or a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the base sequence described in Genbank Accession No: NC_000019.

[0048] In addition, the polynucleotide encoded by the Nfix gene may include an RNA sequence (including mRNA) encoding all or part of the Nuclear Factor I / X protein, an RNA sequence encoding a protein that can help the Nuclear Factor I / X protein function normally, an RNA sequence encoding a protein that can help the mRNA encoding the Nuclear Factor I / X protein to be translated normally, and an RNA sequence encoding a protein that can help the Nfix gene to be transcribed normally, and specifically, may be composed of an RNA sequence encoded by a polynucleotide consisting of a base sequence described in Genbank Accession No: NC_000019.

[0049] In addition, the polypeptide or fragment thereof encoded by the Nfix gene may include all or part of the Nuclear Factor I / X protein, a protein that can help the Nuclear Factor I / X protein to function normally, a protein that can help the mRNA encoding the Nuclear Factor I / X protein to be translated normally, and a protein that can help the Six1 gene to be transcribed normally, and specifically, may be a polypeptide encoded by a polynucleotide consisting of the amino acid sequence of all or part of the Nuclear Factor I / X protein, and may include all of the primary structure, secondary structure, tertiary structure, or quaternary structure forms, and more specifically, may be a polypeptide encoded by a polynucleotide consisting of the base sequence described in Genbank Accession No: NC_000019.

[0050] The term "thyroid ophthalmopathy" has the same meaning as "thyroid ophthalmopathy" and may be used interchangeably.

[0051] In one specific example, the thyroid ophthalmopathy may cause extraocular muscle hypertrophy or extraocular muscle fibrosis, and specifically may cause both extraocular muscle hypertrophy and extraocular muscle fibrosis.

[0052] In addition, in one specific example, the thyroid ophthalmopathy may cause exophthalmos, strabismus, diplopia, decreased vision, or blindness, and specifically, the thyroid ophthalmopathy may cause extraocular muscle hypertrophy or extraocular muscle fibrosis, thereby causing exophthalmos, strabismus, diplopia, decreased vision, or blindness.

[0053] "Biomarker" refers to a molecule that is quantitatively or qualitatively related to the presence of a biological phenomenon. In one aspect, a biomarker refers to a protein that can confirm the presence of thyroid ophthalmopathy among thyroid-related diseases, or a gene that serves as a standard for predicting patients with a good or poor prognosis after thyroid ophthalmopathy treatment. The term includes a biomarker protein, a gene encoding the biomarker protein, a polynucleotide sequence complementary to or flanking a gene sequence encoding the biomarker protein, such as a polynucleotide used as a probe or primer pair capable of amplifying a gene encoding the marker protein.

[0054] In one embodiment, a hypertrophic thyroid eye disease mouse model was produced, extraocular muscles were isolated from the mouse model, and the gene expression levels between the treatment group injected with placental-derived mesenchymal stem cells as a treatment for thyroid eye disease and the disease group were confirmed through single cell RNA sequencing, and it was confirmed that Sox 6, Six1, and Nfix genes were target genes (see Manufacturing Example 2 and Example 1).

[0055] In another example, genes involved in differentiation of extraocular muscle progenitor cells of patients with thyroid ophthalmopathy into myofibroblasts were confirmed in vitro using qRT-PCR, and it was confirmed that the expression levels of Six1 and Nfix genes were reduced in patients with thyroid ophthalmopathy compared to normal subjects (see Preparation Example 1 and Example 2).

[0056] In another example, using a hypertrophic thyroid eye disease mouse model, the difference in gene expression levels between the treatment group and the disease group was confirmed using a heatmap, feature plot, and violin plot using single cell RNA sequencing results, and it was confirmed that the expression levels of Sox6, Six1, and Nfix genes were increased in the treatment group compared to the disease group (see Examples 3 and 4).

[0057] In another embodiment, using a thyroid eye disease hypertrophy mouse model, the difference in gene expression levels between the treatment group and the disease group was analyzed using single cell RNA sequencing results to identify a network between target genes, and it was confirmed that Sox6, Six1, and Nfix genes were correlated with genes related to differentiation and fibrosis of muscle cells that induce hypertrophy (see Example 5).

[0058] According to another embodiment, in a thyroid eye disease muscle hypertrophy model, muscle area measurement and fibrosis evaluation of the diseased group, the treatment group, and the normal group were confirmed through Hematoxylin & Eosin staining and Masson's trichrome staining. As a result, the muscle area in the diseased group was confirmed to have increased by about 1.8 times compared to the normal group, and in the treatment group, it was confirmed to have decreased by about 28% compared to the diseased group. It was confirmed that the fibrotic area was large in the diseased group compared to the normal group, and it was confirmed that the fibrotic area was reduced in the treatment group (see Example 6).

[0059] In another embodiment, using a thyroid ophthalmopathy hypertrophy mouse model, clusters and gene expression levels for representative marker genes for each muscle fiber type and muscle fiber differentiation-related marker genes in the treatment group and the disease group were confirmed over similar time. As a result, it was confirmed that, unlike the disease group, in the treatment group, differentiation (commitment) for all clusters was reduced based on the branch point over similar time. In addition, in the case of gene expression, unlike the disease group, in the treatment group, expression of representative marker genes (Myh7, Myh2, Mhy1, and Mhy4) for each muscle fiber type was decreased, and in the case of representative marker genes related to differentiation, expression of Six1 and Nfix was increased, and expression of Eya1 and Sox6 was decreased (see Example 7).

[0060] In another example, as a result of correlation analysis of the Six1 gene and the Eya1 gene in patients with thyroid ophthalmopathy, it was confirmed that in thyroid ophthalmopathy patient cells with overexpression of Six1 and lack of Eya1, the mRNA expression of Myh1 and Myh4, which are marker genes of fast twitch fiber types IIX and IIB, was significantly reduced, thereby confirming that regulation of the expression of Six1 and Eya1 proteins or genes plays a key role in the differentiation process of fast twitch fibers that induces thyroid ophthalmopathy muscle hypertrophy (see Example 8).

[0061] As described above, the identification of thyroid ophthalmopathy is divided according to the measurement of the presence or absence of ocular changes, and there has been no research to discover protein biomarkers that can diagnose extraocular muscle hypertrophy or extraocular muscle fibrosis caused by thyroid ophthalmopathy, or proptosis, strabismus, diplopia, decreased visual acuity, or blindness caused by these, or to diagnose the severity of thyroid ophthalmopathy and to use them to determine the course of treatment.

[0062] Accordingly, a solution to the above-mentioned problem was sought by providing a protein biomarker capable of diagnosing thyroid ophthalmopathy, particularly extraocular muscle hypertrophy or extraocular muscle fibrosis caused by thyroid ophthalmopathy. A biomarker composition comprising a protein or fragment thereof according to a specific aspect enables the early diagnosis of thyroid ophthalmopathy, thereby enabling a more detailed and accurate diagnosis of the cause of thyroid ophthalmopathy, thereby providing a personalized treatment method for each patient.

[0063]

[0064] Another aspect provides a composition for diagnosing thyroid ophthalmopathy, comprising an agent for measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0065] The above "Sox6 gene", "Eya1 gene", "Six1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment" or "thyroid ophthalmopathy" may be within the above-mentioned range.

[0066] In one specific example, the formulation may comprise a primer, probe, antisense nucleotide, antibody, antibody fragment, antibody mimetic, aptamer, avidity multimer, peptidomimerics, peptide or compound that specifically binds to the gene, the polynucleotide or the polypeptide or fragment thereof.

[0067] Specifically, when the agent is a agent for measuring the expression level of the gene or the polynucleotide, the agent may include a primer, probe, antisense nucleotide, peptide or compound that specifically binds to the gene or the polynucleotide, and since the base sequence of the gene is known, a person skilled in the art can design a primer, probe, antisense nucleotide, peptide or compound that specifically binds to the mRNA of these genes based on the sequence.

[0068] The term "primer" refers to a short nucleic acid sequence with a free 3' hydroxyl group that can form base pairs with a complementary template and serves as a starting point for copying the template strand. A primer can initiate DNA synthesis in the presence of a polymerization reagent (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. Furthermore, a primer may incorporate additional features that do not alter the basic properties of the primer, which serves as the starting point for DNA synthesis, as sense and antisense nucleotides with a sequence of 7 to 50 nucleotides. The sequence of the primer need not be exactly identical to that of the template, but must be sufficiently complementary to hybridize with the template. The position or primer binding site of a primer may refer to the target DNA fragment to which the primer hybridizes. According to one specific example, diagnosis can be made by measuring the amount of a desired product produced by performing PCR amplification using sense and antisense primers of the mRNA of the gene. PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

[0069] In one specific example, when the formulation comprises a primer, the formulation may comprise a primer that specifically binds to at least one selected from the group consisting of a polynucleotide encoded by a Sox6 gene, a polynucleotide encoded by an Eya1 gene, a polynucleotide encoded by a Six1 gene, and a polynucleotide encoded by an Nfix gene.Specifically, the primer may be at least one selected from the group consisting of a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, a polynucleotide consisting of the base sequence of SEQ ID NO: 3, a polynucleotide consisting of the base sequence of SEQ ID NO: 4, a polynucleotide consisting of the base sequence of SEQ ID NO: 5, a polynucleotide consisting of the base sequence of SEQ ID NO: 6, a polynucleotide consisting of the base sequence of SEQ ID NO: 7, and a polynucleotide consisting of the base sequence of SEQ ID NO: 8, and more specifically, the primer that specifically binds to the polynucleotide encoded by the Sox6 gene may be at least one selected from the group consisting of a polynucleotide consisting of the base sequence of SEQ ID NO: 1 and a polynucleotide consisting of the base sequence of SEQ ID NO: 2, and the primer that specifically binds to the polynucleotide encoded by the Eya1 gene may be at least one selected from the group consisting of a polynucleotide consisting of the base sequence of SEQ ID NO: 3 and a polynucleotide consisting of the base sequence of SEQ ID NO: 4, and the primer that specifically binds to the polynucleotide encoded by the Six1 ... The primer that specifically binds to the polynucleotide may be at least one selected from the group consisting of a polynucleotide consisting of a base sequence of SEQ ID NO: 5 and a polynucleotide consisting of a base sequence of SEQ ID NO: 6, and the primer that specifically binds to the polynucleotide encoded by the Nfix gene may be at least one selected from the group consisting of a polynucleotide consisting of a base sequence of SEQ ID NO: 7 and a polynucleotide consisting of a base sequence of SEQ ID NO: 8.

[0070] In addition, the polynucleotide consisting of the base sequence of the above sequence number 1 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 1.

[0071] In addition, the polynucleotide consisting of the base sequence of the above sequence number 2 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 2.

[0072] In addition, the polynucleotide consisting of the base sequence of the above sequence number 3 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 3.

[0073] In addition, the polynucleotide consisting of the base sequence of the above sequence number 4 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 4.

[0074] In addition, the polynucleotide consisting of the base sequence of the above sequence number 5 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 5.

[0075] In addition, the polynucleotide consisting of the base sequence of the above sequence number 6 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 6.

[0076] In addition, the polynucleotide consisting of the base sequence of the above sequence number 7 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 7.

[0077] In addition, the polynucleotide consisting of the base sequence of the above sequence number 8 may be a polynucleotide consisting of a base sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more with the base sequence of the sequence number 8.

[0078] The term "probe" refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to several hundred bases in length, that can specifically bind to a polynucleotide, especially mRNA, and is labeled so that the presence or absence of a specific mRNA and the level of expression can be confirmed.

[0079] In one specific example, the probe may be produced in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc. The selection of an appropriate probe and hybridization conditions may be modified based on those known in the art.

[0080] The term "antisense nucleotide" means a nucleic acid-based molecule having a complementary sequence to a targeted Sox6, Eya1, Six1 or Nfix gene and capable of forming a dimer with the Sox6, Eya1, Six1 or Nfix gene, and can be used to detect the Sox6, Eya1, Six1 or Nfix gene.

[0081] The antisense nucleotide may be the gene, the polynucleotide, or a fragment thereof, or a complementary one thereof. The fragment may have nucleotides of 5 nt or more, 10 nt or more, 10 to 1000 nt, 10 to 500 nt, 15 to 500 nt, 15 to 300 nt, 15 to 200 nt, or 15 to 150 nt, but an appropriate length may be selected to increase detection specificity.

[0082] The above primers or probes can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using many means known in the art. Such modifications include, for example, methylation, capping, substitution with one or more homologs of a natural nucleotide, and modification between nucleotides, for example, modification with uncharged linkers such as methyl phosphonate, phosphotriester, phosphoramidate, carbamate, etc., or with charged linkers such as phosphorothioate, phosphorodithioate, etc.

[0083] According to one specific example, the "expression level of the gene or polynucleotide" may be identifiable by measuring the expression level of the mRNA of the gene or the expression level of the protein encoded by the gene. As an example, a gene with a difference in expression level may be utilized as a marker, and specifically, based on the expression level of the gene, the presence or absence of thyroid ophthalmopathy, the severity (severity) of thyroid ophthalmopathy, extraocular muscle hypertrophy or extraocular muscle fibrosis due to thyroid ophthalmopathy, and the possibility of exophthalmos, strabismus, diplopia, decreased vision, or blindness due to thyroid ophthalmopathy may be determined.

[0084] Methods for measuring the expression level of the above gene or polynucleotide include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or DNA chips.

[0085] Additionally, specifically, when the formulation is a formulation for measuring the expression level of the polypeptide or a fragment thereof, the formulation may include an antibody, antibody fragment, antibody mimetic, aptamer, avidity multimer, peptidomimerics, peptide or compound that specifically binds to the polypeptide or a fragment thereof.

[0086] The term "antibody" is a term known in the art and can mean a specific protein molecule directed against an antigenic site. The form of the antibody according to one aspect is not particularly limited and may include a polyclonal antibody, a monoclonal antibody, or a part thereof as long as it has antigen binding property, and all immunoglobulin antibodies may be included, and further, special antibodies such as humanized antibodies may also be included. The antibody according to one aspect may include a complete form having two full-length light chains and two full-length heavy chains, as well as a functional fragment of an antibody molecule. A functional fragment of an antibody molecule means a fragment that has at least an antigen binding function, and may be, for example, Fab, F(ab'), F(ab')2, Fv, etc.

[0087] The above "measuring the expression level of a polypeptide or fragment thereof" is a process of confirming the presence and expression level of a polypeptide or fragment thereof encoded by the gene in a sample of a subject, and may be a process of measuring the amount of the polypeptide or fragment thereof, or may be a process that can be confirmed by measuring the expression level of a polynucleotide encoding the polypeptide or fragment thereof, for example, mRNA.

[0088] Methods for measuring the expression level of the polypeptide or fragment thereof include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, mass spectrometry, fluorescence activated cell sorter (FACS), or protein chip.

[0089]

[0090] Another aspect provides a kit for diagnosing thyroid ophthalmopathy comprising the composition.

[0091] The above "Six1 gene", "Eya1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment" or "thyroid ophthalmopathy" may be within the above-mentioned range.

[0092] In one specific example, the kit may be a real-time PCR (RT-PCR) kit, a microarray kit, or a Serial Analysis of Gene Expression (SAGE) kit.

[0093] As a specific example, the kit may be a kit containing the essential components required for performing RT-PCR. For example, the RT-PCR kit may include, in addition to each primer specific for a miRNA gene, a test tube or other appropriate container, a reaction buffer (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC water, sterile water, etc. In addition, the kit may include a primer pair specific for DNA, RNA, or miRNA used as a quantitative control.

[0094] Additionally, a kit according to the aspect may include a kit for extracting proteins or nucleic acids (e.g., total RNA) from body fluids, cells or tissues, a fluorescent substance for labeling, an enzyme and medium for nucleic acid amplification, and instructions for use.

[0095] In addition, the kit is a device for measuring a thyroid ophthalmopathy marker, wherein the gene, the polynucleotide, or the polypeptide or a fragment thereof is bound or attached to, for example, a solid phase. Examples of the material of the solid phase include plastic, paper, glass, silicone, etc., and a preferred material of the solid phase is plastic due to its ease of processing. The shape of the solid phase is arbitrary, and may be, for example, square, circular, rectangular, film-shaped, etc.

[0096] The above microarray chip may include polynucleotide probes composed of DNA or RNA. A microarray refers to a device in which the probes are immobilized at a high density on distinct regions of a substrate surface. Furthermore, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art.

[0097] The protein chip kit can measure, for example, the expression level of the polypeptide or a fragment thereof. The protein chip kit can include a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, a chromogenic substrate, etc. for immunological detection of antibodies. Peroxidase, alkaline phosphatase, etc. can be used as the chromogenic enzyme. In addition, FITC, RITC, etc. can be used as the fluorescent substance, and ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)), OPD (o-phenylenediamine), TMB (tetramethyl benzidine), etc. can be used as the chromogenic substrate. The kit can also include an instruction manual.

[0098]

[0099] Another aspect provides a method for providing information for diagnosing thyroid ophthalmopathy, comprising the step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy.

[0100] The above "Sox6 gene", "Eya1 gene", "Six1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment", "thyroid ophthalmopathy" or "measurement of expression level" may be within the above-mentioned range.

[0101] The term "subject" is interpreted to mean mammals, including humans, primates including chimpanzees, pets such as dogs and cats, livestock such as cattle, horses, sheep and goats, and rodents such as mice and rats, that are susceptible to or have developed thyroid ophthalmopathy.

[0102] Additionally, the term "biological sample" includes a biological sample, such as blood, plasma, serum, urine, mucus, saliva, tears, tissues, or cells, from which a gene, polynucleotide, or polypeptide or fragment thereof can be identified, which can be specifically possessed by an individual with thyroid ophthalmopathy that can be distinguished from a normal state. Specifically, the biological sample may be orbital tissue or surrounding tissue or cells thereof, and more specifically, orbital muscle tissue or cells thereof.

[0103] In one specific example, the step of measuring the expression level may be measuring at least one selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, DNA chip, Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip.

[0104] Specifically, methods for measuring the expression level of the gene or polynucleotide include, for example, RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or DNA chips.

[0105] In one specific example, the step of measuring the expression level of the gene or polynucleotide can be performed using a preparation including a primer, and the primer can be, for example, at least one selected from the group consisting of a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, a polynucleotide consisting of a base sequence of SEQ ID NO: 4, a polynucleotide consisting of a base sequence of SEQ ID NO: 5, a polynucleotide consisting of a base sequence of SEQ ID NO: 6, a base sequence of SEQ ID NO: 7, and a polynucleotide consisting of a base sequence of SEQ ID NO: 8.

[0106] In addition, the expression level of the polypeptide or fragment thereof can be measured using an antibody. An antibody specific for the polypeptide or fragment thereof in a sample forms a complex, i.e., an antigen-antibody complex, and the amount of the antigen-antibody complex formed can be quantitatively measured through the size of the signal of a detection label. Such a detection label can be selected from the group consisting of enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioisotopes. Examples of analytical methods for measuring the level of the polypeptide or fragment thereof include Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation analysis, complement fixation analysis, FACS, or protein chips.

[0107] In one specific embodiment, the method may further include a step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy, and comparing the measured expression level with the expression level measured in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy.

[0108] In addition, in one specific embodiment, the method may further include a step of determining thyroid ophthalmopathy when the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having the thyroid ophthalmopathy, is lower than the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample isolated from an individual not having the thyroid ophthalmopathy.

[0109] In addition, in one specific embodiment, the method comprises the steps of: measuring the expression level of one or more selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having the thyroid ophthalmopathy; and measuring the expression level of one or more selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having the thyroid ophthalmopathy. If the expression level is higher than one or more of the selected levels, a step of determining thyroid ophthalmopathy may be further included.

[0110] More specifically, the method comprises the steps of: measuring at least one expression level selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having the thyroid ophthalmopathy, lower than the expression level selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample isolated from an individual not having the thyroid ophthalmopathy;

[0111] When the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having the above thyroid ophthalmopathy, is higher than the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample isolated from an individual not having the above thyroid ophthalmopathy, Additional steps may be included to determine whether thyroid ophthalmopathy is present.

[0112] In one specific example, the method comprises: identifying a change in the expression level of one or more genes selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, and converting this into a clinical activity score (CAS) to determine the presence or absence of thyroid ophthalmopathy, the severity (severity) of thyroid ophthalmopathy, and extraocular muscle hypertrophy or It can be used to evaluate the possibility of extraocular muscle fibrosis, proptosis, strabismus, diplopia, decreased vision, or blindness due to thyroid ophthalmopathy.

[0113]

[0114] Another aspect comprises the steps of treating a biological sample isolated from an individual with thyroid ophthalmopathy with a candidate substance; and

[0115] The present invention provides a method for screening a therapeutic agent for thyroid ophthalmopathy, comprising the step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in the biological sample.

[0116] The above "Sox6 gene", "Eya1 gene", "Six1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment", "thyroid ophthalmopathy" or "measurement of expression level" may be within the above-mentioned range.

[0117] In one specific example, the step of measuring the expression level of the gene or polynucleotide can be performed using a preparation including a primer, and the primer can be, for example, at least one selected from the group consisting of a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, a polynucleotide consisting of a base sequence of SEQ ID NO: 4, a polynucleotide consisting of a base sequence of SEQ ID NO: 5, a polynucleotide consisting of a base sequence of SEQ ID NO: 6, a base sequence of SEQ ID NO: 7, and a base sequence of SEQ ID NO: 8.

[0118] In one specific embodiment, the method may further include a step of measuring the expression level of one or more selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in a biological sample isolated from an individual having thyroid ophthalmopathy, and comparing the measured expression level with the expression level measured in a biological sample treated with the candidate substance.

[0119] In addition, in one specific example, the method may further include a step of selecting the candidate substance as a therapeutic agent for thyroid ophthalmopathy, when the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample treated with the candidate substance, is higher than the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample not treated with the candidate substance.

[0120] In addition, in one specific example, the method comprises the steps of: measuring the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, the polynucleotide encoded by the Sox6 gene, the polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, the polynucleotide encoded by the Eya1 gene, and the polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample treated with the candidate substance, lower than the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, the polynucleotide encoded by the Sox6 gene, the polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, the polynucleotide encoded by the Eya1 gene, and the polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample not treated with the candidate substance; A further step may be included in screening for treatment of thyroid eye disease.

[0121] More specifically, the method is characterized in that the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, the polynucleotide encoded by the Six1 gene, the polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, the polynucleotide encoded by the Nfix gene, and the polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample treated with the candidate substance, is higher than the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, the polynucleotide encoded by the Six1 gene, the polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, the polynucleotide encoded by the Nfix gene, and the polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample not treated with the candidate substance.

[0122] If the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, the polynucleotide encoded by the Sox6 gene, the polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, the polynucleotide encoded by the Eya1 gene, and the polypeptide encoded by the Eya1 gene or a fragment thereof measured in the biological sample treated with the candidate substance is lower than the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, the polynucleotide encoded by the Sox6 gene, the polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, the polynucleotide encoded by the Eya1 gene, and the polypeptide encoded by the Eya1 gene or a fragment thereof measured in the biological sample not treated with the candidate substance, the method further includes a step of selecting the candidate substance as a therapeutic agent for thyroid ophthalmopathy. Can be.

[0123]

[0124] Another aspect provides a pharmaceutical composition for preventing or treating thyroid ophthalmopathy, comprising at least one expression promoter selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0125] The above "Six1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment" or "thyroid ophthalmopathy" may be within the above-mentioned range.

[0126] The above promoter may exhibit a preventive or therapeutic effect on thyroid ophthalmopathy by promoting the expression of at least one selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, and specifically, may exhibit a preventive or therapeutic effect on orbital muscle hypertrophy or orbital muscle fibrosis caused by thyroid ophthalmopathy, and more specifically, may exhibit a preventive or therapeutic effect on eye extrusion, strabismus, diplopia, decreased vision, or blindness resulting therefrom.

[0127] The term “prevention” may mean any action that inhibits or delays the onset of thyroid ophthalmopathy in a subject by administration of a pharmaceutical composition according to one aspect.

[0128] The term “treatment” may mean any action by which the symptoms of thyroid ophthalmopathy in a subject are improved or beneficially altered by administration of a pharmaceutical composition according to one aspect.

[0129] The term "administration" means introducing a given substance into an individual in an appropriate manner.

[0130] Additionally, the pharmaceutical composition may be provided as a pharmaceutical composition containing only the active ingredient, or including one or more pharmaceutically acceptable carriers, excipients or diluents.

[0131] Specifically, the carrier may be, for example, a colloidal suspension, a powder, a saline solution, a lipid, a liposome, microspheres, or nano-spheres. These may be complexed or associated with a carrier vehicle and may be transported in vivo using carrier systems known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances, or fatty acids.

[0132] When the above pharmaceutical composition is formulated, it can be prepared using diluents or excipients such as lubricants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants that are commonly used. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and such solid preparations can be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the above composition. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin. When manufacturing in the form of eye drops, known diluents or excipients may be used.

[0133] In one aspect, the pharmaceutical composition may further comprise a thyroid ophthalmopathy treatment agent in addition to the expression promoter.

[0134] The above pharmaceutical composition may be provided mixed with another thyroid ophthalmopathy treatment agent, and the other thyroid ophthalmopathy treatment agent may be a pharmaceutical composition for preventing or treating thyroid ophthalmopathy, which comprises at least one expression inhibitor selected from the group consisting of a conventionally known thyroid ophthalmopathy treatment agent or a newly developed thyroid ophthalmopathy treatment agent or a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof.

[0135] When the above pharmaceutical composition further includes another thyroid ophthalmopathy treatment agent, it is important to mix the agents in an amount that can achieve the maximum effect with the minimum amount without causing side effects, which can be easily determined by a person skilled in the art.

[0136] Furthermore, in one specific embodiment, the pharmaceutical composition may be administered alone or in combination with another thyroid ophthalmopathy treatment agent. That is, the pharmaceutical composition may be administered in combination with a known composition having a preventive or therapeutic effect on thyroid ophthalmopathy or another thyroid ophthalmopathy treatment agent, and may be administered simultaneously, separately, or sequentially, and may be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be readily determined by those skilled in the art.

[0137] The above pharmaceutical composition can be administered orally or parenterally, and when administered parenterally, the method of injection can be selected from external application to the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intraarterial injection, intramedullary injection, intracardiac injection, intrathecal injection, percutaneous injection, intranasal injection, intraenteric injection, local injection, sublingual injection, rectal injection, or intrathoracic injection.

[0138] The pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and the excretion rate, the duration of treatment, concomitant drugs, and other factors well known in the medical field. Specifically, the pharmaceutical composition can be administered at 0.001 to 4,700 mg / kg / day, and more specifically, at 0.1 to 4,000 mg / kg / day. The administration may be administered once a day or in several divided doses. For example, it may be administered every other day or once a week.

[0139]

[0140] Another aspect provides a method for preventing or treating thyroid ophthalmopathy, comprising administering to a subject in need thereof at least one expression promoter selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0141] The above "Six1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment", "expression promoter", "subject", "administration", "thyroid ophthalmopathy", "prevention" or "treatment" may be within the scope described above.

[0142] In one specific example, the expression promoter may be administered alone or in combination with another thyroid ophthalmopathy treatment agent, and the other thyroid ophthalmopathy treatment agent may be a conventionally known thyroid ophthalmopathy treatment agent or a newly developed thyroid ophthalmopathy treatment agent, or one or more expression inhibitors selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof.

[0143] That is, the above-mentioned expression promoter can be administered in combination with a known composition having a preventive or therapeutic effect on thyroid ophthalmopathy or with another thyroid ophthalmopathy treatment agent, and can be administered simultaneously, separately, or sequentially, and can be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that achieves maximum effect with the minimum amount without side effects, and this can be readily determined by those skilled in the art.

[0144]

[0145] Another aspect provides the use of one or more expression promoters selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof for the manufacture of a medicament for preventing or treating thyroid ophthalmopathy.

[0146] The above "Six1 gene", "Nfix gene", "polynucleotide", "polypeptide", "fragment", "expression promoter", "thyroid ophthalmopathy", "prevention" or "treatment" may be within the above-mentioned scope.

[0147]

[0148] Another aspect provides a pharmaceutical composition for preventing or treating thyroid ophthalmopathy, comprising at least one expression inhibitor selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof.

[0149] The above "Sox6 gene", "Eya1 gene", "polynucleotide", "polypeptide", "fragment", "thyroid ophthalmopathy", "prevention" or "treatment" may be within the above-mentioned scope.

[0150] The above inhibitor may exhibit a preventive or therapeutic effect on thyroid ophthalmopathy by inhibiting the expression of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, and specifically, may exhibit a preventive or therapeutic effect on orbital muscle hypertrophy or orbital muscle fibrosis caused by thyroid ophthalmopathy, and more specifically, may exhibit a preventive or therapeutic effect on eye extrusion, strabismus, diplopia, decreased vision, or blindness resulting therefrom.

[0151] In one aspect, the pharmaceutical composition may further comprise a thyroid ophthalmopathy treatment agent in addition to the expression inhibitor.

[0152] The above pharmaceutical composition may be provided mixed with another thyroid ophthalmopathy treatment agent, and the other thyroid ophthalmopathy treatment agent may be a pharmaceutical composition for preventing or treating thyroid ophthalmopathy, which includes at least one expression promoter selected from the group consisting of a conventionally known thyroid ophthalmopathy treatment agent or a newly developed thyroid ophthalmopathy treatment agent or a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0153] When the above pharmaceutical composition further includes another thyroid ophthalmopathy treatment agent, it is important to mix the agents in an amount that can achieve the maximum effect with the minimum amount without causing side effects, which can be easily determined by a person skilled in the art.

[0154] Furthermore, in one aspect, the pharmaceutical composition may be administered alone or in combination with another thyroid ophthalmopathy treatment agent. That is, the pharmaceutical composition may be administered in combination with a known composition having a preventive or therapeutic effect on thyroid ophthalmopathy or another thyroid ophthalmopathy treatment agent, and may be administered simultaneously, separately, or sequentially, and may be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be readily determined by those skilled in the art.

[0155]

[0156] Another aspect provides a method for preventing or treating thyroid ophthalmopathy, comprising administering to a subject in need thereof at least one expression inhibitor selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof.

[0157] The above "Sox6 gene", "Eya1 gene", "polynucleotide", "polypeptide", "fragment", "expression inhibitor", "subject", "administration", "thyroid ophthalmopathy", "prevention" or "treatment" may be within the above-mentioned scope.

[0158] In one specific example, the expression inhibitor may be administered alone or in combination with another thyroid ophthalmopathy treatment agent, and the other thyroid ophthalmopathy treatment agent may be a conventionally known thyroid ophthalmopathy treatment agent or a newly developed thyroid ophthalmopathy treatment agent, or one or more expression promoters selected from the group consisting of a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

[0159] That is, the above expression inhibitor can be administered in combination with a known composition having a preventive or therapeutic effect on thyroid ophthalmopathy or with another thyroid ophthalmopathy treatment agent, and can be administered simultaneously, separately, or sequentially, and can be administered singly or in multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that achieves maximum effect with the minimum amount without causing side effects, and this can be readily determined by those skilled in the art.

[0160]

[0161] Another aspect provides the use of one or more expression inhibitors selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof for the manufacture of a medicament for preventing or treating thyroid ophthalmopathy.

[0162] The above "Sox6 gene", "Eya1 gene", "polynucleotide", "polypeptide", "fragment", "expression inhibitor", "thyroid ophthalmopathy", "prevention" or "treatment" may be within the above-mentioned scope.

[0163]

[0164] According to one aspect, accurate and rapid diagnosis of thyroid ophthalmopathy is possible by measuring the expression level of a biomarker comprising one or more genes selected from the group consisting of the Sox6 gene, the Eya1 gene, the Six1 gene, and the Nfix gene, or a polynucleotide, polypeptide, or a fragment thereof encoded by the genes. In addition, by utilizing the biomarker, not only thyroid ophthalmopathy but also muscle hypertrophy or muscle fibrosis caused by thyroid ophthalmopathy can be diagnosed early, thereby preventing exophthalmos, strabismus, diplopia, decreased vision, or blindness. Furthermore, the biomarker can be utilized to screen for a treatment for thyroid ophthalmopathy, and by controlling the expression level of the biomarker, it can be utilized for the treatment of thyroid ophthalmopathy.

[0165]

[0166] Figure 1 is a diagram confirming the expression of Six1 and Nfix genes in extraocular muscle progenitor cells isolated from a patient with thyroid ophthalmopathy in vitro.

[0167] Figure 2 is a diagram comparing the differences in Six1, Sox6, and Nfix expression levels and the expression levels of fibrosis and hyaluronic acid synthesis genes in the control group (Sham) and treatment group (hPMSC) using a thyroid ophthalmopathy hypertrophy mouse model through a heatmap.

[0168] Figure 3 is a diagram comparing the expression levels of target genes Six1, Sox6, and Nfix in the control group (Sham) and treatment group (hPMSC) using a thyroid ophthalmopathy hypertrophy mouse model using a feature plot and violin plot after single cell RNA sequencing.

[0169] Figure 4 is a diagram showing the network between target genes confirmed after single cell RNA sequencing using a hypertrophic thyroid eye disease mouse model.

[0170] Figure 5 shows the measurement of muscle area and evaluation of fibrosis in orbital cross-section tissue using a thyroid ophthalmopathy hypertrophy mouse model using (A) H&E staining and (B) Masson's trichrome staining.

[0171] Figure 6 shows the results of different trajectory analyses performed over similar time periods in the control group (Sham) and the treatment group (hPMSC) using a thyroid eye disease hypertrophy mouse model: (A) Confirmation of gene expression level and cluster changes over similar time periods, (B) and (C) Confirmation of gene expression level and cluster changes of representative muscle fiber marker genes over similar time periods, (D) and (E) Confirmation of gene expression level and cluster changes of representative muscle fiber differentiation-related marker genes over similar time periods.

[0172] Figure 7 is a diagram confirming the expression of differentiation-related genes in extraocular muscle progenitor cells isolated from normal individuals and patients with thyroid ophthalmopathy.

[0173]

[0174] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0175]

[0176] Manufacturing example

[0177] Manufacturing Example 1. Manufacturing of extraocular muscle progenitor cells isolated from patients with thyroid ophthalmopathy (in vitro model production)

[0178] Extraocular muscle progenitor cells were obtained by disaggregating the extraocular muscle tissue of a patient with thyroid ophthalmopathy with Collagenease Type Ⅱ (0.25 mg / ml; Thermo Fisher Scientific, cat no. 17101015) in a vibrating incubator at 37°C for 1 hour, and then cultured in media containing 20% ​​FBS (Fetal Bovine Serum; Thermo Fisher Scientific) and 1% P / S (Penicillin Streptomycin; Thermo Fisher Scientific) in DMEM / 12. The cultured extraocular muscle progenitor cells (myogenic cells; myoblasts) were then used in Example 2.

[0179]

[0180] Manufacturing Example 2. Manufacturing of a thyroid ophthalmopathy hypertrophy mouse model (in vivo model production)

[0181] To identify the fundamental target genes that induce extraocular muscle hypertrophy in thyroid ophthalmopathy and to verify in vivo the efficacy of placental-derived stem cells, known as a hypertrophy treatment, a thyroid ophthalmopathy mouse animal model was created using 6-week-old female mice. Specifically, pTriEx1.1Neo-hTSHR A-subunit DNA, a plasmid DNA encoding TSHR-subunit A, a component of the thyroid stimulating hormone receptor (TSHR), was provided by Professor Jasvinder Paul S Banga (Department of Ophthalmology, University Hospital Essen, University Duisburg-Essen, Essen, Germany). The DNA was injected into the leg muscles of the mice, followed by intracellular delivery through electrical stimulation. The delivery was performed four times at three-week intervals, and then an immune response period of approximately nine weeks was established. After generating thyroid ophthalmopathy mice, intra-orbitally injected human placenta-derived mesenchymal stem cells (hPMSCs, Cha Biotech, Gyeonggi-do, Republic of Korea) (3 x 10 5 Heatmap, feature plot, and violin plot analysis were performed one week after injection of 30 μl of cells / .

[0182]

[0183] Example

[0184] Example 1. Comparison of gene expression and marker discovery through single cell RNA sequencing in the control (Sham) and treatment (hPMSC) groups in a thyroid ophthalmopathy hypertrophy model (in vivo)

[0185] In an in vivo animal model of hypertrophic thyroid ophthalmopathy, mouse extraocular muscles were isolated and single cell RNA sequencing (Rocket Genomics, Inc.) was performed to investigate the cell types and patterns distributed in the extraocular muscles, and to detect genes that changed in the placental stem cell injection group.

[0186] Specifically, single-cell RNA sequencing was performed using the 10X Chromium Next GEM Single Cell 3'RNA library & Gel Bead Kit v3.1 (10X Genomics, cat no. PN-1000121) to isolate single cells from extraocular muscle tissues of a thyroid ophthalmopathy mouse model, and sequenced using the Illumina NovaSeq 6000 platform. Following this, unique molecular identifier (UMI) was generated according to the 10X Genomics standard seq. protocol, and initial data analysis, barcode table, gene table, and gene expression matrix were performed using Cell Ranger.

[0187] As a result, the differences in gene expression between the disease group (Sham) and the treatment group (hPMSC) were confirmed as a heatmap, and Six1 (Genbank Accession No: NC_0.000014), a gene essential for differentiation of embryonic myoblasts into muscle cells, Sox6 (Genbank Accession No: NC_000011), which suppresses the activity of embryonic myoblasts, and Nfix (Genbank Accession No: NC_000019), which activates myoblasts, were discovered.

[0188]

[0189] Example 2. Confirmation of the expression levels of Six1 and Nfix genes, which are genes involved in the differentiation of extraocular muscle progenitor cells into myofibroblasts from patients with thyroid ophthalmopathy (in vitro).

[0190] In this example, the expression of target genes that differentiate into myofibroblasts that induce muscle hypertrophy and fibrosis from extraocular muscle progenitor cells obtained in the above-mentioned Manufacturing Example 1 was confirmed, and Six1, Nfix, etc. were confirmed in vitro as target genes.

[0191] Specifically, the extraocular muscle progenitor cells obtained in the above manufacturing example 1 were treated with TRIzol TM (Ambion, cat no. 15596018) RNA was isolated with reagent, and cDNA was synthesized at a concentration of 500 μg of RNA, and then the target gene primers (Sox6 Forward: 5′-TAAGCAACTGATGAGGTCTC-3′ (SEQ ID NO: 1), Sox6 Reverse: 5′-AGGCGATGGTGTGGTAGTT-3′ (SEQ ID NO: 2); EYA1 Forward 5′-TGGCATCACCAGCCAAGCAGTT-3′ (SEQ ID NO: 3); EYA1 Reverse 5′-CCATCTGAACCTCGACGCAATC-3′ (SEQ ID NO: 4); Six1 Forward: 5′-CAAGAACGAGAGCGTACTCAAGGC-3′ (SEQ ID NO: 5), Six1 Reverse: 5′-GGTGGTTGTGAGGCGAGAACTG-3′ (SEQ ID NO: 6); Nfix Forward: 5′- qRT-PCR (Quantitative Real-Time PCR) was performed using a QuantStudio TM1 Real-Time PCR instrument using the following primers: GAGAGCCCTGTTGATGACG -3′ (SEQ ID NO: 7), Nfix Reverse: 5'- CTGCAGAAGTCCAGCTTTCC -3′ (SEQ ID NO: 8).

[0192] The expression levels of Six1 and Nfix in myogenic progenitor cells isolated from the extraocular muscles of patients with thyroid ophthalmopathy and the normal group were confirmed by qRT-PCR in vitro. As a result, it was confirmed that the expression of Six1 and Nfix was significantly reduced in the patient group (TAO) compared to the normal group (see Figure 1).

[0193]

[0194] Example 3. Confirmation of the expression levels of Six1, Sox6, and Nfix through heatmap in the control group (Sham) and treatment group (hPMSC) in the thyroid ophthalmopathy hypertrophy model, and confirmation of the expression levels of genes related to fibrosis and hyaluronic acid synthesis (In vivo)

[0195] The expression levels of Six1, Sox6, and Nfix genes discovered in Example 1 were confirmed through a heatmap (R v4.3.1, https: / www.r-project.org / and Seurat v4.3.0, https: / satijalab.org / seurat / ). As a result, it was confirmed that the expression levels of Six1 and Nfix increased in the stem cell treatment group compared to the disease group model, and the expression level of Sox6 decreased (see Fig. 2).

[0196] In addition, it was confirmed that the expression levels of Foxo1, Mstn, TGFβ2, Vim, and Fn1, which are myofibroblast target genes and fibrosis-related genes, were all reduced in the stem cell treatment group compared to the disease group model, and in particular, TGFα2 and Fibronectin were confirmed to be significantly reduced (see Figure 2).

[0197] In addition, it was confirmed that the expression levels of all of the hyaluronan synthase-related genes, HAS1, HAS2, HAS3, and TSG6, which are related to hyaluronic acid synthesis, were reduced, and in particular, it was confirmed that HAS2 was significantly reduced (see Figure 2).

[0198]

[0199] Example 4. Verification of the expression levels of Six1, Sox6, and Nfix in the control (Sham) and treatment (hPMSC) groups in a thyroid ophthalmopathy hypertrophy model using feature plots and violin plots (in vivo).

[0200] The single cell RNA sequencing results of Example 1, which were confirmed in the in vivo model of Manufacturing Example 2, were confirmed by clustering the expression of target genes Six1, Sox6, and Nfix in Sham and hPMSC using feature plot (Seurat v4.3.0) and violin plot (Seurat v4.3.0).

[0201] As a result, in the stem cell treatment group compared to the disease group model, Six1 showed an increase in expression level based on cluster 0 (myocyte cells), Nfix showed an increase in expression level across all 17 clusters, and Sox6 showed a decrease in expression level based on cluster 0. This was also confirmed by using a violin plot of expression levels by cluster (see Figure 3).

[0202]

[0203] Example 5. Network identification between target genes (Six1, Sox6, and Nfix) in the control (Sham) and treatment (hPMSC) groups in a thyroid eye disease hypertrophy model (in vivo)

[0204] The single cell RNA sequencing results of Example 1, confirmed in the in vivo model of Manufacturing Example 2, were visualized as a network between target genes using R v4.3.1 and Seurat v4.3.0 programs.

[0205] As a result, it was confirmed that the target genes (Six1, Sox6, and Nfix) were correlated in the network with genes related to myocyte differentiation (Eyal1, Pax3, Myh1, Myh2, Myh7, Atp2a1) that induce muscle hypertrophy, fibrosis-related genes (MSTN, Smad2, Smad3, Foxo1, Fn1, Ppard, Vim, TGFβ2), and hyaluronan synthase-related genes related to hyaluronic acid synthesis (Has1, Has2, Has3, Hyal1, Hyal2, Tnfaip6) (see Figure 4).

[0206]

[0207] Example 6. Measurement of muscle area and evaluation of fibrosis in the control (Sham) and treatment (hPMSC) groups in a thyroid eye disease hypertrophy model (in vivo)

[0208] From the in vivo model manufactured in the above Manufacturing Example 2 (3 mice per group), orbital sections were collected, fixed on slides, and then pathological analysis was performed.

[0209] Specifically, orbital tissues from thyroid ophthalmopathy were fixed with 4% PFA, dehydrated with ethanol, and embedded in paraffin. For histological analysis, paraffin blocks were cut into 5-μm-thick slices and stained with hematoxylin & eosin and Masson's trichrome using standard protocols. Muscle area was quantified using a ZEISS axio scan and Z1 slide scanner.

[0210] As a result of measuring the muscle cross-sectional area through H&E staining, the muscle was significantly increased by about 1.8 times in the sham (control group) compared to the normal group, and in the hPMSC-treated group (treatment group), the muscle area was observed to decrease by about 28% (p <0.1) compared to the sham (control group) (see Figure 5(A)).

[0211] Meanwhile, when comparing fibrosis in tissues using Masson's trichrome stain, it was confirmed that fibrosis areas were observed more in the sham (control group) than in the normal group, and were reduced in the hPMSC-treated group (treatment group) (see Figure 5(B)).

[0212]

[0213] Example 7. Trajectory analysis of representative markers for each muscle fiber type and markers related to muscle fiber differentiation in the control (Sham) and treatment groups (hPMSC) in a thyroid eye disease hypertrophy model (in vivo)

[0214] Trajectory analysis according to pseudotime was performed through the single cell RNA sequencing results of Example 1 confirmed in the in vivo model of Manufacturing Example 2 above.

[0215] As a result of trajectory analysis, both the disease group model (Sham) and the stem cell treatment group (hPMSCs) model showed the same pattern of having one branch point, but the pattern of gene expression (upper graph of Figure 6A) and cluster (lower graph of Figure 6A) according to similar time were different.

[0216] (1) Trajectory analysis of representative markers by muscle fiber type

[0217] In the case of the trajectory analysis results for representative markers by muscle fiber type, in the case of the disease group model, the gene expression level after the branch point according to the similar time increased, and differentiation (commitment) was well achieved for all clusters according to the muscle fiber type (type I, IIA, IIX, IIB), whereas in the stem cell treatment group model, the gene expression level after the branch point and differentiation (commitment) for all clusters decreased.

[0218] Specifically, as shown in Figures 6B and 6C, in the case of the disease group model, the differentiation state (state) of representative marker genes (Myh7, Myh2, Mhy1, and Mhy4) for each muscle fiber type progressed from 1 to 2 and 3 over similar time, whereas in the case of the stem cell treatment group model, differentiation did not occur further from state 1.

[0219] In addition, in the case of the disease group model, the change in clusters according to pseudotime increased for all types I, IIA, IIX, and IIB, and the expression of representative marker genes (Myh7, Myh2, Mhy1, and Mhy4) for each muscle fiber type increased at 0 and +10 or more based on the x-axis. On the other hand, in the case of the stem cell treatment group model, the change in clusters according to pseudotime was not confirmed, and the expression of representative marker genes (Myh7, Myh2, Mhy1, and Mhy4) for each muscle fiber type decreased at +10 or more based on the x-axis.

[0220] (2) Trajectory analysis of representative markers related to muscle fiber differentiation

[0221] In the case of the trajectory analysis results for markers involved in myofiber differentiation, as shown in Figures 6D and 6E, in the case of the disease group model, the differentiation state (state) of Six1, Eya1, Sox6, and Nfix genes progressed from 1 to 2 and 3 over similar time, whereas in the case of the stem cell treatment group model, differentiation did not proceed further from state 1.

[0222] In addition, in the case of the disease group model, the change in clusters according to pseudotime increased for all of the Six1, Eya1, Sox6, and Nfix genes, and in the case of gene expression, the expression of Six1 and Nfix decreased and the expression of Eya1 and Sox6 increased at 0 and +10 or more on the x-axis. On the other hand, in the case of the stem cell treatment group model, the change in clusters according to pseudotime decreased, and in the case of gene expression, the expression of Six1 and Nfix increased and the expression of Eya1 and Sox6 decreased at 0 and +10 or more on the x-axis, contrary to the disease group model.

[0223] That is, through the above results, it was confirmed that treatment with hPMSCs can be used as a preventive or therapeutic agent for abnormal myofiber differentiation in an animal model of thyroid eye disease.

[0224]

[0225] Example 8. Correlation analysis of Six1 and Eya1 genes in patients with thyroid ophthalmopathy (in vitro)

[0226] The Eya1 gene was knocked down using siRNA in an environment where the expression of Six1 protein was increased by treating extraocular muscle progenitor cells derived from normal individuals and thyroid ophthalmopathy (TAO) patients with His-tag-recombinant Six1 protein. The effect on the expression of representative myofiber genes was analyzed. The sequence of the siRNA used for knockdown was as follows: 5'- UUG UGA GUG AAU UAU UUC CUG (SEQ ID NO: 9).

[0227] As a result, as shown in Fig. 7, when Six1 protein was overexpressed alone, the expression of mRNA of representative factors (Myh7, Myh3, Mhy1, Mhy4, Myh2, DESMIN, and CKMT2) related to the structure and function of muscle fibers was significantly decreased in extraocular muscle progenitor cells of normal subjects, whereas in patients with thyroid ophthalmopathy, the expression of representative factors was significantly increased.

[0228] In contrast, in an environment where only the Eya1 gene was knocked down, the expression of all types of muscle fiber-related factors in extraocular muscle progenitor cells of normal individuals was increased, and in patients with thyroid ophthalmopathy, the expression of mRNA of Myh2 and DESMIN, marker genes of intermediate fiber type IIA, was increased, while the expression of other types of muscle fiber-related factors was decreased or remained unchanged.

[0229] In cells overexpressing Six1 and lacking Eya1, the expression of all types of muscle fiber markers was decreased in normal subjects. In patients with thyroid ophthalmopathy, the mRNA expression of Myh1 and Myh4, marker genes for fast-twitch fiber types IIX and IIB, was significantly decreased, whereas the mRNA expression of Myh7 and Myh3, marker genes for slow-twitch fibers, and Myh2 and Desmin, marker genes for intermediate fiber type IIA, was increased.

[0230] Based on the above results, we confirmed that the regulation of Six1 and Eya1 protein or gene expression may play a key role in the differentiation process of fast-twitch muscle fibers that induce thyroid ophthalmopathy hypertrophy.

Claims

1. A biomarker for diagnosing thyroid ophthalmopathy, comprising at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

2. A biomarker for diagnosing thyroid ophthalmopathy according to claim 1, wherein the thyroid ophthalmopathy causes extraocular muscle hypertrophy or extraocular muscle fibrosis.

3. A biomarker for diagnosing thyroid ophthalmopathy according to claim 1, wherein the thyroid ophthalmopathy causes exophthalmos, strabismus, diplopia, decreased vision, or blindness.

4. A composition for diagnosing thyroid ophthalmopathy, comprising an agent for measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof.

5. A kit for diagnosing thyroid ophthalmopathy comprising the composition of claim 4.

6. A method for providing information for diagnosing thyroid ophthalmopathy, comprising the step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof, in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy.

7. In claim 6, a method for diagnosing thyroid ophthalmopathy further comprises a step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy, and comparing the measured expression level with the measured expression level in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy. Method of providing information.

8. In claim 7, a method for diagnosing thyroid ophthalmopathy further comprises a step of determining thyroid ophthalmopathy when the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, the polynucleotide encoded by the Six1 gene, the polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, the polynucleotide encoded by the Nfix gene, and the polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having thyroid ophthalmopathy, is lower than the expression level of at least one selected from the group consisting of the Six1 (SIX Homeobox 1) gene, the polynucleotide encoded by the Six1 gene, the polypeptide encoded by the Six1 gene or a fragment thereof, the Nfix (Nuclear Factor I / X) gene, the polynucleotide encoded by the Nfix gene, and the polypeptide encoded by the Nfix gene or a fragment thereof, measured in a biological sample isolated from an individual not having thyroid ophthalmopathy. Method of providing information.

9. In claim 7, the expression level of at least one selected from the group consisting of the SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample isolated from an individual suspected of having the thyroid ophthalmopathy is greater than the expression level of the SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, the Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, and a polypeptide encoded by the Eya1 gene or a fragment thereof, measured in a biological sample isolated from an individual not having the thyroid ophthalmopathy. A method for providing information for diagnosing thyroid ophthalmopathy, further comprising a step of determining that thyroid ophthalmopathy is present if the expression level is higher than one or more of the selected levels.

10. A step of treating a biological sample isolated from an individual with thyroid ophthalmopathy with a candidate substance; and A method for screening a therapeutic agent for thyroid ophthalmopathy, comprising a step of measuring the expression level of at least one selected from the group consisting of a SOX6 (SRY-Box Transcription Factor 6) gene, a polynucleotide encoded by the Sox6 gene, a polypeptide encoded by the Sox6 gene or a fragment thereof, an Eya1 (EYA transcriptional coactivator and phosphatase 1) gene, a polynucleotide encoded by the Eya1 gene, a polypeptide encoded by the Eya1 gene or a fragment thereof, a Six1 (SIX Homeobox 1) gene, a polynucleotide encoded by the Six1 gene, a polypeptide encoded by the Six1 gene or a fragment thereof, an Nfix (Nuclear Factor I / X) gene, a polynucleotide encoded by the Nfix gene, and a polypeptide encoded by the Nfix gene or a fragment thereof in the biological sample.

Citation Information

Patent Citations

  • A composition for maintaining the balance of microbiome or skin moisturizing comprising chamaecyparis obtusa fermentation extracts

    KR102872260B1

  • Compositions and methods for treating graves disease

    US20210002641A1

  • KR20220077714A