Microorganism of corynebacterium genus with enhanced lipoate protein ligase activity and uses thereof
By introducing a microorganism with enhanced lipoate protein ligase activity from Corynebacterium glutamicum or Corynebacterium stationis, the challenges of inefficient and polluting L-histidine production are addressed, achieving improved histidine yield and scalability in microbial fermentation.
Patent Information
- Application Number
- PCT/KR2025/007003
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-24
- Filing Date
- 2025-05-23
- Publication Date
- 2025-11-27
AI Technical Summary
Current methods for producing L-histidine through microbial fermentation face challenges such as competition with phosphoribosyl pyrophosphate (PRPP) for nucleotide synthesis precursors, complex biosynthetic processes, and regulatory mechanisms, leading to low efficiency and environmental pollution, and the enzyme ATP phosphoribosyl transferase experiences feedback inhibition by the final product, hindering large-scale industrial production.
Introduction of a microorganism with enhanced lipoate protein ligase activity, specifically from Corynebacterium glutamicum or Corynebacterium stationis, to improve histidine production by optimizing the lipoate protein ligase activity through genetic modification and expression vectors, enhancing the microorganism's ability to produce L-histidine.
The enhanced lipoate protein ligase activity in the modified microorganism increases histidine production capacity, overcoming the limitations of traditional methods and enabling more efficient and environmentally friendly large-scale industrial production of L-histidine.
Abstract
Description
Microorganisms of the genus Corynebacterium with enhanced lipoate protein ligase activity and their uses
[0001] Provided are a microorganism having enhanced lipoate protein ligase activity, a composition for producing histidine comprising the microorganism, and a method for producing histidine comprising a step of culturing the microorganism.
[0002] Cross-citation with related application(s)
[0003] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2024-0067862, dated May 24, 2024, the entire contents of which are incorporated herein by reference.
[0004]
[0005] L-histidine is one of the 20 standard amino acids. While adults do not require large amounts from a nutritional standpoint, it is classified as an essential amino acid for growing children. Furthermore, L-histidine is involved in important physiological processes, including antioxidant and immune regulation, and is used in the medical industry as a raw material for gastric ulcer treatments, circulatory system treatments, and amino acid rehydration solutions.
[0006] Histidine is particularly abundant in hemoglobin, and is primarily produced through protein hydrolysis using blood meal as a raw material. However, this process has drawbacks such as low efficiency and environmental pollution. On the other hand, while L-histidine can be produced through microbial fermentation, large-scale industrialization has not yet been achieved. This is because L-histidine biosynthesis competes with phosphoribosyl pyrophosphate (PRPP), a nucleotide synthesis precursor, and involves a complex biosynthetic process and regulatory mechanisms that require high energy levels.
[0007] The L-histidine production capacity of microorganisms used in fermentation methods has been improved in the past by mutagenesis and mutant selection methods, and by controlling the metabolism of strains through genetic modification. Recently, it has been known that histidine production using microorganisms is biosynthesized through several steps from PRPP. However, among the enzymes involved in histidine biosynthesis, ATP phosphoribosyl transferase, the first enzyme, experiences feedback inhibition by the final product, L-histidine or its derivatives, which poses a problem in the industrial mass production of L-histidine. Due to these complex biosynthetic processes and regulatory mechanisms, producing L-histidine through microbial culture requires an approach from various perspectives related to microbial metabolism.
[0008]
[0009] An example of the present application provides a histidine-producing microorganism having enhanced activity of lipoate protein ligase.
[0010] Another example of the present application provides a composition for producing histidine comprising the microorganism.
[0011] Another example of the present application provides a use of the microorganism for producing histidine.
[0012] Another example of the present application provides the use of the microorganism for the preparation of a composition for producing histidine.
[0013] Another example of the present application provides a method for producing histidine, comprising the step of culturing the microorganism in a medium.
[0014]
[0015] One aspect provides a histidine-producing microorganism having enhanced lipoate protein ligase activity. The histidine may be L-histidine.
[0016] As used herein, lipoate protein ligase (or Lipoate protein ligase A) may be a protein that catalyzes the process of transferring lipoyl to the lipoyl domain of a lipoate-dependent enzyme. The lipoate protein ligase may refer to a lipoate protein ligase protein, a lipoate protein ligase polypeptide, or a protein having lipoate protein ligase activity. The lipoate protein ligase is known in the art, and may be, but is not limited to, the LplA protein encoded by the lplA gene.
[0017]
[0018] In one example, the activity enhancement of the lipoate protein ligase may be achieved by introducing the lipoate protein ligase or a polynucleotide encoding the same, but is not limited thereto, and various methods well known in the art may be applied. In one example, the lipoate protein ligase may be a protein endogenous to the microorganism to be introduced or an exogenous protein.
[0019] In the present specification, introduction of a foreign protein and / or a polynucleotide encoding the same may mean introduction of a protein and / or polynucleotide derived from a microorganism (host cell) belonging to a different genus than the microorganism (host cell) into which the protein and / or polynucleotide is introduced, a microorganism (host cell) belonging to a different species, or another microorganism (host cell) of the same species.
[0020] The lipoate protein ligase and / or the polynucleotide encoding the same may be derived from a microorganism of the genus Corynebacterium. In one example, the lipoate protein ligase and / or the gene encoding the same may be derived from, but is not limited to, Corynebacterium glutamicum or Corynebacterium stationis. The sequence of the lipoate protein ligase derived from Corynebacterium glutamicum or Corynebacterium stationis can be obtained from the NCBI, a known database.
[0021] In one example, the lipoate protein ligase derived from Corynebacterium glutamicum may have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 15.
[0022] In one example, the lipoate protein ligase from Corynebacterium stationenis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 17.
[0023] In one example, the lipoate protein ligase has an amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17 that is at least 70%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98% The lipoate protein ligase may comprise or consist of an amino acid sequence having a sequence homology or sequence identity of at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%. In addition, if it is a protein having such homology or identity and exhibiting lipoate protein ligase activity, a variant of the lipoate protein ligase having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the lipoate protein ligase. For example, if the amino acid sequence has sequence additions or deletions that do not alter lipoate protein ligase activity, naturally occurring mutations, silent mutations or conservative substitutions at the N-terminus, C-terminus and / or within the amino acid sequence.
[0024] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
[0025] The polynucleotide encoding the lipoate protein ligase may refer to a gene encoding the lipoate protein ligase. The polynucleotide encoding the lipoate protein ligase may be prepared based on the amino acid sequence of the lipoate protein ligase, codon information known in the art, and codons preferred in a host microorganism (cell) to be introduced, and may be derived from, but is not limited to, Corynebacterium glutamicum or Corynebacterium stationanis, in one example.
[0026] In one example, the polynucleotide encoding the lipoate protein ligase has an amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17 that is at least 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5% It may encode an amino acid sequence having a sequence homology or sequence identity of at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9%.
[0027]
[0028] In one example, a polynucleotide encoding a lipoate protein ligase from Corynebacterium glutamicum can have, comprise, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 16.
[0029] In one example, the lipoate protein ligase from Corynebacterium stationensis may be encoded by a polynucleotide having, comprising, consisting of, or consisting essentially of the nucleic acid sequence of SEQ ID NO: 18.
[0030] In one example, the polynucleotide encoding the lipoate protein ligase has a nucleic acid sequence of SEQ ID NO: 16 or SEQ ID NO: 18 that is at least 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5% It may comprise or consist of a nucleic acid sequence having a sequence homology or sequence identity of at least 98%, at least 98.5%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9%.
[0031] In the present application, the phrase “a polynucleotide or polypeptide has, includes, consists of, or consists essentially of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or desired function of the polynucleotide or polypeptide is maintained. In one example, a polynucleotide or polypeptide "has, comprises, consists of, or consists essentially of a particular nucleic acid sequence (base sequence) or amino acid sequence" means that the polynucleotide or polypeptide (i) essentially comprises the particular nucleic acid sequence (base sequence) or amino acid sequence, or (ii) is at least 70%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, 93.5% or more, 94% or more, 94.5% or more, 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more or 99.It may mean that it consists of or essentially contains a nucleic acid sequence or amino acid sequence having a homology or identity of 9% or more and maintains the original function and / or the desired function. In one example, the desired function may mean the function of increasing (improving) or providing the histidine production ability of the microorganism.
[0032] In this application, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.
[0033] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.
[0034] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.
[0035] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0036] The polynucleotide encoding the lipoate protein ligase may be introduced into a microorganism using, but is not limited to, a recombinant vector. The recombinant vector may be used as an insertion vector or an expression vector. Expression of the lipoate protein ligase in a microorganism may be performed by culturing a recombinant microorganism comprising a lipoate protein ligase gene, a polynucleotide encoding the lipoate protein ligase, or a recombinant vector comprising the same.
[0037] The introduction of the polynucleotide encoding the lipoate protein ligase or the recombinant vector containing the same into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. The transformation method can be performed by any method for introducing a nucleic acid into a host cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.
[0038] The transformed polynucleotide may be inserted into and positioned within the chromosome of the host cell or may be positioned outside the chromosome. The polynucleotide may be introduced in any form. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal, which are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into the host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as described above may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so as to perform transcriptional regulation (e.g., transcription initiation) of the polynucleotide. Operable linking can be accomplished using genetic recombination techniques known in the art.
[0039] The term "vector" as used herein refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, it may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences for regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself. For example, the target polynucleotide can be inserted into the chromosome via a vector for chromosomal integration. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, such as, but not limited to, homologous recombination. The above vector may further include a selection marker to determine whether the vector has been transformed into a host cell or further, whether the vector has been integrated into the host cell chromosome. The selection marker is used to select cells transformed with the vector or to determine whether the target polynucleotide has been integrated into the chromosome. Markers that confer selectable phenotypes such as drug resistance, nutritional requirements, cytotoxic agent resistance, or expression of surface proteins may be used. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.
[0040] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pDC series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. For example, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.
[0041]
[0042] In this application, the term “enhancement” of polypeptide (protein) activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or the activity before modification. The “intrinsic activity” refers to the activity of a specific polypeptide that the parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.
[0043] In one example, the enhancement can be achieved by introducing an exogenous polypeptide, or by increasing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the degree of activity of the polypeptide, the expression level, or the amount of a product resulting from the activity of the polypeptide.
[0044] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0045] Specifically, the activity enhancement of the polypeptide (protein) of the present application is
[0046] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;
[0047] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;
[0048] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0049] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;
[0050] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);
[0051] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;
[0052] 7) Codon optimization of polynucleotides encoding polypeptides;
[0053] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or
[0054] 9) Control of cellular localization of proteins (polypeptides); or
[0055] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0056] More specifically,
[0057] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.
[0058] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.
[0059] In one example, strengthening of the polypeptide may be accomplished by operably linking a gene encoding the polypeptide to a strong promoter. This can be accomplished by, but is not limited to, a method such as genetic modification to enable the gene encoding the polypeptide to be operated by a strong promoter within the chromosome of the microorganism, or introducing a recombinant vector expressing the gene encoding the polypeptide operably linked to a strong promoter within the microorganism. Examples of known strong promoters include the PlysCP1 promoter (US Patent No. US 8426577 B2), CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. US 10584338 B2), O2 promoter (US Patent No. US 10273491 B2), tkt promoter, yccA promoter, etc., but are not limited thereto.
[0060] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0061] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.
[0062] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0063] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.
[0064] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0065] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.
[0066] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0067]
[0068] In this application, the term "attenuation" of the activity of a polypeptide (protein) encompasses both a decrease in activity or absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0069] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “inactivation, deficiency, reduction, downregulation, deterioration, attenuation” of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.
[0070] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
[0071] Specifically, the weakening of the activity of the polypeptide (protein)
[0072] 1) Deletion of all or part of a gene encoding a polypeptide;
[0073] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;
[0074] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;
[0075] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleic acid bases in the nucleic acid base sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);
[0076] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0077] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;
[0078] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;
[0079] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or
[0080] 9) Controlling the cellular localization of polypeptides; or
[0081] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0082] for example,
[0083] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.
[0084] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0085] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0086] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto. For example, by introducing a mutation in a polynucleotide sequence to form a stop codon, the expression of a gene may be inhibited or weakened, but is not limited thereto. The "stop codon" is a codon that does not specify an amino acid among the codons on mRNA and serves as a signal to indicate the end of the protein synthesis process, and generally, three types of UAA, UAG, and UGA can be used as stop codons.
[0087] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0088] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.
[0089] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0090] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.
[0091] Such attenuation of polypeptide activity may be, but is not limited to, attenuation of the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of the product produced from the polypeptide.
[0092]
[0093] In this application, the term "microorganism (or strain)" may include both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been strengthened or weakened due to reasons such as the insertion of an external gene or the enhancement or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., histidine).
[0094] The microorganism (or strain, recombinant cell) of the present application may be a microorganism having histidine production ability (or production amount) or having improved (or increased) histidine production ability.
[0095] The microorganism of the present application may be a microorganism that does not naturally have histidine production ability, or a microorganism that has histidine production ability but has enhanced histidine production ability by enhancing the activity of lipoate protein ligase, but is not limited thereto. The microorganism with enhanced lipoate protein ligase activity may be a microorganism into which lipoate protein ligase or a polynucleotide encoding the same has been introduced, but is not limited thereto. In one example, the lipoate protein ligase may be derived from Corynebacterium glutamicum or Corynebacterium stationanis. The microorganism with enhanced activity of lipoate protein ligase derived from Corynebacterium glutamicum or Corynebacterium stationanis may have enhanced histidine production ability.
[0096]
[0097] The fact that the microorganism with enhanced activity of the above lipoate protein ligase has improved histidine production ability or histidine production ability may mean that the microorganism has improved histidine production ability compared to a non-modified microorganism, a cell before recombination, a parent strain, or a wild-type strain, or that the microorganism is endowed with histidine production ability, unlike a non-modified microorganism, a cell before recombination, a parent strain, or a wild-type microorganism that does not have histidine production ability.
[0098] According to an example, a microorganism with enhanced lipoate protein ligase activity may have enhanced histidine production capacity compared to a microorganism before introduction or a microorganism before enhancement, i.e., an unmodified microorganism of the same species. In the present application, the term "unmodified microorganism" does not exclude a strain containing a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a strain before the activity of lipoate protein ligase is enhanced, according to an example. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmutated strain", "unmodified microorganism", or "reference microorganism". The enhanced activity of the lipoate protein ligase is as described above.
[0099] In one example, a polynucleotide encoding a lipoate protein ligase in the microorganism may be operably linked to a strong promoter.
[0100] In one example, the microorganism may be a microorganism having further enhanced activity of a glycine transporter, a glycine cleavage system, or both (glycine transporter and glycine cleavage system).
[0101] In this specification, the term "glycine transporter" includes without limitation any protein that has the function of importing glycine into cells, and specifically may be a D-serine / D-alanine / glycine transporter. The glycine transporter may be used interchangeably with the D-serine / D-alanine / glycine transporter or a glycine import protein. The "D-serine / D-alanine / glycine transporter" is a protein that can be involved in the transport of serine, alanine, and glycine, and information on it can be obtained by searching for the D-Serine / D-Alanine / glycine transporter sequence in a known database such as NCBI Genbank. The glycine transporter may specifically be CycA or AapA, and more specifically may be a CycA protein, but is not limited thereto.
[0102] The above "CycA protein" may be involved in the uptake of serine, alanine, and glycine. The CycA protein is encoded by the cycA gene, and the cycA gene is known to exist in microorganisms such as Escherichia coli, Klebsialla pneumoniae, Mycobacterium bovis, Salmonella enterica, Erwinia amylovora, and Corynebacterium stationis.
[0103] In one example, the enhancement of the activity of a glycine transporter in the microorganism may be achieved by introducing into the host microorganism a glycine transporter derived from a microorganism of the genus Corynebacterium, a glycine transporter derived from Escherichia coli, Klebsialla pneumoniae, Mycobacterium bovis, Salmonella enterica, or Erwinia amylovora, or a polynucleotide encoding the same.
[0104] In one example, the glycine transporter derived from a microorganism of the genus Corynebacterium has an amino acid sequence of SEQ ID NO: 23 that is at least 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, It may be a polypeptide comprising or consisting of an amino acid sequence having a homology or identity of 98% or more, 98.5% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more. In addition, it is obvious that if it is an amino acid sequence having the homology or identity and exhibiting an effect corresponding to the protein, it is included within the scope of the present application even if it has an amino acid sequence in which some of the sequences are deleted, modified, substituted, or added.
[0105] In one example, the glycine transporter derived from a microorganism of the genus Corynebacterium may be a polypeptide derived from Corynebacterium stationaris.
[0106] In one example, the glycine transporter derived from Corynebacterium stationenis may comprise or consist of the amino acid sequence of SEQ ID NO: 23 (NCBI Reference No. WP_079005619.1).
[0107]
[0108] In this specification, the term "Glycine Cleavage System" may be any one or more proteins selected from the group consisting of T-protein (GcvT protein), P-protein (GcvP protein), L-protein (GcvL protein), H-protein (GcvH protein) constituting the glycine cleavage system, and LipB and LipA, which are coenzymes of the glycine cleavage system, but is not limited thereto (John E. Cronan, Microbiology and Molecular Biology Reviews., 13 April 2016).
[0109] The above glycine cleavage system may comprise a complex of glycine cleavage enzymes, or one or more glycine cleavage enzymes.
[0110] The above glycine decomposition enzyme may be any one enzyme selected from the group consisting of glycine dehydrogenase, aminomethyltransferase, glycine decarboxylase, and dihydrolipoyl dehydrogenase.
[0111] The glycine cleavage system may comprise one or more subunits selected from the group consisting of a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide. In one example, the glycine cleavage system may comprise a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide. The glycine cleavage system may catalyze a process of converting glycine into carbon dioxide and ammonia, wherein THF (tetrahydrofolate) is converted into mTHF (5,10-methylenetetrahydrofolate), and NAD+ (oxidized nicotine amide dinucleotide) is converted into NADH (reduced nicotine amide dinucleotide) and a hydrogen ion (H+).
[0112] The above glycine cleavage system may be derived from a microorganism of the genus Corynebacterium, including, but not limited to, Corynebacterium stationaris.
[0113] The above glycine cleavage system can be obtained by searching for the Glycine Cleavage System sequence in a known database such as NCBI GenBank.
[0114] In one example, the GcvP protein from Corynebacterium stationenis is GenBank Ref No. WP_066793094.1 (SEQ ID NO: 24), and the GcvT protein is Ref No. WP_066793092.1 (SEQ ID NO: 25) GcvH protein may be composed of the amino acid sequence of WP_066793088.1 (SEQ ID NO: 26), LipA protein may be composed of WP_066797447.1 (SEQ ID NO: 27), and LipB protein may be composed of the amino acid sequence of WP_066797447.1 (SEQ ID NO: 28). In one example, the enhancement of the activity of the glycine cleavage system may be by introducing into the host microorganism one or more selected from the group consisting of GcvP protein, GcvT protein, GcvH protein, LipA protein, and LipB protein derived from a microorganism of the genus Corynebacterium, or a polynucleotide encoding them.
[0115] In one example, the activity of the glycine cleavage system may be enhanced by introducing into the microorganism at least one selected from the group consisting of GcvP protein, GcvT protein and GcvH protein derived from a microorganism of the genus Corynebacterium; and at least one selected from the group consisting of LipA protein and LipB protein.
[0116] In one example, the GcvP protein, GcvT protein, GcvH protein, LipA protein and LipB protein derived from the Corynebacterium genus microorganism have an amino acid sequence of at least 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5% or more, It may be a polypeptide comprising or consisting of an amino acid sequence having a homology or identity of 95% or more, 95.5% or more, 96% or more, 96.5% or more, 97% or more, 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more. In addition, it is obvious that if it is an amino acid sequence having the homology or identity and exhibiting an effect corresponding to the protein, it is included within the scope of the present application even if it has an amino acid sequence in which some of the sequences are deleted, modified, substituted, or added.
[0117] In one example, the glycine cleavage system derived from a microorganism of the genus Corynebacterium (or at least one selected from the group consisting of a GcvP protein, a GcvT protein, a GcvH protein, a LipA protein, and a LipB protein) may be a polypeptide derived from Corynebacterium stationaris.
[0118] In one example, the GcvP protein, GcvT protein, GcvH protein, LipA protein and LipB protein derived from Corynebacterium stationenis may each comprise or consist of the amino acid sequences of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28.
[0119] In one example, the microorganism may be a microorganism having enhanced histidine production ability due to enhanced activity of a glycine transporter, a glycine cleavage system, or both, or having enhanced histidine production ability.
[0120] The above microorganism may additionally include a mutation that increases histidine production, and the location of the mutation and / or the type of gene and / or protein that is the target of the mutation may be included without limitation as long as it increases histidine production. The above recombinant cell may be used without limitation as long as it is a cell capable of transformation.
[0121] The above microorganism may be a microorganism of the genus Corynebacterium (Corynebacterium sp.). The above-mentioned Corynebacterium genus microorganisms are Corynebacterium amycolatum, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, and Corynebacterium pollutisoli. The microorganism may be one or more species selected from the group consisting of, but is not limited to, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.
[0122] In one example, the target strain for comparing whether the histidine productivity is increased may be a parent strain before mutation, or an unmodified microorganism. In one example, the target strain may be a wild-type Corynebacterium strain, such as Corynebacterium glutamicum or Corynebacterium glutamicum ATCC13032 strain. In one example, the target strain may be, but is not limited to, a microorganism in which the activity of the glycine transporter, the glycine cleavage system, or both thereof is enhanced. In one example, the target strain may be Corynebacterium glutamicum KCCM12488P (CA14-0777 strain) or Corynebacterium glutamicum KCCM12489P strain (CA14-0809 strain).
[0123] For example, the microorganism with improved histidine production ability is newly granted histidine production ability, or is about 0.5% or more, about 1% or more, about 1.5% or more, about 2% or more, about 2.1% or more, about 2.5% or more, about 3% or more, about 3.5% or more, about 3.8% or more, about 4% or more, about 5% or more, about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 150% or more, about 200% or more, about 250% or more, about 300% or more, about It may be increased by, but is not limited to, 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, about 1,000% or more, about 1,500% or more, about 2,000% or more, about 2,500% or more, or about 3,000% or more.
[0124] As another example, the microorganism with improved histidine production ability has a histidine production ability of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, about 2 times or more, about 2.5 times or more, about 3 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, about 8 times or more, about 9 times or more, about 10 times or more, about 15 times or more, about 20 times or more, about 25 times or more, or about It can be 30 times or more (the upper limit is not particularly limited, for example, it can be about 1,000 times or less), but is not limited thereto.
[0125] As another example, the microorganism with improved histidine productivity has a histidine productivity of about 0.05 g / L or more, about 0.1 g / L or more, about 0.11 g / L or more, about 0.12 g / L or more, about 0.15 g / L or more, about 0.2 g / L or more, about 0.3 g / L or more, about 0.4 g / L or more, about 0.5 g / L or more, about 0.6 g / L or more, about 0.7 g / L or more, about 0.8 g / L or more, about 0.9 g / L or more, about 1 g / L or more, about 1.1 g / L or more, about 1.2 g / L or more, about 1.3 g / L or more, about 1.4 g / L or more, about 1.5g / L or more, about 1.6g / L or more, about 1.7g / L or more, about 1.8g / L or more, about 1.9g / L or more, about 2.0g / L or more, about 2.5g / L or more, about 3g / L or more, about 3.5g / L or more, about 4g / L or more, about 4.1g / L or more, about 4.2g / L or more, about 4.3g / L or more, about 4.4g / L or more, about 4.5g / L or more, about 4.6g / L or more, about 4.7g / L or more, about 4.8g / L or more, about 4.9g / L or more, about 5g / L or more, about 5.5g / L or more, about 6g / L or more, about 7g / L or more, about 8g / L or more, about 9g / L or more, about 10g / L or more, about It may be 15 g / L or more, about 20 g / L or more, about 25 g / L or more, about 30 g / L or more (the upper limit is not particularly limited, for example, it may be about 100 g / L or less), but is not limited thereto.
[0126] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values equal to or similar to the value following the term “about,” but is not limited thereto.
[0127]
[0128] Another aspect provides a method for producing (or preparing) histidine, comprising a step of culturing the microorganism of the present application in a medium.
[0129] The method for producing histidine of the present application may include a step of culturing the microorganism of the present application in a medium.
[0130] In this application, "cultivation" refers to growing the microorganism under appropriately controlled environmental conditions. The cultivation process of this application can be performed using any suitable medium and culture conditions known in the art. This cultivation process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the cultivation may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0131] In this application, "medium" means a material containing nutrients necessary for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.
[0132] Specifically, culture media for the microorganisms of the present application, such as strains of the genus Corynebacterium, can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.Corynebacterium, USA, 1981)].
[0133] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0134] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0135] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.
[0136] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.
[0137] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.
[0138] Histidine produced by the culture of the present invention may be secreted into the medium or remain within the cells.
[0139] The histidine production method of the present application may additionally include a step of preparing the microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, before the culturing step.
[0140] The histidine production method of the present application may further include a step of recovering histidine from a culture medium (a culture medium in which culture is performed) or a microorganism (e.g., a strain of the genus Corynebacterium). The recovering step may be additionally included after the culturing step.
[0141] The above recovery may be performed by collecting the target histidine using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target histidine may be recovered from the medium or microorganism using a suitable method known in the art.
[0142] Additionally, the histidine production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the histidine production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0143] Another aspect is to provide a composition for producing histidine comprising the microorganism of the present application, a medium in which the microorganism is cultured, or a combination thereof.
[0144] Another aspect provides for the use of the above microorganism for the production of histidine.
[0145] Another aspect provides for the use of the microorganism in the preparation of a composition for producing histidine.
[0146] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing histidine, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.
[0147]
[0148] Culturing microorganisms with enhanced lipoate protein ligase activity of the present invention enables high-yield histidine production. This, in turn, can be expected to facilitate production and reduce manufacturing costs for industrial use.
[0149]
[0150] The present invention will be described in more detail below with reference to the following examples. However, these examples are provided solely to illustrate the present invention, and the scope of the present invention is not limited by these examples.
[0151]
[0152] Example 1: Construction of a recombinant vector for introducing lipoate protein ligase.
[0153] Example 1-1: Construction of plasmids for gene insertion
[0154] The NCgl1518 gene, known as a transposon-encoding gene, was used as an insertion site to insert a gene encoding lipoate protein ligase (lplA) into the Corynebacterium glutamicum chromosome (Appl Microbiol Biotechnol 62, 99-109 (2003)). First, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, using primer pairs of SEQ ID NOs: 1 and 2 and primer pairs of SEQ ID NOs: 3 and 4, respectively. The primer sequences used to perform each PCR are shown in Table 1 below.
[0155] SEQ ID NO: 1GTGAATTCGAGCTCGGTACCCCACTTAAAAAGGTT2AGGGAGCTACCGGGATATCCGCTGTGGGGTTGTG3TTACACAACCCCACAGCGGATATCCCGGTAGCT4CGACTCTAGAGGATCCCCTGGTGCCCAAGTACGC
[0156] PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization reactions were repeated 28 times. As a result, DNA fragments of 500 bp and 506 bp were obtained, respectively. The obtained DNA product was purified using a PCR purification kit (PCR Purification kit, QUIAGEN), and the purified amplified product was treated with the restriction enzyme smaI and then heat-treated at 65°C for 20 minutes. The pDC24 vector (SEQ ID NO: 29; Korean Patent Publication No. KR 10-2024-0167588 A) was cloned using an Infusion Cloning Kit (TaKaRa) according to the provided manual to construct the vector pDC24ΔNCgl1518 for NCgl1518 deletion and target gene insertion.
[0157] Example 1-2: Construction of a plasmid for promoter replacement
[0158] In order to further enhance the activity of the lipoate protein ligase to be introduced, a vector was constructed to replace the wild-type promoter of the lplA gene with the PlysCP1 promoter (US Patent Publication No. US 8426577 B2), a mutant lysC promoter known as a strong promoter.
[0159] Specifically, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032, Escherichia coli K-12 MG1655, Bacillus subtilis 168, and Corynebacterium stationis ATCC 6872 as templates, respectively, and the primers of SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; or SEQ ID NO: 11 and SEQ ID NO: 12, respectively. In addition, the PlysCP1 promoter fragment was obtained using the pDZ-lysCP1 (US Patent Publication No. US 8426577 B2) vector as a template and the primers of SEQ ID NO: 13 and SEQ ID NO: 14. The primer sequences used to perform each of the PCRs are as shown in Table 2 below.
[0160] SEQ ID NO: Name Sequence 5PrimerGATCGAAAGGTGCACAAAGATGAATAACCATTTTGAG6PrimerGGTCAGGGAGCTACCGGGATCTATTGAACTCGCTTAGTC7PrimerGATCGAAAGGTGCACAAAGATGTCCACATTACGCCTGC8PrimerGGTCAGGGGAGCTACCGGGATCTACCTTACAGCCCCCGCCA9PrimerGATCGAAAGGTGCACAAAAGATGTTATTTA TAGACAATCA10PrimerGGTCAGGGAGCTACCGGGATTTAGTAAATCAGATCAAGGA11PrimerGATCGAAAGGTGCACAAGATGAGCCAACATTTTGAAC12PrimerGGTCAGGGAGCTACCGGGATTTAGGGGACGCGCTTTGTCC13PrimerTACACAACCCCACAGCGGATCCATCTTTTGGGPriGTGCGGAG14merCTTTGTGCACCTTTCGATC
[0161] PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization conditions were repeated 28 times. As a result, a 373 bp DNA fragment from the PlysCP1 promoter region, a 1,098 bp DNA fragment from the Corynebacterium glutamicum ATC13032lplA gene region, a 1,056 bp DNA fragment from the Escherichia coli lplA gene region, a 1,035 bp DNA fragment from the Bacillus subtilis lplA gene region, and a 1,098 bp DNA fragment from the Corynebacterium stationani lplA gene region were obtained, respectively.
[0162] PCR was performed using the amplified PlysCP1 promoter and DNA fragments of each lplA gene as templates with primers of SEQ ID NO: 13 and SEQ ID NO: 6; SEQ ID NO: 13 and SEQ ID NO: 8; SEQ ID NO: 13 and SEQ ID NO: 10; or SEQ ID NO: 13 and SEQ ID NO: 12. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 28 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
[0163] As a result, each DNA fragment containing the promoter PlysCP1 and the 1.5 Kb lplA gene encoding each lipoprotein ligase was amplified. The amplified product was purified using a PCR purification kit (PCR Purification kit, QUIAGEN), treated with restriction enzyme EcoRV, and heat-treated at 65°C for 20 minutes. The product was cloned into the pDC24△NCgl1518 vector at a molar concentration (M) ratio of 2:1 using an Infusion Cloning Kit (TaKaRa) according to the provided manual to create vectors pDC24△NCgl1518::PlysCP1_lplA(C.gl), pDC24△NCgl1518::PlysCP1_lplA(E.co), pDC24△NCgl1518::PlysCP1_lplA(B.su), and pDC24△NCgl1518::PlysCP1_lplA(C.st) for introducing the lplA gene into the chromosome.
[0164]
[0165] Example 2: Production of an L-histidine strain with lipoate protein ligase and evaluation of histidine production capacity.
[0166] The four vectors produced in Example 1 above were transformed into Corynebacterium glutamicum KCCM12489P (CA14-0809, U.S. Patent Publication No. US 2022-0205003 A1), a histidine-producing strain, by electroporation.
[0167] To confirm the histidine productivity and glycine reduction effect of the above transformed strains, they were cultured using the following method.
[0168] Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. The composition of the medium used in this example is as follows.
[0169] <Jongbaeji>
[0170] Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4%, pH 7.2
[0171] <Production medium>
[0172] Glucose 5%, ammonium sulfate 2%, monobasic potassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, CSL (corn steep liquor) 2.0%, biotin 200 μg / L, calcium carbonate 30 g / L, pH 7.2
[0173]
[0174] After the culture was completed, the production of L-histidine and L-glycine by the strains was measured using high-performance liquid chromatography (HPLC), and the concentrations are shown in Table 3 below.
[0175] Strain Histidine concentration (g / L) Glycine concentration (g / L) CA14-0809 (parent strain) 5.97 0.46 CA14-0809 △NCgl1518::PlysCP1_lplA (E.co) 5.90.4 CA14-0809 △NCgl1518::PlysCP1_lplA (B.su) 5.90.4 CA14-0809 △NCgl1518::PlysCP1_lplA (C.gl) 6.10.44 CA14-0809 △NCgl1518::PlysCP1_lplA (C.st) 6.20.23
[0176] As can be confirmed in Table 3 above, the parent strain, Corynebacterium glutamicum CA14-0809, produced approximately 5.97 g / L of histidine. Among the strains into which lipoate protein ligase (lplA) was introduced, the CA14-0809 △NCgl1518::PlysCP1_lplA(C.st), a strain expressing lipoate protein ligase derived from Corynebacterium stationanis, produced approximately 6.2 g / L of histidine, showing the highest histidine productivity, and its glycine productivity was reduced by approximately 50% compared to the parent strain.
[0177] The above results confirmed that among the lipoate protein ligases selected in this application, a microorganism expressing a lipoate protein ligase derived from Corynebacterium glutamicum or Corynebacterium stationaris can produce histidine more efficiently.
[0178]
[0179] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A histidine-producing microorganism of the genus Corynebacterium with enhanced lipoate protein ligase activity.
2. A microorganism of the genus Corynebacterium, wherein the lipoate protein ligase in the first paragraph is a LplA (lipoate protein ligase A) protein.
3. In the first paragraph, the activity of the lipoate protein ligase is enhanced by introducing a lipoate protein ligase derived from a microorganism of the genus Corynebacterium or a polynucleotide encoding the same.
4. In the third paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum or Corynebacterium stationaris.
5. In the third paragraph, the lipoate protein ligase derived from a microorganism of the genus Corynebacterium comprises an amino acid sequence of SEQ ID NO: 15 or SEQ ID NO: 17 or a sequence having at least 80% sequence identity therewith.
6. In the first paragraph, the Corynebacterium microorganism is a Corynebacterium microorganism in which the activity of a glycine transporter, a glycine cleavage system, or both thereof is further enhanced.
7. A microorganism of the genus Corynebacterium, wherein the glycine transporter, the glycine cleavage system, or both are derived from Corynebacterium stationarus.
8. In the first paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
9. In any one of paragraphs 1 to 8, the Corynebacterium microorganism has increased histidine production ability compared to a parent strain in which lipoate protein ligase activity is not enhanced.
10. A method for producing histidine, comprising a step of culturing a microorganism of the genus Corynebacterium according to any one of claims 1 to 8 in a medium.
11. A method for producing histidine, further comprising a step of recovering histidine from a medium or microorganism according to the culturing in accordance with paragraph 10.
12. A composition for producing histidine, comprising a microorganism of the genus Corynebacterium according to any one of claims 1 to 8.
Citation Information
Patent Citations
Method for producing l-amino acids in corynebacteria using a glycine cleavage system
KR1020160148006A
Mutant of Corynebacterium glutamicum Producing L-Histidine and Method for Producing L-Histidine Using the Same
KR1020170106685A
Novel D-alanine--D-alanine ligase variant and a method for producing IMP using the same
KR102270701B1
Process for producing L-histidine by fermentation
US4495283A
Cited By
An optimized lipoic acid protein ligase for glycine production in reverse glycine cleavage system and application thereof
CN122427882A