Novel synthetic promoter derived from strain of genus corynebacterium

Abstract

The present invention relates to a novel synthetic promoter derived from a strain of the genus Corynebacterium and, more specifically, to two novel promoters that are variants of known promoters of a strain of the genus Corynebacterium, a recombinant strain comprising one of the two promoters, a vector comprising one of the two promoters, a host cell, and a method for producing a target protein using the host cell.

Description

A novel synthetic promoter derived from a strain of the genus Corynebacterium

[0001] This application claims priority to Republic of Korea Patent Application No. 10-2024-0087809, filed July 3, 2024, the entire disclosure of which is incorporated herein by reference.

[0002] The present invention relates to a novel synthetic promoter derived from a strain of the genus Corynebacterium, and more specifically, to two novel promoters which are mutant forms of known promoters of a strain of the genus Corynebacterium, a new strain comprising one of the two promoters, a vector comprising one of the two promoters, a host cell, and a method for producing a target protein using the host cell.

[0003] Strains of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive strains widely used to produce amino acids such as glutamate, lysine, and threonine. Corynebacterium glutamicum has simple growth conditions, can be cultivated at high concentrations compared to Escherichia coli, and has a stable genome structure, reducing the risk of mutations. Furthermore, it is non-pathogenic and does not produce spores, thus posing no environmental hazards, making it an advantageous strain for industrial use.

[0004] To develop Corynebacterium strains capable of producing high titers of target compounds using genetic and metabolic engineering techniques, it is essential to control the expression intensity of desired genes. Overexpression of specific genes is particularly crucial for mass production and industrialization. Research is ongoing to discover and develop synthetic biology tools to enhance gene expression intensity. However, the discovery of novel genetic sequences that enhance gene expression intensity in strains remains rare.

[0005] Looking at the promoters of previously reported strains of the Corynebacterium genus, novel promoters capable of inducing strong gene expression, named 'H30' and 'H36', were disclosed in Patent Document 1, but there is still a need for the development of novel promoters that exhibit higher expression efficiency.

[0006] Against this backdrop, the inventors of the present invention discovered two novel promoters capable of further overexpressing a target gene in a Corynebacterium glutamicum strain, and confirmed that the expression ability thereof was significantly improved compared to existing promoters, thereby completing the present invention.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] (Patent Document 1) Republic of Korea Publication No. 10-2014-0110134

[0010] The purpose of the present invention is to provide a novel promoter that exhibits strong activity in a strain of the genus Corynebacterium spp.

[0011] Another object of the present invention is to provide a vector comprising the novel promoter and a host cell transformed with the vector.

[0012] Another object of the present invention is to provide a new strain of Corynebacterium glutamicum comprising the novel promoter.

[0013] Another object of the present invention is to provide a method for producing a target protein using the host cell.

[0014] To solve the above-described problem, the present invention provides a promoter comprising a base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0015] In addition, the present invention provides a vector comprising the promoter.

[0016] In the present invention, a gene encoding a target protein can be operably linked to the promoter.

[0017] In the present invention, the expression level of the gene encoding the target protein may be higher than when operably linked to the H36 promoter including the base sequence of SEQ ID NO: 3.

[0018] In addition, the present invention provides a Corynebacterium glutamicum strain 13g (accession number KCTC 15895BP) comprising a promoter comprising a base sequence of SEQ ID NO: 1 and a gene cluster glpFKD encoding glycerol facilitator, glycerol kinase, and glycerol-3-phosphate dehydrogenase.

[0019] In addition, the present invention provides a strain of Corynebacterium glutamicum comprising a promoter having a base sequence of SEQ ID NO: 2, a gene cluster pduCDEGH encoding propanediol dehydratase large subunit PduC, propanediol dehydratase medium subunit PduD, propanediol dehydratase small subunit PduE, propanediol dehydratase reactivase alpha subunit PduG, and propanediol dehydratase reactivase beta subunit PduH. 13gp2 (Accession No. KCTC 15896BP) is provided.

[0020] Additionally, the present invention provides a host cell transformed with the vector.

[0021] In the present invention, the host cell may be derived from a Gram-positive bacterium.

[0022] In the present invention, the Gram-positive bacteria may be Corynebacterium, Bifidobacterium, Rhodococcus, Candida, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Streptomyces, or Bifidobacterium.

[0023] Furthermore, the present invention provides a method for producing a target protein, including a step of culturing the transformed host cell to produce the target protein.

[0024] In the present invention, the method for producing the target protein may additionally include a step of recovering the produced target protein.

[0025] The two novel synthetic promoters according to the present invention are more effective in overexpressing a target gene in a host cell, and thus, a host cell and method capable of mass-producing a useful target protein can be provided using the same.

[0026] Figure 1 is a schematic diagram showing the process by which the J0 promoter and J1 promoter of the present invention are generated by mutation of the H36 promoter inserted into the Corynebacterium glutamicum genome.

[0027] Figure 2 is a schematic diagram of the genome of the Corynebacterium WT bioD::sfGFP strain into which the H36, JO, and J1 promoters were each inserted.

[0028] Figure 3 is a graph comparing the green fluorescence intensities of the H36, JO, and J1 promoters.

[0029] Hereinafter, the present invention will be described in more detail.

[0030] All technical terms used in this invention, unless otherwise defined, have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of this invention.

[0031] All numbers expressing sizes, amounts, and physical properties of features used in this specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that may vary depending on the desired properties sought to be obtained by those skilled in the art utilizing the teachings disclosed herein.

[0032] As previously mentioned, there remains a need for the development of novel promoters that exhibit higher expression efficiency in Corynebacterium spp. Accordingly, the inventors of the present invention have sought solutions to the aforementioned problems by confirming that two novel synthetic promoters, generated by mutation of H36, a synthetic promoter previously known to function in Corynebacterium spp., exhibit significantly improved expression performance.

[0033] Accordingly, the first aspect of the present invention relates to a novel synthetic promoter exhibiting strong promoter activity in a microorganism of the genus Corynebacterium, wherein the promoter may comprise or consist of the base sequences of the following SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0034] acccggtgggtgacctttttaccgtggtcagcgcagcttagttctgcttggaaatacttttgcttacatgtggggttggtgcagcggtagcgaggtagacggataaacagtttggtgggaaacccgacgat gggtaaatcaatgagcatccggtgggtgtgatgacgaaacaccccaggttgggagcattctgggcaggtggaggtgtagtcgagtgcgtctgcttcgatcagggtgtaatcacctgcatcggaagcgccggt gatggtgagtcctagttccgcagtgcggcagatggtgtcagcgatgatgttgccggtagacttcatgggtagagccttttgttggtgtttggttagcttagatacctaaaccttaaccctgacaaaaggct cgtttatttcgggtctacaccgctagcccaggttctgtgatgtaccccaaaaccggaagggcccctaaacgggggaatattaacgggcccagggtggtcgcaccttggttggtagggagtagcatgggatcc (SEQ ID NO: 1)

[0035] ggtacctctatctggtgccctaaacggggggtagagccttttgttggtgtttggttagcttagatacctaaaccttaaccctgacaaaaaggctcgtttattttcgggtctac accgctagcccaggttctgtgatgtaccccaaaaccggaagggcccctaaacgggggaatattaacgggcccagggtggtcgcaccttggttggtaggagtagcatgggatcc (SEQ ID NO: 2)

[0036] In the present invention, the promoter consisting of the base sequence of sequence number 1 is named 'J0', and the promoter consisting of the base sequence of sequence number 2 is named 'J1'.

[0037] As used herein, the term "promoter" refers to a DNA region to which RNA polymerase binds and initiates transcription of a gene operably linked thereto. The promoter sequence can be modified by those skilled in the art to the extent that it has the same or similar activity. Accordingly, a promoter having a sequence identity of, for example, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more with each base sequence of SEQ ID NOs: 1 and 2, and a fragment (hereinafter "variant") comprising a sequence having promoter activity among each base sequence of SEQ ID NOs: 1 and 2, for example, a sequence of a predicted transcription start point and a -10 region, may be included within the scope of the present invention.

[0038] As used herein, the term "homology" refers to the percentage of identity between two polynucleotides or polypeptide moieties. The sequence homology from one moiety to another can be determined by known techniques. For example, homology can be determined by directly aligning sequence information and parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules using readily available computer programs (e.g., BLAST 2.0). Alternatively, homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form a stable duplex between homologous regions, then digesting them with a single-strand-specific nuclease and determining the sizes of the digested fragments.

[0039] In the present invention, the two types of promoters are novel synthetic promoters derived from Corynebacterium glutamicum, and the two types of promoter sequences may match a portion of the entire genome of Corynebacterium glutamicum, but the strong promoter activity of the corresponding sequences is confirmed for the first time in the present invention.

[0040] A second aspect of the present invention relates to two new strains of Corynebacterium glutamicum each comprising the two promoters described above.

[0041] Specifically, the two new strains of Corynebacterium glutamicum may be Corynebacterium glutamicum strain 13g (accession number KCTC 15895BP) including a promoter including the base sequence of sequence number 1 and Corynebacterium glutamicum strain 13gp2 (accession number KCTC 15896BP) including a promoter including the base sequence of sequence number 2.

[0042] More specifically, the Corynebacterium glutamicum strain 13g may include (i) a promoter comprising the base sequence of SEQ ID NO: 1, and (ii) glpFKD, a gene cluster encoding glycerol facilitator, glycerol kinase, and glycerol-3-phosphate dehydrogenase.

[0043] The gene encoding the above glycerol facilitator (glpF), the gene encoding glycerol kinase (glpK), and the gene encoding glycerol-3-phosphate dehydrogenase (glpD) may be derived from Escherichia coli, particularly from Escherichia coli MG1655.

[0044] The amino acid sequence of the above glycerol persylate and the base sequence of the gene encoding the above glycerol persylate are disclosed in a known database such as NCBI. For example, the glycerol persylate may include the amino acid sequence of NCBI Reference Sequence: NP_418362.1 or a portion thereof, or may consist of the amino acid sequence or a portion thereof, and the gene encoding the glycerol persylate may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: NP_418362.1 or a portion thereof, or may consist of the base sequence or a portion thereof.

[0045] The amino acid sequence of the above glycerol kinase and the base sequence of the gene encoding the above glycerol kinase are disclosed in a known database such as NCBI. For example, the glycerol kinase may include the amino acid sequence of NCBI Reference Sequence: NP_418361.1 or a portion thereof, or may be composed of the amino acid sequence or a portion thereof, and the gene encoding the glycerol kinase may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: NP_418361.1 or a portion thereof, or may be composed of the base sequence or a portion thereof.

[0046] The amino acid sequence of the above glycerol-3-phosphate dehydrogenase and the base sequence of the gene encoding the above glycerol-3-phosphate dehydrogenase are disclosed in a known database such as NCBI. For example, the glycerol-3-phosphate dehydrogenase may include the amino acid sequence of NCBI Reference Sequence: NP_417884.1 or a part thereof, or may be made of the amino acid sequence or a part thereof, and the gene encoding the glycerol-3-phosphate dehydrogenase may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: NP_417884.1 or a part thereof, or may be made of the base sequence or a part thereof.

[0047] According to a specific embodiment of the present invention, the glpFKD may include or consist of the base sequence of SEQ ID NO: 4 and the base sequence of SEQ ID NO: 5. Preferably, the glpFKD may sequentially include the base sequence of SEQ ID NO: 4 and the base sequence of SEQ ID NO: 5, or may sequentially consist of these base sequences.

[0048] The above Corynebacterium glutamicum strain 13gp2 may include (i) a promoter comprising a base sequence of SEQ ID NO: 2, and (ii) a gene cluster pduCDEGH encoding propanediol dehydratase large subunit PduC, propanediol dehydratase medium subunit PduD, propanediol dehydratase small subunit PduE, propanediol dehydratase reactivase alpha subunit PduG, and propanediol dehydratase reactivase beta subunit PduH.

[0049] The gene encoding the gene encoding the propanediol dehydratase large subunit PduC, the propanediol dehydratase medium subunit PduD, the propanediol dehydratase small subunit PduE, the propanediol dehydratase reactivase alpha subunit PduG, and the propanediol dehydratase reactivase beta subunit PduH (PduH) may be derived from Klebsiella pneumoniae, particularly Klebsiella pneumoniae KCTC 2952.

[0050] The amino acid sequence of the propanediol dehydratase large subunit PduC and the base sequence of the gene encoding the propanediol dehydratase large subunit PduC are disclosed in known databases such as NCBI. For example, the propanediol dehydratase large subunit PduC may include the amino acid sequence of NCBI Reference Sequence: WP_002915744.1 or a part thereof, or may consist of the amino acid sequence or a part thereof, and the gene encoding the propanediol dehydratase large subunit PduC may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_002915744.1 or a part thereof, or may consist of the base sequence or a part thereof.

[0051] The amino acid sequence of the propanediol dehydratase medium subunit PduD and the base sequence of the gene encoding the propanediol dehydratase medium subunit PduD are disclosed in known databases such as NCBI. For example, the propanediol dehydratase medium subunit PduD may include the amino acid sequence of NCBI Reference Sequence: WP_016161755.1 or a part thereof, or may consist of the amino acid sequence or a part thereof, and the gene encoding the propanediol dehydratase medium subunit PduD may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_016161755.1 or a part thereof, or may consist of the base sequence or a part thereof.

[0052] The amino acid sequence of the propanediol dehydratase small subunit PduE and the base sequence of the gene encoding the propanediol dehydratase small subunit PduE are disclosed in known databases such as NCBI. For example, the propanediol dehydratase small subunit PduE may include the amino acid sequence of NCBI Reference Sequence: WP_004133648.1 or a part thereof, or may consist of the amino acid sequence or a part thereof, and the gene encoding the propanediol dehydratase small subunit PduE may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_004133648.1 or a part thereof, or may consist of the base sequence or a part thereof.

[0053] The amino acid sequence of the propanediol dehydratase reactivase alpha subunit PduG and the base sequence of the gene encoding the propanediol dehydratase reactivase alpha subunit PduG are disclosed in known databases such as NCBI. For example, the propanediol dehydratase reactivase alpha subunit PduG may include the amino acid sequence of NCBI Reference Sequence: WP_014226638.1 or a part thereof, or may consist of the amino acid sequence or a part thereof, and the gene encoding the propanediol dehydratase reactivase alpha subunit PduG may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_014226638.1 or a part thereof, or may consist of the base sequence or a part thereof.

[0054] The amino acid sequence of the propanediol dehydratase reactivase beta subunit PduH and the base sequence of the gene encoding the propanediol dehydratase reactivase beta subunit PduH are disclosed in known databases such as NCBI. For example, the propanediol dehydratase reactivase beta subunit PduH may include the amino acid sequence of NCBI Reference Sequence: WP_004205479.1 or a part thereof, or may consist of the amino acid sequence or a part thereof, and the gene encoding the propanediol dehydratase reactivase beta subunit PduH may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_004205479.1 or a part thereof, or may consist of the base sequence or a part thereof.

[0055] According to a specific embodiment of the present invention, the pduCDEGH may include or consist of the base sequence of SEQ ID NO: 6.

[0056] The two types of promoters according to the present invention can be each inserted into a vector and used for the purpose of mass producing a target protein or target product in a Gram-positive bacterium, particularly a microorganism of the genus Corynebacterium.

[0057] Accordingly, the third aspect of the present invention relates to a vector comprising each of the two promoters described above and a host cell transformed with the vector.

[0058] The term "vector," as used herein, refers to an artificial DNA molecule that carries genetic material capable of expressing a gene of interest in a suitable host, and specifically refers to a DNA construct containing the base sequence of a gene operably linked to suitable regulatory sequences. The regulatory sequences may include, but are not limited to, a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. For the purposes of the present invention, the promoter may be a J0 or J1 promoter.

[0059] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, λMBL3, λMBL4, λⅨII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. The vector usable in the present invention is not particularly limited, and a known expression vector can be used. Examples include, but are not limited to, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pCES208 vectors.

[0060] Additionally, the endogenous promoter within the chromosome can be replaced with a nucleic acid molecule having the promoter activity of the present invention through a vector for chromosomal integration into a host cell. The insertion of the nucleic acid molecule into the chromosome can be achieved by any method known in the art, for example, homologous recombination. Since the vector of the present invention can be inserted into the chromosome by homologous recombination, it may additionally include a selection marker to confirm whether the chromosomal insertion has occurred.

[0061] A selectable marker is used to select cells transformed with a vector, i.e., to confirm the presence of the target nucleic acid molecule. Markers that confer selectable phenotypes, such as drug resistance, nutrient requirements, cytotoxic agent resistance, or surface protein expression, can be used. In an environment treated with a selective agent, only cells expressing the selectable marker will survive or exhibit other phenotypic characteristics, allowing the selection of transformed cells.

[0062] Accordingly, even in the case of a vector in which a target gene is not operably linked to a nucleic acid molecule having the activity of a promoter comprising or consisting of the base sequence of the above-described sequence number 1 or 2 of the present invention, the target gene can be replaced by homologous recombination with an endogenous promoter in a host cell, for example, a microorganism of the genus Corynebacterium. By overexpressing the endogenous gene of the microorganism of the genus Corynebacterium, the activity of the gene can be modified to be enhanced compared to the endogenous activity.

[0063] The term "intrinsic activity" as used herein refers to the activity state of an enzyme that a microorganism originally has in an unmodified state, and "modified to be enhanced compared to intrinsic activity" refers to the newly introduced or enhanced activity of the enzyme compared to the activity of the enzyme before modification.

[0064] As used herein, “enhancement of enzyme activity” includes an increase in activity by increasing endogenous gene activity, amplification of endogenous genes from internal or external factors, deletion of inhibitory regulatory factors of gene expression, increase in gene copy number, introduction of genes from outside, modification of expression regulatory sequences, particularly promoter replacement or modification, and increase in enzyme activity by mutation within a gene.

[0065] In this specification, "modified to be enhanced compared to the intrinsic activity" means that the activity of the microorganism after manipulation is increased compared to the activity of the microorganism before manipulation, such as deletion of a suppression regulator of gene expression or modification of an expression control sequence, or use of an improved promoter.

[0066] In this specification, “overexpression” refers to a higher level of expression than the level at which the corresponding gene is expressed in a cell under normal conditions, and is a concept that includes increasing the amount of expression by replacing the promoter of a gene existing in the genome with a strong promoter or cloning the corresponding gene into an expression vector and transforming the cell.

[0067] In the present invention, a gene encoding a target protein may be operably linked to the promoter. Preferably, the target gene may be operably linked downstream of the promoter or a variant thereof. The term "operably linked" means that the gene required for expression and its regulatory sequence are functionally linked to each other in a manner that enables gene expression.

[0068] As used herein, the term "target protein" or "target product" refers to a protein or product to be overexpressed or mass-produced in a host cell or microorganism. Specifically, any protein or product to be overexpressed or mass-produced in a Gram-positive bacterium, more preferably a microorganism of the genus Corynebacterium, may be included without limitation.

[0069] For example, the vector of the present invention can be linked downstream of a promoter to express a gene encoding a quantifiable protein (hereinafter referred to as a "reporter gene"), thereby measuring the level of promoter activity. Green fluorescent protein (GFP) is preferably used as the reporter gene, but is not limited thereto.

[0070] Accordingly, the expression level of a gene encoding a target protein operably linked to the J0 promoter or J1 promoter according to the present invention may be higher than the expression level of the same target gene operably linked to the H36 promoter comprising the base sequence of SEQ ID NO: 3 below. For example, the expression level of a gene encoding a target protein may be about 1.5 times, about 2 times, or about 3 times higher than when operably linked to the H36 promoter.

[0071] ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct tggttggtag gagtagcatg ggatcc (SEQ ID NO: 3)

[0072] In a specific embodiment of the present invention, the gene expression ability of the J0 promoter and J1 promoter of the present invention was compared and evaluated using the Corynebacterium WT bioD::sfGFP strain. The WT bioD::sfGFP strain is a strain in which a sequence for expressing the fluorescent protein sfGFP with the synthetic promoter H36 is inserted into the gene bioD position of the wild-type Corynebacterium strain. As a result of the comparison of expression ability, as shown in Fig. 3, the Corynebacterium glutamicum strain containing the novel synthetic promoters, the J0 and J1 promoters, exhibited significantly higher fluorescence than the Corynebacterium glutamicum strain containing the existing synthetic promoter, the H36 promoter, confirming that the expression ability of the target gene was significantly improved.

[0073] The host cell according to the present invention is a transformant transformed with the above-described vector.

[0074] The term "transformation" in the present invention refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide includes both an integrated location within the chromosome of the host cell and an extrachromosomal location, as long as it can be expressed in the host cell. Furthermore, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for its own expression. The expression cassette typically includes a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably linked to the polynucleotide. For the purposes of the present invention, the promoter may comprise a nucleic acid molecule having the activity of a promoter comprising or consisting of the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 according to the present invention. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell.

[0075] The method for transforming the vector of the present invention includes any method for introducing nucleic acids into cells, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0076] As the above host cell, it is recommended to use a host cell that has a high DNA introduction efficiency and a high expression efficiency of the introduced DNA, and all microorganisms, including prokaryotic and eukaryotic ones, can be used. For example, the host cell may be selected from the group consisting of Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, It may be derived from Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces or Cyclobacterium. Preferably, the host cell may be derived from a Gram-positive bacterium.For example, the Gram-positive bacteria may be, but are not limited to, Corynebacterium, Bifidobacterium, Rhodococcus, Candida, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Streptomyces, or Bifidobacterium.

[0077] According to a specific embodiment of the present invention, the host cell may be derived from Corynebacterium glutamicum, more preferably Corynebacterium glutamicum ATCC 13032, but is not limited thereto.

[0078] A host cell transformed with a vector containing a promoter according to the present invention can overexpress a gene encoding a target protein compared to an existing promoter, and is therefore useful for mass-producing a target protein or target product.

[0079] Accordingly, the fourth aspect of the present invention relates to a method for producing a target protein, comprising a step of culturing the aforementioned host cell to produce the target protein.

[0080] The term "cultivation" in the present invention refers to growing host cells under appropriately artificially controlled environmental conditions. The method for producing the desired product using host cells derived from Gram-positive bacteria, such as Corynebacterium genus, in the present invention can be performed using methods widely known in the art. Specifically, the culturing can be performed continuously in a batch process, fed batch, or repeated fed batch process, but is not limited thereto.

[0081] The culture medium used must suitably meet the requirements of the specific strain. Culture media for the aforementioned Gram-positive bacteria, particularly strains of the genus Corynebacterium, are known (e.g., Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981). Sugar sources that can be used include, but are not limited to, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as gluconic acid, acetic acid, and pyruvic acid. These substances can be used individually or as a mixture. Nitrogen sources that can be used include, but are not limited to, peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture. Phosphorus sources that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. In addition, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate required for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins may be used. Appropriate precursors may also be used in the culture medium. The above-mentioned raw materials may be added to the culture in a batch or continuous manner in an appropriate manner during the culture process.These various culture methods are described, for example, in the literature ("Biochemical Engineering" by James M. Lee, Prentice-Hall International Editions, pp 138-176).

[0082] The pH of the culture can be adjusted by appropriately using basic compounds such as sodium hydroxide, potassium hydroxide, or ammonia, or acid compounds such as phosphoric acid or sulfuric acid. Furthermore, foaming can be suppressed by using antifoaming agents such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture to maintain an aerobic state. The culture temperature can typically be between 20°C and 45°C, preferably between 25°C and 40°C, but can be changed depending on the conditions, but is not limited thereto.

[0083] In the present invention, the method for producing the target protein may additionally include a step of recovering the produced target protein. Methods for recovering the target protein from host cells or cultures thereof may include, but are not limited to, methods known in the art, such as centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC.

[0084] The above recovery step may include a purification process, and a person skilled in the art may select and utilize one of several known purification processes as needed.

[0085] Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be modified in various ways and can take various forms. Therefore, the specific examples and descriptions described below are only intended to aid in understanding the present invention and are not intended to limit the present invention to a specific disclosed form. It should be understood that the scope of the present invention includes all modifications, equivalents, and substitutes included in the spirit and technical scope of the present invention.

[0086] [Example 1]

[0087] Production of novel synthetic promoters

[0088] As a result of developing a synthetic promoter capable of overexpressing a target gene in Corynebacterium, two types of promoters consisting of the base sequence of sequence number 1 and the base sequence of sequence number 2 in Table 1 were synthesized, and these were named 'J0' and 'J1', respectively.

[0089] The above two types of promoters were discovered when a mutation was found in the inserted promoter H36 during the construction of a mutant Corynebacterium strain that can grow using glycerol as a single carbon. The construction method of the mutant Corynebacterium strain is disclosed in Korean Patent Publication No. 10-2019-0087091, and the construction method is briefly described as follows. After inserting the gene glpFKD into the genome of wild-type Corynebacterium glutamicum ATCC 13032, a mutant strain was selected through adaptive laboratory evolution, and the selected strain was named '13g'. The sequences of the glpFK gene fragment and the glpD gene fragment are as shown in SEQ ID NOs: 4 and 5 of Table 1 below. The selected strain '13g' was deposited in the Korea Center for Bioscience and Biotechnology (KCTC) Gene Bank on April 26, 2024 and was assigned the accession number KCTC 15895BP.

[0090] Furthermore, we attempted to insert a sequence expressing the gene pduCDEGH with the J1 promoter into the 13g genome. First, in order to insert the J1 promoter and the pduCDEGH gene into the strain, the J1 promoter was amplified using the primers of SEQ ID NO: 7 and SEQ ID NO: 8, and the pduCDEGH gene was amplified using the primers of SEQ ID NO: 9 and SEQ ID NO: 10. The sequence of the pduCDEGH gene fragment is shown in SEQ ID NO: 6 in Table 1 below. In addition, the upstream (left arm), which becomes the homologous arm, was amplified from the 13g genome using the primers of SEQ ID NO: 11 and SEQ ID NO: 12, and the downstream (right arm) was amplified from the 13g genome using the primers of SEQ ID NO: 13 and SEQ ID NO: 14. And these four amplified sequences were performed by overlapping PCR using primers of SEQ ID NO: 11 and SEQ ID NO: 14, and inserted into pK19mob-sacB digested with BamHI and PstI (Park, SH et al., Nat. Commun 5, 4618, 2014) by Gibson assembly method to construct the final vector 'pK19-msb-J1-pduCDEGH'. The J1 promoter and pduCDEGH gene were inserted into the 13g strain using 'pK19-msb-J1-pduCDEGH' using the reported method (Park, SH et al., Nat. Commun 5, 4618, 2014), and the strain was named '13gp2'. Strain '13gp2' was deposited at the Korea Center for Bioscience and Biotechnology (KCTC) Gene Bank on April 26, 2024 and was assigned the accession number KCTC 15896BP.

[0091] [Table 1]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] [Example 2]

[0098] Activity analysis of novel synthetic promoters J0 and J1 through GFP expression

[0099] In order to confirm the genomic expression ability of the 'J0' and 'J1' promoters, which are novel synthetic promoters manufactured in Example 1, a positive control was used to compare and evaluate the strain containing the synthetic promoter H36 (Korean Patent Publication No. 10-2014-0110134, SEQ ID NO. 3), which is known to operate in a microorganism of the genus Corynebacterium.

[0100] The Corynebacterium WT bioD::sfGFP strain is a strain in which a sequence for expressing the fluorescent protein sfGFP (super-folder green fluorescent protein) with the synthetic promoter H36 is inserted into the bioD gene locus of the wild-type Corynebacterium strain (ATCC 13032). First, in order to replace the promoters in the strain with the J0 promoter (SEQ ID NO: 1) and the J1 promoter (SEQ ID NO: 2), the primers of SEQ ID NO: 15 and SEQ ID NO: 17 were used to amplify the J0 promoter from the genome of the improved Corynebacterium '13g' strain with SEQ ID NO: 16 and SEQ ID NO: 17. In addition, the upstream (left arm) homologous arm was amplified from the WT bioD::sfGFP genome using primers of SEQ ID NO: 18 and SEQ ID NO: 19, and the downstream (right arm) was amplified from the WT bioD::sfGFP genome using primers of SEQ ID NO: 20 and SEQ ID NO: 21. Then, these three amplified sequences were subjected to overlapping PCR using primers of SEQ ID NO: 18 and SEQ ID NO: 21, and inserted into pK19mob-sacB (Park, SH et al., Nat. Commun 5, 4618, 2014) digested with BamHI and PstI by the Gibson assembly method to construct the final vectors 'pK19-msb-H36-sfGFP-tnp1' and 'pK19-msb-H36-sfGFP-tnp2'.

[0101] The J0 and J1 promoters were inserted into the WT bioD::sfGFP strain using the reported method (Park, SH et al., Nat. Commun 5, 4618, 2014) to construct strains containing each promoter.

[0102] [Table 2]

[0103]

[0104] Corynebacterium glutamicum into which the above promoter was introduced was inoculated into BHIS (Brain Heart Infusion (BHI), 91 g / L sorbitol) medium and cultured at 30°C and 200 rpm for 24 hours. Then, 1 / 100 of the volume was transferred to fresh BHI medium and cultured for 24 hours under the same conditions. Each Corynebacterium glutamicum strain culture was centrifuged at 6000 rpm for 5 minutes to obtain bacterial cells, which were suspended in PBS and subjected to fluorescence intensity analysis to confirm the expression level of GFP.

[0105] As a result, as confirmed in Fig. 3, the Corynebacterium glutamicum strain containing the novel synthetic promoters, J0 and J1 promoters, exhibited significantly higher fluorescence than the Corynebacterium glutamicum strain containing the existing synthetic promoter, H36 promoter. These results suggest that the two promoters of the present invention can be usefully utilized as overexpression promoters in microorganisms of the genus Corynebacterium.

[0106] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0107] [Accession number]

[0108] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0109] Accession number: KCTC15895BP

[0110] Date of acceptance: 20240426

[0111]

[0112] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0113] Accession number: KCTC15896BP

[0114] Date of acceptance: 20240426

[0115]

[0116]

[0117]

Claims

1. A promoter comprising the base sequence of sequence number 1 or sequence number 2.

2. A vector containing the promoter of paragraph 1.

3. A vector in the second paragraph, wherein a gene encoding a target protein is operably linked to the promoter.

4. A vector in the third paragraph, wherein the expression level of the gene encoding the target protein is higher than when operably linked to the H36 promoter including the base sequence of SEQ ID NO:

3.

5. A strain of Corynebacterium glutamicum 13g (accession number KCTC 15895BP) comprising a promoter comprising the base sequence of sequence number 1 and a gene cluster, glpFKD, encoding glycerol facilitator, glycerol kinase, and glycerol-3-phosphate dehydrogenase.

6. A strain of Corynebacterium glutamicum comprising a promoter having a base sequence of sequence number 2, and a gene cluster pduCDEGH encoding propanediol dehydratase large subunit PduC, propanediol dehydratase medium subunit PduD, propanediol dehydratase small subunit PduE, propanediol dehydratase reactivase alpha subunit PduG, and propanediol dehydratase reactivase beta subunit PduH. 13gp2 (Accession number KCTC 15896BP).

7. A host cell transformed with the vector of paragraph 2 or 3.

8. In the 7th paragraph, the host cell is derived from a gram-positive bacterium.

9. In the 8th paragraph, the gram-positive bacteria is a host cell that is Corynebacterium, Bifidobacterium, Rhodococcus, Candida, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Streptomyces or Bifidobacterium.

10. A method for producing a target protein, comprising a step of culturing the host cell of clause 7 to produce the target protein.

11. A method for producing a target protein, further comprising a step of recovering the produced target protein in accordance with claim 10.

Images