Microorganism of genus corynebacterium with improved l-citrulline or l-arginine productivity and method for producing l-citrulline or l-arginine using same
By enhancing the activities of key enzymes in Corynebacterium strains, the production of L-citrulline and L-arginine is significantly improved, achieving high yields and efficient substrate utilization.
Patent Information
- Application Number
- PCT/KR2024/007243
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-20
- Filing Date
- 2024-05-28
- Publication Date
- 2025-11-27
AI Technical Summary
Existing methods for producing L-citrulline and L-arginine using microorganisms like Corynebacterium are inefficient, as they do not effectively enhance the activities of key enzymes involved in their biosynthesis, such as glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase, leading to suboptimal production yields.
Enhancing the activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase in Corynebacterium strains through nucleotide modifications, copy number increases, promoter modifications, or introduction of foreign genes to increase enzyme expression and activity, thereby improving the production of L-citrulline and L-arginine.
The enhanced enzyme activities result in significantly increased production of L-citrulline and L-arginine, with yields up to 100 times higher than the parent strains, and improved substrate utilization, reducing byproduct ratios.
Smart Images

Figure PCTKR2024007243-APPB-IMG-000001 
Figure PCTKR2024007243-APPB-IMG-000002
Abstract
Description
Microorganisms of the genus Corynebacterium with enhanced L-citrulline or L-arginine production capacity and methods for producing L-citrulline or L-arginine using the same
[0001] The present invention relates to a microorganism of the genus Corynebacterium having improved L-citrulline or L-arginine production ability and a method for producing L-citrulline or L-arginine using the same.
[0002] Citrulline is a non-essential amino acid that plays a vital role in the body, including promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, promoting neurotransmission, boosting immunity, and scavenging reactive oxygen species. In the kidneys, citrulline is metabolized into arginine, which then produces nitric oxide (NO). While not a component of proteins in the body, citrulline is an intermediate in the urea cycle. It is produced from arginine along with NO, a substance known to have vasodilating properties. Furthermore, it is regenerated into arginine through condensation with aspartic acid.
[0003] Arginine is a non-essential amino acid, but it is a semi-essential amino acid that must be supplied in growing children and under stressful conditions, trauma, cancer, and other special conditions. It is widely used as an ingredient in amino acid fortifiers, pharmaceuticals, and foods. For pharmaceutical purposes, it is used in liver function promoters, brain function promoters, male infertility treatments, and comprehensive amino acid preparations. For food, it is used as a fish cake additive, health drink additive, and salt substitute for hypertensive patients.
[0004] In the production of citrulline or arginine using microorganisms, L-citrulline or L-arginine can be produced from a wild-type strain obtained in a natural state or a mutant strain modified to enhance its citrulline or arginine production ability. Recently, in order to improve the production efficiency of L-citrulline or L-arginine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, to develop various recombinant strains or mutants having excellent L-citrulline or L-arginine production ability and methods for producing L-citrulline or L-arginine using the same. In microorganisms, L-glutamate is synthesized from 2-oxoglutarate, an intermediate of the citric acid cycle, and using this as a starting material, L-citrulline and L-arginine are synthesized through N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, and L-ornithine. Since the biosynthetic process of L-citrulline or L-arginine in microorganisms involves various proteins such as enzymes, transcription factors, and transport proteins in a step-by-step manner, there have been attempts to increase the production of L-citrulline or L-arginine by inducing mutations in the genes encoding these proteins or in the promoters that control their expression. However, since there are dozens of types of proteins such as enzymes, transcription factors, and transport proteins that are directly or indirectly related to the production of L-citrulline or L-arginine, much research is still needed on whether L-citrulline or L-arginine production increases according to changes in the activity of these proteins.
[0005] [Prior Art Literature]
[0006] [Patent Document]
[0007] (Patent Document 1) Korean Patent No. 10-2007-0053321
[0008] (Patent Document 2) Korean Patent No. 10-2008-0052593
[0009] The present invention aims to provide a microorganism of the genus Corynebacterium having improved L-citrulline or L-arginine production ability.
[0010] In addition, the present invention aims to provide a method for producing L-citrulline or L-arginine using the above-described Corynebacterium microorganism.
[0011] One aspect of the present invention provides a Corynebacterium microorganism having enhanced L-citrulline or L-arginine production ability by enhancing the activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase.
[0012] The "glutamine synthetase" used in the present invention is an enzyme that catalyzes the reaction of condensing glutamic acid and ammonia into glutamine in nitrogen metabolism. The glutamine synthetase in the present invention may be a polypeptide having glutamine synthetase activity encoded by the glnA gene (Cgl2214 or Cgl2229), but is not limited thereto.
[0013] The “aspartate transaminase” used in the present invention is an important enzyme in amino acid metabolism because it catalyzes the reversible transfer of an α-amino group between aspartate and glutamic acid. The aspartate transaminase in the present invention may be a polypeptide encoded by the aspB gene (Cgl0240) and having aspartate transaminase activity, but is not limited thereto.
[0014] The “carbamoyl phosphate synthetase” used in the present invention is an enzyme that synthesizes carbamoyl phosphate from glutamine or ammonia and bicarbonate using ATP, and is composed of two subunits. The carbamoyl phosphate synthetase in the present invention may be a polypeptide having carbamoyl phosphate synthase activity encoded by the carA gene (Cgl1610) and the carB gene (Cgl1609), but is not limited thereto.
[0015] Nucleic acid sequence and protein sequence information for the above glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase can be obtained through known sequence databases (e.g., GenBank, UniProt).
[0016] As used herein, “enhanced activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, transport protein, etc. is increased compared to the original microorganism, i.e., a wild-type strain or a strain before modification. Such enhanced activity of a target protein includes cases where the activity of the protein itself is increased compared to the activity of the protein originally possessed by the microorganism through modification of nucleotides in the endogenous gene encoding the target protein (e.g., substitution, insertion, deletion of some nucleotides in the target gene, or a combination thereof), cases where the copy number of the gene is increased, cases where the overall protein activity level in a cell is higher than that of a wild-type strain or a strain before modification due to increased expression or increased translation of the target gene due to modification of a noncoding region such as a promoter (e.g., modification of all or part of the nucleotides in the promoter sequence, replacement with a strong promoter), and combinations thereof.
[0017] The above nucleotide modification means that the nucleotide sequence is different from the original nucleotide sequence due to substitution, insertion, deletion, or a combination thereof in all or part of the nucleotide sequence. The above promoter modification means that the nucleotides in the promoter sequence are different from the original promoter sequence due to substitution, insertion, deletion, or a combination thereof in all or part of the nucleotides, thereby increasing the expression level or enhancing the activity of the target gene. In addition, the promoter modification includes replacing the promoter of the original gene with a promoter that has a stronger expression level or activity for the target gene. Here, a substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.
[0018] Additionally, enhancing the activity of a target protein involves introducing a foreign gene that the microorganism does not originally have, and in this case, the nucleotides of the foreign gene may be modified.
[0019] According to one specific example of the present invention, the activity enhancement of the glutamine synthetase may be achieved by nucleotide modification, copy number increase, promoter modification, introduction, or a combination thereof of a gene encoding the glutamine synthetase.
[0020] According to one specific example of the present invention, the glutamine synthetase may be encoded by the glnA gene inherent in Corynebacterium glutamicum.
[0021] The above glutamine synthetase may be encoded by the base sequence of sequence number 1 or may be composed of the amino acid sequence of sequence number 2, but is not limited thereto.
[0022] According to one specific example of the present invention, the activity enhancement of the aspartate aminotransferase may be achieved by nucleotide modification, copy number increase, promoter modification, introduction, or a combination thereof of a gene encoding the aspartate aminotransferase.
[0023] According to one specific example of the present invention, the aspartate aminotransferase may be encoded by the aspB gene inherent in Corynebacterium glutamicum.
[0024] The above aspartate aminotransferase may be encoded by the base sequence of SEQ ID NO: 3 or may be composed of the amino acid sequence of SEQ ID NO: 4, but is not limited thereto.
[0025] According to one specific example of the present invention, the activity enhancement of the carbamoyl phosphate synthase may be achieved by nucleotide modification, copy number increase, promoter modification, introduction, or a combination thereof of a gene encoding the carbamoyl phosphate synthase.
[0026] According to one specific example of the present invention, the carbamoyl phosphate synthase may be encoded by the carAB gene inherent in Corynebacterium glutamicum.
[0027] The above carbamoyl phosphate synthase may be encoded by the base sequences of SEQ ID NOs: 5 and 7 or may be composed of the amino acid sequences of SEQ ID NOs: 6 and 8, but is not limited thereto.
[0028] The amino acid sequence of the glutamine synthetase, aspartate aminotransferase and carbamoyl phosphate synthetase according to the present invention or the base sequence encoding the same may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity compared to each sequence, and may have an original function. Here, “homology” or “identity” means the rate of agreement (%) between a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence when they are aligned and analyzed to correspond as much as possible.
[0029] As used herein, “improved productivity” means increased productivity of L-citrulline or L-arginine compared to the target of mutation (parent strain). The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that does not have L-citrulline or L-arginine production ability or has L-citrulline or L-arginine production ability, or a wild type Corynebacterium or a Corynebacterium genus mutated from the wild type.
[0030] According to one specific example of the present invention, the genus Corynebacterium is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans,These may include, but are not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi, and Corynebacterium flavescens.
[0031] For example, the above-mentioned Corynebacterium genus microorganism may be Corynebacterium glutamicum.
[0032] The Corynebacterium microorganism according to the present invention can enhance the production ability of L-citrulline or L-arginine by enhancing the pool of glutamine as a substrate and aspartate as a secondary substrate through enhanced activity of glutamine synthetase and aspartate aminotransferase, and by accelerating the conversion of L-citrulline from L-ornithine as a byproduct through enhanced activity of carbamoyl phosphate synthetase.
[0033] Specifically, the Corynebacterium genus microorganism having enhanced L-citrulline or L-arginine production ability exhibits increased L-citrulline or L-arginine production ability compared to the parent strain, and in particular, the L-citrulline or L-arginine production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, It may be increased by 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited thereto. For example, the Corynebacterium microorganism having enhanced activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase may have an L-citrulline or L-arginine production increased by 3% or more, specifically 3 to 80% (preferably 5 to 60%) compared to the parent strain.
[0034] A composition comprising a microorganism of the genus Corynebacterium according to the present invention can be used as a composition for producing L-citrulline or L-arginine.
[0035]
[0036] A microorganism of the genus Corynebacterium according to one specific example of the present invention can be implemented through a recombinant vector for introducing genes encoding glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase individually or simultaneously into a parent strain.
[0037] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0038] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.
[0039] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.
[0040] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.
[0041] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.
[0042] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.
[0043] When transforming prokaryotic cells to produce recombinant microorganisms, various intestinal bacteria and strains such as E. coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus may be used as host cells, but are not limited thereto.
[0044] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.
[0045] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.
[0046] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.
[0047] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.
[0048] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.
[0049] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.
[0050]
[0051] Another aspect of the present invention provides a method for producing L-citrulline or L-arginine, comprising the steps of culturing the above-described Corynebacterium microorganism in a medium; and recovering L-citrulline or L-arginine from the Corynebacterium microorganism or the medium in which the Corynebacterium microorganism is cultured.
[0052] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.
[0053] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.
[0054] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.
[0055] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.
[0056] According to one specific example of the present invention, the step of recovering L-citrulline or L-arginine from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-citrulline or L-arginine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but the present invention is not limited thereto.
[0057] According to one specific example of the present invention, the step of recovering the L-citrulline or L-arginine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
[0058] According to one specific example of the present invention, the step of recovering L-citrulline or L-arginine may include a process of purifying L-citrulline or L-arginine.
[0059] The Corynebacterium microorganism according to the present invention can improve the production yield of L-citrulline or L-arginine compared to before mutation by enhancing the activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase.
[0060] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.
[0061]
[0062] Example 1. Production of a Corynebacterium glutamicum mutant with improved L-arginine production.
[0063] To produce a strain with enhanced L-arginine production by enhancing the activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase, the glnA gene encoding glutamine synthetase, the aspB gene encoding aspartate aminotransferase, and the carAB gene encoding carbamoyl phosphate synthetase were introduced into Corynebacterium glutamicum 14GR (accession number KCCM13219P), which produces L-arginine.
[0064] E. coliDH5a (HIT Competent cells™, Cat No. RH618) was used to introduce the gene.
[0065] The above Corynebacterium glutamicum 14GR was cultured at 30°C in ARG-broth medium (pH 7.2) containing 10.5 g of 98% Glucose, 1 g of Beef extract, 4 g of Yeast extract, 2 g of Polypeptone, 2 g of NaCl, and 40 g of (NH4)2SO4 in 1 L of distilled water.
[0066] The above E. coliDH5a was cultured at 37°C on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.
[0067] The antibiotic kanamycin was a product from Sigma.
[0068] DNA sequencing analysis and gene synthesis were performed by Macrogen, Inc.
[0069]
[0070] 1-1. Introduction of the glnA gene
[0071] PCR was performed using the primers in Table 1 below, using Corynebacterium glutamicum 14GR as a template, to obtain fragments. Takara PrimeSTAR Max DNA polymerase was used, and PCR amplification conditions were 30 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 10 seconds, and polymerization at 72°C for 30 seconds. The obtained fragments were cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), thereby obtaining a recombinant plasmid, which was designated pAG1.
[0072] pAG1 was introduced into Corynebacterium glutamicum 14GR using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). The resulting colonies were then subjected to a second recombination, diluted, and plated on a 10% sucrose medium. A strain that was not resistant to kanamycin and grew on the 10% sucrose medium was selected, and this strain was designated AG1.
[0073] Sequence numberPrimer namePrimer sequence (5'-3')9G-LF1tgattacgccCATCCTGCACCACGCAG10G-LF2CATCCTGCACCACGCAG11G-LR1TCACTGTCCGATGTAGTTG12G-LR2CGGAACCGTCTCACTGTCCG13G-F1GACGGTTCCGGGTCCGTCAAGCCAACTTC14G-F2GGTCCGTCAAGCC AACTTC15G-R1AAGTACAATTCGAATTCCTG16G-R2ttaGCAGTCGAAGTACAATTC17G-RF1CGACTGCtaaTGTGTGTTCGCCACGGAAC18G-RF2TGTGGTTCGCCACGGAAC19G-RR1TTGGGCACACTCACCCAGTCG20G-RR2GTCGCACCAATTGGCACA
[0074]
[0075] The L-arginine production ability of mutant AG1, into which the glnA gene was introduced, was evaluated compared to the parent strain, Corynebacterium glutamicum 14GR.
[0076] Each strain (parent strain or mutant strain) was inoculated at 10% of the volume into a 5 L fermenter containing 1 L of the medium for L-arginine production in Table 2 below, and cultured at 35°C, 600 rpm, for 60 hours. After completion of the culture, the concentration of L-ornithine, which is produced as a byproduct along with L-arginine in the medium, was measured using HPLC (Agilent), and the results are shown in Table 3 below.
[0077] Medium for L-arginine production 98% Glucose 120 g, MgSO4 1 g, KH2PO4 2 g, (NH4)2SO4 45 g, FeSO4 20 mg, MnSO4 20 mg, Biotin 100 μg, Thiamine 100 μg, YSP 4 g and Urea 2 g
[0078] OD 610L-Arginine (%) Yield (%) L-Arginine production (g) ORN / ARG ratio (%) 14GR937.7835.9154.015.6AG18010.9742.0307.010.7
[0079] As shown in Table 3 above, when the activity of glutamine synthetase was enhanced (AG1), L-arginine production increased by approximately 2 times compared to the parent strain (14GR), and the L-ornithine / L-arginine (ORN / ARG) ratio decreased by approximately 31.4%.
[0080]
[0081] 1-2. Introduction of the aspB gene
[0082] PCR was performed using the primers in Table 4 below, using Corynebacterium glutamicum 14GR as a template, to obtain fragments. Takara PrimeSTAR Max DNA polymerase was used, and PCR amplification conditions were 30 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 10 seconds, and polymerization at 72°C for 30 seconds. The obtained fragments were cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), thereby obtaining a recombinant plasmid, which was designated pAG2.
[0083] pAG2 was introduced into Corynebacterium glutamicum AG1 produced in Example 1-1 using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). The resulting colonies were then subjected to secondary recombination, diluted, and plated on a plate containing 10% sucrose. A strain that was not resistant to kanamycin and grew on a 10% sucrose medium was selected, and this strain was designated AG2.
[0084] Sequence number Primer name Primer sequence (5'-3') 21A-LF1tgattacgccCGGGCGTGTCGTTCTTCC 22A-LF2CGGGCGTGTCGTTCTTCC 23A-LR1TCGCACATCGACCGTTTC 24A-LR2AAATCTCACTTCGCACATCG 25A-F1AGTGAGATTTAATCCTCCAGCTAGAACGGC 26A-F2AATCCTCCAGCTAGAACGGC 27A-R1TAATGCTCCGCTGCTGCCA 28A-R2ttaGTTAGCGTAATGCTCCG 29A-RF1CGCTAACtaaTGAGCCTGGCCAGGGCC 30A-RF2TGAGCCTGGCCAGGGCC 31A-RR1AGTTGAGGGACCGGGCAA 32A-RR2CCTTCCACGCAGTTGAGGG
[0085]
[0086] The L-arginine production ability of the mutant strain AG2, into which the aspB gene was introduced, was evaluated compared to the parent strain AG1. After culturing the strain using the same method as Example 1-1, the concentration of L-ornithine produced as a byproduct along with L-arginine in the medium was measured, and the results are shown in Table 5 below.
[0087] OD 610 L-Arginine (%) Yield (%) L-Arginine production (g) ORN / ARG ratio (%) AG18010.9742.0307.010.7 AG28912.2147.8345.18.61
[0088] As shown in Table 5 above, when the activity of aspartate aminotransferase was enhanced (AG2), L-arginine production increased by approximately 12.4% compared to the parent strain (AG1), and the L-ornithine / L-arginine (ORN / ARG) ratio decreased by approximately 19.5%.
[0089]
[0090] 1-3. Introduction of the carAB gene
[0091] PCR was performed using the primers in Table 6 below, using Corynebacterium glutamicum 14GR as a template, to obtain fragments. Takara PrimeSTAR Max DNA polymerase was used, and PCR amplification conditions were 30 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 10 seconds, and polymerization at 72°C for 30 seconds. The obtained fragments were cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), thereby obtaining a recombinant plasmid, which was designated pAG3.
[0092] pAG3 was introduced into Corynebacterium glutamicum AG2 produced in Example 1-2 using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). The resulting colonies were then subjected to secondary recombination, diluted, and plated on a plate containing 10% sucrose. A strain that was not resistant to kanamycin and grew on a 10% sucrose medium was selected, and this strain was designated AG3.
[0093] Sequence numberPrimer namePrimer sequence (5'-3')33C-LF1tgattacgccGTTGCCGTTCAACCGCTT34C-LF2GTTGCCGTTCAACCGCTT35C-LR1ACCGAAACGCTCATAGAACG36C-LR2AGCCAGCGGAACCGAAAC37C-F1TCCGCTGGCTCCAATCGCAGAAGGTGAGC38C-F2CCAATCGCAGAA GGTGAGC39C-R1ACTGCGTGGTCGAGTTCC40C-R2ttaAGCCTTGACTGCGTG41C-RF1CAAGGCTtaaTTGCCATCTTGGAAGAAACC42C-RF2TTGCCATCTTGGAAGAAACC43C-RR1GTACACCTGGTTAATACCAA44C-RR2GAAATCGAGGGTACACCTGG
[0094]
[0095] The L-arginine production capacity of the mutant strain AG3, into which the carAB gene was introduced, was evaluated compared to the parent strain AG2. After culturing the strain using the same method as in Example 1-1, the concentration of L-ornithine produced as a byproduct along with L-arginine in the medium was measured, and the results are shown in Table 7 below.
[0096] OD 610 L-Arginine (%) Yield (%) L-Arginine production (g) ORN / ARG ratio (%) AG28912.2147.8345.18.61 AG39212.9651.2333.62.06
[0097] As shown in Table 7 above, when the activity of carbamoyl phosphate synthase was enhanced (AG3), the L-arginine production was similar to that of the parent strain (AG2), but the L-ornithine / L-arginine (ORN / ARG) ratio was reduced by approximately 76% compared to the parent strain (AG2).
[0098]
[0099] Example 2. Production of a Corynebacterium glutamicum mutant with enhanced L-citrulline production.
[0100] To produce a strain with enhanced L-citrulline production by enhancing the activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase, the glnA gene encoding glutamine synthetase, the aspB gene encoding aspartate aminotransferase, and the carAB gene encoding carbamoyl phosphate synthetase were introduced into Corynebacterium glutamicum CT19b3 (accession number KCCM13451P), which produces L-citrulline.
[0101] The above Corynebacterium glutamicum CT4 was cultured at 30°C in CIT-broth medium (pH 7.2) containing 10.5 g of 98% Glucose, 1 g of Beef extract, 4 g of Yeast extract, 2 g of Polypeptone, 2 g of NaCl, 40 g of (NH4)2SO4, and 100 mg of Arginine in 1 L of distilled water.
[0102]
[0103] 2-1. Introduction of the glnA gene
[0104] A mutant strain with the glnA gene introduced was produced in the same manner as in Example 1-1, except that Corynebacterium glutamicum CT19b3 was used instead of Corynebacterium glutamicum 14GR, and was named CG1.
[0105] The L-citrulline production ability of mutant CG1, into which the glnA gene was introduced, was evaluated compared to the parent strain, Corynebacterium glutamicum CT19b3.
[0106] Each strain (parent strain or mutant) was inoculated at 1% of the volume into a 100 mL flask containing 10 mL of the medium for L-citrulline production in Table 8 below, and cultured at 32°C, 200 rpm, for 30 hours. After completion of the culture, the concentration of L-ornithine, which is produced as a byproduct along with L-citrulline in the medium, was measured using HPLC (Agilent), and the results are shown in Table 9 below.
[0107] Medium for L-citrulline production 95% Glucose 105.3 g, MgSO4 1 g, YPA 4 g, KH2PO4 0.8 g, Na2HPO4 1.2 g, (NH4)2SO4 30 g, FeSO4 20 mg, MnSO4 20 mg, ZnSO4 10 mg, Arginine 100 mg, Biotin 100 μg and Thiamine 200 μg
[0108] OD 610L-citrulline (%) Yield (%) L-citrulline production (g) ORN / CIT ratio (%) CT431.81.2728.20.11432.1CG128.21.6234.60.14625.8
[0109] As shown in Table 9 above, when the activity of glutamine synthetase was enhanced (CG1), L-citrulline production increased by approximately 28% compared to the parent strain (CT4), and the L-ornithine / L-citrulline (ORN / CIT) ratio decreased by approximately 19.6%.
[0110]
[0111] 2-2. Introduction of the aspB gene
[0112] A mutant strain into which the aspB gene was introduced was produced in the same manner as in Example 1-2, except that Corynebacterium glutamicum CG1 was used instead of Corynebacterium glutamicum AG1, and this strain was named CG2.
[0113] Afterwards, the L-citrulline production ability of the mutant strain CG2, into which the aspB gene was introduced, was evaluated in comparison with the parent strain CG1. After culturing the strain using the same method as Example 2-1, the concentration of L-ornithine produced as a byproduct together with L-citrulline in the medium was measured, and the results are shown in Table 10 below.
[0114] OD 610 L-citrulline (%) Yield (%) L-citrulline production (g) ORN / CIT ratio (%) CG128.21.6234.60.14625.8CG227.82.2439.70.20221.8
[0115] As shown in Table 10 above, when the activity of aspartate aminotransferase was enhanced (CG2), L-arginine production increased by approximately 38.3% compared to the parent strain (CG1), and the L-ornithine / L-citrulline (ORN / CIT) ratio decreased by approximately 15.5%.
[0116]
[0117] 2-3. Introduction of the carAB gene
[0118] A mutant strain with the carAB gene introduced was produced in the same manner as in Example 1-3, except that Corynebacterium glutamicum CG2 was used instead of Corynebacterium glutamicum AG2, and was named CG3.
[0119] Afterwards, the L-citrulline production ability of the mutant strain CG3, into which the carAB gene was introduced, was evaluated in comparison with the parent strain, Corynebacterium glutamicum CG2. After culturing the strain using the same method as Example 2-1, the concentration of L-ornithine produced as a byproduct along with L-citrulline in the medium was measured, and the results are shown in Table 11 below.
[0120] OD 610 L-citrulline (%) Yield (%) L-citrulline production (g) ORN / CIT ratio (%) CG227.82.2439.70.20221.8CG325.32.5844.80.23210.5
[0121] As shown in Table 11 above, when the activity of carbamoyl phosphate synthase was enhanced (CG3), L-citrulline production increased by approximately 14.8% compared to the parent strain (CG2), and the L-ornithine / L-citrulline (ORN / CIT) ratio decreased by approximately 51.8%.
[0122]
[0123] These results suggest that the glutamine biosynthetic pathway is strengthened by enhancing the activities of glutamine synthetase, aspartate aminotransferase, and carbamoyl phosphate synthetase, while simultaneously increasing the production of the by-substrate aspartate and accelerating the conversion of the by-product L-ornithine to L-citrulline, thereby enhancing the L-arginine or L-citrulline production ability of the mutant.
[0124]
[0125] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.
[0126] [Accession number]
[0127] Name of depositor: Korea Center for Microbiological Conservation (KCCM)
[0128] Accession number: KCCM13219P
[0129] Date of acceptance: 20220629
[0130]
[0131] Name of depositor: Korea Center for Microbiological Conservation (KCCM)
[0132] Accession number: KCCM13451P
[0133] Date of acceptance: 20240104
[0134]
[0135]
Claims
1. A microorganism of the genus Corynebacterium with enhanced L-citrulline or L-arginine production capacity due to enhanced activities of glutamine synthetase, aspartate transaminase, and carbamoyl phosphate synthetase.
2. In claim 1, The above glutamine synthetase is composed of the amino acid sequence of sequence number 2, The above aspartate aminotransferase is composed of an amino acid sequence of sequence number 4, A microorganism of the genus Corynebacterium, wherein the above carbamoyl phosphate synthase is composed of amino acid sequences of sequence numbers 6 and 8.
3. In claim 1, A microorganism of the genus Corynebacterium, wherein the activity of the above glutamine synthetase, aspartate aminotransferase and carbamoyl phosphate synthetase is enhanced by nucleotide modification, copy number increase, promoter modification, introduction, or a combination thereof of the genes encoding each enzyme.
4. In claim 1, The above Corynebacterium genus microorganism is Corynebacterium glutamicum.
5. A step of culturing the Corynebacterium genus microorganism of claim 1 in a medium; and A method for producing L-citrulline or L-arginine, comprising a step of recovering L-citrulline or L-arginine from a microorganism of the genus Corynebacterium or a medium in which the microorganism of the genus Corynebacterium is cultured.
Citation Information
Patent Citations
Method for producing L-arginine or L-lysine by fermentation
KR101086205B1
Microorganism of the genus corynebacterium with enhanced l-arginine productivity and method for producing l-arginine using the same
KR1020140126495A
Mutant of homoserine dehydrogenase from Corynebacterium and DNA encoding thereof
US7332310B2