Pharmaceutical composition for preventing or treating metabolic diseases, comprising rosuvastatin and ursodeoxycholic acid conjugate and method for preparing same

A statin-conjugated bile acid composition addresses the limitations of existing statin preparations by enhancing cholesterol-lowering and liver-protective effects, effectively treating metabolic diseases like nonalcoholic fatty liver disease and obesity.

WO2026010026A1PCT designated stage Publication Date: 2026-01-08GLOCAL IND ACADEMIC COOPERATION FOUND KONKUK UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/014324
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-02
Filing Date
2024-09-23
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Existing statin preparations for treating metabolic diseases are limited by side effects such as liver toxicity, musculoskeletal issues, and the development of diabetes, while lacking comprehensive therapeutic effects on conditions like diabetes and obesity.

Method used

A pharmaceutical composition is developed comprising a statin-conjugated bile acid, specifically rosuvastatin and ursodeoxycholic acid conjugate (ROUA), which binds to the apical bile salt transporter (ASBT), maintaining cholesterol-lowering effects and providing liver protection, weight loss, and blood sugar reduction.

Benefits of technology

The statin-conjugated bile acid composition effectively reduces cholesterol levels, alleviates liver damage, and improves metabolic diseases like nonalcoholic fatty liver disease and obesity without observed toxicity, even at high doses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024014324_08012026_PF_FP_ABST
    Figure KR2024014324_08012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for preventing, alleviating or treating metabolic diseases, the composition comprising a rosuvastatin and ursodeoxycholic acid conjugate or a pharmaceutically acceptable salt thereof, in which the statin conjugates to an ursodeoxycholic acid transporter and has the effects of function inhibition, cholesterol level reduction, antilipid toxicity, body weight reduction, blood lipid reduction, fatty liver alleviation, inflammation alleviation, and kidney damage alleviation. The composition, in the form of a single formulation, has the characteristics of maintaining the therapeutic effects of rosuvastatin and ursodeoxycholic acid while reducing the side effects of existing statins, and thus can be widely used as a substitute for complex formulations in the treatment of metabolic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for preventing or treating metabolic diseases containing bile acid conjugated with statin and method for preparing the same

[0001] The present invention relates to a pharmaceutical composition for preventing or treating metabolic diseases, including a statin-conjugated bile acid (rosuvastatin and ursodeoxycholic acid conjugate, ROUA), and a method for preparing the same.

[0002] Hyperlipidemia is a condition in which excessive fat accumulates on blood vessel walls, causing inflammation and ultimately leading to cardiovascular disease. Hyperlipidemia can be caused by elevated blood lipids or by factors such as obesity, alcohol consumption, and diabetes. It can be improved through lifestyle changes like diet and exercise, as well as medication. Medications used to treat hyperlipidemia include statins, ezetimibe, cholestyramine, niacin, and fibrates.

[0003] Statins are drugs that inhibit cholesterol synthesis, a general term for substances that inhibit the activity of HMG-CoA reductase. Statins have a similar structure to HMG-CoA, which plays a central role in cholesterol production, and thus competitively bind to HMG-CoA reductase, inhibiting its activity. This ultimately prevents the conversion of HMG-CoA to mevalonate, thereby preventing cholesterol synthesis. This also reduces cholesterol, which is necessary for bile acid synthesis in hepatocytes, and increases the number of LDL receptors on the surface of hepatocytes, increasing the rate at which blood cholesterol enters the liver cells and lowering blood cholesterol levels. However, side effects of statins have been reported, including gastrointestinal symptoms such as liver toxicity proportional to the drug dose, deterioration of the musculoskeletal system due to a decrease in muscle fibers, induction of diabetes, and development of renal failure.

[0004] According to patent document 1, a pharmaceutical composition for treating diabetes and its complications, comprising alkanoyl L-carnitine or a pharmaceutically acceptable salt thereof, in combination with a statin, is disclosed, and according to patent document 2, a pharmaceutical composition for preventing or treating a metabolic disease, comprising linagliptin or a pharmaceutically acceptable salt thereof; pitavastatin or a pharmaceutically acceptable salt thereof; and ezetimibe or a pharmaceutically acceptable salt thereof, wherein the metabolic disease includes diabetes or dyslipidemia, is disclosed. However, research on a therapeutic agent for metabolic diseases that complements the shortcomings of existing statin preparations while maintaining the hyperlipidemia treatment effect of statins is insufficient.

[0005] Against this backdrop, the inventor of the present invention completed the present invention by confirming that a compound in which a statin is bound to a bile acid maintains the cholesterol-lowering effect of a statin and the liver-protecting effect of a bile acid, while exhibiting a therapeutic effect on metabolic diseases such as diabetes and obesity, which are disadvantages of statin preparations.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] Republic of Korea Patent Publication No. 10-2009-0115939 (November 10, 2009)

[0009] Republic of Korea Patent Document No. 10-2289381 (August 6, 2021)

[0010] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating metabolic diseases, comprising a bile acid or a pharmaceutically acceptable salt thereof bound to a statin.

[0011] Another object of the present invention is to provide a health functional food composition for preventing or improving metabolic diseases, which comprises a bile acid or a pharmaceutically acceptable salt thereof combined with a statin.

[0012] Another object of the present invention is to provide a method for producing a bile acid bound to a statin.

[0013] To achieve the above purpose, the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases, comprising a bile acid or a pharmaceutically acceptable salt thereof combined with a statin.

[0014] The present invention also provides a health functional food composition for preventing or improving metabolic diseases, comprising a bile acid or a pharmaceutically acceptable salt thereof combined with a statin.

[0015] The present invention also provides a method for preparing a bile acid bound to a statin, comprising: i) preparing a first mixture by mixing a statin, EDC, and NHS in an anhydrous DMSO solution; ii) preparing a second mixture by mixing a bile acid, EDC, and NHS in an anhydrous DMSO solution; iii) preparing a third mixture by stirring the second mixture and EDA; iv) preparing a fourth mixture by mixing the first mixture and the third mixture in anhydrous DMSO and stirring; and v) precipitating the fourth mixture in distilled water and then centrifuging it.

[0016] The statin-conjugated bile acid according to the present invention maintains the liver protection effect of existing bile acids through binding to the apical bile salt transporter (ASBT) and the cholesterol-lowering effect of statins, and exhibits weight loss, blood sugar reduction, and inflammation relief effects after oral administration, thereby improving the shortcomings of existing statin preparations. In addition, it is maintained in the body for a long time and no toxicity is observed even with high-dose administration, so it can be widely used for the prevention and treatment of metabolic diseases.

[0017] Figure 1 is a schematic diagram showing the process of inhibition of bile acid metabolism, reduction of cholesterol levels, and alleviation of fatty liver through binding of rosuvastatin and ursodeoxycholic acid conjugate (ROUA) nanoparticles to an apical bile salt transporter (ASBT).

[0018] Figure 2 shows the synthesis process of ROUA, which is a combination of UDCA-EDA and RO-NHS.

[0019] Figure 3A shows the synthetic process of rosuvastatin (RO) and ursodeoxycholic acid (UDCA), Figure 3B shows the interaction between ROUA and HMG-CoA reductase and ASBT, Figure 3C shows the analysis result of ROUA using RP-HPLC, Figure 3D shows the surface charge of ROUA, Figure 3E shows the analysis result of the binding site of ROUA with ASBT, Figure 3F shows the binding conformation and interaction of residues with ROUA and ASBT, Figure 3G shows the time-dependent RMSD result of the interaction between ASBT and ROUA molecular residues analyzed by TRAPP web server, Figure 3H shows the conformational change of ROUA during molecular dynamics simulation, Figure 3I shows the analysis result of the interaction energy between UDCA and ROUA during molecular dynamics simulation, Figure 3J shows the analysis result of the binding energy of ASBT and UDCA or ROUA, and Figure 3K shows the predicted Ki(Nm) value of ASBT and UDCA or ROUA. It is shown.

[0020] Figure 4 shows the RP-HPLC spectrum analysis results and retention times (RT) of UDCA, UDCA-NHS, UDCA-EDA, RO, and RO-NHS.

[0021] Figure 5 shows the compositions of UDCA, RO, UDCA-NHS, UDCA-EDA, RO-NHS and ROUA. 1 This shows the results of H NMR analysis.

[0022] Figure 6 is ROUA's 13 This shows the results of C NMR analysis.

[0023] Figures 7A and 7B show the mass spectrometry results of ROUA through HPLC-ESI-MS and MALDI-TOF-MS measurements.

[0024] Figures 8A to 8C illustrate the hydrophobic binding pocket within ASBT, UDCA bound to ASBT, and the binding conformation analysis using molecular binding simulations.

[0025] Figure 9 shows the results of UDCA analysis for the root-mean-square deviation (RMSD) at residues over 100 ps in an in silico molecular dynamics analysis.

[0026] Figures 10A and 10B show binding affinity and interaction binding type through in silico docking simulation analysis.

[0027] Figure 11A shows the ROUA particle formation process during molecular dynamics simulation, Figure 11B shows the interaction types exhibited by ROUA after molecular dynamics simulation, Figure 11C shows the surface charge distribution of ROUA, Figure 11D shows TEM and SEM images of ROUA, Figure 11E shows the average size of ROUA, Figure 11F shows the surface charge of ROUA, Figure 11G shows the stability of ROUA according to its size, and Figure 11H shows the stability of ROUA surface charge.

[0028] Figures 12A and 12B are graphs showing the particle size and zeta potential distribution of ROUA at pH 2 and pH 8.

[0029] Figure 13A shows the results of pharmacological analysis of RO and ROUA bound to HMG-CoA reductase (green: hydrogen bond, cyan: hydrophobic, blue: anionization potential), Figure 13B shows the results of in vitro experiments measuring the HMG-CoA reductase inhibitory activity of atorvastatin (ATR, 100 μM), UDCA (100 μM), rosuvastatin (RO, 100 μM), and ROUA (100 μM) compared to the control group (ns: not significant), Figure 13C shows a schematic diagram of the cholesterol biosynthetic pathway, Figure 13D shows the results of measuring HMGCS1 mRNA levels after treatment with UDCA, RO, and ROUA in colon cancer cells HCT116, Figure 13E shows the results of measuring FDPS mRNA levels after treatment with UDCA, RO, and ROUA in HCT116 cells, and Figure 13F shows the results of Western blotting for HMGCS1 protein levels. The results measured by blot, Fig. 13G is a schematic diagram showing the treatment of mouse primary hepatocytes with ROUA and / or PA, Fig. 13H is a graph showing the cholesterol levels measured after treatment of HCT116 cells with SIM (20 μM), UDCA (20 μM), RO (20 μM), and ROUA (20 μM), and Fig. 13I is a graph showing the cell viability measured after treatment of primary hepatocytes with RO, UDCA, and ROUA.

[0030] Figure 14A [ 3H]TCA's inhibitory activity on ASBT through intracellular accumulation, FIG. 14B shows the results of BLI analysis of the binding between ASBT and UDCA, FIG. 14C shows the results of BLI analysis of the binding between ASB and ROUA, FIG. 14D shows the results of fluorescence tracing of RITC-labeled ROUA in Caco-2 cells, FIG. 14E shows the results of RITC intensity quantification over time obtained from real-time fluorescence tracing, FIG. 14F shows the results of cellular uptake (blue: nucleus, green: tight junction) of RITC-labeled ROUA (red) in Caco-2 cells, FIG. 14G shows the results of cytotoxicity evaluation of RO, UDCA, and ROUA in CT26.WT cells, FIG. 14H shows the results of cytotoxicity evaluation of RO, UDCA, and ROUA in Caco-2 cells, and FIG. 14I shows the results of cytotoxicity evaluation of RO, UDCA, and ROUA in HepG2 cells.

[0031] Figure 15A shows the distribution of fluorescence in the intestine over time after oral administration of ROUA, Figure 15B shows the results of cross-sectional staining of the ileum (blue: DAPI, green: ASBT, red: RITC-labeled ROUA), Figure 15C shows the results of gastrointestinal tract tracing, Figure 15D shows the fluorescence quantification in major organs over time, Figure 15E shows the results of plasma ROUA concentration-time profiles after oral administration of RITC-labeled ROUA, and Figure 15F shows the results of measuring the stability of ROUA in rat serum using RP-HPLC.

[0032] Figure 16 shows the results of plasma concentration analysis of intravenously injected ROUA nanoparticles.

[0033] Fig. 17A shows the experimental plan of the HFD animal experiment, Fig. 17B shows the body weight change after 44 days, Fig. 17C shows the body weight on the last day, Fig. 17D shows the results of the oral glucose tolerance test conducted on the 43rd day, Fig. 17E shows the results of quantifying the AREA% graph for 1 to 2 hours, Figs. 17F to 17J show the results of measuring the liver weight, aminotransferase (ALT), low-density lipoprotein (LDL), triglyceride (TG), and total cholesterol levels after treatment with UDCA (10 mg / kg), RO (10 mg / kg), and ROUA (20 mg / kg) in HFD-fed mice and normal diet mice, Fig. 17K shows the results of hematoxylin and eosin (H&E) and Oil Red O staining, and Fig. 17J shows the results of Oil Red O quantitative analysis.

[0034] Figure 18A shows an animal model fed a high-fat / high-fructose diet (HFHFD), Figure 18B shows the change in body weight after 84 days, Figure 18C shows the comparison result of body weight on the last day, Figure 18D shows the comparison result of liver weight on the last day, Figure 18E shows the results of H&E, Oil Red O, Sirius Red, and TUNEL staining in liver tissue, Figure 18F shows the results of TUNEL % quantification, and Figures 18G to 18K show the levels of blood urea nitrogen (BUN), creatinine (Cre), aspartate aminotransferase (AST), aminotransferase (ALT), and albumin (ALB) after treatment with ROUA (200 mg / kg) and RO (100 mg / kg).

[0035] Figures 19A to 19E show the mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), total bilirubin (T-Bili), and total protein (TP) of RO and ROUA.

[0036] Hereinafter, the present invention will be described in detail.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well known and commonly used in the art.

[0038] When the present invention is said to “include” a certain component or a certain step, this does not mean that other components or other steps are excluded, but rather that other components or other steps may be further included, unless specifically stated otherwise.

[0039] In the present invention, the term "administration" refers to a method that results in at least partial localization of a substance to a desired site in an individual, or placement of a substance into an individual. Administration can be accomplished by any method known in the art.

[0040] In the present invention, the term "prevention" may include, without limitation, any act that can block, suppress or delay symptoms caused by a metabolic disease by using the composition of the present invention.

[0041] In the present invention, the term "treatment" may include, without limitation, any act that can improve or benefit symptoms caused by a metabolic disease by using the composition of the present invention.

[0042] In the present invention, the term “subject” or “subject” refers to a mammal that is the subject of treatment, observation or experiment, and may specifically be a human.

[0043] In the present invention, the term "HMG-CoA" is an abbreviation for '3-hydroxy-3-methylglutaryl-CoA synthase', and refers to a precursor for the biosynthesis of sterols including cholesterol. The term "HMG-CoA reductase inhibitor" used in the present invention refers to compounds that provide the effect of lowering total cholesterol and LDL cholesterol in the body by inhibiting the activity of HMG-CoA reductase involved in the initial step of converting HMG-CoA to mevalonate during the cholesterol biosynthesis process.

[0044]

[0045] The present invention provides a pharmaceutical composition for preventing or treating metabolic diseases, comprising a bile acid or a pharmaceutically acceptable salt thereof bound to a statin.

[0046] The above term "pharmaceutically acceptable salt" means a salt form of a compound that does not cause serious irritation to an organism to which the compound is administered and does not impair the biological activity and physical properties of the compound. The salt includes acid addition salts formed by acids that form non-toxic acid addition salts containing pharmaceutically acceptable anions, for example, inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, hydroiodic acid, etc.; organic carboxylic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, etc.; sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. For example, pharmaceutically acceptable carboxylic acid salts include metal salts or alkaline earth metal salts formed by lithium, sodium, potassium, calcium, magnesium, etc.; amino acid salts such as lysine, arginine, guanidine, etc.; organic salts such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, diethanolamine, choline, and triethylamine.

[0047] The bile acid may be at least one selected from the group consisting of glycocholic acid, glycocholic chenodeoxycholic acid, taurocholic acid, deoxycholic acid, taurodeoxycholic acid, cholic acid, chenodeoxycholic acid, ursodeoxycholic acid, lithocholic acid, and dehydrocholic acid, and preferably ursodeoxycholic acid. In the present invention, among various types of bile acids, ursodeoxycholic acid (UDCA), a safe drug approved by the U.S. Food and Drug Administration (FDA), was used.

[0048] The above ursodeoxycholic acid (UDCA) accounts for approximately 2% of human bile acids and is a tertiary bile acid that is synthesized in the liver, excreted in bile, metabolized by intestinal microorganisms, and then reabsorbed into the liver (enterohepatic recirculation).

[0049] Bile is classified into primary bile acids such as cholic acid and chenodeoxycholic acid (CDCA), and secondary bile acids such as deoxycholic acid, lithocholic acid, and ursodeoxycholic acid (UDCA), a stereoisomer of CDCA.

[0050] Bile acids secreted by the liver are reabsorbed into the bloodstream from the intestinal mucosa of the distal ileum, the initial portion of the small intestine, or the small intestine. Furthermore, ASBT transporters exist in the intestinal epithelial cell membrane, which facilitate the intracellular uptake of bile acids remaining within the small intestine. Reabsorbed bile acids enter the portal vein, return to the liver, and undergo enterohepatic recirculation, where they are absorbed by hepatocytes via the venous sinus and re-secreted into bile. Approximately 94% of bile acids are recirculated into bile.

[0051] The statin may be at least one selected from the group consisting of rosuvastatin, cerivastatin, atorvastatin, lovastatin, simvastatin, pravastatin, mevastatin, fluvastatin, rivastatin, pitavastatin, and pharmaceutically acceptable salts thereof, and may preferably be rosuvastatin, but is not limited thereto.

[0052] The statin may bind to the bile acid via ethylenediamine (EDA), but is not limited thereto. When binding via EDA, the carboxyl groups of the statin and bile acid may bind to the amino groups at both ends of EDA.

[0053] The above metabolic disease refers to all diseases that occur due to abnormalities in the pathway of chemical reactions occurring in the body, and non-limiting examples of metabolic diseases include the following diseases. Metabolic diseases may include, but are not limited to, type 1 diabetes, type 2 diabetes, hyperlipidemia, hypertension, insulin resistance, obesity, abnormal glucose metabolism, diabetic retinopathy, diabetic nephritis, diabetic neuropathy, body mass gain, hypercholesterolemia, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver fibrosis, polycystic ovarian syndrome (PCOS), liver cirrhosis, hepatitis C, alcoholic liver disease, primary sclerosing cholangitis, primary biliary cholangitis, dyslipidemia, and the like, and are preferably, but are not limited to, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), obesity, diabetes, hyperlipidemia, and dyslipidemia.

[0054] The composition can inhibit apical sodium-dependent bile acid transporter (ASBT).

[0055] The sodium-dependent bile acid transporter (S-BOT) exists in the intestinal epithelial cell membrane and actively transports bile acids remaining in the small intestine into the cells. It can also be referred to as a sodium-dependent bile acid transporter (S-BOT). Inhibiting this transporter is known to have the effect of preventing the reabsorption of bile acids, thereby lowering cholesterol levels.

[0056] The above pharmaceutical composition may be used as a combination therapy applied simultaneously or at different times, including, in addition to the above active ingredient, one or more other therapeutic agents known to be effective in treating or preventing metabolic diseases.

[0057] The pharmaceutical composition of the present invention may be administered orally or parenterally in various dosage forms. When formulating the composition, it may be prepared using one or more buffers (e.g., saline or PBS), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.

[0058] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing one or more compounds with at least one excipient, such as starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

[0059] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, or preservatives may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants in some cases, and anticoagulants, flavoring agents, emulsifiers, solubilizers, dispersants, flavoring agents, antioxidants, packaging agents, pigments, and preservatives may be additionally included.

[0060] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, or suppositories. Non-aqueous solutions and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin, glycerol, and gelatin.

[0061] The composition of the present invention can be administered orally or parenterally, and when administered parenterally, it can be formulated in the form of an injection for intravenous, intraperitoneal, intramuscular, subcutaneous, intradermal, topical, intrapulmonary, and intrarectal administration according to a method known in the art.

[0062] In the case of the above injection, it must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for the injection include, but are not limited to, solvents or dispersion media including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. In addition, the injection may in most cases additionally include isotonic agents such as sugars or sodium chloride.

[0063] The composition of the present invention is administered in a pharmaceutically effective amount. A pharmaceutically effective amount refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, concomitant drugs, and other factors well known in the medical field. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. That is, the total effective amount of the composition of the present invention can be administered to a patient as a single dose, or can be administered as multiple doses in a fractionated treatment protocol for long-term administration. It is important to consider all of the above factors and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0064] The composition has effects of reducing body weight, blood sugar levels, liver weight, serum lipid concentrations including hepatic alanine aminotransferase (ALT), low-density lipoprotein (LDL), total cholesterol (T-Chol), and triglycerides (TG), reducing lipid droplets within liver cells, and reducing liver damage.

[0065] The bile acid to which the statin is bound may be represented by the following chemical formula 1.

[0066] [Chemical Formula 1]

[0067]

[0068]

[0069] The size of the bile acid to which the statin is bound may be 100 to 400 nm, preferably 200 to 300 nm, but is not limited thereto.

[0070] The above statin-bound bile acid can self-assemble at pH 6 to 8, preferably at pH 7, but is not limited thereto.

[0071] The daily dosage of the above composition may be 1 to 200 mg / kg, preferably 5 to 50 mg / kg, but is not limited thereto.

[0072]

[0073] The present invention also provides a health functional food composition for preventing or improving metabolic diseases, comprising a bile acid or a pharmaceutically acceptable salt thereof combined with a statin.

[0074] The above health functional food composition includes all forms such as functional food, nutritional supplement, health food, food additives, or feed, and is intended for consumption by humans or animals, including livestock. The above type of food composition can be manufactured in various forms according to conventional methods known in the art.

[0075] The health functional food composition of the above type can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (e.g., ham, sausages, corned beef, etc.), breads and noodles (e.g., udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (e.g., butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.), etc., and the pyrrolo pyrimidine derivative compound represented by the chemical formula 1 of the present invention, an optical isomer thereof, or a pharmaceutically acceptable salt thereof can be manufactured by adding the same. In addition, the nutritional supplement may be manufactured by adding the bile acid bound to the statin of the present invention to capsules, tablets, pills, etc., but is not limited thereto.

[0076] The health food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. In addition, the health food of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in combination.

[0077]

[0078] The present invention also provides a method for preparing a bile acid bound to a statin, comprising: i) preparing a first mixture by mixing a statin, EDC, and NHS in an anhydrous DMSO solution; ii) preparing a second mixture by mixing a bile acid, EDC, and NHS in an anhydrous DMSO solution; iii) preparing a third mixture by stirring the second mixture and EDA; iv) preparing a fourth mixture by mixing the first mixture and the third mixture in anhydrous DMSO and stirring; and v) precipitating the fourth mixture in distilled water and then centrifuging it.

[0079]

[0080] The description of the above health functional food composition and manufacturing method, its effects and all related descriptions are the same as those described above, so the description is omitted to avoid excessive complexity of this specification due to duplicate description.

[0081]

[0082] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0083]

[0084] Example 1. Experimental materials and methods

[0085]

[0086] 1-1. Experimental materials

[0087]

[0088] Acetonitrile (ACN), antibiotic antimycotic solution (100X), 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride, anhydrous dimethyl sulfoxide (DMSO), chloroform, Dulbecco's modified Eagle's medium (DMEM), Dulbecco's phosphate-buffered saline (DPBS), dimethyl sulfoxide-d6, ethanol, 1-ethyl-3-(3-dimethyl aminopropyl)carbodiimide (EDC), Ethylenediamine (EDA), ether, methanol, N-hydroxysuccinimide (NHS), 2-methyl-2-butanol, paraformaldehyde (PFA), palmitic acid (PA), phosphate-buffered saline (PBS), rhodamine B isothiocyanate (RITC), syringe-driven filters (0.45 μm), trifluoroacetic acid (TFA), 2,2,2-tribromoethanol (TBE), and ursodeoxycholic acid (UDCA) were purchased from Sigma Aldrich (St. Louis, MO, USA).Fetal bovine serum (FBS) was purchased from Gibco (Milford, MA, USA). Rosuvastatin calcium (RO) was purchased from Aladdin Co. Ltd. (Shanghai, China). Hydrochloric acid (35.0–37.0%) was purchased from Samcheon (Seoul, Korea). The EZ-cytox kit was purchased from DoGenBio (Seoul, Korea). Neutral-buffered formalin (10%) was purchased from HuBenTech (Damyang, Korea). D(+)-glucose was purchased from Duksan (Ansan, Korea). Amine-reactive probes were purchased from Gator Bio (Palo Alto, CA, USA). Phalloidin-fluorescein isothiocyanate reagent was purchased from Abcam (Cambridge, UK). SLC10A2 (human) recombinant protein was purchased from Abnova (Taipei, Taiwan). HMGCS1 antibody was purchased from Cell Signaling Technology (Danvers, MA, USA). β-tubulin was purchased from Santa Cruz (Santa Cruz, CA, USA). Bio-Rad protein assay dye reagent concentrate was purchased from Bio-Rad Laboratories (Hercules, CA, USA). [. 3 H]taurocholic acid ([ 3 [H]taurocholic acid, 20 Ci / mmol) was purchased from American Radiolabeled Chemicals, Inc. (St. Louis, MO, USA). K2E (K2EDTA) tubes were purchased from KP&T Technology (Cheongju, Korea).

[0089]

[0090] 1-2. Animal models

[0091]

[0092] Seven-week-old male Sprague Dawley (SD) rats, seven-week-old male BALB / c mice, and four- and five-week-old male C57BL / 6 mice were purchased from Orient Bio (Seongnam, South Korea). All animal experiments were performed in compliance with the standard regulations of the Institutional Animal Care and Use Committee (IACUC) of Konkuk University (Reference number: KU22078-1). Animals were housed in an animal facility with a 12-h day / night cycle, a temperature of 25 ± 1 °C, and a relative humidity of 50 ± 5%. All animals were observed daily during the experiment to ensure their health. Animals were euthanized slowly by CO2 asphyxiation and a final blood draw under anesthesia.

[0093]

[0094] 1-3. ROUA synthesis

[0095]

[0096] The synthesis of ROUA consists of three major steps. In the first step, RO (50 mg, 33.3 mmol), EDC (77.53 mg, 116.48 mmol), and NHS (34.49 mg, 99.89 mmol) are mixed in anhydrous DMSO solution and stirred at room temperature for 4 hours to synthesize RO-NHS. Simultaneously, UDCA (100 mg, 84.91 mmol), EDC (197.73 mg, 424.56 mmol), and NHS (87.95 mg, 254.74 mmol) are mixed in another anhydrous DMSO solution and stirred at room temperature for 4 hours to synthesize UDCA-NHS. In the second step, EDA (306.2 mg, 1.7 mol) is added to the DMSO solution containing UDCA-NHS and stirred for an additional 10 minutes to synthesize UDCA-EDA. Each reaction solution was precipitated in 30 mL of distilled water for purification, and then centrifuged at 4000 rpm for 4 min at 4 °C for three repetitions of purification. In the final step, RO-NHS (5 mg, 2.883 mmol) and UDCA-EDA (18.78 mg, 14.41 mmol) were dissolved in 3 mL of anhydrous DMSO and stirred at room temperature overnight. The mixture was then precipitated in 30 mL of distilled water for purification, and centrifuged at 4000 rpm for 4 min at 4 °C for three repetitions of purification. The purified mixture was lyophilized to obtain a white powder. In the final purification step, the product was precipitated in a solution of ether-ACN (9:1). After sonication for 5 min, the product was purified five times by centrifuging at 2500 rpm for 4 min at 4 °C. Finally, lyophilization produced a white powder of ROUA.

[0097]

[0098] 1-4. ROUA characteristics

[0099]

[0100] The reaction was monitored using thin layer chromatography (TLC) in a mixture of methanol and chloroform. The volume ratio of the mixture was 1:3. The purity of the synthesized ROUA was confirmed using a reversed-phase high-performance liquid chromatography (RP-HPLC) system (Agilent 1200 series, Agilent Technologies, Santa Clara, CA, USA) and a ZORBAX RR Eclipse Plus C18 column (4.6 mm Х 150 mm, 3.5 μm). The ratio of solvent A to solvent B was changed from 10:90 to 90:10 over 40 min using a gradient system. Solvent A consisted of acetonitrile containing 0.1% trifluoroacetic acid (TFA), and solvent B consisted of distilled water containing 0.1% TFA. The flow rate used throughout this process was 1 mL / min. RP-HPLC peaks were monitored using a UV-vis detector (245 nm). Liquid chromatography-electrospray ionization mass spectrometry (LC-ESI-MS; Agilent 1260 infinity series, Agilent Technologies, Santa Clara, CA, USA) and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF-MS) were used to accurately measure the molecular weight of ROUA.

[0101]

[0102] 1-5. Binding analysis of ROUA to bile acid transporters

[0103]

[0104] The molecular structures of UDCA and ROUA were drawn using ChemDraw Professional 20.1.1.125 (PerkinElmer Inc.). Molecular docking was performed using AMDOCK (Assisted Molecular Docking) software against the ASBT protein (PDB: 3ZUX) using the Chemistry at Harvard Molecule Macromolecular Mechanics (CHARMM) force field. The binding sites were identified based on the active sites of the ligands in the PDB. The best structure among the 10 structures recorded was selected and visualized using Discovery Studio 2022 software (BIOVIA, San Diego, CA, USA). After docking, molecular dynamics (MD) simulations were performed using the standard dynamic cascade protocol. The NVE ensemble including the Generalized Born Simple Switching (GBSW) implicit solvent model was used to observe the system behavior. To verify the molecular structure and interaction efficiency, the interaction energies between UDCA and ROUA molecules and the ASBT protein were calculated through trajectory analysis during the 100 ps production phase. The trajectories obtained from MD were analyzed using the TRAPP web server to identify the interaction structure and changes with the ASBT protein. All analyses used the default parameters provided by the TRAPP web server. Initially, the ligand bound to the ASBT protein was input into TRAPP. The trajectory data was then submitted for interaction analysis. The binding site of the ligand was determined within an 8 angstrom radius around the bound ligand. The analyses were performed using the TRAPP-Analysis and TRAPP-Pocket protocols, and the obtained results were reviewed.

[0105]

[0106] 1-6. Nanoparticle formation

[0107]

[0108] Simulations were performed using the GROMACS 2021_2 program. UDCA and ROUA molecules were parameterized using the CHARMM-36m force field, and the parameters were generated via the CHARMM-GUI web server. Solvation was performed using the Tip3 water model. Neutralization was performed using chloride ions (Cl - ) and sodium ions (Na + ) was added. The time step was set to 100 ns, and a cutoff of 1.4 nm was used for short-range van der Waals and electrical interactions. Long-range electrical interactions were calculated using the particle mesh Ewald method with a Fourier spacing of 0.24 nm and fourth-order interpolation. Coupling was constrained using the LINCS algorithm. The rigid water temperature coupling was managed using a v-rescale thermostat, and the pressure coupling was managed using a Berendsen barostat during equilibration and a Parrinello-Rahman barostat during sampling. The simulations were performed at 300 K and 1 bar. After the 100 ns MD simulation, the generated nanoparticles were transferred to the Discovery Studio program in PDB format, and the molecular interactions were analyzed using the Analyze Trajectory tool. Additionally, the surface charge of the self-assembled nanoparticles was examined to characterize the particle charge distribution.

[0109]

[0110] 1-7. Measurement of particle size and surface charge

[0111]

[0112] The formation and size distribution of ROUA nanoparticles were evaluated by dynamic light scattering (DLS; Zetasizer Nano, Malvern Instruments, Worcestershire, UK) analysis. For DLS measurements, 50 μg / mL of ROUA nanoparticles were dissolved in distilled water containing 5% DMSO. In addition, the zeta potential of 50 μg / mL of ROUA was evaluated using the Zetasizer Nano method. The spherical morphology of 50 μg / mL of self-assembled ROUA dissolved in distilled water was observed by transmission electron microscopy (TEM; Tecnai G2 spirit twin, FEI, Eindhoven, Netherlands) and scanning electron microscopy-energy-dispersive X-ray spectroscopy (SEM-EDS; MERLIN, Carl Zeiss, Oberkochen, Germany).

[0113]

[0114] 1-8. Pharmacological analysis of ROUA and HMB-CoA reductase proteins

[0115]

[0116] Molecular docking and pharmacophore analysis were performed to investigate the binding of ROUA and RO to HMG-CoA reductase (PDB: 1HW8). ROUA and RO were optimized using the prepare ligand protocol in Discovery Studio 2022. They were then docked to HMG-CoA reductase using the AMDOCK program, and the structure with the optimal energy was selected from 10 structures. The selected ligand structures were transferred to Discovery Studio for analysis using the generated receptor-ligand pharmacophore protocol.

[0117]

[0118] 1-9. In vitro HMB-CoA reductase inhibitory activity

[0119]

[0120] The HMG-CoA reductase inhibitory activity of ROUA and RO was measured using an HMG-CoA reductase activity assay kit (ab204701, Abcam, Cambridge, UK). In brief, the screening compounds inhibited HMG-CoA reductase, HMG-CoA, and NADPH (nicotinamide-adenine dinucleotide

[0121] The reaction mixture containing phosphate and HMG-CoA reductase assay buffer was mixed. During the 10-minute incubation, the reaction was measured in kinetic mode at 340 nm. The inhibition percentage of the screening compounds was calculated using the formula provided in the protocol booklet.

[0122]

[0123] 1-10. Western blot

[0124]

[0125] Cells were lysed in a buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.1 mM EDTA (ethylenediamine tetraacetic acid), 1% NP-40, and a protease inhibitor cocktail. After centrifugation, the supernatant was transferred to a new tube, and equal amounts of protein were subjected to SDS-PAGE and transferred to PVDF membranes. The membranes were then incubated overnight with primary antibodies (HMGCG1 and β-tubulin). The following day, the membranes were incubated with secondary antibodies for 1 h at room temperature and visualized by band intensity using ECL prime (GE Healthcare, Milwaukee, WI, USA).

[0126]

[0127] 1-11. Quantitative real-time PCR (qRT-PCR)

[0128]

[0129] Total RNA was isolated from cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Two micrograms of RNA was then reverse transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). SYBR Green PCR Master Mix (Dyne Bio., Seongnam, Republic of Korea) was used to detect mRNA expression levels, and H36B4 was used as a reference gene to normalize the expression of the genes of interest. The list of qPCR primers used is presented in Table 1.

[0130]

[0131] Gene Forward primer 5' → 3' Reverse primer 5' → 3' HMGCS1TGGCAGGGAGTCTTGGTATCCCACTCCAAATGATGACAFDPSTCCATGATGTCATCTGCCACAGCCAAGGAAACAGGATGH36B4TGGTGATACCTAAAGCCTGGAACATGTTGCTGGCCAATAAGG

[0132]

[0133] 1-12. Lipid Sample Preparation and Cholesterol Quantification

[0134]

[0135] Cells were seeded at 7.0 Х 10 in 6-well plates 5Cells were seeded at a density of 10 cells / well. The materials indicated in Figure 13H were added to serum-free medium and cultured for 24 h. Cells were extracted with chloroform-isopropanol-IGEPAL CA-630 (7:11:0.1) and sonicated using an ultrasonic homogenizer (Bandelin Electronic, Berlin, Germany). The organic phase was transferred to a new tube and air-dried overnight at 50 °C. The sample was kept under vacuum for 30 min to remove any remaining organic solvent. Finally, the obtained lipids were dissolved in the cholesterol assay buffer provided in the cholesterol quantification kit (cat. MAK043, Sigma Aldrich, St. Louis, MO, USA). The cholesterol levels in the samples were then quantified according to the manufacturer's instructions.

[0136]

[0137] 1-13. Cell viability assessment for assessing lipotoxicity by palmitate

[0138]

[0139] Primary hepatocytes were obtained from the livers of 8-week-old male C57BL / 6 mice using a two-step perfusion method using medium containing collagenase. Primary hepatocytes were isolated without other cell types using the Percoll gradient method. Cells were seeded in culture medium containing 10% fetal bovine serum (FBS). Five hours after seeding, the medium was replaced with maintenance medium containing 0% FBS. ROUA, UDCA, and RO were applied to the primary hepatocytes in the presence of 500 μM PA. After 24 hours of incubation, cells were fixed with 4% paraformaldehyde and stained with crystal violet. The stained cells were extracted with 1% sodium dodecyl sulfate (SDS) solution and measured at 590 nm.

[0140]

[0141] 1-14. Plasmid

[0142]

[0143] Human ASBT (NM_000452.2) was provided by Dawson PA (Love MW. et al., Arterioscler Thromb Vasc Biol. 2001) and subcloned into pCMV5.

[0144]

[0145] 1-15. Measurement of ASBT inhibition by ROUA

[0146]

[0147] ROUA was dissolved in DMSO at a concentration of 40 mM and stored at -20 °C until use. HEK293 human embryonic kidney) cells were cultured at 1.2 Х 10 5 Cells were seeded in poly-D-lysine-coated 24-well plates at a density of 10 cells / well. The following day, cells were transiently transduced with human ASBT (NM_000452.2) using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Cells transiently transduced with the appropriate empty vector served as mock cells. Culture medium was removed, cells were washed with carrier solution (DPBS), and preincubated at 37 °C for 10 min. Probe substrate [ 3 [H]Taurocholic acid (0.8 μM) and ROUA (0.5 or 50 μM) dissolved in carrier solution were added to the cells and incubated for 5 minutes. Gradually increasing the concentration of ROUA from 0.5 to 50 μM resulted in increased inhibition of intracellular accumulation of the radioactive substrate. After 5 minutes, the incubation was stopped, and the cells were washed twice with cold DPBS (pH 7.4). Cells were lysed in 100 mM NaOH for 1 hour. The radioactivity of the samples was measured using a liquid scintillation counter (Tri-carb 2900 TR, Perkin Elmer, CA, USA).

[0148]

[0149] 1-16. Measurement of protein concentration in cell lysate

[0150]

[0151] The protein content of cell lysates was measured using Bio-Rad protein assay dye reagent according to the manufacturer's instructions. A standard calibration curve was constructed by plotting the average absorbance of a bovine serum albumin (BSA) standard of known concentration, and this was used to determine the protein concentration of the cell lysates.

[0152]

[0153] 1-17. ASBT binding analysis

[0154]

[0155] The binding affinity of ROUA to ASBT was evaluated using biolayer interferometry (BLI) experiments. The binding rate of ASBT was measured using Gator Prime (Gator Bio, Palo Alto, CA, USA) at 35 °C and 1000 rpm. The buffer of the sodium-dependent bile acid transporter (ASBT, SLC10A2) protein was changed from Tris buffer to sodium acetate buffer at pH 4.5 to account for the reactivity of the amine-reactive (AR) sensor. The AR sensor was soaked in distilled water for at least 10 min to stabilize and activate the sensor surface. Activation of the amine group of the AR sensor was performed with DPBS (pH 7.4) in distilled water containing EDC / NHS for 120 s. Subsequently, the binding of ASBT to the AR sensor proceeded for 400 s. After equilibration exposure for 70 s in DPBS, the interactions between ASBT and ROUA and UDCA were evaluated in distilled water containing 1% DMSO for 300 s. The concentrations of ROUA ranged from 25 to 200 μM, and those of UDCA ranged from 61.25 to 500 μM. The dissociation process was performed in DPBS (pH 7.4) for 300 s.

[0156]

[0157] 1-18. Cell uptake analysis

[0158]

[0159] To confirm the binding of ROUA to ASBT, real-time observations were performed using fluorescently labeled ROUA. First, 50 mg of ROUA was dissolved in 2 mL of DMSO, and then 5 mg of RITC dissolved in 500 μL of DMF was added. The mixture was stirred overnight, precipitated in 30 mL of distilled water, and purified five times by centrifugation at 4,000 rpm for 4 minutes at 4 °C. After centrifugation, the supernatant was discarded, and the precipitated mixture was lyophilized to obtain a powder. Purification of the ROUA-RITC compound was confirmed using thin-layer chromatography using a 1:3 volume ratio of methanol and chloroform as the mobile phase. Caco-2 cells were cultured in complete medium consisting of DMEM supplemented with 10% (v / v) FBS and 1% antibiotic-antimycotic solution. Cells were cultured at 37 °C in a 5% CO2 atmosphere. 1.5 Х 10 on a 35 mm confocal plate 5Cells were seeded at a density of 10 μg / mL. After culturing for 4 days, ROUA-RITC was added to the medium at a concentration of 20 μM. Caco-2 cells were observed in real time at 30-second intervals for 1 h using an ECLIPSE Ti2 Series microscope equipped with a RITC filter (Nikon, Tokyo, Japan). The medium was then removed, and the cells were washed twice with DPBS. The cells were treated with 4% paraformaldehyde (PFA) for 30 min at room temperature. The cells were then treated with phalloidin-FITC reagent (Abcam, Cambridge, UK) for 24 h at room temperature. After 24 h, the cells were washed with DPBS. The cells were then incubated with 4',6-diamidino-2-phenylindole (DAPI) solution for 15 min at room temperature and then washed with DPBS. Finally, cells were observed using a Nikon microscope to visualize fluorescent signals at DAPI, FITC, and RITC wavelengths.

[0160]

[0161] 1-19. Toxicity analysis

[0162]

[0163] Cytotoxicity assays of ROUA were performed on CT26.WT cells, a colon adenocarcinoma cell line, Caco-2 cells, and Hep G2 cells obtained from the Korea Cell Line Bank (Seoul, Republic of Korea). These cells were cultured in high-glucose DMEM supplemented with 10% (v / v) FBS and 1% antibiotic-antimycotic solution. The cells were then seeded in 96-well cell culture plates at a density of 1.0 × 10 4Cells were seeded at a density of 10 cells / well and stabilized at 37 °C in a 5% CO2 atmosphere for 1 h. Subsequently, cells were treated with RO, UDCA, and ROUA at concentrations ranging from 0.1 to 500 μM for 24 h. Cell viability (n = 5) was assessed using the EZ-Cytox Cell Viability Assay Kit and measured at 450 and 600 nm using a microplate reader (SPECTROstar Nano, BMG LABTECH, Ortenberg, Germany). The UV absorbance values ​​of the samples were analyzed by comparing them with the control blank.

[0164]

[0165] 1-20. In vivo biodistribution of ROUA

[0166]

[0167] Seven-week-old male BALB / c mice were acclimated for 1 week in a 12-h day / night cycle, controlled temperature and humidity environment. Mice fasted for 17 h before oral administration. ROUA-RITC was dissolved in distilled water at a concentration of 20 mg / kg and administered orally. After administration, fluorescence distribution was measured in major organs, including the intestine, lungs, spleen, heart, kidney, and liver, at each time point. Fluorescence distribution was observed using a Fluorescence In Vivo Imaging System (FOBI, ​​CELLGENTEK, Cheongju, South Korea) utilizing the RITC channel. Intestinal tissues were then stained with DAPI and ASBT, and the staining was performed by KP&T Technology (Cheongju, South Korea). Fluorescence of the stained tissues was observed using an ECLIPSE Ti2 Series microscope (Nikon, Tokyo, Japan) equipped with RITC, FITC, and DAPI filters.

[0168]

[0169] 1-21. In vivo pharmacokinetic (PK) analysis

[0170]

[0171] Seven-week-old male SD rats were housed for 1 week in a 12-h day / night cycle, temperature- and humidity-controlled environment. Rats fasted for 17 h before oral administration of ROUA-RITC. ROUA-RITC was dissolved in distilled water at a concentration of 20 mg / kg for oral administration and 1 mg / kg for intravenous administration. Blood was collected from the jugular vein of the rats at each time point after administration and allowed to coagulate for 30 min at room temperature. Serum was then collected by centrifugation at 4500 G for 15 min at 4 °C. The collected serum was mixed with DMSO in a 1:4 volume ratio for fluorescence measurement. Fluorescence intensity was measured at an excitation / emission wavelength of Ex 555 / Em 595 using a multifunction microplate reader (SpectraMax M2 / SpectraMax L, Molecular Devices, San Jose, CA, USA).

[0172]

[0173] 1-22. Measurement of ROUA stability in rat serum

[0174]

[0175] Serum was obtained from 7-week-old male SD rats. 3 mg of ROUA was dissolved in saline containing 5% DMSO, mixed with the serum, and incubated at 37 °C for 3 days. The cleavage analysis of ROUA in rat serum was evaluated using RP-HPLC. Incubated serum was collected at a rate of 200 μL every hour and extracted with distilled water-ACN (1:1) solvent at a volume ratio of 1:2. The extracted serum was filtered through a syringe filter (0.45 μm) before analysis by RP-HPLC. The ratio of solvent A to solvent B was varied from 10:90 to 90:10 over 40 min using a gradient system. Solvent A consisted of acetonitrile containing 0.1% TFA, and solvent B consisted of distilled water containing 0.1% TFA. The flow rate used throughout this procedure was 1 mL / min. RP-HPLC peaks were monitored using a UV-visible detector (245 nm).

[0176]

[0177] 1-23. High-fat diet animal experiments

[0178]

[0179] All animal experiments were conducted in compliance with the standard regulations of the Institutional Animal Care and Use Committee (IACUC) of Konkuk University (Reference Number: KU22078-1). Animals were housed in a 12-hour day / night cycle, controlled temperature and humidity environment. Obesity was induced in male C57BL / 6 mice (4 weeks old) by diet for 42 days. A total of 30 mice were used and divided into five experimental groups (n = 6): negative control group (normal diet, RD), positive control group (high-fat diet, HFD), UDCA (10 mg / kg), RO (10 mg / kg), and ROUA (20 mg / kg). The RD group received a normal diet, whereas the other groups received a high-fat diet containing 60 kcal% fat (D12492, Research Diets, New Brunswick, NJ, USA). Body weights were measured weekly. From day 18 of the dietary intervention, each group received daily oral administration of the respective substance: UDCA (10 mg / kg), RO (10 mg / kg), or ROUA (20 mg / kg). On the last day of the study, an oral glucose tolerance test (OGTT) was performed to assess glucose sensitivity. After a minimum of 17 h of fasting, all experimental groups received oral glucose solution (2 g / kg). Blood glucose levels were measured at 0, 15, 30, 60, 90, 120, and 180 min using a glucometer (G CARE, GC Medical Science, Yongin, Republic of Korea) (n = 3). After a 2-h feeding period, the mice were fasted again for 17 h. Afterwards, the mice were anesthetized by intraperitoneal injection of 2,2,2-tribromoethanol (TBE), and blood samples were collected. Hepatotoxicity and lipid profile analyses were performed on collected blood samples, and liver tissue was stained with H&E and Oil Red O for further evaluation. All analyses were performed at KP&T Technology (Cheongju, Republic of Korea).

[0180]

[0181] 1-24. High-fat / high-fructose diet animal studies

[0182]

[0183] Animals were housed in a 12-h day / night cycle, temperature- and humidity-controlled environment. Fatty liver disease was induced in male C57BL / 6 mice (5 weeks old) through dietary intervention for 84 days. A total of 30 mice were used and divided into five experimental groups (n = 6): negative control (regular diet, RD), positive control (high-fat / high-fructose diet, HFHFD), RO (10 mg / kg), ROUA (20 mg / kg), and ROUA (40 mg / kg). The RD group received a regular diet, and the other four groups received diets containing 40 kcal% fat (palm oil) and 20 kcal% fructose (D09100310, Research Diets, New Brunswick, NJ, USA). Body weights were measured weekly. From day 34 of the dietary intervention, RO (10 mg / kg), ROUA (20 mg / kg), and ROUA (40 mg / kg) were administered orally daily. On the last day of the study, the animals were fasted for 17 h. Afterwards, mice were anesthetized by intraperitoneal injection of TBE, and blood samples were collected. Hepatotoxicity and lipid profile analyses were performed on the collected blood samples. Additionally, liver tissues were further evaluated using H&E, Oil Red O, Sirius Red, and TUNEL staining, and all analyses were performed at KP&T Technology (Cheongju, South Korea).

[0184]

[0185] 1-25. Acute toxicity studies

[0186]

[0187] Eight-week-old male BALB / c mice were housed in a 12-h day / night cycle, controlled temperature and humidity environment. After a 6-day acclimation period, oral administration of RO (100 mg / kg) and ROUA (200 mg / kg) was initiated. Three days after the start of oral administration, blood samples were collected from the inferior vena cava of the mice. The collected blood samples were allowed to clot for 30 minutes at room temperature to obtain serum (n = 5). Additionally, some blood samples were collected in tubes containing K2E (K2EDTA) to obtain whole blood (n = 3). Acute toxicity assessments of the collected blood samples were performed on the same day at KP&T Technology (Cheongju, South Korea).

[0188]

[0189] 1-26. Statistical Analysis

[0190]

[0191] Results are presented as mean ± standard deviation (SD). Error bars represent standard deviations from the mean of independent samples. The statistical significance of differences between groups was analyzed using one-way analysis of variance (ANOVA) tests and post hoc tests. All statistical analyses were performed using GraphPad Prism 9.0 (GraphPad Software Inc.) or SigmaPlot software (Systat Software Inc., Palo Alto, CA, USA). Differences between groups were considered statistically significant when the p value was less than 0.05, 0.01, or 0.001 ( * : p < 0.05, ** : p < 0.01, *** : p < 0.001).

[0192]

[0193] Example 2. Synthesis and characterization of ROUA

[0194]

[0195] ROUA was synthesized in three steps via a 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide / N-hydroxysuccinimide (EDC / NHS) coupling reaction using dimethyl sulfoxide (DMSO) ( Figure 3A ). The detailed synthetic process is shown in Figure 2 . Each carboxyl group of rosuvastatin (RO) and ursodeoxycholic acid (UDCA) was chemically bonded to the amino groups at both ends of ethylenediamine (EDA). This linker-based molecular structure allows ROUA to bind to HMG-CoA reductase and ASBT without interfering with their respective pharmacological functions ( Figure 3B ). The ROUA bioconjugate was identified through analysis using a RP-HPLC system (Agilent 1200 series, Agilent Technologies, Santa Clara, CA, USA) and a 1D proton nuclear magnetic resonance (NMR) spectrometer (JNM-ECZ500R / S1, JEOL, Tokyo, Japan). As a result, the retention time (RT) of ROUA was clearly measured as 20.5 min, which was different from that of the intermediate, confirming that it was successfully synthesized ROUA (Fig. 4). 1 H NMR spectroscopy analysis showed the simultaneous presence of specific peaks of amide bonds formed by UDCA, RO, and EDA (Fig. 5). ROUA and the reaction intermediate 1 H NMR results and ROUA 13C NMR results are shown in Figures 5 and 6. After confirming the synthesis of ROUA molecules, the molecular weight of the synthesized ROUA was measured using LC-ESI-MS and MALDI-TOF-MS. The resulting value was almost identical to the predicted molecular weight of 897.51 g / mol of the ROUA molecule (Figure 7). The synthesized ROUA molecules possess not only hydrophobic but also amphiphilic properties due to the presence of multiple hydroxy groups (Figure 3D). This may enable ROUA molecules to aggregate in aqueous solutions to form nanoparticles.

[0196]

[0197] Example 3. Binding analysis of ROUA to bile acid transporters

[0198]

[0199] As shown in Figure 8, the ASBT protein features a binding site within a hydrophobic pocket located at the top of the structure. While the internal structure of this binding site is primarily hydrophobic, the upper region contains numerous hydrophilic amino acids, allowing it to interact with the hydrophilic portion of ROUA or RO (Figure 3E). UDCA binding to ASBT is shown in Figure 8B. Furthermore, the presence of RO effectively increases the molecular size of ROUA compared to UDCA, thereby effectively binding to the binding site and inhibiting the recycling of other bile acids. This is evidenced by the interactions of ROUA docked to ASBT with surrounding residues. Unlike the UDCA molecule, ROUA exhibits additional potential interactions with Lys55, Val116, Val125, Met51, and Gly51 (Figures 3F and 8C). Trajectories obtained from 100 ps molecular dynamics (MD) simulations showed consistent interactions between ROUA and surrounding residues, particularly in the hydrophilic region of ASBT spanning amino acids 51 to 55, which were absent for UDCA (Figures 3G and 9). A quantitative assessment of the ligand-receptor interactions observed during the MD simulations was performed using energy calculations. The structural stability of ROUA was investigated during the 100 ps MD simulations, and no significant conformational changes were observed, indicating its sustained efficacy as an ASBT inhibitor (Figure 3H). If ROUA had undergone extreme conformational changes during the MD simulations, its inhibitory efficacy against ASBT would have been lost, but this was not observed. Analysis of the interaction energy over time revealed that ROUA exhibited a higher interaction strength than UDCA (Figure 3I). Evaluation of the binding energy in the stabilized structure after 100 ps MD simulations revealed that ROUA exhibited an interaction energy strength that was more than three times that of UDCA (Figure 3J). Additionally, in the inhibitory concentration (Ki) evaluation of UDCA and ROUA against ASBT, ROUA showed a Ki four times lower than UDCA (Fig. 3K).The affinity energies obtained from docking simulations of UDCA and ROUA were -9.3 for UDCA and -9.9 for ROUA, indicating that ROUA can bind to the ASBT protein for a longer period of time (Figure 10A). Additionally, Figure 10B shows the types and number of interactions within the nanoparticles after MD simulations. Most of the binding and MD simulation results indicate that ROUA molecules bind well to both the target (ASBT) and the bile acid (UDCA) and inhibit the function of ASBT.

[0200]

[0201] Example 4. Nanoparticle analysis

[0202]

[0203] Although ROUA molecules are hydrophobic, they are endowed with amphipathic properties by four or more hydrophilic residues, and thus were expected to self-assemble into nanoparticles at low concentrations. We initially observed self-assembled ROUA in an ionic-neutral solvent model. Self-nanoassembly of ROUA began around 30 ns, and distinct clustering of nanoparticles was observed after 60 ns ( Figure 11A ). By the end of the 100 ns MD simulation, ROUA had formed nanoparticles composed of approximately 20 molecules. Morphological analysis of the nanoparticles revealed that the hydrophobic UDCA moiety formed the core, while the hydrophilic RO moiety interacted with the solvent and remained exposed to the outside. Evaluation of the interactions within the nanoparticles generated after MD simulation revealed that hydrogen bonding was predominant, supplemented by hydrophobic interactions such as alkyl and pi orbital bonds ( Figure 11B ). Additionally, due to the inherent negative charge of RO, most of the nanoparticles exhibited negative charges, indicating that RO was exposed to the solvent and had functional potential within the ROUA nanoparticles (Fig. 11C). The morphology of the ROUA nanoparticles was observed using TEM and SEM-EDS, which provided detailed analysis of the morphological characteristics of the nanoparticles (Fig. 11D). The particle size distribution and zeta potential of the ROUA nanoparticles were measured using dynamic light scattering (DLS; Zetasizer Nano, Malvern Instruments, Worcestershire, UK). In distilled water at pH 7 containing 5% DMSO, ROUA molecules self-formed nanoparticles with an average size of 239.23 ± 6.12 nm (Fig. 11E) and an average zeta potential of -22.08 ± 0.84 mV (Fig. 11F). The stability of the size and zeta potential of the formed nanoparticles was monitored for 6 days, during which consistent stability was observed (Figs. 11G to 11H).Oral administration of ROUA nanoparticles was considered in future studies, and the particle size and zeta potential were measured at pH 2 and pH 8, which are similar conditions in the stomach and intestine, respectively. The size was 161.57 ± 0.71 nm and the zeta potential was -20.78 ± 0.56 mV at pH 8, while in distilled water at pH 2, the particle size was 4420 ± 360.2 nm (Fig. 12A) and the zeta potential was 12.1 ± 1.71 mV (Fig. 12B). This suggests that in an acidic environment, the hydroxyl groups acquire protons, resulting in a positive charge.

[0204]

[0205] Example 5. Inhibitory effects on cholesterol biosynthesis and hepatic lipotoxicity.

[0206]

[0207] Statins are competitive inhibitors of HMG-CoA reductase (HMGCR), the rate-limiting enzyme involved in cholesterol biosynthesis. Several cholesterol-lowering drugs, such as atorvastatin, simvastatin, and rosuvastatin, have been widely used to prevent cardiovascular disease and hyperlipidemia. These cholesterol-lowering drugs have been shown to paradoxically increase the activity of cholesterol biosynthesis-related enzymes, including HMG-CoA synthase 1 (HMGCS1) and farnesyl diphosphate synthase (FDPS), in the liver and various cancer cells. Both ROUA and RO are absorbed into the body via ASBT, but contain the bile acid UDCA, which must bind effectively to HMG-CoA reductase. Therefore, it is essential that ROUA exhibit a similar interaction with HMG-CoA reductase as the existing drug RO. Pharmacophore analysis is a validated method for estimating and analyzing potential interactions of small-molecule drugs. It systematically divides the key domains of drug action into circles, representing them as circles, and predicts interactions when key functional groups overlap within these circles. In this regard, docking RO and ROUA revealed striking similarities in the interacting pharmacophore conformations (Figure 13A). In the case of RO, interactions with the negatively charged nitrogen of the central ring were observed, with hydrogen bond acceptors playing a key role in both functional groups. These characteristics closely resemble the pharmacophore of the RO moiety of ROUA, indicating that ROUA retains the ability to bind to HMG-CoA reductase. To determine whether ROUA, as a prodrug, has an inhibitory effect on HMGCR, the enzymatic activity of HMG-CoA reductase was measured in the presence or absence of ROUA, UDCA, and RO alone.The HMG-CoA reductase enzyme activities of RO and ATR were reduced by 23% and 15%, respectively, compared to the control group. In particular, ROUA reduced HMG-CoA reductase enzyme activity by 41% compared to the control group, indicating that ROUA acts as an activated statin (Fig. 13B). Several genes, such as HMGCS1 and FDPS, are associated with cholesterol biosynthesis (Fig. 13C).

[0208] Next, we examined HMGCS1 and FDPS mRNA levels in ROUA-treated colon cancer cells. The results were significant, with HMGCS1 (Fig. 13D) and FDPS mRNA levels (Fig. 13E) being higher than after single RO treatment. Furthermore, ROUA treatment increased HMGCS1 protein levels in HCT116 cells (Fig. 13F). ROUA consistently reduced intracellular cholesterol levels in colon cancer cells (Figs. 13G to 13H).

[0209] Furthermore, the antilipotoxic effect of ROUA was investigated in normal primary hepatocytes by assessing cell viability. Treatment with palmitic acid (PA) induced lipotoxicity, significantly reducing cell viability. ROUA and UDCA restored PA-induced cell death, but this effect was not observed with simvastatin or rosuvastatin (Fig. 13I). Similar to UDCA, ROUA exhibited significant antilipotoxic activity against PA.

[0210]

[0211] Example 6. ASBT binding and inhibitory effects of ROUA nanoparticles in various cells.

[0212]

[0213] We performed several cell binding and inhibition tests to evaluate the inhibitory potential of ROUA on human ASBT, a member of the solute carrier (SLC) family, using an in vitro cell test system. For ASBT inhibition, ROUA nanoparticles showed a concentration-dependent inhibition pattern within the tested concentration range of 0.5 to 50 μM in HEK293 cells overexpressing ASBT. Under these conditions, ROUA nanoparticles inhibited ASBT-mediated [ 3 [H] showed a concentration-dependent inhibition pattern in taurocholic acid uptake, with inhibition rates of 70.76% at 0.5 μM and 59% at 50 μM (Fig. 14A). These results suggest that ROUA nanoparticles have an inhibitory effect on ASBT activity.

[0214] The binding affinity of ROUA to ASBT was evaluated using BLI experiments. When the experiment was performed at 35°C and 1000 rpm using Gator Prime (Gator Bio, Palo Alto, CA, USA), the binding kinetics of ROUA to ASBT was measured to be 1.34 nM, which was approximately four times higher than that of UDCA (4.84 nM) (Figures 14B-C). It is noteworthy that ROUA exhibits a higher affinity for ASBT protein than UDCA, suggesting that ROUA is more selective and can bind to ASBT. The binding of ROUA to ASBT was monitored for 1 h using the real-time monitoring technology of an ECLIPSE Ti2 Series microscope (Nikon, Tokyo, Japan) (Figure 14D). RITC-labeled ROUA was treated to Caco-2 cells, a human epithelial colon adenocarcinoma cell line expressing ASBT. Rapid interaction of ASBT and ROUA on the Caco-2 cell membrane was observed, and the fluorescence intensity was quantified using Image J software (US National Institutes of Health) (Fig. 14E). After 1 h of observation, cells were fixed with 4% paraformaldehyde (PFA) and stained with a nuclear (DAPI) and actin marker (phalloidin-FITC). Real-time fluorescence tracking confirmed the intracellular uptake of ROUA labeled with RITC via ASBT, and RITC fluorescence was observed in the cytoplasmic region, excluding cell junction sites (FITC) and the nucleus (DAPI) (Fig. 14F). This suggests that ROUA nanoparticles bind to ASBT on the cell membrane and then enter the cell.

[0215] To evaluate the cytotoxic effects of ROUA nanoparticles on various colon cells, several cytotoxicity assays were performed using the mouse colon cancer cell line CT26.WT and the human epithelial colon adenocarcinoma cell line Caco-2. Interestingly, treatment with 500 μM RO significantly reduced the cell viability of the CT26.WT cell line to 36.51 ± 2.13%, whereas ROUA treatment maintained a significantly higher cell viability of 96.89 ± 5.93% (Figures 14G to 14H). The cell viability of UDCA was measured to be 100.95 ± 3.12%, indicating that ROUA exhibits minimal toxicity. Similarly, in the Caco-2 cell line experiment, RO treatment decreased cell viability to 50.31 ± 11.12%, whereas ROUA showed a high cell viability of 80.58 ± 5.63%, which was similar to the toxicity level of UDCA (85.70 ± 4.10%). Furthermore, in the cytotoxicity evaluation using the human hepatocellular carcinoma cell line Hep G2, ROUA nanoparticles showed almost no toxicity compared to the FDA-approved drug rosuvastatin (Fig. 14I). RO treatment at the same concentration showed a cell viability of 78.39 ± 5.21%, whereas ROUA treatment showed a much higher cell viability of 96.89 ± 5.93%. The lack of toxicity in the combination of RO and UDCA suggests that UDCA may transform RO into a safer bioconjugate, highlighting the safety profile of ROUA nanoparticles.

[0216]

[0217] Example 7. Fluorescence measurement in organs after oral administration of ROUA nanoparticles

[0218]

[0219] ROUA nanoparticles (RITC-labeled) were orally administered to male BALB / c mice at a concentration of 20 mg / kg. After administration, the fluorescence distribution was observed at various time points using the RITC channel of a fluorescence in vivo imaging system (Fig. 15A). Fluorescence was strongly observed in the small intestine, where ASBT expression is high, compared to the duodenum, where ASBT expression is relatively low. The fluorescence coincidence between FITC-labeled ASBT and RITC-labeled ROUA confirms that ROUA binds to ASBT (Fig. 15B). The intestinal distribution of ROUA was monitored over time, and fluorescence was measured at regular intervals (Fig. 15C). While fluorescence was faintly detected in the duodenum, where ASBT expression is low, fluorescence was relatively strong and persistent in the small intestine, including the ileum, a target site where ASBT is typically overexpressed. This indicates that ROUA binds to ASBT persistently and long-term in the small intestine. The accumulation of ROUA nanoparticles in major organs such as the lungs, spleen, heart, kidney, and liver was also monitored throughout the experiment (Fig. 15D). The increase in fluorescence intensity in the liver indicates that ROUA nanoparticles accumulated in the liver for a long time after absorption from the intestine and were excreted through the kidney. The pharmacokinetic properties of ROUA were investigated after oral and intravenous administration of RITC-labeled ROUA to SD rats. Serum obtained from jugular vein blood collected after administration was extracted with DMSO, and fluorescence was measured using a multi-mode microplate reader (SpectraMax M2 / SpectraMax L, Molecular Devices, San Jose, CA, USA). Male SD rats were administered orally at 20 mg / kg and intravenously with ROUA-RITC at 1 mg / kg. After oral administration, serum fluorescence reached the peak concentration after 12 h, gradually decreased over the next 72 h, and completely disappeared after 120 h (Fig. 15E).After intravenous injection of ROUA nanoparticles, the fluorescence signal gradually decreased over 12 hours and completely disappeared within 48 hours (Fig. 16). To confirm the stability of ROUA nanoparticles in serum, they were incubated in rat serum for 72 hours. Serum extracted with distilled water-ACN (1:1) solvent was measured over time using an RP-HPLC system. The results confirmed that ROUA molecules were stable and not degraded in serum for 72 hours (Fig. 15F).

[0220]

[0221] Example 8. Therapeutic effect of ROUA in animals fed a high-fat diet (HFD).

[0222]

[0223] To observe the therapeutic effects in an obese mouse model fed a high-fat diet (D12492, Research Diets, New Brunswick, NJ, USA) containing 60 kcal% of fat, mice were orally administered ROUA (20 mg / kg), UDCA (10 mg / kg), or RO (10 mg / kg) daily. The schedule of the high-fat diet experiment is shown in Figure 17A. The body weight of the group fed the high-fat diet significantly increased compared to the regular diet (RD) group, but the body weight of the group treated with ROUA significantly decreased, similar to the RD group (Figure 17B). The body weights of the mice at the end of the experiment were as follows: RD, 27.1 ± 1.73 g; HFD, 37.2 ± 2.62 g; HFD+UDCA, 33.04 ± 1.12 g; HFD+RO, 35.34 ± 3.06 g; HFD+ROUA, 31.72 ± 0.81 g (Fig. 17C). Before the end of the experiment, the therapeutic efficacy of ROUA on diabetes-related metabolic disorders was confirmed through a glucose tolerance test. Unlike the other groups, the ROUA group rapidly maintained a level similar to the RD group. In contrast, the RO group did not show a stable decrease in blood glucose (Fig. 17D). The area values ​​from 1 to 2 hours were as follows: RD, 52.33 ± 6.43%; HFD, 100 ± 33.41%; UDCA, 90.67 ± 11.72%; RO, 97.33 ± 10.07%; ROUA, 64.33 ± 8.51% (Fig. 17E). Despite the HFD conditions, the group treated with ROUA nanoparticles showed reduced liver weight and levels of hepatic alanine aminotransferase (ALT), low-density lipoprotein (LDL), triglyceride (TG), and total cholesterol compared to the HFD group (Figures 17F to 17J). Notably, the reduction in intrahepatic fat accumulation was further confirmed by H&E and Oil Red O staining.Compared to the RD group, abnormal accumulation of lipid droplets was observed in the HFD and RO groups (Fig. 17K). In contrast, the group treated with ROUA nanoparticles showed a significant reduction in lipid droplet accumulation in the liver tissue. Quantitative analysis of liver fat using Image J software further supported these results (Fig. 17L). The HFD group had significantly higher lipid levels compared to the RD group, and similar observations were made in the UDCA and RO groups. In contrast, the group treated with ROUA nanoparticles showed a significant reduction in lipid accumulation. Therefore, these results suggest that ROUA nanoparticles have therapeutic potential to reduce blood lipid levels and improve fatty liver status after oral administration.

[0224]

[0225] Example 9. Therapeutic effect of ROUA nanoparticles fed a high-fat / high-fructose diet (HFHFD).

[0226]

[0227] The therapeutic effect of ROUA was observed in an obese mouse model fed a high-fat / high-fructose diet (HFHFD) (D09100310, Research Diets, New Brunswick, NJ, USA) containing 40 kcal% fat (palm oil) and 20 kcal% fructose for 84 days (Fig. 18A). RO (10 mg / kg), ROUA (20 mg / kg), and ROUA (40 mg / kg) were orally administered daily from the start of the diet on day 34. The body weight of the control group fed the HFHFD diet increased compared to the normal diet (RD) group, but the body weights of all treated groups were relatively similar to the RD group (Fig. 18B). The body weights measured at the end of the experiment were as follows: RD, 30.42 ± 2.01 g; HFHFD, 37.98 ± 1.72 g; RO, 31.78 ± 2.1 g; ROUA (20 mg / kg), 33.28 ± 1.33 g; ROUA (40 mg / kg), 32.5 ± 1.05 g (Fig. 18C). Interestingly, although all treatment groups did not show significant body weight loss compared to the HFHFD group, there was a significant difference in liver weight. In the group treated with ROUA nanoparticles, liver weight was reduced by approximately 15% compared to the HFHFD group despite consuming the HFHFD diet. The results of liver weight measurements were as follows: RD, 71.83 ± 4.26%; HFHFD, 100.17 ± 8.3%; RO, 102 ± 2.16%; ROUA (20 mg / kg), 87.33 ± 6.44%; ROUA (40 mg / kg), 84.4 ± 5.46% (Fig. 18D). For further analysis, liver samples were fixed in neutral buffered formalin (10%) and then embedded in paraffin. Liver sections were stained with hematoxylin and eosin (H&E) or Oil Red O to assess the degree of intrahepatic fat accumulation, and Sirius Red staining was used to assess the degree of liver fibrosis. Hepatocyte apoptosis was assessed using TUNEL staining.H&E staining results showed abnormal lipid droplet accumulation in the HFHFD and RO groups compared to the RD group (Fig. 18E). In contrast, the ROUA treatment group showed a decrease in lipid droplet accumulation in the liver tissue. Specifically, the HFHFD group showed significantly higher lipid accumulation compared to the RD group, and high lipid accumulation was also observed in the ROUA treatment group. Conversely, lipid accumulation was reduced in the ROUA treatment group. Liver fibrosis evaluation using Sirius Red staining showed that fibrosis was reduced in a dose-dependent manner in the ROUA treatment group. Furthermore, TUNEL staining for measuring hepatocyte apoptosis showed a significant increase in fluorescence expression in the HFHFD and RO groups, whereas fluorescence decreased in a dose-dependent manner in the ROUA treatment group. The percentage of TUNEL fluorescence was quantified using Image J software (US National Institutes of Health). The fluorescence expression level in the RO group was similar to that in the HFHFD group, but the fluorescence level in the ROUA treatment group was observed to be approximately half (Fig. 18F). These results suggest that orally administered ROUA nanoparticles can improve fatty liver and alleviate inflammation in an HFHFD animal model.

[0228] Finally, acute toxicity assessment of high-dose (200 mg / kg) ROUA nanoparticles administered orally in normal mice was conducted. High-dose single oral doses of RO (100 mg / kg) and ROUA (200 mg / kg), equivalent to five times the therapeutic dose, were administered, and no significant adverse effects were observed after 3 days. Biochemical and hematological measurements were performed at KP&T Technology (Cheongju, South Korea). As a result, no significant toxicity was detected in biochemical and hematological analyses (Figs. 18G to 18K and 19). ROUA exhibited lower blood urea nitrogen (BUN) levels than RO, suggesting its potential as a safer drug candidate than rosuvastatin, which is associated with nephrotoxicity at high doses.

[0229]

[0230] The present invention is an invention carried out through the following tasks.

[0231]

[0232] [National Research and Development Project Supporting This Invention]

[0233] [Project ID]RS-2024-0042226830382106450001

[0234] [Project Number] RS-2024-00422268

[0235] [Ministry Name] Ministry of Science and ICT

[0236] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea (Korea Institute for Science and Technology Commercialization)

[0237] [Research Project Name] University Technology Management Promotion Project

[0238] [Research Project Name] IP Enhancement and Commercialization for UDCA Conjugate Commercialization

[0239] [Project Performing Organization Name] Konkuk University GLOCAL Campus

[0240] [Research Period] April 1, 2024 - December 31, 2024

[0241]

[0242] [National Research and Development Project Supporting This Invention]

[0243] [Project ID]1345370811

[0244] [Project Number] 2021RIS-001

[0245] [Ministry Name] Ministry of Education (P13)

[0246] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0247] [Research Project Name] Local Government-

[0248] University Cooperation-Based Regional Innovation Project (086123605005223002301400)

[0249] [Research Project Name] Local Government-University Cooperation-Based Regional Innovation Project (Chungbuk Regional Innovation Platform)

[0250] [Contribution rate] 50 / 100

[0251] [Name of Project Performing Organization] (Chungbuk Regional Innovation Platform) Chungbuk National University

[0252] [Research Period] April 1, 2023 - February 29, 2024

Claims

1. A pharmaceutical composition for the prevention or treatment of metabolic diseases comprising a bile acid or a pharmaceutically acceptable salt thereof combined with a statin.

2. In paragraph 1, the bile acid is glycocholic acid, glycocholic acid A pharmaceutical composition comprising at least one selected from the group consisting of chenodeoxycholic acid, taurocholic acid, deoxycholic acid, taurodeoxycholic acid, cholic acid, chenodeoxycholic acid, ursodeoxycholic acid, lithocholic acid, and dehydrocholic acid.

3. A pharmaceutical composition according to claim 1, wherein the statin is at least one selected from the group consisting of rosuvastatin, cerivastatin, atorvastatin, lovastatin, simvastatin, pravastatin, mevastatin, fluvastatin, rivastatin, pitavastatin, and pharmaceutically acceptable salts thereof.

4. A pharmaceutical composition according to claim 1, wherein the statin is bound to the bile acid via ethylenediamine (EDA).

5. A pharmaceutical composition according to claim 1, wherein the metabolic disease is at least one disease selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), obesity, diabetes, hyperlipidemia, and dyslipidemia.

6. A pharmaceutical composition according to claim 1, wherein the composition is administered by any one route of administration selected from the group consisting of oral administration, intravenous administration, intraperitoneal administration, intramuscular administration, subcutaneous administration, intradermal administration, topical administration, intrapulmonary administration, and rectal administration.

7. A pharmaceutical composition according to claim 1, wherein the bile acid to which the statin is bound is represented by the following chemical formula 1. [Chemical Formula 1] 8. A pharmaceutical composition according to claim 1, wherein the size of the bile acid to which the statin is bound is 100 to 400 nm.

9. A pharmaceutical composition according to claim 1, wherein the bile acid to which the statin is bound self-assembles at pH 7 to 10.

10. A pharmaceutical composition according to claim 1, wherein the daily dosage of the composition is 1 to 200 mg / kg.

11. A health functional food composition for preventing or improving metabolic diseases, comprising a bile acid combined with a statin or a pharmaceutically acceptable salt thereof. 12.ⅰ) A step of preparing a first mixture by mixing statin, EDC, and NHS in an anhydrous DMSO solution; ⅱ) A step of preparing a second mixture by mixing bile acid, EDC and NHS in an anhydrous DMSO solution; ⅲ) A step of preparing a third mixture by stirring the second mixture and EDA; ⅳ) A step of preparing a fourth mixture by mixing the first mixture and the third mixture in anhydrous DMSO and then stirring; and ⅴ) A step of precipitating the fourth mixture in distilled water and then centrifuging it; A method for producing a bile acid conjugated with a statin, comprising:

Citation Information

Patent Citations

  • Composition useful for the treatment of type 2 diabetes

    KR1020090115939A

  • Pharmaceutical composition for prevention and treatment of hyperlipidemia and diabetes

    KR102289381B1

  • Profit generation system and method using fuel cell cogeneration

    KR102582693B1

  • Electronic device for reducing harmonic interference and operating method thereof

    KR102900718B1