Compositions and methods for re-activation of dysfunctional skeletal stem cells

Abstract

Disclosed are methods of treating musculoskeletal and / or bone diseases using at least one inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF-β) signaling and at least one activator of Hedgehog (Hh) signaling.

Description

COMPOSITIONS AND METHODS FOR RE-ACTIVATION OF DYSFUNCTIONAL SKELETAL STEM CELLSFIELD

[0001] The disclosure relates to combinations of at least one inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF- ) signaling and at least one activator of Hedgehog (Hh) signaling, and their use in the treatment and / or prevention of musculoskeletal and / or bone diseases and / or conditions.INCORPORATION BY REFERENCE OF ELECTRONICALLY SUBMITTED MATERIAL

[0002] This application contains, as a separate part of the disclosure, a Sequence Listing in computer-readable form which is incorporated by reference in its entirety and identified as follows: 70187_SeqListing.XML; Size: 8,513 bytes; Created: July 23, 2025.GOVERNMENT SUPPORT CLAUSE

[0003] This invention was made with Government support under contracts AG049958, AG066963, and CA151673 awarded by the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND

[0004] Musculoskeletal diseases are skyrocketing with the increasingly aging society. For instance, available bone anabolic and anti-bone resorptive therapies to treat or prevent osteoporosis-related bone loss come with critical limitations and known side effects. The therapeutic increase in trabecular long bone and vertebral bones with these agents is limited and is usually not used in a fracture setting to improve poor healing outcomes. Thus, there remains a need for better therapies and methods for treating musculoskeletal diseases, including, but not limited to, osteoporosis-related bone loss.

[0005] Furthermore, it is known in the field of skeletal stem cells that growth, maintenance, and regeneration of adult organ tissues require the constant replenishment of mature cell types by pools of resident stem cells. Revealing the identity and characterizing the ontogeny of these rare self-renewing multipotent stem cells in different tissues could unlock the underlying biology behind degenerative conditions including aging and cancer. The utility of a stem cell-centric approach to understanding disease is best exemplified by studies on hematopoietic stem cells (HSCs), which give rise to the entire blood system and have been revealed to play key roles in major aspects of hematopoiesis, from early development to age-related changes in immunityand blood-borne malignancies56. Recent advances in single-cell RNA-sequencing (scRNA-seq) analysis further revealed previously overlooked cellular heterogeneity in HSC populations while highlighting new aspects of their regulation by non-hematopoietic cell types that serve as their niche7-9. ScRNA-seq has also been applied to characterize the complexity of skeletal boneresident niche populations in mice10-12. Nonetheless, the current understanding of human skeletal stem and progenitor cells remains limited due to a variety of challenges such as ethical and experimental accessibility.

[0006] Although functionally intertwined with HSCs, the identity of a self-renewing, multipotent human skeletal stem cell (hSSC) has long been elusive. Several cell populations have been proposed to enrich stem and progenitor cell types that can create a hematopoiesissupporting microenvironment but have relied on unspecific single markers or prior in vitro expansion for functional assessment13,14. Using a combination of eight cell surface markers, recent research described a distinct bona fide hSSC in the fetal growth plate that is capable of giving rise to bone, cartilage, and stromal tissue3,4. These stem cells can also be found in fracture calluses of regenerating adult bones and show a functional association with healing outcomes and decline during aging15,16. Although HSC aging and blood diseases have been attributed to aberrant clonal expansion and lineage output17,18, which has been causally tied to skeletal stem cell lineage dysfunction in mice19,20, there remains a need for better understanding of the underlying mechanism of hSSC dysfunction.

[0007] A need exists for therapies that re-activate dysfunctional hSSCs for treating and / or preventing musculoskeletal and / or bone diseases and / or conditions without the need of exogeneous cell sources.SUMMARY

[0008] The present disclosure provides, in some embodiments, methods for treating bone disease. In one embodiment, a method for treating a bone disease in a subject is provided, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF-p) signaling, and (b) an activator of Hedgehog (Hh) signaling. In one embodiment, the inhibitor of BMP / TGF-p signaling is any inhibitor that inhibits activin receptor-like kinase 1 (ALK1 ) or activin receptor-like kinase 3 (ALK3). In another embodiment, the inhibitor of BMP / TGF-p signaling is a selective inhibitor. In still another embodiment, the selective inhibitor of BMP / TGF-p signaling is LDN- 193189 2HCI, LDN-193189, dorsomorphin 2HCI, dorsomorphin, K02288, LDN-212854, ML347,or DMH1 (dorsomorphin homolog 1 ). In one embodiment, the selective inhibitor of BMP / TGF-3 signaling is DMH1 .

[0009] In still another embodiment of the present disclosure, an aforementioned method is provided wherein the activator of Hedgehog signaling is a Smoothened agonist. In another embodiment of the present disclosure, an aforementioned method is provided wherein the activator of Hedgehog signaling is Hh-Ag1 .5, 20(S)-Hydroxycholesterol, SAG, or SAG21 k. In some embodiments, the activator of Hedgehog signaling is SAG21 , SAG, SAG1 , or SAG21 k. In one embodiment, the activator of Hedgehog signaling is SAG21 k.

[0010] The present disclosure also provides, on one embodiment, a method for treating a bone disease in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) DMH1 , and (b) SAG21 k. In still another embodiment of the present disclosure, an aforementioned method is provided wherein the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are implanted in a drug delivery device. In one embodiment, the drug delivery device is a biodegradable implant. In another embodiment, the biodegradable implant is a block polymer implant. In yet another embodiment, the biodegradable implant comprises poly(caprolactone) (PCL), poly(lactic acid) (PLA), or poly(lactic-co-glycolic acid) (PLGA). In still another embodiment, the biodegradable implant comprises collagen, hyaluronic acid, cellulose, chitosan, silk, gelatin, albumin, elastin, or milk proteins. In yet another embodiment of the disclosure the biodegradable implant is a hydrogel. In related embodiments, the drug delivery device is implanted at a position topical to a fracture site or to a site afflicted with the bone disease.

[0011] In still another embodiment of the present disclosure, an aforementioned method is provided wherein the selective inhibitor of BMP / TGF- signaling and the activator of Hedgehog signaling are administered topically to a fracture site or to a site afflicted with the bone disease of a subject. In still another embodiment, the implant is provided immediately following an injury.

[0012] In still another embodiment of the present disclosure, an aforementioned method is provided wherein the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are administered within 3 days of an injury.

[0013] The present disclosure further provides a drug delivery device comprising of an effective dose of a selective inhibitor of BMP / TGF-p signaling and an activator of Hedgehog signaling for reactivation of SSCs.

[0014] In still another embodiment of the present disclosure, an aforementioned method is provided wherein the SSCs are human SSCs (hSSCs). In on embodiment, the subject is a mammal. In still another embodiment, the subject is a human.

[0015] The present disclosure also provides, in one embodiment, a substantially pure population of skeletal stem cells produced by the method according to an aforementioned method. In yet another embodiment, a method of treatment is provided, comprising administering to an individual the population of cells according to an aforementioned embodiment. In yet another embodiment, the present disclosure provides a kit or system for use in an aforementioned method.

[0016] Additional embodiments and aspects of the presently disclosed compositions and methods are provided below. All headings are simply for organization and are not intended to limit the disclosure in any manner. The content of any individual section may be equally applicable to all sections.BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIGs. 1A-1 G illustrate that human bone development and disorders are rooted in distinct skeletal stem cell diversity. (FIG. 1 A) Schematic overview of fetal skeletal tissue compartments processed for human skeletal stem cell (hSSC) scRNA-seq. (FIG. 1 B) Dotplot showing gene expression of reported skeletal stem and progenitor (prog.) marker genes in hSSCs across skeletal sites. (FIG. 1 C) Uniform Manifold Approximation and Projection (UMAP) plot of 2,754 single fetal hSSCs. (FIG. 1 D) Corresponding Leiden subclustering of all fetal hSSCs. (FIG. 1 E) Specified Leiden subclusters with marker genes. (FIG. 1F) Distribution of fetal skeletal tissue specific hSSCs in Leiden subclusters. (FIG. 1G) Selected differentially expressed genes associated with genetic disorders with bone phenotypes as detected in single-cell RNA- sequenced hSSCs from different Leiden clusters. Bottom: Matrixplot selected genes associated with developmental skeletal disorders and their expression in site-specific hSSCs.

[0018] FIGs. 2A-2J illustrate that the refined human skeletal stem cell lineage tree contains four distinct hSSC subtypes. (FIG. 2A) ForceAtlas2 projection of single-cell RNA-sequencing (scRNA-seq) data from previously defined and prospectively isolated human skeletal lineage populations (885 cells). hSSC: human skeletal stem cell (175 cells); hBCSP: human bonecartilage-stromal progenitor cell (369 cells); hOP: human osteoprogenitor (341 cells). (FIG. 2B) Unbiased Leiden clustering of the same cells with annotation of putative cell types. (FIG. 2C) Pseudotime trajectory inference of scRNA-seq data from prospectively isolated hSSC lineagepopulations. (FIG. 2D) Leiden cluster-specific marker expression. (FIG. 2E) Index sort analysis of scRNA-seq data from skeletal lineage populations based on Leiden clusters. (FIG. 2F) In vitro (top) and in vivo (bottom) osteogenesis of freshly purified sorted Ops (PDPN CD146+CD73 ), and SPs (PDPN CD146hi / CD73l0) stained with Alizarin Red S. (FIG. 2G) Representative flow cytometric plots of fetal tissue from four skeletal sites showing distinct hSSC subtype distribution within phenotypic hSSC gate (CD45 CD235a CD31 TIE2 PDPN+CD146 ). Below: Composition (%) of hSSC subtypes within phenotypic hSSC gate. (FIG. 2H) Flow cytometric analysis of 4- week ossicles derived from the four distinct hSSC subtypes. (FIG. 21) Representative Alizarin Red S staining and immunohistological staining supporting osteogenic (hOCN), chondrogenic (hCOL2A1 ), and stromal (hCD146) output (HNA: Human Nuclear Antigen, hOCN: Osteocalcin, hCOL2a: Collagen 2A1 , DAPI: nuclei) of sections from eight-week in vivo ossicles derived from prospectively isolated hSSC subtype populations. Scale bar = 50 pm. (FIG. 2J) Schematic of the human SSC lineage tree incorporating new findings.

[0019] FIGs. 3A-3I illustrate that long bones are maintained by the diversity of skeletal stem cell subsets with distinct clonal lineage dynamics. (FIG. 3A) Uniform Manifold Approximation and Projection (UMAP) of scRNA-seq data of 616 prospectively isolated growth plate (GP; 172 cells) hSSCs, periosteal (PE; 78 cells) hSSCs, and hSSCs from non-dissected long bone tissue (GP+PE; 366 cells). (FIG. 3B) Unbiased Leiden clustering of the same dataset. (FIG. 3C) Gene expression of hSSC subtype-specific markers SKIL (Chondro.), SPP1 (Osteo.), HIC1 (Stromal), and FMO1 (Fibro.). (FIG. 3D) In situ validation of hSSC subtype marker expression in the fetal long bones growth plate (left) and periosteum (right) using RNAscope. DAPI: nuclear stain. (RZ: resting zone; PZ: proliferative zone; PHZ: pre-hypertrophic zone; HZ: hypertrophic zone; EN: endosteal site). Inserts (i) showing co-staining with podoplanin (PDPN). (FIG. 3E) Hematoxylin and eosin (H&E) staining of fetal long bone (left) and RNA in situ hybridization-based distribution of overall prevalence of hSSC subtypes (bottom). (GP: growth plate; MP: Metaphysis; PE: Periosteum; PC: Perichondrium). (FIG. 3F) UMAP with RNA velocity of Leiden clustered scRNA-seq data from barcoded GP-hSSC derived grafts (top) and barcoded PE- hSSC derived grafts (bottom). SSC: skeletal stem cell; BCSP: bone-cartilage-stromal progenitor; CH: chondrogenic; OS: osteostromal; FS: fibrostromal. (FIG. 3G) Distribution of single cell-derived cells within UMAP Leiden clusters from two selected GP hSSC clones (top) and for two selected PE hSSC clones (bottom). MP: multipotent; OF: osteofibrogenic. (FIG. 3H) The top 3 most abundant clones per hSSC site of origin and their relative cell type contributions based on Leiden clusters. (FIG. 3I) Overall clonal cell type output of barcoded GP and PE SSCs with at least three cells per clone. Scale bar = 50 pm.

[0020] FIGs. 4A-4K illustrate that human skeletal aging and impaired regeneration are tied to a fibrostromal shift due to loss of SSC diversity. (FIG. 4A) Representative x-ray images of a healing acute long bone fracture (FX) with visible fracture callus (left). Acute fracture and followup x-ray images of an unhealed nonunion (right). (FIG. 4B) Association of patient age and in vitro mineralization capacity of phenotypic hSSCs (n = 219). Correlations assessed by Spearman test. (FIG. 4C) Four-week-old subcutaneous grafts derived from young and geriatric donor hSSCs showing degree of mineralization by micro-computed tomography (micro-CT or pCT) (left) and Movat Pentachrome staining for graft tissue composition (MS: matrix scaffold, white; Bo: Bone, yellow; Ca: Cartilage, green; FS: Fibrogenic stroma, red). (FIG. 4D) Quantification of mineralization of patient hSSC-derived grafts, (n = 5 per age group). Y: young < 35 years; G: geriatric > 65 years. Significance was assessed by a two-tailed t-test with Welch’s correction. (FIG. 4E) In vitro osteogenic potential of hSSCs from acute fractures (n = 219) versus nonunion tissue (n = 15). Significance assessed by Mann-Whitney test. Data is shown as mean + standard deviation of the mean (SEM). (FIG. 4F) SmartSeq2 plate-based single-cell RNA-sequencing analysis of 1 ,957 freshly isolated fetal long bone and patient hSSCs and their UMAP clustering. FD: fibrous dysplasia; NU: Nonunion; PE: Periosteum. (FIG. 4G) Flow cytometry plots of freshly processed human patient tissue stained and gated for phenotypic hSSCs showing subtype composition based on CD73 / CD164 marker expression with bar graph quantitation below. (FIG. 4H) Correlation matrix of hSSCs grouped by distinct donor groups. (FIG. 4I) Grouping of hSSCs in UMAP based on combined unbiased Leiden clustering and in vitro functional readout. (FIG. 4J) Dotplot showing selected genes and their expression in the three clusters separating functional states of hSSCs. (FIG. 4K) Boolean relationships of Boolean Equivalent Correlated Clusters (BECC) inferred dysfunctional hSSC gene TAGLN and its global relationship with COL2A1 (top, left) and ACTA2 (bottom, left) as well as its expression relationships in single cell hSSC dataset (right).

[0021] FIGs. 5A-5G illustrate that aging manifests a fibro-lineage fate in human skeletal stem cells. (FIG. 5A) Schematic overview of Boolean Equivalent Correlated Clusters (BECC) algorithm approach performed on the global human dataset (GSE119087). Based on a seed gene (ACTA2) the first step performs Boolean analysis by following the Boolean equivalent relationship three times. In the second step, a score is computed for each gene, which is then ranked. Finally, a threshold is imposed using the StepMiner algorithm to define a list of high- confidence genes with potentially superior performance than the seed gene (i.e., marking a fibrogenic / dysfunctional state). (FIG. 5B) Boolean relationships of selected genes based on the global microarray dataset. (FIG. 5C) UMAP plot of patient hSSCs with expression of TAGLNand MYL9. (FIG. 5D) Boolean relationships of TAGLNand MYL9\NiVn bone marker genes in hSSCs from nonunion fracture tissue, fibrous dysplasia, and fetal bones as well as periosteal tissue. (FIG. 5E) Gene expression of TAGLNand MYL9 \n selected published datasets of healthy and pathological cells / tissues (GP Zones: Growth Plate Zones; BMSC: Bone Marrow Stromal Cell; FS: Fibrosarcoma; LMS: Leiomyosarcoma; MFH: Malignant Fibrous Histiocytoma; OS: Osteosarcoma). (FIG. 5F) Gene expression of TAGLN and MYL9 in publicly available GSE8406 dataset containing femoral trabecular bone extracted from healthy as well as osteoporotic (OP) and osteoarthritic (OA) patients. Results are shown as a Iog2 fold change of aged-matched healthy controls versus diseased OP (n = 9) or OA tissue (n = 20). The dataset reports overall low fold changes with almost all data points between -0.5 and 0.5, potentially reflecting the technical limitation in early microarray technology. Genes could be confirmed by qPCR and showed higher fold changes. (FIG. 5G) Gene expression of TAGLN and MYL9 in the GSE72815 dataset containing iliac crest bone biopsies (n = 58) from healthy young (30.3 ± 5.4 years) and old patients (73.1 ± 6.6 years) as well as old patients that underwent three weeks of estrogen (Es.) therapy (70.5 ± 5.2 years). Data are shown as whisker boxplots with Tukey distribution. Significance was assessed by one-way ANOVA with Tukey’s post-hoc test.

[0022] FIGs. 6A-6I illustrate the Boolean-based analysis of gene regulatory networks in single cells. (FIG. 6A) BooleanNet statistic is used to evaluate the Boolean implication relationship between two genes, A and B. aij is the number of samples in the respective quadrants. nAiowand nBiow are a number of samples where A and B are low, respectively. Soo = BooleanNet statistic and poo = error rate to test sparsity for the bottom left quadrant. S > 3 and p < 0.1 is used to test whether each quadrant is sparse. (FIG. 6B) Deriving six possible Boolean implication relationships using BooleanNet statistics. (FIG. 6C) Schematic pipelines of Boolean analysis were performed in this manuscript. (FIG. 6D) Boolean Implication analysis was performed on the global human dataset (GSE1 19087), which was built from 25,955 human microarrays from diverse tissues (bulk samples). (FIG. 6E) Clustered Boolean Implication Network and six possible Boolean Implication Relationships (BIRs) between genes / clusters. (FIG. 6F) Visualization of Boolean Implication relationships by one-dimensional plots of gene expression levels assuming gene expression value change (up or down) only once along a path. Samples are ordered in two possible ways to show the relationship. X low => Y low can be represented in a single dimension in two possible ways: (1 ) X turns on first, and then Y turns on along a hypothetical biological path defined by the sample order. The path begins with X low and Y low, then it transitions to X high and Y low, and finally it transitions to X high and Y high. (2) Y turns off first, and then X turns off along a hypothetical biological path defined by thesample order. The path begins with X high and Y high, then it transitions to X high and Y low; finally, it transitions to both low. Similarly, the other Boolean relationships follow two possible path scenarios based on logical conclusions. (FIG. 6G) Visualization of a complex Boolean path using a one-dimensional plot. (1 ) Three Boolean relationships between W, X, Y, and Z. (2) Graphic representation of the Boolean relationships. Edges are colored differently according to the type of Boolean relationship. (3) W turns off first, and then X turns off along a hypothetical biological path defined by the sample order followed by Y turning on and Z turning on. The path begins with W high, X high, Y low, and Z low. (4) The path begins with W low, X low, Y high and Z high. Z turns off first, and then Y turns off along a hypothetical biological path defined by the sample order, followed by X turning on and W turning on. (FIG. 6H) Similar to panel E, four Boolean implication relationships A equivalent B, B opposite C, C low => D low, D low => E low constitute a Boolean path that can be used to develop a computational model of biological process from functional to dysfunctional. The computational model predicts how these five genes might be changing along a biological path, as shown in the plot. (FIG. 61) In the final step, selected paths from the Clustered BIN are used with BoolTraineR (BTR), which incorporates the single-cell RNA-seq dataset as an input, the Boolean value of genes at the beginning of the selected pathway in the MiDReG algorithm as an initial state, and the BIRs between genes as an initial Boolean model. A gene regulatory network constructed underlying BTR for a single-cell RNA-seq dataset is generated.

[0023] FIGs. 7A-7L illustrate that Boolean-logic guided gene regulatory network combinatorial targeting restores hSSC diversity. (FIG. 7A) Schematic of workflow for the invariant analysis of single-cell data from functional and dysfunctional patient hSSCs based on Boolean implication relationships. (FIG. 7B) Selected Boolean implication network (BIN) pathways and high-level mathematical model of gene regulation with predicted orders of activation. Gene relationships are indicated by the color and type of arrows. Green (dotted) line: hi-hi; red (dash-dotted) line: hi-lo; and blue (solid) line: lo-lo. (FIG. 7C) BoolTraineR (BTR) model of a gene regulatory network based on a selected pathway identified by BIN to capture dynamic Boolean circuit-based model. (FIG. 7D) Representative Alizarin Red S staining of in vitro osteogenic assays on patient-derived fracture (Fx) hSSCs either treated with DMSO as control or small molecules DMH1 (dorsomorphin homolog 1 ), SAG21 k (Smoothened agonist), and combination of DMH1 and SAG21 k. (FIG. 7E) Quantification of in vitro osteogenic assays with small molecule treatments on hSSCs from seven patients. Insert shows quantification of combined patient hSSCs relative to combinatorial DMH1 +SAG21 k treatment. Two-tailed student t-test versus combinatorial treatment with Welch’s correction or Mann-Whitney test to correct forunequal variances or non-normality. (n = 14 from independent duplicates of seven patient hSSCs). (FIG. 7F) Representative pCT images of 8-week grafts derived from transplanted patient hSSCs either treated with DMSO (control) or DMH1 +SAG21 k. The top left insert shows a brightfield image of grafts. No hSSC graft is shown in the top right insert of the control. (FIG. 7G) Representative hematoxylin and eosin (H&E) staining of graft sections. (MS: matrix scaffold; Bo: Bone; FS: Fibrogenic stroma). (FIG. 7H) Quantification of hSSC grafts either treated with DMSO or combinatorial cocktail. Two-tailed paired Wilcoxon test (n = 6). (FIG. 71) Representative micro-CT and saffranin-0 staining images of fracture calluses with hSSC transplants with or without factors at day 21 after bi-cortical fracture. Ca, cartilage. (FIG. 7J) Micro-CT-based analysis of fractional bone volume in formed callus. (FIG. 7K) Immunohistochemistry identifying hSSC-derived cells staining for human nuclear antigen (HNA) and osteocalcin (OCN) in fracture callus tissue of different experimental groups. (FIG. 7L) Quantification of HNA and OCN double-positive cells across calluses. All fracture callus analyses n = 4-5 per group. Data shown as box-plots with min to max. One-way ANOVA with Dunnett’s post hoc test. Scale bars, 50 pm.

[0024] FIGs. 8A-8D illustrate the Boolean-based analysis of gene regulatory networks in single cells. (FIG. 8A) Complex Boolean implication network (BIN) derived from a large database (GSE119087) of publicly available human microarrays of human tissues for genes expressed in functional and dysfunctional hSSCs. Expression relationships: hi-hi = A high => B high; hi-lo = A high => B low; lo-hi: A low => B high; lo-lo: A low => B low; eqv. = equivalent; opo. = opposite. (FIG. 8B) Expression of Hedgehog pathway-specific genes and TGF- pathway-specific genes in single-cell RNA-sequencing data of functional and dysfunctional hSSCs. (FIG. 8C) Schematic of in vivo subcutaneous grafting of patient hSSCs. (FIG. 8D) Prediction of enriched transcription factor networks using SCENIC based on single-cell RNA- sequencing data of patient hSSCs for comparison to the Boolean method. Left: whole network. Right selected the top 50 important transcription factors and their interactions.

[0025] FIGs. 9A-9H provide single-cell spatial mapping of fetal long bone hSSCs. (FIG. 9A) Selected gene expression of hSSC-enriched markers in Leiden populations. (FIG. 9B) Nanostring CosMx spatial transcriptomic analysis of a fetal phalange bone section with single cells clustered using CellCharter. (FIG. 9C) Marker genes of the subpopulations identified by CellCharter. (FIG. 9D) Expression of genes enriched in hSSCs in different clusters. (FIG. 9E) Human SSC-enriched population detected by co-expression of SOX9 and PDGFRA shown as distribution across fetal bone. Fraction of hSSCs per cell cluster shown in pie chart. Specificsubregions enriched for SOX9*PDGFRA+cells are demarcated. (FIG. 9F) Distinct gene expression of SOX PDGFRA+cells in GP and PE subregions. (FIG. 9G) CellPhoneDB ligandreceptor interactions inference between SOX9*PDGFRA+and surrounding cells. (FIG. 9H) Expression of selected ligands in SOX9 PDGFRA+cells in subregions as well as expression of respective receptors in surrounding cells. Scale bar, 1 mm.

[0026] FIGs. 10A-10E illustrate Boolean based analysis of gene regulatory networks in single cells. (FIG. 10A) Quantitative PCR of primary hSSCs treated with factors or control for 48 hours in vitro. N = 2 donors. (FIG. 10B) Schematic of in vivo subcutaneous grafting of patient hSSCs. (FIG. 10C) Schematic of in vivo fracture site grafting of patient hSSCs. (FIG. 10D) Flow cytometric readout of digested callus tissue using the hSSC lineage panel. (FIG. 10E) Micro-CT based callus volume quantification at day-14 after fracture.DETAILED DESCRIPTION

[0027] The present disclosure is based on the discovery that aging and disease may lead to a pathological shift in the cellular fates of human skeletal stem cells (hSSCs) that further impair regeneration and decrease bone health. The aged SSCs have lower bone-forming potential due to their skewed lineage trajectory towards fibrostromal tissues. Under these conditions, individuals are prone to diseases such as osteoporosis that further cause sustained fractures and regenerate poorly. The present disclosure further provides developed and applied a novel Boolean mathematics-based approach that can infer gene regulatory networks connecting functional and dysfunctional states of human SSCs to remedy the aged SSCs. Using Boolean mathematics-based method of the present disclosure, two small molecules were identified and showed that their combination can reinstate youthful SSC activity in aged or diseased dysfunctional SSCs. The present disclosure further provides a combination therapy of dorsomorphin homolog 1 and SAG21 k to reactivate aged SSCs differentiation potential. DMH1 is a selective inhibitor of BMP / TGF- signaling overactivated in aged SSCs, whereas SAG21 k is a powerful Smoothened agonist to activate Hedgehog signaling. The combination therapy of the present disclosure can be delivered, for instance, through biodegradable hydrogels that are placed topical to the fracture site. This treatment expands diminished SSC pools, redirects their differentiation to osteochondrogenic lineages, and enhances bone formation.

[0028] Methods for reversing the effects of aging on the regeneration of skeletal tissues can have medical and economic importance. It has been shown that aged skeletal stem cells (SSCs) can be targeted for reactivation. For instance, and specifically, aged SSCs can be reactivated by the administration of a combination of a bone morphogenetic protein (BMP) andan inhibitor of colony stimulating factor 1 (CSF1) to the targeted skeletal site. Methods for administration of the combination of BMP and CSF1 to re-activate aged SSCs and simultaneously abate crosstalk to hematopoietic cells, resulting in aged SSC pools expansion, osteoclast activity reduction, and bone healing enhancement are previously described in International Application No. PCT / US2022 / 026305, which is incorporated by reference herein in its entirety.

[0029] The skeleton is one of the most structurally and compositionally diverse organ systems in human physiology because it depends on unique cellular dynamism. In the present disclosure, prospective isolation of human skeletal stem cells (hSSCs; CD45 CD235a TIE2‘ CD31 CD146 PDPN+CD73+CD164+) was integrated from ten skeletal sites with functional assays and single-cell RNA-sequencing analysis to identify chondrogenic, osteogenic, stromal, and fibrogenic subtypes of hSSCs during development and their linkage to skeletal phenotypes. The distinct composition of hSSC subtypes was mapped across multiple skeletal sites, and their unique in vivo clonal dynamics were demonstrated. The results of the present disclosure showed that age-related changes in bone formation and regeneration disorders stem from a pathological fibroblastic shift in the hSSC pool. By utilizing a Boolean algorithm, gene regulatory networks that dictate differences in the ability of hSSCs to generate specific skeletal tissues were identified and described in the present disclosure. Importantly, hSSC lineage dynamics are pharmacologically malleable, providing a new strategy to treat aberrant hSSC diversity central to aging and skeletal maladies.

[0030] In the present disclosure, scRNA-seq was integrated with functional, clonal, and spatial analysis of hSSCs for examination during their development, aging, and disease states. The findings of the disclosure reveal a striking diversity in hSSCs that is strongly associated with their specific anatomical locations. More importantly, significant functional disparities among hSSCs obtained from patient samples were observed. Without wishing to be bound to a specific theory, the observation suggested that these differences in stem cell diversity may be directly linked to various skeletal diseases. Specifically, an abnormal increase in fibrostromal hSSC subtypes in cases of age-related bone loss, fracture nonunions, and fibrous dysplasia was identified. The skewed in stem cell population suggests a possible pathological shift that may contribute to the progression of these conditions.

[0031] Previously, multiple skeletogenic populations were observed in the long bones of mice21-27. Thus, it is crucial to perform a closer examination of human bone-forming stem cells for a better understanding of pathological changes in humans that are detrimental to skeletalhealth. In some embodiments, the present disclosure provides a method for treating a bone disease in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP) / transforming growth factorbeta (TGF-J3) signaling, and (b) an activator of Hedgehog (Hh) signaling.Inhibitors BMP / TGF-3 signaling

[0032] Transforming growth factor- s (TGF-ps) and bone morphometric proteins (BMPs) are cytokines that belong to the TGF-p superfamily and perform essential functions during osteoblast and chondrocyte lineage commitment and differentiation, skeletal development, and homeostasis. Whereas TGF-p was discovered as a growth factor (GF) that can transform mammalian fibroblasts, BMP was found to be capable of inducing ectopic bone formation. Moses et al., "The discovery and early days of TGF- : a historical perspective." Cold Spring Harbor Perspectives in Biology 8.7 (2016): a021865; and Katagiri and Watabe. "Bone morphogenetic proteins. "Cold Spring Harbor Perspectives in Biology 8.6 (2016): a021899. TGF-p and BMP signaling regulates a variety of physiological and pathological processes. TGF- ps and BMPs transduce signals through SMAD-dependent and -independent pathways; specifically, they recruit different receptor heterotetramers and R-Smad complexes, resulting in unique biological readouts. BMPs promote osteogenesis, osteoclastogenesis, and chondrogenesis at all differentiation stages, while TGF-ps play different roles in a stagedependent manner. BMPs and TGF- have opposite functions in articular cartilage homeostasis. Moreover, TGF-p has a specific role in maintaining the osteocyte network. The precise activation of BMP and TGF- signaling requires regulatory machinery at multiple levels, including latency control in the matrix, extracellular antagonists, ubiquitination and phosphorylation in the cytoplasm, nucleus-cytoplasm transportation, and transcriptional coregulation in the nuclei. Numerous mutations of the genes in TGF-p and BMP signaling are associated with human skeletal disorders. Many mouse models with dysregulated TGF- and BMP signaling displayed certain skeleton defects. Wu et al., "The roles and regulatory mechanisms of TGF- and BMP signaling in bone and cartilage development, homeostasis and disease." Cell Research 34.2 (2024): 101 -123.

[0033] In the TGF- and BMP signaling pathways, the dimeric ligands bind to heterotetrameric receptors comprising two type I and two type II receptors. This binding ultimately results in the phosphorylation and activation of a glycine-serine-rich domain within the type I receptor by the constitutively active type II receptor, transducing signals downstreamthrough both suppressor of mothers against decapentaplegic homolog (SMAD)-dependent and - independent pathways.

[0034] As used herein, the term "inhibitor," in the context of TGF-p signaling and / or BMP signaling, refers to any modulator of a molecule or a compound which inhibits the biological activity of the defined signaling pathway or its target. In some embodiments, the inhibitors may include, but are not limited to, peptides, antibodies, or small molecules that target the receptors, transcription factors, signaling mediators / transducers, and the like that are a part of the signaling pathway or the targets natural ligand thereby modulating the biological activity of the signaling pathways. In this regard, as used herein "inhibitors" in the context of TGF-p signaling and / or BMP signaling refers to the inhibition of one or more components of the defined signaling, including, but not limited to, the signaling ligands, receptors, transducers, signaling mediators, and transcriptional factors. In some embodiments, "inhibitors" may refer to antagonists of the ligand protein of the signaling pathways or any component of the signaling transduction pathways besides the ligand protein (e.g., without limitation, the receptors, transducers, or signaling mediators). In some embodiments, the inhibitor of BMP / TGF-p signaling is a selective inhibitor. In some embodiments, the terms “inhibitor” and “antagonist” are used interchangeably herein throughout the disclosure.

[0035] In certain embodiments, the selective inhibitor of BMP / TGF-p signaling is LDN-193189 2HCI, LDN-193189, dorsomorphin 2HCI, dorsomorphin, K02288, LDN-212854, ML347, or DMH1 (dorsomorphin homolog 1).

[0036] In some embodiments, the BMP inhibitor dorsomorphin blocks osteoclast formation and bone resorption.

[0037] In certain embodiments, the selective inhibitor of BMP / TGF-p signaling is DMH1 .

[0038] In embodiments, an activator refers to any molecule or compound which either enhances or inhibits the biological activity of the defined signaling pathway or its target.

[0039] In some embodiments, the inhibitors of BMPs and TGF- s signaling pathway are Inhibitory Smads. In embodiments, Inhibitory Smads include l-Smad, Smad6, and Smad 7. In embodiments, Inhibitory Smads inhibit BMPs and TGF- s signal in multiple ways.

[0040] In further embodiments, an inducing agent useful in a particular induction composition may include an inhibitor of the TGF-p pathway, inhibitors of the TGF-p pathway include small molecule inhibitors, peptide inhibitors, antibodies, nucleic acid inhibitors, and the like that inhibitat least one component of the TGF-p pathway resulting in a corresponding inhibition in cellular TGF-p signaling.

[0041] In particular embodiments, the binding of the TGF-£ ligands to the various TGF- receptors is influenced by soluble protein inhibitors including, for example, noggin, chordin, and caronte. caronte is a cerberus related gene from the chick, which showed antagonistic activities against BMP-2, BMP-4, and BMP-7.

[0042] In further embodiments, the inhibitor of TGF- signaling is A-83-01 (3-(6-Methyl-2- pyridinyl)-N-phenyl-4-(4-quinolinyl)-IH-pyrazole-1 -carbothioamide), SB431542 (4-[4-(1 , 3- benzodioxol-5-yl)-5-14ituxima-2-yl-IH-imidazol-2-yl] benzamide), SB-505124 (2-[4-(1 , 3- Benzodioxol-5-yl)-2-(1 ,1-dimethylethyl)-IH-imidazol-5-yl]-6-methyl-pyridine), IDE1 (l-[2-[(2- Carboxyphenyl) methylene] hydrazide] heptanoic acid), IDE2 (heptanedioic acid-1 -(2- cyclopentylidenehydrazide), Leftyl , or Lefty2.

[0043] In other embodiments, the inhibitor of TGF-p signaling is A-83-01 , SB431542, Leftyl , or Lefty2.

[0044] In still other embodiments, the inhibitor of TGF-p signaling is LY2109761 . In embodiments, LY2109761 is a TGF-p receptor type l / ll inhibitor.

[0045] In some embodiments, the inhibitor of TGF-p signaling is LY2157299. In some embodiments, LY2157299 is a TGF- receptor inhibitor.

[0046] In some embodiments, the inhibitor of TGF-p signaling is ITDts. In some embodiments, ITDts is a TGF-p pathway inhibitor.

[0047] In some embodiments, the inhibitor of TGF-p signaling is (+)-ITD-1 . In some embodiments, (+)-ITD- 1 is a TGF-p pathway inhibitor.

[0048] In some embodiments, the inhibitor of TGF-p signaling is (-)-ITD- 1 . In some embodiments, (-)- ITD-1 is a TGF-[3 pathway inhibitor.

[0049] In other embodiments, the inhibitor of TGF- signaling is ITD-1 . In some embodiments, ITD-1 is a TGF-p pathway inhibitor.

[0050] In some embodiments, the inhibitor of TGF-p signaling is A83-01 . In embodiments, A83-01 is a ALK4 / 5 / 7 inhibitor. In some embodiments, A83-01 is a selective inhibitor of ALK5 (12 nM), ALK4 (45 nM), and ALK7 (7.5 nM). In embodiments, A83-01 only weakly inhibits ALK1 ,ALK2, ALK3, and ALK6. In some embodiments, A83-01 inhibits the TGF-p-induced epithelial-to- mesenchymal transition (EMT) via the inhibition of Smad2 phosphorylation.

[0051] In certain embodiments, an inducing agent useful in a particular induction composition may include an inhibitor of the BMP pathway, inhibitors of the BMP pathway include small molecule inhibitors, peptide inhibitors, antibodies, nucleic acid inhibitors, and the like that inhibit at least one component of the BMP pathway resulting in a corresponding inhibition in cellular BMP signaling.

[0052] In some embodiments, the inhibitor of BMP signaling is DM3189 / LDN-193189 (4-(6- (4-(piperazin-1 -yl)phenyl)pyrazolo[1 ,5-a]pyrimidin-3-yl)quinoline), noggin, chordin, or dorsomorphin (6-(4-(2-(Piperidin-1 -yl)ethoxy)phenyl)-3-(pyridin-4-yl)pyrazolo[1 ,5-a]pyrimidine), or DMH1 (4-[6-(4-propan-2-yloxyphenyl)pyrazolo[1 ,5-a]pyrimidin-3-yl]quinoline).

[0053] In some embodiments, the inhibitor of BMP signaling is DM3189 / LDN-193189, noggin, chordin, dorsomorphin, or DMH1.

[0054] In some embodiments, the inhibitor of BMP signaling is DM3189 / LDN193189, noggin, chordin, or dorsomorphin.

[0055] In some embodiments, the inhibitor of BMP signaling is DM3189 / LDN193189. In some embodiments, DM3189 / LDN193189 is a selective BMP signaling inhibitor. In some embodiments, DM3189 / LDN193189 inhibits ALK1 , ALK2, ALK3, and ALK6 with IC50s of 0.8 nM, 0.8 nM, 5.3 nM and 16.7 nM in the kinase assay, respectively. In embodiments, DM3189 / LDN193189 inhibits the transcriptional activity of the BMP type I receptors ALK2 and ALK3 with IC50s of 5 nM and 30 nM in C2C12 cells, respectively, exhibits 200-fold selectivity for BMP versus TGF-p.

[0056] In some embodiments, the inhibition of BMP signaling may be carried out via soluble receptors, endogenous inhibitors, or neutralizing antibodies.

[0057] In some embodiments, the inhibitor of BMP signaling is LDN-193189. In some embodiments, LDN-193189 is a BMP type I receptors ALK2 / 3 inhibitor.

[0058] In some embodiments, the inhibitor of BMP signaling pathway is Noggin, Chordin, Follistatin, or the dominant-negative type I BMP receptor (tBMPR-l).

[0059] In some embodiments, the inhibitor of BMP pathway is NOGGIN, CHORDIN, LDN- 193189, DMH1 , Dorsomorphin, K 02288, ML 347, DMH-1 , antibodies to BMPs and BMP receptors, BMP inhibitory nucleic acids, and the like.

[0060] In some embodiments, the inhibitor of BMP / TGF-p signaling is any inhibitor that inhibits activin receptor-like kinase 1 (ALK1 ) or activin receptor-like kinase 3 (ALK3).

[0061] TGF-p family cytokines exert their effects by binding to heteromeric complexes of type I and type II transmembrane serine / threonine kinase receptors. On binding to the ligands, type II receptors recruit and phosphorylate the type I receptors, which in turn activate the downstream signaling mediators Smads. To date, seven type I receptors have been identified and designated as activin receptor-like kinase (ALK) 1 to 7. The ligand specificity of these ALKs has been determined primarily by their ability to bind to a given ligand and to activate specific downstream genes in the presence of corresponding type II receptors. ALK1 is able to bind to TGF-pi or activins in the presence of either T|3R-I I or activin type II receptors, respectively. However, ALK1 does not elicit a specific transcriptional response. Thus, ALK1 has been considered an “orphan” receptor.

[0062] Activin receptor-Like Kinase 1 (ALK1 ) is a type I receptor for the TGF- receptor family proteins. The ALK1 gene, which is also known as ACVRL 1 gene, shares a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (i.e., the GS domain) preceding the kinase domain, and a short C-terminal tail with other type I receptors. The encoded receptor protein ALK1 shares similar domain structures with other closely related ALK proteins that form a subfamily of receptor serine / threonine kinases. Mutations in the ALK1 gene are associated with hereditary hemorrhagic telangiectasia (HHT) type 2, also known as Osler Weber Rendu syndrome type 2. In some embodiments, an inhibitor that inhibits ALK1 is dalantercept.

[0063] Activin receptor-Like Kinase 3 (ALK3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1 A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-P) superfamily. The BMP receptors form a subfamily of transmembrane serine / threonine kinases including the type I receptors BMPR1A and BMPR1 B and the type II receptor BMPR2. ALK3 / BMPR1 A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1 A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. The transforming growth factor (TGF)-beta type III receptor (T|3RI 11) enhanced ALK3 signaling. T|3RI 11 associated with ALK3 primarily through their extracellular domains. ALK3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK3 was specifically required at mid-gestation for normaldevelopment of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK3 was specifically deficient in expressing TGF-[32, an established paracrine mediator of cushion morphogenesis. Hence, ALK3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.Activators of Hedgehog Signaling

[0064] In some embodiments, the activator of Hedgehog (Hh) signaling is a Smoothened agonist (SAG). Smoothened agonist (SAG) was one of the first small-molecule agonists developed for the protein Smoothened, a key part of the Hedgehog (Hh) signaling pathway which is involved a number of functions in mammalian physiology. Lewis and Krieg. "Reagents for developmental regulation of Hedgehog signaling." Methods 66.3 (2014): 390-397.

[0065] The Hedgehog (Hh) signaling pathway is a signaling pathway that transmits information to embryonic cells required for proper cell differentiation. Different parts of the embryo have different concentrations of Hedgehog (Hh) signaling proteins. The pathway also has roles in the adult. Hedgehog signaling (Hh) play significant roles in bone remodeling and homeostasis. During bone development, Hh signaling controls the differentiation of bone marrow mesenchymal stromal cells (BM-MSC) to chondrocytes during endochondral ossification, via the increased protein expression of runt-related transcription factor 2 (RUNX2) and its downstream target osterix (OSX). RUNX2 and OSX are transcription factors known to be master regulators of osteoblast differentiation and bone mineral deposition and RUNX2 signaling may be a driver of chondrocyte hypertrophy during endochondral ossification. Hh signaling pathway activation specifically in mature osteoblasts of adult Ptch1c / ~ HOC-Cre mice resulted in increased rates of both bone deposition and resorption, but resorption outpaced deposition, leading to a severe osteopenia phenotype. After inhibiting Hh signaling in mature osteoblasts in Smoc / cHOC- Cre mice, increased bone mass was observed. This series of experiments helped elucidate the role of HH signaling in postnatal mammalian bone.

[0066] The Hedgehog signaling pathway is one of the key regulators of animal development and is present in all bilaterians. The pathway takes its name from its polypeptide ligand, an intracellular signaling molecule called Hedgehog (Hh) found in fruit flies of the genus Drosophila’, fruit fly larvae lacking the Hh gene are said to resemble hedgehogs. Hh is one of Drosophila's segment polarity gene products, involved in establishing the basis of the fly body plan. The molecule remains important during later stages of embryogenesis and metamorphosis.

[0067] Mammals have three Hedgehog (Hh) homologues, Desert (DHH), Indian (IHH), and Sonic (SHH), of which Sonic is the best studied. The pathway is equally important during vertebrate embryonic development and is therefore of interest in evolutionary developmental biology. In knockout mice lacking components of the pathway, the brain, skeleton, musculature, gastrointestinal tract, and lungs fail to develop correctly. Recent studies point to the role of Hedgehog signaling in regulating adult stem cells involved in maintenance and regeneration of adult tissues.

[0068] As used herein, the term "activator," in the context of Hedgehog signaling, refers to any modulator of a molecule or compound which enhances the biological activity of the defined signaling pathway or its target. In some embodiments, the activators may include, but are not limited, to peptides, antibodies, or small molecules that target the receptors, transcription factors, signaling mediators / transducers, and the like that are a part of the signaling pathway or the targets natural ligand thereby modulating the biological activity of the signaling pathways. In this regard, as used herein "activators" in the context of Hedgehog signaling refers to the activation of one or more components of the defined signaling, including but not limited to the signaling ligands, receptors, transducers, signaling mediators, and transcriptional factors. In some embodiments, "activators" may refer to agonists of the ligand protein of the signaling pathways or any component of the signaling transduction pathways besides the ligand protein (e.g., without limitation, the receptors, transducers, or signaling mediators). In some embodiments, the terms “activator” and “agonist” are used interchangeably herein throughout the disclosure. In some embodiments, the activator of Hedgehog signaling has the ability to activate Hedgehog signaling.

[0069] The term “Hedgehog agonist” refers to an agent which potentiates or recapitulates the bioactivity of hedgehog, such as to activate transcription of target genes. Preferred Hedgehog agonists can be used to mimic or enhance the activity or effect of Hedgehog protein in a smoothened-dependent manner. The term ‘Hedgehog agonist’ as used herein refers not only to any agent that may act by directly activating the normal function of the Hedgehog protein, but also to any agent that activates the Hedgehog signaling pathway, and thus inhibits the function of ptc.

[0070] In some embodiments, an inducing agent useful in a particular induction composition may include an activator of the Hedgehog signaling pathway. Activators of the Hedgehog signaling pathway include small molecule activators, peptide activators, antibodies, nucleic acidactivators, and the like that inhibit at least one component of the Hedgehog signaling pathway resulting in a corresponding activation in cellular Hedgehog signaling.

[0071] Without wishing to be bound by to a specific theory, the ability of the agonists to activate the Hedgehog pathway may be due to the ability of such molecules to interact with or bind to smoothened, or at least to promote the ability of those proteins to activate a hedgehog, ptc, and / or smoothened-mediated signal transduction pathway.

[0072] In some embodiments, the activator of Hedgehog signaling is Hh-Ag1 .5, 20(S)- Hydroxycholesterol, SAG, or SAG21 k.

[0073] In some embodiments, the activator of Hedgehog signaling is Hh-Ag1 .5. In some embodiments, Hh-Ag1 .5 (3-chloro-4,7-difluoro- / V-[trans-4-(methylamino)cyclohexyl]- / V-[[3-(4- pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide ) is a high affinity and potent Smo receptor agonist.

[0074] In some embodiments, the activator of Hedgehog signaling is 20(S)- Hydroxycholesterol. In some embodiments, 20(S)-Hydroxycholesterol ((3 / 3)-Cholest-5-ene-3,20- diol) is an allosteric activator of the Hedgehog (Hh) signaling pathway Smoothened (Smo) oncoprotein. In some embodiments, 20(S)-Hydroxycholesterol binds at a site distinct from the canonical cyclopamine binding site. In some embodiments, 20(S)-Hydroxycholesterol induces Smo accumulation.

[0075] In some embodiments, the activator of Hedgehog signaling is SAG. In some embodiments, SAG (3-Chloro-A / -[trans-4-(methylamino)cyclohexyl]-A / -[[3-(4- pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide) activates the Hedgehog signaling pathway. In embodiments, SAG is a potent Smoothened receptor agonist. In embodiments, SAG is a potent Smoothened agonist. In embodiments, SAG antagonizes cyclopamine action at the Smo receptor.

[0076] In some embodiments, the activator of Hedgehog signaling is SAG21 k. In embodiments, SAG21 k (3-chloro-4,7-difluoro- / V-[[2-methoxy-5-(4-pyridinyl)phenyl]methyl]- / V- trans-4-(methylamino)cyclohexyl]benzo[b]thiophene-2-carboxamide) is a Hedgehog signaling activator. In embodiments, SAG21 k is brain penetrant and orally bioavailable.

[0077] In embodiments, the activator of Hedgehog signaling is SAG21 , SAG, SAG1 , or SAG21 k.

[0078] In some embodiments, the activator of Hedgehog signaling is SAG21 k.

[0079] In some embodiments, the present disclosure provides a method for treating a bone disease in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) DMH1 , and (b) SAG21 k.Drug Delivery Device

[0080] In certain embodiments, the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are implanted in a drug delivery device.

[0081] Drug delivery devices include structures that can be implanted and that release the active agents, e.g., an inhibitor of BMP / TGF- signaling and an activator of Hedgehog signaling, at the targeted site. Implantable drug delivery devices can be broadly classified in two main groups: passive implants and active implants. The first group includes two main types of implants: biodegradable and non-biodegradable implants. Active systems rely on energy dependent methods that provide the driving force to control drug release. The second group includes devices such as osmotic pressure gradients and electromechanical drives.

[0082] In some embodiments, the drug delivery device delivers the factors or combination of factors via local delivery. In embodiments, the drug delivery device may include, but not necessarily limited to a scaffold, a sponge, or a matrix. In some embodiments, the drug delivery device comprises a nanobody. In some embodiments, the drug delivery device comprises an engineered monocyte. In some embodiments, the drug delivery device comprises a CAR-T cell technology. In some embodiments, the drug delivery device combines the activators and inhibitors with targeted delivery to skeletal tissues when injected systemically.

[0083] In some embodiments, the drug delivery device is a biodegradable implant.

[0084] Passive polymeric implants are normally relatively simple devices with no moving parts, they rely on passive diffusion for drug release. They are generally made of drugs packed within a biocompatible polymer molecule. Several parameters such as: drug type / concentration, polymer type, implant design and surface properties can be modified to control the release profile. Passive implants can be classified in two main categories: non-biodegradable and biodegradable systems.

[0085] Non-biodegradable implants are commonly prepared using polymers such as silicones, poly(urethanes), poly(acrylates) or copolymers such as poly(ethyelene vinyl acetate). Poly(ethylene-vinyl acetate) (PEVA) is a thermoplastic copolymer of ethylene and vinyl acetate. Poly(siloxanes) or silicones are organosilicon polymeric materials composed of silicon andoxygen atoms. Lateral groups can be methyl, vinyl, or phenyl groups. These groups will influence the properties of the polymer. Poly(siloxanes) have been extensively used in medicine due to the unique combination of thermal stability, biocompatibility, chemical inertness, and elastomeric properties. The silicones commonly used for medical devices are vulcanized at room temperature. They are prepared using a two-component poly(dimethylsiloxanes) (PDMS) in the presence of a catalyst (platinum-based compound). The final material is formed via an addition hydrosilation reaction. An alternative method to obtain silicones for medical applications is the using linear PDMS with hydroxyl terminal groups. This linear polymer is cross-linked with low molecular weight tetra(alkyloxysilane) using stannous octoate catalyst.

[0086] This type of device can be monolithic or reservoir type implant. Monolithic type implants are made from a polymer matrix in which the drug is homogeneously dispersed. On the other hand, reservoir- type implants contain a compact drug core covered by a permeable non- biodegradable membrane. The membrane thickness and the permeability of the drug through the membrane will govern the release kinetics.

[0087] Biodegradable implants are made using polymers or block copolymers that can be broken down into smaller fragments that will be subsequently excreted or absorbed by the body. Normally they are made using polymers such as collagen, PEG, chitin, poly(caprolactone) (PCL), poly(lactic acid) (PLA), or poly(lactic-co-glycolic acid) (PLGA). Numerous other biodegradable polymers for drug delivery exist including poly(amides), poly(anhydrides), poly(phosphazenes) and poly(dioxanone). Poly(anhydrides) have a low hydrolytic stability resulting in rapid degradation rates, making them suitable for use in short-term controlled delivery systems. Poly(phosphazenes) have a degradation rate that can be finely tuned by appropriate substitution with specific chemical groups and use of these polymers has been investigated for skeletal tissue regeneration and drug delivery. Poly(dioxanone), like PCL, is a polylactone that has been used for purposes such as drug delivery, and tissue engineering They do not need to be extracted after implantation, as they will be degraded by the body of the patient. They can be manufactured as monolithic implants and reservoir-type implants. In addition to the biopolymers, such as the abovementioned PLA, there a few natural polymers which also represent a promising class of materials with a wide range of applications, including use in implantable devices. These natural polymers include, collagen, hyaluronic acid, cellulose, chitosan, silk, and others naturally derived proteins, as well as collagen, gelatin, albumin, elastin, and milk proteins. These materials present certain advantages compared to the traditional materials (metals and ceramics) or synthetic polymers, such as biocompatibility,biodegradation, and non-cytotoxicity, which make them ideal to be used in implantable drug delivery devices.

[0088] Dynamic or Active Polymeric Implants have a positive driving force to control the release of drugs from the device. Most of the implants in this category are electronic systems made of metallic materials. Dynamic drug delivery implants are mainly pump type implants. The main type of polymeric active implants are osmotic pumps. This type of device is formed mainly by a semipermeable membrane that surrounds a drug reservoir. The membrane should have an orifice that will allow drug release. Osmotic gradients will allow a steady inflow of fluid within the implant. This process will lead to an increase in the pressure within the implant that will force drug release trough the orifice. This design allows constant drug release (zero order kinetics). This type of device allows a favorable release rate, but the drug loading is limited.

[0089] In other embodiments, the biodegradable implant is a block polymer implant.

[0090] In still other embodiments, the biodegradable implant comprises poly(caprolactone) (PCL), poly(lactic acid) (PLA), or poly(lactic-co-glycolic acid) (PLGA).

[0091] In some embodiments, the biodegradable implant comprises collagen, hyaluronic acid, cellulose, chitosan, silk, gelatin, albumin, elastin, or milk proteins.

[0092] In embodiments, the biodegradable implant is a hydrogel.

[0093] In embodiments, the drug delivery device is implanted at a position topical to a fracture site or to a site afflicted with the bone disease.

[0094] In embodiments, the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are administered topically to a fracture site or to a site afflicted with the bone disease of a subject.

[0095] In embodiments, the implant is provided immediately following an injury.

[0096] In embodiments, the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are administered within 3 days of an injury.

[0097] A system for pharmaceutical use, i.e. , a drug delivery device with factors, can include, depending on the formulation desired, pharmaceutically acceptable, non-toxic carriers of diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, bufferedwater, physiological saline, PBS, Ringer's solution, dextrose solution, and Hank's solution. In addition, the NR pharmaceutical composition or formulation can include other carriers, adjuvants, or non-toxic, nontherapeutic, nonimmunogenic stabilizers, excipients, and the like. The compositions can also include additional substances to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, wetting agents, and detergents.

[0098] The composition can also include any of a variety of stabilizing agents, such as an antioxidant for example. When the pharmaceutical composition includes a polypeptide, the polypeptide can be complexed with various well-known compounds that enhance the in vivo stability of the polypeptide, or otherwise enhance its pharmacological properties (e.g., increase the half-life of the polypeptide, reduce its toxicity, enhance solubility or uptake). Examples of such modifications or complexing agents include sulfate, gluconate, citrate, and phosphate. The polypeptides of a composition can also be complexed with molecules that enhance their in vivo attributes. Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, ions (e.g., sodium, potassium, calcium, magnesium, manganese), and lipids.

[0099] Further guidance regarding formulations that are suitable for various types of administration can be found in Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, Pa., 17th ed. (1985). For a brief review of methods for drug delivery, see, Langer, Science 249:1527-1533 (1990). [001 15] The pharmaceutical composition, i.e., combinations of factors and / or cells, can be administered for prophylactic and / or therapeutic treatments. Toxicity and therapeutic efficacy of the active ingredient can be determined according to standard pharmaceutical procedures in cell cultures and / or experimental animals, including, for example, determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred.

[0100] The data obtained from cell culture and / or animal studies can be used in formulating a range of dosages for humans. The dosage of the active ingredient typically lines within a range of circulating concentrations that include the ED50 with low toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.

[0101] The components used to formulate the pharmaceutical compositions are preferably of high purity and are substantially free of potentially harmful contaminants (e.g., at least National Food (NF) grade, generally at least analytical grade, and more typically at least pharmaceuticalgrade). Moreover, compositions intended for in vivo use are usually sterile. To the extent that a given compound must be synthesized prior to use, the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxin, which may be present during the synthesis or purification process. Compositions for parental administration are also sterile, substantially isotonic and made under GMP conditions.

[0102] The effective amount of a therapeutic composition to be given to a particular patient will depend on a variety of factors, several of which will differ from patient to patient. A competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to halt or reverse the progression the disease condition as required. Utilizing LD50 animal data, and other information available for the agent, a clinician can determine the maximum safe dose for an individual, depending on the route of administration. For instance, an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered. Similarly, compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration. Utilizing ordinary skill, the competent clinician will be able to optimize the dosage of a particular therapeutic in the course of routine clinical trials.

[0103] The present invention provides methods of treating a bone lesion, or other injury in which growth of bone is desired, in an aged human or other animal subject, comprising applying to the site a composition comprising a combination of factors as set forth in the present disclosure, e.g., a combination of an inhibitor of BMP / TGF-p signaling and an activator of Hedgehog signaling. The factors can be provided in combinations with cements, gels, and the like. As referred to herein, such lesions include any condition involving skeletal tissue which is inadequate for physiological or cosmetic purposes. Such defects include those that are congenital, the result from disease or trauma, and consequent to surgical or other medical procedures. Such defects include, for example, defect brought about during the course of surgery, dental implants, osteoarthritis, osteoporosis, infection, malignancy, developmental malformation, etc.

[0104] An individual in need of skeletal regeneration can be treated with the methods described herein. Various sites for bone regeneration can be treated, including without limitation, ribs, lone bones, phalanges, facial bones, knee joint, elbow joint, joints in the phalanges and phalanxes, shoulder joints, hip joints, wrist joints, ankle joints, etc. The individualmay be an adult, e.g., past adolescence, and may be an aged adult, e.g., a human over 55 years of age, over 60 years of age, over 65 years of age, over 70 years of age, etc.

[0105] At the time of injury, a drug delivery device is implanted or otherwise positioned to provide an effective dose of the combination of agents. The factors may be provided individually or as a single composition, that is, as a premixed composition of factors. In some embodiments, the factors may be provided at the same molar ratio or at different molar ratios, e.g., where the ratio of the inhibitor to the activator is from about 1 :20, 1 :10, 1 :5, 1 :3, 1 :2, 1 :1 , 2:1 , 3:1 , 5:1 , 10:1 , 20:1 , etc. on a wt / wt basis. In some embodiments, the factors may be provided at the same molar ratio or at different molar ratios, e.g., where the ratio of the activator to the inhibitor is from about 1 :20, 1 :10, 1 :5, 1 :3, 1 :2, 1 :1 , 2:1 , 3:1 , 5:1 , 10:1 , 20:1 , etc. on a wt / wt basis. The factors may be provided once or multiple times in the course of treatment. For example, an implant comprising factors may be provided to an individual, and additional factors and / or cells provided during the course of treatment.

[0106] While in many cases the endogenous SSC are sufficient for regeneration, optionally exogenous cells are provided at the site of local acute injury. The cells may be SSC, or non- SSC, e.g., mesenchymal stem cells, adipose stem cells, and the like. The cells may be autologous or allogeneic. The cells may be provided concomitant with the provision of growth factors, e.g., simultaneously, shortly before, shortly, after, etc. and may be in a single implant with the growth factors, as a separate implant or injection, and the like.

[0107] In some embodiments, the present disclosure provides a drug delivery device comprising of an effective dose of a selective inhibitor of BMP / TGF-p signaling and an activator of Hedgehog signaling for reactivation of SSCs.

[0108] In some embodiments, the SSCs are human SSCs (hSSCs).

[0109] In some embodiments, the subject is a mammal.

[0110] In some embodiments, the subject is a human.

[0111] In some embodiments, the present disclosure provides a substantially pure population of skeletal stem cells produced by the method of the present disclosure.

[0112] The terms “substantially pure,” “substantially purified,” and “substantially enriched” as used herein with respect to cells means the isolated cell population of cells that includes at least 80% pure, and preferably at least 85% pure, at least 90% pure, at least 95% pure, at least 97% pure, at least 98% pure, at least 99% pure, at least 99.5% pure, or at least 99.9% pure cells ofthe type in question, for example, skeletal stem cells. Percentage purity refers to the percentage of the cell type in question relative to all cells in the sample.

[0113] In some embodiments, the present disclosure provides a method of treatment, comprising administering to an individual the population of cells of the present disclosure.

[0114] In some embodiments, the present disclosure provides a kit or system for use in the method of the present disclosure.

[0115] Also provided are kits. Such kits can include a therapeutic composition described herein and, in certain embodiments, instructions for administration. Instructions may be printed on paper or other substrate or may be supplied as an electronic-readable medium, such as a floppy disc, mini-CD-ROM, CD-ROM, DVD-ROM, Zip disc, videotape, audio tape, and the like. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an Internet web site specified by the manufacturer or distributor of the kit. Such kits can facilitate performance of the methods described herein. When supplied as a kit, the different components of the composition can be packaged in separate containers and admixed immediately before use. Components include, but are not limited to, population of cells (e.g., without limitation, substantially pure population of skeletal stem cells (SSCs)), culture media, and matrix or scaffold materials, as described herein. Such packaging of the components separately can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the composition. The pack may, for example, comprise metal or plastic foil such as a blister pack. Such packaging of the components separately can also, in certain instances, permit long-term storage without losing activity of the components.

[0116] Kits may also include skeletal stem cells or population of skeletal stem cells in a container with or without other components such as water, media, growth factors, and the like. Containers may include test tubes, vials, flasks, bottles, syringes, bags or pouch, and the like. Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle. Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to mix. Removable membranes may be glass, plastic, rubber, and the like.Additional Methods

[0117] As described herein, the present disclosure provides compositions and methods for treating bone disease. The methods include contacting skeletal stem cells (SSCs) with a combination of (a) a selective inhibitor of bone morphogenic protein (BMP)Ztransforming growthfactor-beta (TGF-P) signaling (such as DMH1 ), and (b) an activator of Hedgehog (Hh) signaling (such as SAG21 k). As will be appreciated by those in the art, similar combinations are contemplated for use in additional methods. For example, in some embodiments, the present disclosure provides a method of treating a musculoskeletal disease in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP)Ztransforming growth factor-beta (TGF- ) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0118] In some embodiments, the present disclosure provides a method of expanding diminished SSC pools in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP)Ztransforming growth factor-beta (TGF- ) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0119] In still other embodiments, the present disclosure provides a method of stimulating differentiation to osteochondrogenic lineages in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP)Ztransforming growth factor-beta (TGF-P) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0120] The present disclosure also provides, in some embodiments, a method of stimulating bone formation in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP)Ztransforming growth factorbeta (TGF-p) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0121] In other embodiments, the present disclosure provides a method of delivering a combination treatment to a fracture site in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP)Ztransforming growth factor-beta (TGF-|3) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0122] In some embodiments, the present disclosure provides a method of enhancing (stimulating) osteogenesis in a subject compared to either molecule alone or a control of, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP)Ztransforming growth factor-beta (TGF-p) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0123] In still other embodiments, the present disclosure provides a method of reactivating (reinstating) youthful SSC activity in aged or diseased dysfunctional SSCs in a subject, themethod comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF- ) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0124] In additional embodiments, the present disclosure provides a method of reinstating youthful SSC activity in aged or diseased dysfunctional SSCs comprising a combination of DMH1 and SAG21 k to re-activate aged SSCs differentiation potential.

[0125] In certain embodiments, the present disclosure provides a method for treating and / or preventing musculoskeletal diseases and / or conditions, osteoporosis-related bone loss, aging, nonunions, genetic diseases, neoplastic skeletal maladies, cancers, skeletal muscle damage, fractures, and jawbone defects.

[0126] The present disclosure also provides, in some embodiments, a method for bone healing after facial reconstruction in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein(BMP) / tran storming growth factor-beta (TGF-p) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0127] In some embodiments, the present disclosure provides a method for skeletal regeneration like fracture healing in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF-|3) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0128] In still other embodiments, the present disclosure provides a method of expanding diminished SSC pools, redirecting their differentiation to osteochondrogenic lineages, and enhancing bone formation in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF- ) signaling, and (b) an activator of Hedgehog (Hh) signaling.

[0129] In certain embodiments, the present disclosure provides an aforementioned method, wherein the musculoskeletal diseases and / or conditions include osteoarthritis, rheumatoid arthritis, juvenile arthritis, osteoporosis, back pain, and back problems such as scoliosis and lupus.

[0130] In still other embodiments, the present disclosure provides a method for treating patients in need of, for instance, bone regenerative therapy (e.g., without limitation, fractures,other lesions, osteoarthritis (OA), genetic defects, etc.). In still other embodiments, the present disclosure provides a method for treating patients with conditions involving skeletal tissue which is inadequate for physiological or cosmetic purposes caused by congenital defects, disease, trauma, surgical, or other medical procedures. Examples of such conditions involving skeletal tissue include dental diseases or defects, osteoarthritis (OA), osteoporosis (OP), fractures / nonunions, infection, developmental malformation, and the like.Definitions

[0131] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001 ); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein in their entireties. Reagents, cloning vectors, and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as Bio-Rad, Stratagene, Invitrogen, Sigma-Aldrich, and Clontech.

[0132] The terms “subject," “individual,” and “patient” are used interchangeably herein and refer to any subject for whom treatment or therapy is desired. The subject may be a mammalian subject. Mammalian subjects include, without limitation, humans, non-human primates, rodents (e.g., rats, mice, and squirrels), lagomorphs (e.g., rabbits, pikas, and hares), ungulates (e.g., cows, sheep, pigs, horses, goats, and the like), etc. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate, for example a cynomolgus monkey. In some embodiments, the subject is a companion animal (e.g., a dog and a cat).

[0133] The term “sample” with reference to a patient encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term also encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, washed, or enrichment for certain cell populations, such as diseased cells. The definition also includes samples that have been enriched for particular types of molecules, e.g., nucleic acids, polypeptides, and the like. The term “biological sample” encompasses a clinical sample, and includes tissue obtained by surgical resection, tissue obtained by biopsy, cells in culture, cellsupernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, and the like. A “biological sample” includes a sample obtained from a patient’s diseased cell, e.g., a sample comprising polynucleotides and / or polypeptides that is obtained from a patient’s diseased cell (e.g., a cell lysate or other cell extract comprising polynucleotides and / or polypeptides), and a sample comprising diseased cells from a patient. A biological sample comprising a diseased cell from a patient can also include non-diseased cells.

[0047] The term “diagnosis” is used herein to refer to the identification of a molecular or pathological state, disease, or condition in a subject, individual, or patient.

[0134] By “proliferate” it is meant to divide by mitosis, i.e. , undergo mitosis. An “expanded population” is a population of cells that has proliferated, i.e., undergone mitosis, such that the expanded population has an increase in cell number, that is, a greater number of cells, than the population at the outset.

[0135] The terms “treatment,” “treating,” “treat,” and the like are used herein to generally refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.

[0136] “Co-administer” means to administer in conjunction with one another, together, coordinately, including simultaneous or sequential administration of two or more agents.

[0137] “Comprising” means, without other limitation, including the referent, necessarily, without any qualification or exclusion on what else may be included. For example, “a composition comprising x and y” encompasses any composition that contains x and y, no matter what other components may be present in the composition. Likewise, “a method comprising the step of x” encompasses any method in which x is carried out, whether x is the only step in the method or it is only one of the steps, no matter how many other steps there may be and no matter how simple or complex x is in comparison to them. “Comprised of” and similar phrases using words of the root “comprise” are used herein as synonyms of “comprising” and have the same meaning. The methods of the invention also include the use of factor combinations that consist or consist essentially of the desired factors.

[0138] “Effective amount” generally means an amount which provides the desired local or systemic effect. For example, an effective amount is an amount sufficient to effectuate a beneficial or desired clinical result. The effective amounts can be provided all at once in a single administration or in fractional amounts that provide the effective amount in several administrations. The precise determination of what would be considered an effective amount may be based on factors individual to each subject, including their size, age, injury, and / or disease or injury being treated, and amount of time since the injury occurred or the disease began. One skilled in the art will be able to determine the effective amount for a given subject based on these considerations which are routine in the art. As used herein, “effective dose” means the same as “effective amount.”

[0139] The term “skeletal stem cell” refers to a multipotent and self-renewing cell capable of generating bone marrow stromal cells, skeletal cells, and chondrogenic cells. By self-renewing, it is meant that when they undergo mitosis, they produce at least one daughter cell that is a skeletal stem cell. By multipotent it is meant that it is capable of giving rise to progenitor cell (skeletal progenitors) that give rise to all cell types of the skeletal system. They are not pluripotent, that is, they are not capable of giving rise to cells of other organs in vivo.

[0140] Skeletal stem cells can be reprogrammed from non-skeletal cells, including, without limitation, mesenchymal stem cells and adipose tissue containing such cells.

[0141] Human SSC have a phenotype as disclosed in U.S. Patent No. 11 ,083,755, which is incorporated by reference herein in its entirety.

[0142] Human SSC cell populations may be characterized by their cell surface markers, although it will be understood by one of skill in the art that endogenous populations of SSC need not be characterized for effective stimulation. Human SSC are negative for expression of CD45, CD235, Tie2, and CD31 , and positively express podoplanin (PDPN). A population of cells, e.g., cells isolated from bone tissue, having this combination of markers may be referred to as [PDPNV146] cells. The [PDPN7146] population can be further subdivided into three populations: a unipotent subset capable of chondrogenesis [PDPN+CD146 CD73+ / CD164 / +], a unipotent cellular subpopulation capable of osteogenesis [PDPN+CD146+] and a multipotent [PDPN+CD146 CD73+CD164+] cell capable of endochondral (bone and cartilage) ossification. A population of cells of interest for use in the methods of the invention may be isolated from bone with respect to CD45, CD235, Tie2, and CD31 and PDPN. Other cell populations of interest are [PDPN+CD146+] cells.

[0143] The mouse skeletal lineage is characterized as CD45; Teri 19; Tie2; av integrin+. The SSC is further characterized as ThyT6C3 CD105 CD200+.

[0144] The cell population may be used immediately. Alternatively, the cell population may be frozen at liquid nitrogen temperatures and stored for long periods of time, being thawed and capable of being reused. In such cases, the cells will usually be frozen in 10% DMSO, 50% serum, 40% buffered medium, or some other such solution as is commonly used in the art to preserve cells at such freezing temperatures and thawed in a manner as commonly known in the art for thawing frozen cultured cells.

[0145] In further embodiments, an effective dose of a regenerative cell population, including, without limitation, mesenchymal stem cell (MSC), such as adipose derived MSC, is also provided as a source of cells for chondrogenesis or skeletogenesis. Such embodiments include, without limitation, implantation in a matrix that serves to localize cells and factors. In some such embodiments, the matrix is comprised of a biocompatible and optionally biodegradable matrix or lattice, e.g., formed from Matrigel, polylactic acid, polyglycolic acid, Poly(lactic-co-glycolic acid) (PLGA), collagen, alginate, and the like, capable of supporting chondrogenesis in a three- dimensional configuration.

[0146] Many different materials (natural and synthetic, biodegradable, and permanent) have been investigated, e.g., PuraMatrix, polylactic acid (PLA), polyglycolic acid (PGA) and polycaprolactone (PCL), and combinations thereof. Scaffolds may also be constructed from natural materials, e.g., proteins such as collagen, fibrin, etc.; polysaccharidic materials, such as chitosan; alginate, glycosaminoglycans (GAGs), which can be classified as nonsulfated (e.g., without limitation, hyaluronic acid (HA)) and sulfated (e.g., without limitation, heparin, chondroitin sulfate, dermatan sulfate, and keratin sulfate). Functionalized groups of scaffolds may be useful in the delivery of small molecules (drugs) to specific tissues. Another form of scaffold under investigation is decellularized tissue extracts whereby the remaining cellular remnants / extracellular matrices act as the scaffold.

[0147] In some embodiments, compositions and methods are provided relating to mammalian skeletal stem cells (SSC). In some embodiments of the invention, compositions of mammalian skeletal stem cells are provided. In other embodiments, compositions of skeletal lineage committed cells are provided, including cartilage committed cells.

[0148] The skeletal stem cells of the invention may be identified, and isolated from cell populations by phenotypic analysis of cell surface markers or induced from non-skeletal cells.Cell populations of interest for isolation of SSC include bone samples, which generally include bone marrow, and which include, without limitation, adult bone, e.g., femoral head bone, and sources of mesenchymal stem and progenitor cells that have been induced to differentiate into bone progenitors, e.g., by contacting with an effective dose of BMP2. Sources of such earlier progenitor cells include blood, adipose tissue, bone marrow, and the like.

[0149] A system for pharmaceutical use, i.e., a scaffold or implant with cells and / or factors, can include, depending on the formulation desired, pharmaceutically acceptable, non-toxic carriers of diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, buffered water, physiological saline, PBS, Ringer's solution, dextrose solution, and Hank's solution. In addition, the NR pharmaceutical composition or formulation can include other carriers, adjuvants, or non-toxic, nontherapeutic, nonimmunogenic stabilizers, excipients, and the like. The compositions can also include additional substances to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, wetting agents and detergents.

[0150] The composition can also include any of a variety of stabilizing agents, such as an antioxidant for example. When the pharmaceutical composition includes a polypeptide, the polypeptide can be complexed with various well-known compounds that enhance the in vivo stability of the polypeptide, or otherwise enhance its pharmacological properties (e.g., increase the half-life of the polypeptide, reduce its toxicity, enhance solubility or uptake). Examples of such modifications or complexing agents include sulfate, gluconate, citrate, and phosphate. The polypeptides of a composition can also be complexed with molecules that enhance their in vivo attributes. Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, ions (e.g., sodium, potassium, calcium, magnesium, and manganese), and lipids.

[0151] Further guidance regarding formulations that are suitable for various types of administration can be found in Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, Pa., 17th ed. (1985). For a brief review of methods for drug delivery, see, Langer, Science 249:1527-1533 (1990).

[0152] The pharmaceutical composition, i.e., combinations of factors and / or cells, can be administered for prophylactic and / or therapeutic treatments. Toxicity and therapeutic efficacy of the active ingredient can be determined according to standard pharmaceutical procedures in cell cultures and / or experimental animals, including, for example, determining the LD50 (thedose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred.

[0153] The data obtained from cell culture and / or animal studies can be used in formulating a range of dosages for humans. The dosage of the active ingredient typically lines within a range of circulating concentrations that include the ED50 with low toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.

[0154] The components used to formulate the pharmaceutical compositions are preferably of high purity and are substantially free of potentially harmful contaminants (e.g., at least National Food (NF) grade, generally at least analytical grade, and more typically at least pharmaceutical grade). Moreover, compositions intended for in vivo use are usually sterile. To the extent that a given compound must be synthesized prior to use, the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxin, which may be present during the synthesis or purification process. Compositions for parental administration are also sterile, substantially isotonic and made under GMP conditions.

[0155] The effective amount of a therapeutic composition to be given to a particular patient will depend on a variety of factors, several of which will differ from patient to patient. A competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to halt or reverse the progression the disease condition as required. Utilizing LD50 animal data, and other information available for the agent, a clinician can determine the maximum safe dose for an individual, depending on the route of administration. For instance, an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered. Similarly, compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration. Utilizing ordinary skill, the competent clinician will be able to optimize the dosage of a particular therapeutic in the course of routine clinical trials.

[0156] More particularly, the present invention finds use in the treatment of subjects, such as human patients, in need of bone or cartilage replacement therapy. Examples of such subjects would be subjects suffering from conditions associated with the loss of cartilage from osteoarthritis, genetic defects, disease, etc. Patients having diseases and disorderscharacterized by such conditions will benefit greatly by a treatment protocol of the pending claimed invention.

[0157] An effective amount of a pharmaceutical composition of the invention is the amount that will result in an increase the number of chondrocytes, skeletal cells, cartilage, or bone mass at the site of implant, and / or will result in measurable reduction in the rate of disease progression in vivo. For example, an effective amount of a pharmaceutical composition will increase bone or cartilage mass by at least about 5%, at least about 10%, at least about 20%, preferably from about 20% to about 50%, and even more preferably, by greater than 50% (e.g., from about 50% to about 100%) as compared to the appropriate control, the control typically being a subject not treated with the composition.

[0158] The methods of the present invention also find use in combined therapies, e.g., in with therapies that are already known in the art to provide relief from symptoms associated with the diseases, disorders and conditions. The combined use of a pharmaceutical composition of the present invention and these other agents may have the advantages that the required dosage for the individual drugs is lower, and the effect of the different drugs complementary.

[0159] “Bone” as used herein includes any bone, such as: the pelvis, long bones such as the tibia, fibula, femur, humerus, radius, and ulna, ribs, sternum, clavicle, etc.

[0160] “Fracture” or “break” as used herein with respect to bones includes any type thereof, including open or closed, simple or compound, comminuted fractures, and fractures of any location including diaphyseal and metaphyseal. “Fracture” as used herein is also intended to include defects such as holes, gaps, spaces, or openings, whether naturally occurring or surgically induced (e.g., by surgical removal of undesired tissue from bone).

[0161] The term “administering” as used herein, means delivery, for example of a skeletal stem cell to a subject.

[0162] The term “bone tissue” as used herein is tissue that includes bone or bone marrow.

[0163] The terms “isolated,” “isolating,” “purified,” “purifying,” “enriched,” and “enriching,” as used herein with respect to cells, means that the skeletal stem cells at some point in time were separated, sorted and capable of directed differentiation. “Highly purified,” “highly enriched,” and “highly isolated,” when used with respect to cells, indicates that the cells of interest are at least about 70%, about 75%, about 80%, about 85% about 90% or more of the cells, about 95%, atleast 99% pure, at least 99.5% pure, or at least 99.9% pure or more of the cells, and can preferably be about 95% or more of the differentiated cells.

[0164] The term “multipotent” as used herein, refers to a property of any stem cell or progenitor cell, meaning that it has the ability to differentiate into two or more different cell types. Pluripotent stem cells, such as embryonic stem cells, can give rise to all of cell types, thus multipotent cells are less potent than pluripotent cells. Adult stem cells are considered multipotent.

[0165] The term “population” as used herein when used with respect to cells, means a group or collection of cells that share one or more characteristics. The term “subpopulation,” when used with respect to cells, refers to a population of cells that are only a portion or “subset” of a population of cells.

[0166] The term “progenitor cell” is a cell that, like a stem cell, has a tendency to differentiate into a specific type of cell, but is already more specific than a stem cell and is pushed to differentiate into its “target” cell.

[0167] The term “stem cells” are undifferentiated cells that can divide or differentiate into specialized cells, replacing dying cells or damaged tissues. There are two broad types of stem cells: embryonic stem cells (ESCs) and adult stem cells (somatic stem cells).

[0168] As used herein, a “therapeutic agent” means a compound or molecule capable of producing an effect. Preferably, the effect is beneficial.

[0169] As used herein, “therapeutically effective amount” means an amount sufficient to treat a subject.

[0170] Treating may refer to any indicia of success in the treatment or amelioration or prevention of a condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the disease condition more tolerable to the patient; slowing in the rate of degeneration or decline; or making the final point of degeneration less debilitating. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of an examination by a physician.

[0171] For example, age-related bone loss and regenerative decline coincide with a diminished skeletal stem cell pool with skewed lineage output. The aged skeletal phenotype is associated with distinct changes in bone architecture, including an attenuation of the growth plate, reduced bone mineral density (BMD), decreased trabecular bone mass, and a decreasein active-matrix mineralization via calcein labeling, an in vivo measurement of bone formation and remodeling. Aged bones form significantly smaller calluses, and mechanical strength testing showed that these calluses were more prone to re-fracture, have less volume and were significantly less mineralized than a young skeleton. An aged skeletal phenotype is characterized by a decline in both homeostatic and regenerative bone formation.

[0172] Effectiveness in treatment can be monitored, for example, by determining post-healing bone strength by mechanical testing, determining callus size, determining matrix mineralization by calcein labeling, and the like. An effective treatment can increase one or more of these indicia by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or more, in an aged individual, relative to bone repair in the absence of the treatment.

[0053] As used herein, a "therapeutically effective amount" refers to that amount of the therapeutic agent sufficient to treat or manage a disease or disorder. A therapeutically effective amount may refer to the amount of therapeutic agent sufficient to improve bone regeneration as disclosed above. A therapeutically effective amount may also refer to the amount of the therapeutic agent that provides a therapeutic benefit in the treatment or management of a bone fractures and other lesions in the aged. Further, a therapeutically effective amount with respect to a therapeutic agent of the invention means the amount of therapeutic agent alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of bone regeneration in the aged.

[0173] As used herein, the term “dosing regimen” refers to a unit dose or doses that are administered individually to a subject, which may be separated by periods of time if multiple doses are administered. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length. In some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount. In someembodiments, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).

[0174] "In combination with," "combination therapy," and "combination products" refer, in certain embodiments, to the concurrent administration to a patient of the factors described herein in combination with additional therapies. When administered in combination, each component can be administered at the same time or sequentially in any order at different points in time. Thus, each component can be administered separately but sufficiently closely in time so as to provide the desired therapeutic effect.

[0175] "Concomitant administration" means administration of one or more components, such as engineered proteins and cells, known therapeutic agents, etc. at such time that the combination will have a therapeutic effect. Such concomitant administration may involve concurrent (i.e., at the same time), prior, or subsequent administration of components. A person of ordinary skill in the art would have no difficulty determining the appropriate timing, sequence, and dosages of administration. In some embodiments of the present invention, active agents are co-formulated in an implant for concurrent administration.

[0176] The use of the term "in combination" does not restrict the order in which prophylactic and / or therapeutic agents are administered to a subject with a disorder. A first prophylactic or therapeutic agent can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second prophylactic or therapeutic agent to a subject with a disorder.

[0177] As used herein, the term aged refers to the effects or the characteristics of increasing age, particularly with respect to the diminished ability of somatic tissues to regenerate in response to damage, disease, and normal use. One measure of aging, therefore, is evidenced by the inability of the organism to provide suitable signals for the activation of somatic stem cells. It is shown herein that such signals are soluble factors; and thus, may be empirically measured, e.g., by functional assay such as the ability of soluble factors in the patient blood to induce stem cell activation in response to tissue damage, etc.

[0178] Alternatively, aging may be defined in terms of general physiological characteristics. The rate of aging is very species specific, where a human may be aged at older than about 50 years, and a rodent at about 2 years. In general terms, a natural progressive decline in body systems starts in early adulthood, but it becomes most evident several decades later. One arbitrary way to define old age more precisely in humans is to say that it begins at conventional retirement age, older than around about 60, older than around about 65 years of age. Another definition sets parameters for aging coincident with the loss of reproductive ability, which is around about age 45, more usually around about 50 in humans, but will, however, vary with the individual. For the purposes of the present disclosure, an aged human may be greater than about 50 years of age, greater than about 55, greater than about 60, greater than about 65, greater than about 70, greater than about 75 years of age.

[0179] More particularly, the present invention finds use in the treatment of subjects, such as human patients, in need of bone regenerative therapy. Examples of such subjects would be subjects suffering from bone fractures and other lesions, particularly aged individuals. Other conditions include osteoarthritis, genetic defects, disease, etc. Patients having diseases and disorders characterized by such conditions will benefit greatly by a treatment protocol of the pending claimed invention.

[0180] An effective amount of a pharmaceutical composition of the invention is the amount that will result in an increase the activation of resident SSC at the site of implant that will result in greater mineralization and mechanical strength in healed bones, a larger bone callus on healing, and the like. For example, an effective amount of a pharmaceutical composition will increase bone mass or mineralization at a lesion by at least about 5%, at least about 10%, at least about 20%, preferably from about 20% to about 50%, and even more preferably, by greater than 50% (e.g., from about 50% to about 100%) as compared to the appropriate control, the control typically being a subject not treated with the composition.

[0181] The methods of the present invention also find use in combined therapies, e.g., in with therapies that are already known in the art to provide relief from symptoms associated with the diseases, disorders, and conditions. For example, therapies drawn to increasing bone density include administration of antiresorptive drugs and anabolic drugs, for example alendronate, risedronate, ibandronate, zoledronic acid, etc. as known in the art. The combined use of a pharmaceutical composition of the present invention and these other agents may have the advantages that the required dosage for the individual drugs is lower, and the effect of the different drugs complementary.

[0182] If any publication incorporated herein by reference contains a definition not consistent with a definition presented herein, the latter definition prevails.

[0183] Throughout this specification and claims, the word “comprise” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0184] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0185] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a human skeletal stem cell (hSSC)" includes a plurality of human skeletal stem cells (hSSCs) and equivalents thereof known to those skilled in the art, and so forth.

[0186] The term “about” signifies not more or less than 10 percent of the stipulated amount. Thus, purified skeletal stem cells of about 90% pure may be interpreted to be inclusive of 81% to 99%.

[0187] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual aspects described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several aspects without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. This is intended to provide support for all such combinations.EXAMPLES

[0188] The examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

[0189] The following examples describe representative materials and methods for using Boolean algorithm to identify novel signaling pathway targets and provide a combination of aninhibitor of BMP / TGF-3 signaling and an activator of Hedgehog (Hh) signaling of the present disclosure.Materials and MethodsFetal and Adult Human Samples

[0190] The gestation ages of fetal specimens are listed in Table 1 .Table 1. Individual human skeletal specimens used in human skeletal stem cell singlecell RNA-sequencing studies.gest. = gestational age.

[0191] Six human fetal samples were obtained from Advanced Bioscience Resources (Alameda, CA) as well as Cercle Allocation Services (Irvine, CA) and shipped overnight. Samples ranged in age from 17 to 20 weeks of gestation with no restrictions on race or gender. Adult human skeletal stem cells (hSSCs) for functional and single-cell RNA-sequencing (scRNA-seq) assays were obtained from fracture callus (day 1 -8 after injury), nonunions (120- 300 days after injury), uninjured periosteum, and fibrous dysplasia bone tissues. The age and sex of bone specimens are also listed in Table 1 . Fracture callus / nonunion / periosteal / fibrous dysplasia specimens, were obtained from Stanford University and UC Davis Hospitals. Fetal sample procurement and handling, as well as collection of all other tissues, including fracture callus, nonunion, and fibrous dysplasia, used in this study were conducted under IRB-35711 (Stanford) and IRB-1997852 (UC Davis) in accordance with the guidelines and regulations set by the Institutional Review Board of Stanford University School of Medicine and UC Davis School of Medicine, respectively. On these IRBs, informed consent was not required as samples were considered biological waste. Briefly, fracture callus tissue was collected from patients undergoing an open approach and direct reduction of fracture fragments. Hematoma and fracture callus tissue that disturbed satisfactory alignment of displaced fragments was removed and saved for research purposes at the time of surgery. Only tissue between the two ends of the fracture was removed to reassemble fragments prior to fixation. Intramedullary sampling was not included in this study. No restrictions were made regarding the race, gender, or age of the specimen’s donor. Following excision, all specimens were placed on ice, and hSSCs were isolated as described below.Mice

[0192] Three-month-old immunodeficient NOD scid gamma (NSG) mice (NOD.Cg-Prkdcscid H2rgtm1 Wjl / SzJ; JAX: 005557) were used for transplantation studies. Mice were maintained atthe Stanford University Research Animal Facility and UC Davis research animal facilities in accordance with university guidelines. Animals were given food and water ad libitum and housed in temperature- and light-controlled micro-insulators. All studies were approved via IACUC by the respective institutions (Protocol ID: 33042).Human Fetal and Adult Bone Dissociation

[0193] Human specimens were processed for the generation of a single-cell solution, as previously described4. Briefly, human fetal bones were separated and gently denuded of soft tissue using scissors and paper towels. Intact long bones, spine, pelvis and cranial tissue were collected. Long bones were additionally dissected by first gently stripping periosteal / perichondral tissue from the intact skeletal element using a razor blade and fine forceps. The cartilaginous bone ends were then removed to analyze the growth plate regions. For spine tissue vertebral bodies from cerebral, thoracic and lumbar vertebrae were combined. Disc tissues were then separated from the rest of the vertebral body by applying force from both sides of the tissue using forceps at the intersection of disc and bone areas. For cranial tissue dissection, sutures were first removed using a razor blade and fine scissors. Frontal and parietal skull elements were then separate dalong the areas where sutures were removed. For tendon tissue, achillea and patella tendon fibers were combined. Once all the desired skeletal site tissues were dissected and cleaned, they were placed on ice in individual 10 cm Petri dishes containing FACS buffer. From adult human bone specimen regions containing distinguishable areas of clotted blood were dissected out with scalpels and the remaining tissue was then minced with razor blades, resuspended in 3000 U / mL type II collagenase (Sigma-Aldrich, Cat#C6885) digestion buffer supplemented with 100 U / mL DNase I (Worthington,Cat#NC9199796) and incubated at 37°C for 60 min under constant agitation. The supernatant was filtered through a 70 mm nylon mesh and quenched with staining buffer (2% fetal bovine serum (FBS), in phosphate-buffered saline (PBS), GIBCO, Cat#C14190500BT). Cells were centrifuged at 200 g at 4°C followed by resuspension in the staining buffer.Fluorescence-activated Cell Sorting (FACS)

[0194] After removing the supernatant from the derived pellet, human stromal cells were separated from red blood cells (RBCs) by the addition of 2 mL of ACK (ammonium-chloride- potassium) lysis buffer. After 3 min incubation on ice, 13 mL of staining buffer was added to quench the lysis reaction, followed by centrifugation at 200 g at 4°C. The resulting pellet was resuspended in 100 pL of staining buffer and stained with fluorochrome-conjugated antibodies against CD45 (BioLegend, Cat#304029-BL), CD235a (BioLegend, Cat#306612-BL), CD31(Thermo Fisher Scientific, Cat#13-0319-82), CD202b (TIE-2) (BioLegend, Cat#334204), CD146 (BioLegend, Cat#342010), PDPN (Thermo Fisher Scientific, Cat#17-9381 -42), CD164 (BioLegend, Cat#324808), and CD73 (BioLegend, Cat#344016). Secondary antibody staining against Biotin was performed after an extra washing step using Streptavidin (Thermo Fisher Scientific, Cat#SA1027). A FACS Aria II (BD Biosciences) or Aurora CS (CYTEK) was used for flow cytometric analysis and sorting of hSSCs. Gating was established with IgG controls, and the help of fluorescence-minus-one (FMO: staining with all fluorophores except one) controls, and negative DAPI staining was used as a measure for cell viability.Cell Culture

[0195] Freshly sorted hSSCs were collected in 200 pL of staining buffer. For assays investigating downstream cell populations, human Bone-Cartilage-Stromal Progenitors (BCSPs) and osteoprogenitors (OPs) were sorted into individual collection tubes as well. Cells were pelleted and resuspended in expansion media containing MEM-alpha medium (Fisher Scientific, Cat#12561 -056) with 10% human platelet-derived lysate (Stem Cell Technologies, Cat#06960), 1 % Penicillin-Streptomycin solution (Pen-Strep; Thermo Fisher Scientific, Cat#15140-122). Plated culture vessels were maintained in an incubator at 37°C with 5% CO2. Fracture callus sample specimens yielding less than 30 hSSCs were excluded from further functional assays.Fibroblast Colonv-Forming-Unit (CFU-F) I Assay

[0196] For fetal CFU-F in vitro assays, 500 hSSCs were sorted and plated into 6-well plates and cultured for 10-14 days. At this time, specimens were fixed with 2% PFA and stained with 0.5% Crystal Violet solution. The number of colonies (> 30 cells) per well was counted to assess the percentage of CFU-F. Human fracture callus-derived hSSCs were sorted and plated at a maximum of 500 cells per culture vessel into 10 cm culture dishes. Colonies were counted two weeks after initial counting using light microscopy. Cells were then lifted and used for in vitro differentiation assays. Samples yielding less than three colonies were excluded from in vitro differentiation assays.Osteogenic In Vitro Differentiation

[0197] Freshly sorted cells expanded for 10-14 days were lifted by trypsin digestion and seeded into 96-well plates for osteogenic differentiation. After overnight incubation expansion media was substituted with osteogenic differentiation media (DMEM medium with 10% FBS, 1 % Pen-Strep, 100 nM dexamethasone, 10 mM sodium b-glycerophosphate [Sigma-Aldrich, Cat#G9891], 2.5 mM ascorbic acid 2-phosphate [Sigma-Aldrich, Cat#A8960]). Media waschanged every other day for 14 days. Cells were then fixed with 2% paraformaldehyde (PFA) and stained with 2% Alizarin Red S (Sigma-Aldrich, Cat#A5533) to assess osteogenic potential. For experiments testing the activation of specific pathways on osteogenic differentiation DMH1 (4 pM; Selleck: Cat#4126) and / or SAG 21 k (0.05 pM; CAS#946002-48-8, provided by the Beachy lab at Stanford University) were added during each osteogenic media change. Plates were washed and dried before subsequently dissolving the stain in 300 pl of 20% Methanol I 10% acetic acid solution. After the complete liberation of staining, 80 pl of each well was transferred into a new 96-well plate in duplicates, and absorbance was measured at 450 nm using an Ultrospec 2100 UV / Visible Spectrophotometer (Biochrom, Harvard Bioscience).Chondrogenic In Vitro Differentiation

[0198] For chondrogenic differentiation, cells were cultured in a micromass. For that, a 5 pL drop containing 8 x 105cells was placed into the center of a 24-well plate well. Cells were incubated at 37°C for 2 hr with 5% CO2 and then provided with 500 pL of pre-warmed chondrogenic media (DMEMhigh with 10% FBS, 100 nM dexamethasone, 1 pM L-ascorbic acid- 2-phosphate and 10 ng / ml human transforming growth factor [31 [PeproTech, Cat#100-21 C]). The media was refreshed every other day for two weeks. The micromass was then fixed with 2% PFA and stained with 1% Alcian Blue (Sigma-Aldrich, Cat#A5268). Chondrogenic potential was assessed by spectrophotometrically measuring absorption at 595 nm.Immunocytochemistry

[0199] Freshly sorted hSSCs were plated at a density of 1 ,000 cells per 96-well plate well and maintained in expansion media for two days, allowing them to attach and expand. On day two, the culture medium was removed, and cells were fixed with 2% PFA. Fixed cell cultures were then permeabilized with 0.1% Triton X-100 solution and blocked with 3% BSA in PBS. Antibody staining was conducted with primary human Anti-alpha smooth muscle Actin antibody (Abeam, Cat# ab7817) and secondary goat anti-mouse AF594 (Abeam, Cat# ab150120). For nuclear staining, specimens were treated with DAPLRNA In Situ Hybridization

[0200] Fresh human fetal long bone specimens (17 weeks) were fixed overnight before decalcification using 400 mM Ethylenediaminetetraacetic acid (EDTA; Invitrogen, Cat#15573- 038) in PBS (pH 7.2) at 4°C for 2 weeks. Specimens were then cryopreserved and sectioned at 10 microns. Sections were then processed for RNA in situ hybridization using RNAscope® Multiplex Fluorescent Reagent Kit v2 according to the manufacturer’s protocol (Advanced CellDiagnostics, Cat#323100). Sections were RNA-probed with HIC1 (ACD, Cat# 470571 ), SKIL (ACD, Cat# 427981 -C3), SPP1 (ACD, Cat# 420101 -C2) and FMO1 (ACD, Cat# 892031 -C2). Additional immunofluorescence was added by staining with mouse anti-human PDPN antibody (eBioscience, Cat#BMS1105) followed by secondary goat anti-mouse AF488 (Abeam, Cat# ab150113) as well as counterstaining with DAPLSubcutaneous Xenograft Transplant Model

[0201] Freshly dissected fetal phalanges (gestational age of 17-20 weeks) were transplanted into the dorsum of 3-month-old immunodeficient NSG mice (NOD.Cg-PrkdcscidH2rgtm1 Wjl / SzJ; JAX: 005557) as described previously4. Briefly, a small skin incision was made in the dorsum of anesthetized NSG mice and fetal phalanges slid under the skin. Interrupted sutures were applied to close the incision and transplants were allowed to engraft and grow for indicated time points.Subcutaneous Cell Transplants

[0202] Freshly sorted patient-derived hSSCs were sorted and expanded to confluency. 1 x 106cells were mixed with 5 pL of Matrigel (Corning, Cat#354230) and seeded on 20 mg anorganic cancellous bone graft granules (InterOss®, 0.25-1 mm, Cat#IOSG050) before incubation at 37°C for 1 h. For experiments testing the activation of specific pathways, DMH1 (2 pg / mL; Selleck, Cat#4126) and SAG21 k (30 ng / mL; CAS#946002-48-8, provided by the Beachy lab at Stanford University) or PBS as control were added during the Matrigel / BioOss / Cell mixture process. Cell mixtures were placed at room temperature and then immediately subcutaneously transplanted into the dorsum of 3-month-old immunodeficient NSG mice (NOD.Cg-Prkdcscid H2rgtm1 Wjl / SzJ; JAX: 005557). Grafts were harvested four weeks later and analyzed by micro-CT (pCT) and histology.In Vivo Clonal Barcoding of hSSCs

[0203] For clonal tracking of single hSSCs, 1 .5-2 x 105freshly sorted cells were seeded into a 12-well plate with 1 ml_ of Opti-MEM Reduced Serum Media containing lentiviral barcode particles generated from CloneTracker XPTM10M Barcode-3' Library in pScribe5-Venus-Puro plasmid (Cellecta, Cat#BCXP10M3VP-P). Cells were spun in the well plate in plate carriers at 1 ,500 g for 60 min at 24-27°C. Directly following that step, 3 mL of fresh culture media was added, and cells were incubated at 37°C for 24 h. At this point, the media was changed, and cells were allowed to further incubate for three days. Cells were then lifted using collagenase and stained with FACS antibodies. Sorted cells with phenotypic hSSC surface marker profileand simultaneous expression of Venus fluorophore were used for renal transplantation assays into NSG mice. To prevent dilution of clones in the final readout, 500 Venus+, barcoded hSSCs were mixed with 5,000 Venus-, non-barcoded hSSC supporter cells, mixed with 5 pL of Matrigel, and transplanted below the renal capsule of mice. Three transplants per hSSC source were conducted. Each mouse was transplanted with hSSCs from the growth plate under the renal capsule of one kidney and with hSSCs from the periosteum contralaterally. After three weeks, kidneys were excised from sacrificed mice and assessed for Venus expression in the graft tissue via microscope. Grafts were then dissected out, pooled by respective hSSC sources, and processed for flow cytometric isolation of Venus+cells as described above. Sorted cells from grafts were processed for 10x Genomics single-cell RNA-sequencing for interrogation into cell fates and clonal relationships (described below).Micro-computed Tomography

[0204] Grafts were dissected from mice and fixed in 2% PFA overnight. Samples were then scanned using a Broker SKYSCAN 1276 (Bruker Preclinical Imaging) with a source voltage of 85 kV, a source current of 200 pA, a filter setting of Al 1 mm, and a pixel size of 12 microns at 2016 x 1344. Reconstructed samples were analyzed using CT Analyzer and CTVox software (Bruker).Bi-cortical fracture model with hSSC transplants

[0205] FACS-purified primary hSSCs were processed from adult human donors and cultured in hSSC media until confluent. Cells were then trypsinized and loaded onto alginate scaffolds. Specifically, MVG sodium alginate was partially oxidized to a theoretical extent of 1% with sodium periodate, which created acetal groups susceptible to hydrolysis and then modified with arginine-glycine-aspartic acid peptide (RGD) to promote cell adhesion. First, Alginate was resuspended in sterile PBS (pH 7.25) at 2%(w / v) and optionally mixed with SAG 21 k (Biotechne, CAT#5282, resuspended in DMSO at 40 mM) and / or DMH1 (Selleckchem, CAT#S7146, resuspended in DMSO at 40 mM) and mixed overnight at 4°C. Cells were resuspended at 5 x 106 / mL in the precursor solution and pipetted onto a silicone mold. To crosslink, samples were submerged in 20 pL of 100 mM CaCh for 20 minutes before transferring to a well plate. Each gel had a total volume of 6 pL with final cell number of 3 x 104cells and optionally with 0.05 pM SAG 21 k and / or 4 pM DMH1 . Secondly, adult male NSG mice were anaesthetized using aerosolized isoflurane and analgesia was administered before incision. The femur was exposed after muscle distraction and lateral dislocation of the patella. A 25-gauge regular bevel needle (BD BioSciences) was inserted between the femoral condyles toprovide relative intramedullary fixation, and a transverse fracture was created in the middiaphysis using micro-scissors. The gel detailed above was then placed adjacent to the fracture. Right after, the patella was relocated, and 6-0 nylon suture (Ethicon) was used to reapproximate the muscles. For flow cytometric analysis, mice were sacrificed after 10 days, and femurs were processed for analysis. For pCT and histology, mice were sacrificed after 14 days. Femurs were fixed in 2% paraformaldehyde overnight, decalcified in 10% EDTA, and dehydrated in 30% sucrose. Pentachrome and IHC staining were performed with anti-Human Nuclear Antigen (HNA) antibody (Abeam, CAT#ab191 181 ), Anti-Osteocalcin antibody (Abeam, CAT#ab93876) and Anti-Collagen II antibody (Abeam, CAT#ab34712).Quantitative PCR

[0206] For analysis of freshly isolated, non-cultured cell populations of interest, fetal cells were directly sorted into 1.5 mL Eppendorf tubes containing 500 pL of Trizol. RNA was isolated from 5-1 O x 104cells and generated cDNA was used for TaqMan Real-Time PCR Assays (Thermo Fisher Scientific) with the following probes: GAPDH Hs02786624_g1 ; SPP1: Hs00959010 _m1 ; FBN1: Hs00171191 ml ; HAPLN1: Hs01091999 ml ; FMO1:Hs01032912_m1 . For analysis of in vitro factor treated hSSCs, primary cells were cultured in hSSC expansion media until confluent. Cells were then trypsinized and plated in a 12-well plate at 100,000 cells / well. Osteogenic media was added the day after plating, with or without the addition of the small molecules SAG21 k (Hh activator) and DMH1 (BMP receptor inhibitor). After 3 days, cells were fixed with TRIzol™ Reagent and processed for mRNA extraction. QuantiTect Reverse Transcription Kit was used to create the cDNA library, followed by the QuantiTect Taq PCR Master Mix Kit for qPCR. The following probes were used: GAPDH: Hs02786624_g1 ; BMPR1A’. Hs04980288_g1 ; IHH: Hs00745531_s1 ; SOX9\ Hs00165814_m1 ; TAGLN: Hs01038777_g1.Spatial transcriptomics with Nanostring CosMx

[0207] CosMx technology (Nanostring, Seattle, WA, USA), a high-plex spatial molecular imager, was employed to profile a 20-week human embryonic phalange specimen with the 1 ,000 genes CosMx Universal Cell Characterization Panel following the manufacturer’s protocol. Briefly, fixed frozen specimens were prepared and sliced to a thickness of 5 pm. PanCK, CD45, and CD68 antibodies and DAP I were used as morphological markers. Prepared samples were loaded onto the CosMx SMI instrument and underwent data collection, image processing, feature extraction, and cell segmentation. Transcriptomic profiles of individual cells were generated by integrating target transcript locations with cell segmentation information.These profiles were subsequently used for downstream data analysis. Spatial transcriptome analysis was performed using squidpy (v1 .2.1) and scanpy (v1 .9.3). Cells with <20 probe counts were filtered out. After quality control, 58,377 cells were obtained within the CosMx SP5 dataset of 104 fields of view (FOVs). To integrate cellular molecular features with tissue spatial histology, we employed CellCharter55as the algorithmic framework to identify, characterize and compare cellular niches. Five distinct cellular niches were annotated. Differentially expressed genes were obtained using the “rank_genes_groups” function in scanpy. An average of 113 genes per cell were detected for the periosteal region analyzed, 75 genes per cell for the growth plate region and 66 genes per cell for the whole phalange. CellphoneDB was used to investigate interactions between putative hSSCs and surrounding cells using only genes that were expressed in at least 5% of the cells within the respective areas analyzed. Cells located more than 200 pm away were excluded from analysis.Plate-based Smart-Seg2 Single Cell RNA-seguencing

[0208] Single-cell suspension derived from target tissues was processed for flow cytometric isolation as described above and published4. Single-cell RNA sequencing was conducted as reported before19. Briefly, single cells were index-sorted into 96-well plates containing 4 pL lysis buffer [1 U / pL RNase inhibitor (Clontech, Cat#2313B), 0.1% Triton (Thermo Fisher Scientific, Cat#85111 ), 2.5 mM dNTP (Invitrogen, Cat#10297-018), 2.5 pM oligo dT30VN (IDT, custom: 5'- AAGCAGTGGTATCAACGCAGAGTACT30VN-3' (SEQ ID NO: 1 )), and 1 :600,000 ERCC (External RNA Controls Consortium) ExFold RNA Spike-In Mix 2 (ERCC; Invitrogen, Cat#4456739) in nuclease-free water (Thermo Fisher Scientific, Cat#10977023)]. Immediately after sorting, plates were centrifuged at 3000 x g for 30 seconds at 4°C, snap frozen on dry ice and kept at -80°C until cDNA synthesis. Reverse transcription (RT) and cDNA pre-amplification was performed using the Smart-seq2 protocol with minor modifications. Lysis plates were thawed on ice and incubated at 72°C for 3 minutes followed by immediate snap chilling on ice to anneal the oligo dT30VN primer. An OligodT30VN is a primer sequence with 30-base sequence of deoxythymidine (dT) residues, followed by a variable nucleotide (VN) region. Immediately after sorting, plates were centrifuged at 3000 x g for 30 seconds at 4°C, snap- frozen on dry ice, and kept at -80°C until cDNA synthesis. Reverse transcription (RT) and cDNA pre-amplification were performed using the Smart-Seq2 protocol with minor modifications. Lysis plates were thawed on ice and incubated at 72°C for 3 min, followed by immediate snap chilling on ice to anneal the oligo. dT30VN Primer

[0209] cDNA synthesis from single-cell RNA was performed using oligo-dT primed reverse transcription with SMARTScribe Reverse Transcriptase (Clontech, Cat#639538) and a locked- nucleic acid containing template-switching oligonucleotide (TSO; Exiqon, custom: 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3' (SEQ ID NO: 2)). In SEQ ID NO: 2, the "rG" represents riboguanosine, a modified form of guanosine whereas the "+G" denotes a locked nucleic acid modified guanosine. PCR amplification was conducted using KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Cat#KK2602) with IS PCR primers (IDT, custom: 5'- AAGCAGTGGTATCAACGCAGAGT-3' (SEQ ID NO: 3)). To remove residual reaction components and oligos smaller than 400 base pairs, pre-amplified cDNA was purified using 0.65-0.75X volume of calibrated AMPure XP beads (Beckman Coulter, Cat#A63882). The cDNA concentration and size distribution for each well were assessed by a high-sensitivity AATI 96-capillary fragment analyzer (HS NGS Fragment Kit [1-6000 bp]; Agilent). cDNA from each well was normalized to the desired concentration range (—0.15 ng / pL) by dilution with EB buffer. The content of four 96-well plates was then consolidated into 384-well plates without cherry- picking / removing wells not holding any single cell cDNA. Subsequently, the 384-well plates were used for library preparation (Nextera XT kit; Illumina, Cat#FC-131 -1096) using a semiautomated pipeline. The barcoded libraries of each well were pooled, cleaned up, and size- selected using two rounds (0.35x and 0.75x) of Agencourt AMPure XP beads (Beckman Coulter), as recommended by the Nextera XT protocol (Illumina). A high-sensitivity AATI fragment analyzer run was used to assess fragment distribution and concentrations. Pooled libraries were sequenced on a NovaSeq 6000 S4 flow cell (Illumina) to obtain 1-2 million 2 x 150 base-pair paired-end reads per cell.Single-Cell RNA-seq Data Processing

[0210] Data was demultiplexed using bcl2fastq2 2.18 (Illumina). Raw reads were further processed using skewer vO.2.2 for 3' quality-trimming, 3' adaptor-trimming, and removal of degenerate reads45. Trimmed reads were then aligned to the hg38 genome (GENCODE version GRCh38.p13) with STAR aligner version 2.6.1 d using 2-pass mapping46, and gene counts were calculated using RSEM 1 .2.2147. When aligning female data, the entire Y chromosome was masked, while only the PAR regions on the Y chromosome were masked for male data. If sex was unknown, PAR-masking was used. For data pre-processing, gene count tables were combined with metadata using the Scanpy python package v1 .9.1 . For each investigated dataset, cells with less than 500 genes or 25,000 read counts, as well as mitochondrial gene content higher than 15%, ERCC content higher than 30%, and ribosomal gene content higherthan 25%, were excluded. Scrublet was then used to detect and remove residual duplicates. The data were normalized using size factor normalization so that every cell had 10,000 read counts, were logs transformed, underwent cell cycle regression48, and were scaled to a maximum value of 10. To account for batch effects and proper data integration, Scanpy- integrated Com Bat was applied for cells derived from separate sequencing runs followed by data scaling to account for batch effects and proper data integration. Highly variable genes were computed using default parameters. Next, the principal component analysis with elbow plot visualization was performed, followed by computing the neighborhood graph and clustering the data using the Leiden method. CytoTRACE (cytotrace.stanford.edu / ) was used to explore the developmental potential of single cells analyzed49. To plot and infer cellular state trajectories, Force-directed graph drawing (ForceAtlas2) with PAGA (Partition-based graph abstraction) or RNA Velocity was applied to the single-cell RNA-seq data50. Enrichr was used to identify pathways based on top-upregulated genes in the target populations51. A total of 5,764 high- quality cells across all donors listed in Table 1 were included in the analysis with an average gene count of 3,262 for fetal and 2,225 for patient hSSCs across datasets. Step-by-step instructions to reproduce the preprocessing and analysis of data are available with deposited data on the Gene Expression Omnibus database.10x Genomics Single Cell RNA-Sequencinq

[0211] Freshly collected fracture nonunion tissue was harvested and processed as described for the tissue dissociation protocol above. The single-cell solution was stained for flow cytometry, and 3 x 106PI CD45 CD235a_cells were sorted into a collection tube containing FACS buffer. Cells were then processed with 10x Chromium Next GEM Single Cell 3' GEM kit (10x Genomics Inc, v3.1 ) according to the manufacturer’s instruction to target 10,000 cells. Barcoded samples were demultiplexed, aligned to the human genome (GRCh38.p13), and UMI- collapsed with the Cell Ranger toolkit with standard settings and -force-cells=10,000 (version 7.1 .0, 10x Genomics Inc) sequenced on a partial-lane Illumina NovaSeq platform. The Scanpy package (version 1.9.1 ) was used for exploring the data. First, quality filtering to exclude multiplets and cells of poor quality was conducted by only keeping cells with a gene count of > 500 and < 4000 with less than 20% mitochondrial and 35% ribosomal gene content, as well as running Scrublet leaving 9,301 high-quality cells with an average gene count of 2,225 per cell. Genes expressed in less than 3 cells across all cells were also removed from downstream analysis. Data was log-normalized, cell cycle regressed and scaled for analysis. Dimensionality reduction and Leiden clustering, as well as subclustering, were conducted by choosingparameters based on the PCA elbow plot. All further analyses were conducted as described for Smart-Seq2 above.Clonal Tracking with Barcoded Single-Cell Readout

[0212] For clonal in vivo tracking of hSSCs, lentivirally barcoded hSSC-derived grafts were processed according to standard 10x Chromium Next GEM Single Cell 3' GEM kit (10x Genomics Inc, v3.1 ). To amplify clonal barcode sequences (Cellecta, Cat#BCXP10M3VP-P), a separate PCR with cDNA after the amplification step (before ligation) was performed since the 10X protocol only requires -25% of cDNA for the standard protocol. The extra 10 pl_ of cDNA were amplified using a combination of Partial Read 1 primer (5’- CTACACGACGCTCTTCCGATCT-3’ (SEQ ID NO: 4)) and an adaptor-FBP1 (Read 2 primer + barcode recognition site) primer (5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGACCACCGAACGCAACGCACGCA- 3’ (SEQ ID NO: 5)). The sequence of the adaptor-FBP1 herein comprises a Read 2 primer (5’- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’ (SEQ ID NO: 6)) and a barcode recognition site (5’-CCGACCACCGAACGCAACGCACGCA-3’ (SEQ ID NO: 7)). Barcode amplification was run as recommended for cDNA reaction (10X protocol step 2.2) plus 4 extra cycles. From there, the product was handled as per standard protocol, starting from the index primer reaction without any fragmentation or ligation steps. Amplicon libraries were then sequenced via MiSeq. After demultiplexing, 10X barcodes and clonal barcodes were read out and matched to 10X barcoded cells in the regular analysis as described and deposited on GitHub (github.com / sahooOO / Clonetracker). Briefly, the FBP1 flanking sequence was used to locate the Clone Barcode ID in the reverse strand. Unique Cell barcode IDs were extracted from the first 28 nt-sequences of the forward strand. The extracted Clone Barcode ID reads were matched against the known Cellecta barcode library, and only reads with barcodes that matched the Cellecta library were kept. The Cell Barcode ID and Clone Barcode ID were combined and stored in a FASTQ file. The FASTQ files were filtered using quality information. The first 16 nt-sequences from this FASTQ file represent the Cell barcode ID, while the last 48- nt sequences are the Clone Barcode ID. The Cell Barcodes and Clone Barcodes were clustered using the DNACLUST tool. Scanpy (version 1.9.1) was used, and cells were quality filtered only, keeping cells with a gene count of > 500 and < 6000 with less than 20% mitochondrial and 35% ribosomal gene content as well as running Scrublet leaving 745 high-quality cells (433 unique barcodes) of grafts derived from growth plate hSSCs and 509 high-quality cells (343 unique barcodes) from periosteal hSSCs with an average gene count of 3,178 and 3,171 per cell,respectively. 150 GP hSSCs and 85 PE hSSCs of the initial 3x500 transplanted hSSCs were recovered from each subregion. Cells were only counted as clones if the identical barcode appeared in at least two single cells of which at least one cell could be identified as a hSSC, yielding a recovery of 46 clones for growth plate hSSCs and 21 clones for periosteal hSSCs. For trajectory inference scVelo (version 0.2.5) was used.StepMiner tor Boolean Analysis

[0213] StepMiner \s a computational tool that identifies step-wise transitions in a time-series data52. StepMiner performs an adaptive regression scheme to identify the best possible step up or down based on sum-of-square errors. The steps are placed between time points at the sharpest change between low expression and high expression levels, which gives insight into the timing of the gene expression-switching event. To fit a step function, the algorithm evaluates all possible step positions, and for each position, it computes the average of the values on both sides of the step for the constant segments. An adaptive regression scheme is used that chooses the step positions that minimize the square error with the fitted data. Finally, a regression test statistic is computed as follows:

[0215] Where XLfor i = 1 to n are the values, X, for i = 1 to n are fitted values, m is the degree of freedom used for the adaptive regression analysis. X is the average of all the values: X = For a step position at k, the fitted values XLare computed by using * 2"=i^Boolean Analysis

[0216] Boolean logic is a simple mathematical relationship of two values, i.e. , high / low, 1 / 0, or positive / negative. The Boolean analysis of gene expression data requires the conversion of expression levels into two possible values. The StepMiner algorithm is reused to perform a Boolean analysis of gene expression data53. The Boolean analysis is a statistical approach that creates binary logical inferences that explain the relationships between phenomena. Boolean analysis is performed to determine the relationship between the expression levels of pairs of genes (FIGs. 6A-6B). The StepMiner algorithm is applied to gene expression levels to convert them into Boolean values (high and low). In this algorithm, first, the expression values are sorted from low to high, and a rising step function is fitted to the series to identify the threshold. The middle of the step is used as the StepMiner threshold. This threshold is used to convertgene expression values into Boolean values. A noise margin of 2-fold change is applied around the threshold to determine intermediate values, and these values are ignored during Boolean analysis. In a scatter plot, there are four possible quadrants based on Boolean values: (low, low), (low, high), (high, low), and (high, high). A Boolean implication relationship is observed if any one of the four possible quadrants or two diagonally opposite quadrants are sparsely populated. Based on this rule, there are six kinds of Boolean implication relationships. Two of them are symmetric: equivalent (corresponding to the positively correlated genes) and opposite (corresponding to the highly negatively correlated genes). Four of the Boolean relationships are asymmetric, and each corresponds to one sparse quadrant: (low => low), (high => low), (low => high), and (high => high). BooleanNet statistics is used to assess the sparsity of a quadrant and the significance of the Boolean implication relationships53,54. Given a pair of genes A and B, four quadrants are identified by using the StepMiner thresholds on A and B by ignoring the Intermediate values defined by the noise margin of 2-fold change (+ / - 0.5 around StepMiner threshold). The number of samples in each quadrant is defined as aoo, aoi, a , and an, which is different from the “X” in the previous equation of F stat. The total number of samples where gene expression values for A and B are low is computed using the following equations.

[0217] nAtow(r^oo T aQ^),nBi0WC^-oo T ®io)>

[0218] The total number of samples considered is computed using the following equation.

[0220] The expected number of samples in each quadrant is computed by assuming independence between A and B. For example, the expected number of samples in the bottom left quadrant eoo = n is computed as probability of A low ((aoo + aoi) / total) multiplied by probability of B low ((aoo + aw) / total) multiplied by total number of samples. The following equation is used to compute the expected number of samples where ij can be 00, 01, 10, 11.

[0221] n = atj, n = (nAlow / total * nBlow / total) * total

[0222] To check whether a quadrant is sparse, a statistical test for (eoo > aoo) or (n > n) is performed by computing Soo and poo using the following equations. A quadrant is considered sparse if Soo is high (n > n) and poo is small. Sij is used in the following equation where ij can be 00, 01, 10, 11.

[0223] SuJ= ^ in

[0225] A suitable threshold is chosen for Sij > sThr and pu < pThr to check the sparse quadrant with an acceptable false discovery rate (FDR < 0.001 ). A Boolean implication relationship is identified when a sparse quadrant is discovered using the following equation.

[0226] Boolean Implication = (S, > sThr, p^ < pThr) where ij can be 00, 01, 10, 11 (see below).

[0227] A relationship is called Boolean equivalent if the top-left and bottom-right quadrants are sparse.

[0228] Equivalent = (S01> sThr, P01< pThr,S10> sThr, P10< pThr)

[0229] Boolean opposite relationships have sparse top-right (an) and bottom-left (aoo) quadrants.

[0230] Opposite = (Soo> sThr, Poo< pThr, S]> sT r, Pn< pThr

[0231] Boolean equivalent and opposite are symmetric relationships because the relationship from A to B is the same as from B to A. An asymmetric relationship forms when there is only one quadrant sparse (A low => B low: top-left; A low => B high: bottom-left; A high=> B high: bottom-right; A high => B low: top-right). These relationships are asymmetric because the relationship from A to B is different from B to A. For example, A low => B low and B low => A low are two different relationships.

[0232] A low => B high is discovered if the bottom-left (aoo) quadrant is sparse, and this relationship satisfies the following conditions.

[0233] A low => B high = (Soo> sThr, Poo< pThr)

[0234] Similarly, A low => B low is identified if the top-left (aoi) quadrant is sparse.

[0235] A low => B low = (S01> sThr, P01< pThr)

[0236] A high => B high Boolean implication is established if the bottom-right (aio) quadrant is sparse, as described below.

[0237] A high => B high = (Sw> sThr, Pw< pThr)

[0238] Boolean implication A high => B low is found if the top-right (an) quadrant is sparse by using the following equation.

[0239] A high => B low = (5^ > sThr, Ptl< pThr)

[0240] For each quadrant, a statistic Sij and an error rate pij are computed. Sij > sThr and py < pThr are the thresholds used on the BooleanNet statistics to identify Boolean implication relationships where ij can be 00, 01, 10, 11.

[0241] Boolean analyses in the test dataset GSE119087 use a threshold of sThr = 3 and pThr = 0.1 . False discovery rate is computed for these thresholds (FDR < 0.000001 ) by using randomly permuting gene expression data in GSE119087.Boolean Network Explorer (BoNE)

[0242] Boolean network explorer (BoNE) provides an integrated platform for the construction, visualization, and querying of a network of progressive changes underlying a disease or a biological process in two steps (FIG. 6C): First, the expression levels of all genes in these datasets were converted to binary values (high or low) using the StepMiner algorithm. Second, gene expression relationships between pairs of genes were classified into one-of-six possible Boolean Implication Relationships (BIRs), two symmetric and four asymmetric, and expressed as Boolean implication statements. This offers a distinct advantage from conventional computational methods (Bayesian, Differential, etc.) that rely exclusively on symmetric linear relationships in networks. The other advantage of using BIRs is that they are robust to the noise of sample heterogeneity (i.e., healthy, diseased, genotypic, phenotypic, ethnic, interventions, disease severity), and every sample follows the same mathematical equation and hence is likely to be reproducible in independent validation datasets. In the resultant Boolean implication network, BoNE enables data science in both unsupervised and supervised ways while remaining agnostic to the sample type.Boolean Implication Network Construction

[0243] Boolean implication analysis was performed in the large diverse human dataset GSE119087 (n = 25,955 human samples, FIGs. 6D-6E). First, gene expression levels were converted to Boolean values (high and low) using the StepMiner algorithm. The expression values are sorted from low to high, and a rising step function is fitted to the series to identify the threshold. The relationship between two genes was evaluated in the context of high and low values. These relationships are called Boolean implication relationships (BIRs) because they are represented by logical implication (=>) formula. BooleanNet statistics is used to assess the significance of the Boolean implication relationships. S > 3 and p < 0.1 are the thresholds (False Discovery Rate < 0.0001 ) used on the BooleanNet statistics during the data analysis to identifyBoolean implication relationships. The thresholds of S > 3 and p < 0.15 were relaxed to identify the Boolean Equivalent relationships. A noise margin of 2-fold change is applied around the threshold to determine intermediate values, and these values are ignored during Boolean analysis. The Boolean implication network contains the six possible Boolean relationships between genes in the form of a directed graph with nodes as genes and edges as the Boolean relationship between the genes. The nodes in the Boolean implication network (BIN) are genes, and the edges correspond to BIRs. Equivalent and Opposite relationships are denoted by undirected edges, and the other four types (low => low; high => low; low => high; high => high) of BIRs are denoted by having a directed edge between them.Boolean Paths

[0244] The asymmetric BIRs provide a unique dimension to the network that is fundamentally different from any other gene expression network in the literature. Traversing a set of nodes in a directed graph of the Boolean network constitutes a Boolean path that can be interpreted as follows. A simple Boolean path involves two nodes and the directed edge between them (FIG. 6F). This simple Boolean path can be interpreted as follows. For the nodes X and Y with X low => Y low only quadrant, #(low, high) is sparse whereas the other quadrants are filled with samples. Assuming monotonicity in X and Y, the quadrants can be ordered in two possible ways: (low, low)-(high, low)-(high, high) and (high, high)-(high, low)-(low, low). The path that corresponds to (low, low)-(high, low)-(high, high) begins with X low and Y low. This is interpreted as X turning on first and then Y turning on along a hypothetical biological path that is defined by the sample order. Similarly, Y turns off first and then X turns off in the path (high, hig h)-(high, low)-(low, low). A complex path in the Boolean network involves more than one Boolean implication relationship (FIGs. 6G-6H). Three Boolean implication relationships can be used to group samples into five bins, and the bins can be ordered in two possible ways (forward, reverse).Boolean Implication Network and BTR

[0245] A curated list of known bone processes-related genes was combined with the selected genes of the top differentially expressed genes (p-value < 0.05, logFC > 1 .16 and < -1 .16; a total of 139 genes) within each analyzed group (functional vs. dysfunctional hSSCs). Genes were grouped according to their expression for displaying results of the complex Boolean implication network (BIN). A complex BIN (Complex-BIN) was created by identifying all significant pairwise Boolean implication relationships (BIRs) derived from a large database (25,955 datasets) of publicly available microarrays of human tissues, diseases, and cell lines(GSE1 19087). A previously published BooleanNet algorithm was performed to determine the BIRs between genes. Briefly, the BooleanNet algorithm identifies the type of BIR by searching the sparsely populated quadrant(s) using a statistical threshold S and likelihood error rate p in a scatterplot between two genes. These relationships are called BIRs because they are represented by the logical implication (=>) formula. There are six types of BIR: high => high, low => low, high low, low => high, equivalent, and opposite. The first four are asymmetric and have only one sparse quadrant, while the latter two are symmetric and have two sparse quadrants. S > 3 and p < 0.15 are the thresholds used on the BooleanNet statistics for symmetric BIRs. For asymmetric BIRs, S > 3 and p < 0.10 were used. The Complex-BINs are displayed in the form of a directed graph where edges (arrows) correspond to the observed BIRs between genes and nodes representing genes. To simplify and reduce the size of Complex-BIN, Boolean equivalent relationships were used to cluster genes. There are three zones in each Boolean Implication network (two zones for analyzed groups and one for the shared genes between those two groups). First, Boolean equivalent relationships within each zone were found, then Boolean equivalent relationships between different zones were found. Finally, all connected components between zones were clustered into one clustered node in the shared zone (each member of the clustered node is labeled as a shared gene regardless of their original group). The relationships between clustered nodes and the remaining genes were identified by combining the BIRs of members for each clustered node to build the Clustered-BIN. Next, four BIRs (high=>high, high=>low, opposite, and low=>low) were selected to simplify the Clustered-BIN by traversing the entire graph by running a depth-first search to find all transitive complex pathways. Each complex pathway was formed from a chain of high=>high BIR, followed by a high=>low or opposite BIR, followed by a chain of low=>low BIR. As the starting point, a gene from one of the analyzed groups (zones) was chosen, following a path through shared genes, and ending in the opposite analyzed group (zone). The simple path containing three BIRS of high=>high, high=>low, and low=>low is interpreted in the context of the previously published MiDReG algorithm (FIGs. 6F-6H). Ordering of the genes was performed using the asymmetric BIRs and MiDReG algorithm. The simplified Clustered-BIN helped to gain predicted orders of genes between analyzed groups. In the final step, all cells relevant to the analyzed groups and all genes in each selected complex pathway from the simplified Clustered-BIN were used in BoolTraineR (BTR), an algorithm for rebuilding and training the asynchronous Boolean model (FIG. 6I). BTR uses a Boolean State Space (BSS) scoring function such that the predicted model can resemble a single-cell expression dataset. Furthermore, because of the conversion of expression levels to two possible values of 0 / 1 , Boolean models are relatively robust to thepresence of dropouts. The initial expression state (Boolean value) of each gene at the beginning of the selected pathways of the MiDReG algorithm was used as an initial state for BTR model learning. The BIRs between genes in each selected pathway were used as an initial Boolean model to start the search. Finally, BTR returned the closest predicted model based on the single-cell dataset. The code has been deposited on GitHub (github.com / sahooOO / lnvariant- Circuits).Boolean Equivalent Correlated Clusters (BECC)

[0246] BECC was used to identify gene clusters that share invariant relationships with a seed gene35. ACT A2 was used as a seed gene, and a publicly available 25,955 diverse human samples were downloaded from GEO (GSE1 19087) to identify and validate an invariant signature for fibroblast-like cells. The algorithm first computes a list of genes that have a Boolean Equivalent relationship with the seed gene. The list of genes was then expanded by performing Boolean analysis by following the Boolean equivalent relationship two more times. In the second step, a score for each gene in the final list was computed from the correlation coefficient and the slope of the fitted line compared with the pre-defined seed gene. Finally, a threshold was imposed using the StepMiner algorithm to define a list of high-confidence genes with potentially superior performance than the seed gene. Once defined, all gene clusters were subsequently validated across global bone tissues and pathological bone diseases in human and murine datasets. This effort resulted in a ranked list of 33 probesets, corresponding to 25 unique genes, based on similarity to ACTA2 (with probelD = 200974_at). TAGLNand MYL9 showed strong correlation patterns with the seed gene and each other in many validation datasets. The results of the BECC algorithm on human, bone-related, and other species datasets can be explored via hegemon. ucsd.edu / ~sataheri / biomarkers / bone. php?go=hs. BECC was also used to find invariant markers for osteogenic and chondrogenic hSSCs, but no high- confidence gene could be found.Statistics and Reproducibility

[0247] All data presented were validated with multiple experimental repeats and plotted as stated in the figure or figure legend. Two-tailed Student’s t-tests were performed with corrections for non-normality (Mann-Whitney test) or unequal variances (Welch’s test) where appropriate, using GraphPad Prism v.9.5.1 (GraphPad Software). For more than two groups, one-way ANOVA with appropriate post hoc tests, as indicated in the figure legends, was used. No statistical method was used to predetermine the sample size. No method of randomizationwas used. The investigators were not blinded to allocation during experiments or outcome assessment.Example 1 - Structural diversity in human bones is reflected by human skeletal stem cell diversity

[0248] This Example shows that the structural diversity in the human bones is reflected by human skeletal stem cell (hSSC) diversity.

[0249] To investigate stem cell diversity in the human skeleton, hSSCs were isolated from ten skeletal sites of the developing human fetus at the gestational age of 17-20 weeks and conducted functional and single-cell transcriptional analysis (FIG. 1 A)34. hSSCs of different bones and skeletal regions were confirmed by established assays to display the potential to expand clonally and to differentiate into osteogenic and chondrogenic lineages. However, prospectively isolated hSSCs varied in terms of their expansion potential and their propensity to commit to either cartilage or osteoblast fates, as indicated by proteoglycan and calcium deposition, respectively. Moreover, hSSCs that displayed reduced chondrogenic and osteoblastic potential instead assumed a fibrostromal monolayer phenotype.

[0250] To gain a deeper understanding of the genetic differences that underpin functional variations, SmartSeq2 scRNA-seq was performed on freshly sorted, prospectively isolated hSSCs. hSSCs from every location investigated were found to exhibit a minimum of 90% gene expression overlap with the previously characterized growth plate hSSCs. Remarkably, most core markers specific to growth plate hSSCs were also present in hSSCs from all examined skeletal sites. Additionally, previous research detected the presence of the early embryonic human skeletal progenitor markers SOX9 and CADM1 (FIG. 1 B)28. However, it is worth noting that there was minimal overlap with widely recognized markers to enrich human skeletal progenitor populations13’1429. Interestingly, two of these markers - NGFR / CD271 and MCAM / CD146 - were found to be significantly more concentrated in populations downstream of the hSSC (FIG. 1 B), including the transit-amplifying human bone cartilage stromal progenitors (hBCSPs) and committed osteostromal progenitors (hOPs).

[0251] A gene expression correlation matrix, as well as dimensionality reduction by Uniform Manifold Approximation and Projection (UMAP), showed distinct heterogeneity between single hSSCs from the various skeletal regions (FIG. 1 C). Similar to findings in mice, phenotypic hSSCs from different skeletal sites expressed markers reflecting their distinct embryonic origins. Unbiased Leiden clustering of all hSSCs revealed four major types representing chondrogenic,osteogenic, stromal, and fibrogenic gene expression patterns as assessed by marker expression and pathway enrichment analysis corresponding to their functional and regional differences (FIGs. 1 D-1 E). The relative proportion of these hSSC subtypes closely correlated with the primary mode of ossification known for each bone, i.e., endochondral ossification (chondrogenic), which depends on a cartilage template, and direct intramembranous ossification (osteostromal) (FIG. 1 F). Thus, these results successfully link transcriptional attributes with functional characteristics.

[0252] In attempting to associate the transcriptomic diversity of hSSCs from different locations with skeletal formation, it was discovered that the expression of certain genes-which, when mutated, cause specific developmental skeletal disorders-could be detected at the stem cell level (FIG. 1 G). For instance, mutations in the gene XYLT1 have been connected to dwarfism and scoliosis. This gene was found to be highly expressed in the growth plate and vertebral chondral hSSC populations. In a similar fashion, the genes CDT1 (associated with narrow long bones) and SEC24D (linked to craniosynostosis) demonstrated overexpression in periosteal and cranial fibrostromal hSSCs, respectively.

[0253] Collectively, these findings underscore the notion that while hSSCs from various skeletal sites possess similar stem cell attributes, they also exhibit diversity in their genetic and lineage traits. This diversity likely contributes significantly to the regional formation, maintenance, and dysfunction of individual bones, which show wide variations in shape, size, and structural composition30.Example 2 - Index-sort single-cell RNA-sequencing analysis refines the hSSC lineage tree

[0254] This Example demonstrates that an index-sort single-cell RNA-sequencing (scRNA- seq) analysis is capable of refining the hSSC lineage tree.

[0255] After observing that there are multiple subtypes of hSSCs distributed throughout the skeleton, the next questions were how these variants are arranged within individual bones and how they contribute to the local areas of osteogenesis. One prior work, which examined the skeletal stem cell hierarchy in the growth plate of long bones, laid out the specific differentiation pathways of mouse skeletal stem cells into chondrogenic, osteogenic, and fibrostromal progenitors322. To better elucidate the bone-forming lineage of hSSCs, index-sorting with platebased SmartSeq2 scRNA-seq on prospectively isolated growth plate hSSCs and their defined progenitor subtypes (hBCSPs and hOPs) was employed. Using Uniform Manifold Approximation and Projection (UMAP) clustering, Leiden separation, trajectory inference, and CytoTRACEprojections, hierarchical lineage relationships between hSSC and hSSC-derived progenitor cell types were identified (FIGs. 2A-2D)22. Utilizing the index-sort information, the new cell surface marker combinations that allowed for resolving of specific hSSC-derived osteogenic (OPC: PDPN CD146+CD73 and stromal (SPC: PDPN CD146hiCD73low) progenitor subsets from the hOP population (PDPN CD146+) were identified (FIG. 2E). In support of this finding, prospectively isolated osteogenic progenitor cells (OPCs) were highly osteogenic compared to stromal progenitor cells (SPCs) in vitro and in vivo (FIG. 2F). Furthermore, utilizing the scRNA- seq-based lineage reconstruction together with the previously published single-cell data of micro-dissected sections of the growth plate zones and the adjacent diaphysis3, the lineage hierarchy from fetal hSSCs to preBCSPs, BCSPs and their committed OPC and SPC downstream subsets was spatially mapped. Thus, growth plate hSSCs exhibit a unique sequential differentiation pattern stretching from the epiphysis to the diaphysis. This differentiation process generates a clearly organized stratification of hSSC-derived progenitors within the maturing growth plate.

[0256] Since scRNA-seq data inferred the existence of four hSSC subtypes (FIGs. 1 D-1 E), the question was whether they could also be identified based on the existing flow cytometric panel for prospective isolation and functional characterization. Since the index-sort analysis of the cartilaginous fetal growth plate skeletal lineage suggested mostly moderate CD73 and CD164 expression levels in hSSCs (FIG. 2E), the double-positive fraction from pooled fetal long bones, vertebrae, and cranium was further subdivided into four subpopulations with varying CD73 / CD164 expression and prospectively isolated for quantitative PCR analysis. This analysis revealed that scRNA-seq marker expression matched CD164lowCD73low(chondrogenic), CD164h'9hCD73low(osteogenic), CD164hi9hCD73hi9h(stromal), and CD164lowCD73h'9h(fibrogenic) hSSC populations. Based on these cell surface marker profiles, and as suggested by scRNA- seq, flow cytometric analysis demonstrated that growth plate and vertebral hSSCs mainly contained the chondrogenic subtype while periosteal and cranial hSSCs were highly enriched for stromal hSSCs (FIG. 2G).

[0257] To test the plasticity of the hSSC subtype composition, hSSCs from different skeletal source tissues were challenged with a pro-osteogenic differentiation cocktail, which was sufficient to generate large proportions of the osteogenic hSSC subtype independent of original variant distribution at the four skeletal sites. The bona fide SSC properties for each hSSC subtype were independently confirmed by prospectively isolating them and performing in vivo ossicle formation assays. Both flow cytometric and histological analyses confirmed the self-renewal and multilineage differentiation capacity of all four hSSCs subtypes in this setting (FIGs. 2H-2I). Altogether, these results confirm scRNA-seq data tying distinct but malleable hSSC subtype distribution to various skeletal sites (FIG. 2J).Example 3 - Spatially mapped regional-specific hSSC diversity is controlled by distinct clonal dynamics

[0258] This Example shows that the spatially mapped regional-specific hSSC diversity can be controlled by distinct clonal dynamics.

[0259] To spatially resolve hSSC subtype distribution, the distinct differences in growth plate and periosteal hSSC diversity were investigated first. scRNA-seq data of hSSCs from dissected growth plate and periosteal regions was integrated, as well as non-dissected long bones containing both anatomical sublocations. Gene expression by unbiased clustering again showed that periosteal hSSCs predominantly consisted of fibrous and stromal subtypes, while GP hSSCs were mainly chondrogenic (FIGs. 3A-3B, FIG. 9A). Spatial transcriptomic analysis of a fetal phalange was then conducted using Nanostring’s CosMx platform with a universal 1 ,000 human genes panel, which together with the CellCharter algorithm successfully mapped individual cells to specific subregions (FIG. 9C). Since the two long bone hSSC subtypes were observed to share expression of common markers, hSSC locations and distribution throughout the long bone was estimated by identifying SOX9^PDGFRA+cells in the CosMx dataset.Accordingly, the majority of SOX9*PDGFRA+cells could be found in growth plate and periosteal regions, while they were not present in the bone marrow (FIG. 9D). In accordance with Smart- seq2 results of hSSC subtypes, SOX PDGFRA+cells in the growth plate expressed markers associated with endochondral ossification, while cells labeled in the periosteum were enriched for genes related to intramembranous ossification (FIG. 9F). This was also consistent with the inference of specific ligand-receptor interactions with other cell types in the vicinity of labeled hSSCs (FIGs. 9G-9H). These results estimate the spatial distribution of long bone hSSCs in situ and confirm distinct molecular differences of identified regional subtypes.

[0260] The Smart-seq2 datasets were then mined to identify distinct markers that could be used to approximate the anatomical organization of the newly identified hSSC subtypes across different skeletal sites. Confirming CosMx results, RNA in situ hybridization for SKI like protooncogene (SKIL) with co-staining of hSSC marker podoplanin (PDPN) localized the chondrogenic hSSC subtype primarily to the resting and proliferative zones of the growth plate and verified the presence of HIC ZBTB transcriptional repressor 1 (HlCI )-expressing stromal hSSCs along the periosteum (FIGs. 3C-3E, FIGs. 4B-4C). When mapping out the in situdistribution of all four hSSC subtypes (i.e., chondrogenic [SKILPPDPN*], osteogenic [secreted phosphoprotein 1 , SPP1+PDPI\P\, stromal [HIC1+PDPI\ ], and fibrogenic [Flavin containing monooxygenase 1 , FM01+PDPN*]) across long bones, vertebrae, and the cranium, their overall prevalence as predicted by scRNA-seq was confirmed (FIGs. 4B-4C).

[0261] Although chondrogenic and osteogenic hSSC subtypes in the metaphysis were found close to newly forming trabecular bone, as well as sparsely across periosteal tissue, none of the four subtypes were present in the diaphyseal bone marrow space, in close alignment with CosMx data. Thus, the analysis suggests that cells previously classified as (bone marrow) mesenchymal stromal cells (BMSCs) are cell types distinct from hSSCs. BMSCs likely consist of perivascular cells (e.g., TIE2+) that could include lineage cells derived from hSSCs. The mostly chondrogenic vertebral hSSCs were highly abundant, specifically at the growth plate area of vertebral bodies and concentric to the nucleus pulposus spanning most of the annulus fibrosus of the vertebral disc. In contrast, stromal and osteogenic hSSC subtypes were abundant in the frontal and parietal skull regions of the cranium. FMO / -expressing fibrogenic hSSCs were highly prevalent throughout cranial suture tissue but less in periosteal and parietal skull regions, while they were almost undetectable in growth plate, vertebra, and frontal skull regions. Combined, these results connect transcriptomic, functional, and histological readouts of hSSC subtype diversity.

[0262] To study the differentiation dynamics of individual hSSCs from the growth plate and periosteum, a clonal barcoding approach was developed. This strategy allows the tracing of the differentiation paths of individual genetically barcoded hSSCs in vivo (see Materials and Methods). The single-cell readouts confirmed distinctive differentiation outcomes between the growth plate and periosteal hSSCs. As expected from the hSSC subtype analysis of the disclosure, both hSSC populations demonstrated robust self-renewal capacity, yet showed significant differences in their formation of cartilage, bone, and fibrostromal progenitors on the single-cell level (FIGs. 3F-3H). For instance, growth plate-associated hSSCs mainly contribute to the development of both cartilage and bone tissues, playing a critical role in facilitating the longitudinal growth of bones. In contrast, hSSCs found in the periosteum predominantly generate fibrostromal lineages, providing toughness and flexibility to the cortical bones. Thus, the specific anatomical locations of hSSCs are crucial in maintaining the overall structure of bone. Of note, when either of these specific hSSC harboring areas are eliminated through microsurgery, the overall development of long bones is significantly impaired. This demonstrates the vital role these specialized hSSCs play in bone structure and growth.

[0263] Altogether, these results indicate that just as different bones contain varying ratios of hSSC variants, different subtypes of hSSCs are distributed in unique domains within a long bone. Therefore, these studies underline the crucial role of location in the function of different hSSC subtypes within human bone tissue.Example 4 - Skeletal aging and loss of regenerative activity are tied to changes in hSSC diversity

[0264] This Example shows that the skeletal aging and loss of regenerative activity are tied to the changes in hSSC diversity.

[0265] Previous studies have linked aging with decreased skeletal regeneration15’1931. An in- depth investigation of age-related changes in hSSCs of the disclosure found that these cells retain the highest potential for osteochondrogenic development in vitro throughout adulthood compared to other cell types. However, an analysis of 407 patient-derived fracture callus specimens demonstrated a significant decrease in hSSC frequency with advanced age. Functional in vitro and in vivo assays conducted on hSSCs isolated from 270 of these patients revealed diminished clonogenicity and bone / cartilage-forming potential in older patients (FIGs. 4A-4B). Subcutaneous transplants of hSSCs from geriatric donors into young mice yielded ossicles that showed significantly reduced mineralization compared with hSSCs from young patients (FIGs. 4C-4D). These results were in line with a sex-independent age-related pattern of reduced hSSC frequency and expansion potential, with male donor cells showing a significant negative correlation in colony-forming unit-fibroblast (CFU-F) capacity with age. The negative correlation of increasing age and bone formation potential was also independent of the patient's sex and body mass index (BMI).

[0266] Using functional readouts and scRNA-seq, the disclosure found that poor fracture healing, which predominantly occurs in older patients and can result in nonunions, was associated with the formation of fibrogenic tissue instead of mineralized fracture callus (FIG. 4E)32. Surprisingly, hSSC numbers were increased in nonunion fracture tissue, but these cells exhibited deficient osteogenesis, indicating a link between impaired hSSC differentiation, and compromised bone regeneration. The results demonstrate that hSSCs from older patients primarily generate fibrostromal tissue, suggesting that dysfunction in hSSCs could underlie pathologically shifted fibrogenic lineage dynamics, thereby impacting the major stem cell source for fracture repair.

[0267] To gain a better understanding of the biological and molecular differences in young, aged, and nonunion adult hSSCs, a SmartSeq2 scRNA-seq analysis of freshly purified long bone fracture callus site-derived hSSCs was conducted from 20 patients (Table 1 ) along with an evaluation of their osteogenic potential (FIG. 4F). Based on the functional readouts, it was hypothesized that higher age favored fibrostromal differentiation of fracture hSSCs thereby preventing proper mineralization at the healing site. This was reminiscent of the phenotype found in the bones of patients with fibrous dysplasia (FD), a genetic disease caused by an activating Gs alpha mutation that results in softened bones and generation of fibrotic marrow that has been linked to stem cell dysfunction3334. Thus, the phenotypic hSSCs were further isolated from a patient with FD. A high prevalence of phenotypic hSSCs in the FD bone was found. However, like nonunion hSSCs, FD hSSCs failed to undergo osteogenesis and displayed strong expression of fibroblastic genes and myofibroblastic proteins such as Smooth muscle alpha-actin (aSMA CTA2). Strikingly, functional readouts of hSSCs were reflected in distinct subtype composition detected in patient samples (FIG. 4G), i.e., higher prevalence of the osteochondrogenic hSSC subtypes in bone-forming hSSCs compared to fibrostromal subtype abundance in dysfunctional skeletal tissues. In further support, the hSSCs from donors with pro- fibrogenic features, i.e., nonunion, FD, and aged PE, showed strong transcriptomic correlation (FIG. 4H). Additionally, young osteogenic hSSCs (fetal and patients <35 years) showed higher development potential, as predicted by CytoTRACE, and lower expression of myofibroblastic genes compared with aged, nonunion, aged PE, and FD hSSCs. Intriguingly, as previously shown that osteogenic performance of hSSCs can be a predictor of fracture union even in young patients16, and as predicted by hSSC subtype distribution, the results herein show that in vitro mineralization capacity assessed by alizarin red staining strongly correlated with hierarchical clustering of a single hSSC. Indeed, hSSCs from a 28-year-old patient failed to mineralize in culture and clustered closely with pro-fibrogenic nonunion and FD hSSCs, similar to PE hSSCs from a 65-year-old patient. To investigate the defining properties of different hSSC types more easily, cells were grouped into functional (osteochondrogenic), impaired, and dysfunctional (pro-fibrogenic) hSSCs based on unbiased Leiden separation and functional readouts (FIG. 4I). The clustering grouped cells of these three groups in a spatially distinct manner in the UMAP, implying strong transcriptional and functional correlation. While stem cell marker expression was mostly conserved throughout functional groups, top regulated genes were shifted from skeletal system development in functional hSSCs to positive regulation of fibroblast differentiation and regulation of smooth muscle cell proliferation in impaired and dysfunctional hSSCs (FIG. 4J). Taken together, these results support the notion that pro-fibroblastic shifts in hSSC diversity are a major pathological mechanism of stem cell dysfunction in bones, which might create an imbalance in skeletal homeostasis, resulting in impaired regenerative capacity.

[0268] Finally, since the observations from the results of the disclosure revealed a shift towards fibroblast-skewed hSSCs in aging, nonunions, and FD, they prompted the question of whether such a shift is a common mechanism in skeletal disorders. The fibroblast marker alphasmooth muscle actin (aSMA) was found to be overexpressed in FD and nonunion hSSCs. To identify a universal biomarker that could potentially diagnose an impaired skeletal tissue state, the computational Boolean Equivalent Correlated Clusters (BECC) approach that uses a database of nearly 26,000 public gene expression datasets was employed3536. This approach identified 25 genes, including the well-known fibroblast markers transgelin (TAGLN) and myosin light chain 9 (MYL9) as potential markers of fibroblast-skewed hSSCs due to their high correlation with each other and ACTA2 - the seed gene (FIG. 5A)37. These genes are also highly expressed in fibrogenic and stromal hSSC clusters (see FIG. 1). Single-cell transcriptomic data also confirmed the specific expression of these markers in impaired aged, FD, and nonunion hSSCs. Remarkably, TAGLN, a pro-fibrotic gene, showed a high-to-low correlation with osteochondrogenic marker genes (e.g., without limitation, COL2A1, SOX5, and the like), emphasizing the inverse Boolean relationship between these two gene programs (FIG. 4K & FIGs. 5B-5D). Analysis of publicly available human gene expression datasets revealed low expression of TAGLN and MYL9 in fetal hSSCs, growth plate zone cells, and freshly isolated bone marrow stromal cells from healthy adults3. However, these markers were highly abundant in tissue samples from various fibro- and osteosarcomas38. Notably, TAGLN was a better biomarker than MYL9 to osteoporotic and osteoarthritic bone tissue (FIGs. 5E-5G).

[0269] In sum, the findings of the disclosure suggest an expansion of fibroblast-skewed hSSCs in multiple skeletal pathologies. Thus, shifts towards higher proportions of this hSSC subtype may serve as indicators of poor bone health.Example 5 - Combinatorial targeting of gene regulatory networks to preserve skeletal stem cell diversity

[0270] This Example shows a combinatorial targeting of gene regulatory networks for preserving skeletal stem cell diversity.

[0271] Noticing considerable transcriptomic differences between functional and dysfunctional hSSCs, the objective was to identify the gene regulatory mechanisms that influence theiridentities. An innovative approach, which is an invariant analysis of Boolean implication relationships across 25,955 human microarrays from various tissues, was used and a new workflow that integrates scRNA-seq data from healthy osteochondrogenic and dysfunctional fibrogenic hSSC subtypes was developed. See FIG. 6 and Materials and Methods for a detailed description.

[0272] Initially, a comprehensive Boolean Implication Network (BIN) was created using the most differentially expressed and common skeletal markers in hSSCs, revealing fundamental global gene expression relationships (FIG. 7A & FIG. 8A). To simplify this, Boolean implication network (BIN) subnets (pathways) were identified, and high-level mathematical modeling was employed to predict the gene regulation orders that linked pro-fibrogenic genes in dysfunctional hSSCs to genes expressed in functional hSSCs. Intriguingly, the results indicated that genes associated with the Hedgehog (Hh) pathway (IHH, PHOSPHO1) had distinct Boolean relationships with fibrogenic genes (ACTA2, TAGLN), which were closely connected to bone morphogenic protein (BMP) signaling (BMPR1A, ACVRL 1) (FIG. 7B). Consistent with the vital role of Hh signaling in limb development and its deficiency as a factor in diabetic bone disease, functional hSSCs exhibited higher expression of genes within this pathway compared to their dysfunctional fibrogenic counterparts (FIG. 8B)39’40. Conversely, excess BMP and heightened transforming growth factor beta (TGF-p) signaling are linked with fibrosis and bone loss41 42.

[0273] The BoolTraineR (BTR) models were applied, based on SmartSeq2 scRNA-seq data, to the selected subnets to identify dynamic Boolean circuits on a single-cell level (FIG. 7C)43. The results highlighted an unforeseen complexity in gene regulation. They suggested the necessity of an activating SOX9-FERMT1-IHH gene regulatory loop in osteogenic hSSCs while simultaneously preventing suppression by excessive inhibitory BMPR1A-re\ated gene programs. This was achieved through the tight control of PHOSPHO1 expression to favor osteochondrogenic over fibrogenic cell states. To test this functionally, the small molecule SAG21 k, which stimulates Hh through smoothened activation, and dorsomorphin homolog 1 (DMH1 ), which selectively blocks BMP signaling to prevent the upregulation of fibrogenic genes, were used. SAG21 k was chosen because Indian hedgehog homolog (IHH) is expressed in functional hSSCs and SAG21 k is a potent activator of Hedgehog (Hh) signaling which can increase the signaling axis.

[0274] Thus, based on the Boolean analysis of the disclosure, it was hypothesized that combined treatment with these molecules could restore hSSC bone-forming hSSC subtype composition in dysfunctional stem cells. In vitro testing confirmed that the combined applicationof SAG21 k and DMH1 to primary patient hSSCs elevated IHH and S0X9 expression while downregulating BMPR1 A and TAGLN (FIG. 10A), and significantly enhanced osteogenesis of patient hSSCs (FIGs. 7D-7E). Moreover, the results confirmed that the simultaneous application of SAG21 k and DMH1 even more significantly enhanced osteogenesis of patient hSSCs (FIGs. 7D-7E).

[0275] Next, to test the hypothesis from an in vivo setting, patient-derived hSSCs encapsulated in Matrigel with acellular bone matrix were transplanted alongside SAG21 k and DMH1 , subcutaneously into immunodeficient NOD scid gamma (NSG) mice (FIG. 8C). The combined treatment significantly improved ossicle formation with a higher mineralized content compared to controls. While fracture hSSCs responded most efficiently, this dual regimen also enhanced bone formation in hSSCs isolated from the tendon, cartilage, and metaphyseal bone marrow of aged donors (FIGs. 7F-7H). Finally, gels encapsulating hSSCs with or without SAG21 k / DMH1 were transplanted around the injury site of NSG mice with a bi-cortical femoral fracture to determine cellular output of human cells and healing outcome (FIG. 10C). Flow cytometric analysis of day-10 callus tissue identified donor hSSCs enriched for the chondrogenic subtype contributing to multiple skeletal lineages during the endochondral ossification process (FIG. 10D). Micro-computed tomography (CT) and immunohistology of day- 14 callus tissue further demonstrated the osteochondrogenic contributions of donor hSSCs during healing and importantly significantly increased mineralization through enhanced bone and cartilage output from hSSCs stimulated by SAG21 K+DMH1 but not mono-treated groups compared with hSSC-only controls (FIGs. 7I-7L, FIG. 10E).

[0276] In summary, a novel approach to gene regulatory network analysis was pioneered in the disclosure based on Boolean logic, inferred from scRNA-seq data of hSSCs. This surpasses traditional methods that only inferred transcription factor interactions (FIG. 8D). Utilizing this advanced technique, specific small molecules that can potentially reinstate the diversity of non- osteochondrogenic dysfunctional hSSCs were identified.DISCUSSION

[0277] The experiments and results described in the Examples of the disclosure provide a unique view into human skeletal development, aging, and disease from the perspective of highly pure human skeletal stem cells (hSSCs). The disclosure shows that individual hSSCs vary in their capacity for expansion, self-renewal, and differentiation into bone, cartilage, and fibrostromal cells, but do not generate fat cells. This has been further confirmed at the singlecell level using barcoding lineage analysis.

[0278] The disclosure provides that while hSSCs derived from different skeletal sites display high transcriptomic similarity, each bone hosts a unique diversity of hSSC subtypes with distinct clonal dynamics. This diversity appears to be vital for shaping and maintaining bone tissue throughout life. Four major types of hSSCs were identified herein, which exhibit over 90% transcriptomic similarity.

[0279] One discovery of the disclosure is that the transcriptomic identity of each hSSC subtype appears to be largely cell intrinsic. It maintains its overall identity during self-renewal in transplant settings, indicating that the unique qualities of each subtype persist even through cell divisions. The experiments and results described in the Examples of the disclosure show that while hSSCs derived from different skeletal sites show high transcriptomic similarity, each bone hosts a unique diversity of hSSC subtypes with distinct clonal dynamics. This diversity appears to be vital for shaping and maintaining bone tissue throughout life.

[0280] Four major types of hSSCs, which exhibit over 90% transcriptional similarity, were identified in the disclosure. However, individual bones host different representations of these hSSC types. Interestingly, different types of hSSCs are dispersed in distinct areas of the bone, providing the bone with a “positional memory” regarding its compositional architecture. The strategic interspersion of fibrostromal and osteochondrogenic hSSCs in specific ratios might be crucial for achieving the right balance between flexibility and rigidity in bone structure, similar to the use of rebars and cement in reinforced concrete. Moreover, a particular directionality in the clonal propagation of skeletal progenitors derived from hSSCs within the bone was found and described in the disclosure. Without wishing to be bound to a specific theory, such directionality may be critical for shaping the bone and determining its structural characteristics during development and growth. Disruptions in genes associated with major hSSC subtypes are often linked to genetic diseases.

[0281] One of the key observations was that fibroblast-skewed hSSCs tend to increase under various pathological conditions, an occurrence reminiscent of age-related myeloid skewing by hematopoietic stem cells (HSCs)6. Thus the question of whether the skewing of HSCs and hSSCs in humans are interconnected, perhaps through communication between the hematopoietic and skeletal compartments, was considered in the disclosure1920. It would also be worthwhile to explore if certain point mutations, such as those found in Clonal Hematopoiesis of Indeterminate Potential (CHIP), could lead to the expansion of fibroblast-skewed hSSCs over time. Alternatively, these clones might already exist but become dominant during aging or in response to co-morbidities such as diabetes17. Fibroblast-skewed hSSCs are significantly lessosteogenic than osteochondral hSSCs. Their pathological expansion results in poor ossification and bone healing. Understanding why aging promotes overexpansion of fibrogenic hSSCs could shed light on the interplay between aging, disease, and skeletal health. Given that fibroblast- skewed hSSCs expansion seems to be a common pathological mechanism in the skeleton, and fibrosis is a typical aging hallmark associated with altered fibroblast composition, identification of diverse hSSC subtypes defined by distinct but tunable gene regulatory networks described in the disclosure offers a new perspective for designing effective strategies against skeletal aging and disease44.

[0282] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0283] It should be understood that, while various embodiments in the specification are presented using “comprising” language, under various circumstances, a related embodiment may also be described using “consisting of” or “consisting essentially of” language. The disclosure contemplates embodiments described as “comprising” a feature to include embodiments that “consist of” or “consist essentially of” the feature. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. No language in the specification should be construed as indicating any nonclaimed element as essential to the practice of the disclosure.

[0284] It should also be understood that when describing a range of values, the disclosure contemplates individual values found within the range. In any of the ranges described herein, the endpoints of the range are included in the range. However, the description also contemplates the same ranges in which the lower and / or the higher endpoint is excluded.

[0285] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual aspects described and illustrated herein has discrete components and features that may be readily separated from or combined with the features of any of the other several aspects. Any recited method can be carried out in the order of steps recited or in any other order which is logically possible. This is intended to provide support for all such combinations.

[0286] Preferred embodiments of this disclosure are described herein. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon readingthe foregoing description. This disclosure includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the disclosure unless otherwise indicated herein or otherwise clearly contradicted by context. Also, only such limitations that are described herein as critical to the invention should be viewed as such; variations of the invention lacking limitations that have not been described herein as critical are intended as aspects of the invention.OTHER EMBODIMENTS

[0287] Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention, as claimed, should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention.REFERENCES1 . El Sayed, S.A., Nezwek, T.A., and Varacallo, M. (2020). Physiology, Bone. In StatPearls (StatPearls Publishing).2. Zaidi, M., Yuen, T., Sun, L., and Rosen, C.J. (2018). Regulation of Skeletal Homeostasis. Endocr. Rev. 39, 701-718. 10.1210 / er.2018-00050.3. Chan, C.K.F., Gulati, G.S., Sinha, R., Tompkins, J.V., Lopez, M., Carter, A.C., Ransom, R.C., Reinisch, A., Wearda, T., Murphy, M., et al. (2018). Identification of the Human Skeletal Stem Cell. Cell 175, 43-56.e21. 10.1016 / j.cell.2O18.07.029.4. Hoover, M.Y., Ambrosi, T.H., Steininger, H.M., Koepke, L.S., Wang, Y., Zhao, L., Murphy, M.P., Alam, A.A., Arouge, E.J., Butler, M.G.K., et al. (2023). Purification and functional characterization of novel human skeletal stem cell lineages. Nat. Protoc. 10.1038 / s41596- 023-00836-5.5. Weissman, I.L., and Shizuru, J. A. (2008). The origins of the identification and isolation of hematopoietic stem cells, and their capability to induce donor-specific transplantation tolerance and treat autoimmune diseases. Blood 112, 3543-3553. 10.1 182 / blood-2008-08- 078220.6. Beerman, I., Maloney, W.J., Weissmann, I.L., and Rossi, D.J. (2010). Stem cells and the aging hematopoietic system. Curr. Opin. Immunol. 22, 500-506. 10.1016 / j.coi.2010.06.007.Zhou, F„ Li, X., Wang, W„ Zhu, P„ Zhou, J., He, W„ Ding, M„ Xiong, F„ Zheng, X., Li, Z„ et al. (2016). Tracing haematopoietic stem cell formation at single-cell resolution. Nature 533, 487-492. 10.1038 / nature17997. Pellin, D., Loperfido, M., Baricordi, C., Wolock, S.L., Montepeloso, A., Weinberg, O.K., Biffi, A., Klein, A.M., and Biasco, L. (2019). A comprehensive single cell transcriptional landscape of human hematopoietic progenitors. Nat. Common. 10, 2395. 10.1038 / s41467-019- 10291 -O. Rodriguez-Fraticelli, A.E., Weinreb, C., Wang, S.-W., Migueles, R.P., Jankovic, M., Usart, M., Klein, A.M., Lowell, S., and Camargo, F.D. (2020). Single-cell lineage tracing unveils a role for TCF15 in haematopoiesis. Nature 583, 585-589. 10.1038 / s41586-020-2503-6. Baryawno, N., Przybylski, D., Kowalczyk, M.S., Kfoury, Y., Severe, N., Gustafsson, K., Kokkaliaris, K.D., Mercier, F., Tabaka, M., Hofree, M., et al. (2019). A Cellular Taxonomy of the Bone Marrow Stroma in Homeostasis and Leukemia. Cell 177, 1915-1932. e16.10.1016 / j.cell.2O19.04.040. Tikhonova, A.N., Dolgalev, I., Hu, H., Sivaraj, K.K., Hoxha, E., Cuesta-Dominguez, A., Pinho, S., Akhmetzyanova, L, Gao, J., Witkowski, M., et al. (2019). The bone marrow microenvironment al single-cell resolution. Nature 569, 222-228. 10.1038 / s41586-019- 1104-8. Baccin, C., Al-Sabah, J., Velten, L., Helbling, P.M., Grunschlager, F., Hernandez-Malmierca,P., Nombela-Arrieta, C., Steinmetz, L.M., Trumpp, A., and Haas, S. (2020). Combined single-cell and spatial transcriptomics reveal the molecular, cellular and spatial bone marrow niche organization. Nat. Cell Biol. 22, 38-48. 10.1038 / s41556-019-0439-6. Sacchetti, B., Funari, A., Michienzi, S., Di Cesare, S., Piersanti, S., Saggio, I., Tagliafico, E., Ferrari, S., Robey, P.G., Riminucci, M., et al. (2007). Self-renewing osteoprogenitors in bone marrow sinusoids can organize a hematopoietic microenvironment. Cell 131, 324- 336. 10.1016 / j.cell.2007.08.025. Wang, Z., Li, X., Yang, J., Gong, Y., Zhang, H., Qiu, X., Liu, Y., Zhou, C., Chen, Y., Greenbaum, J., et al. (2021 ). Single-cell RNA sequencing deconvolutes the in vivo heterogeneity of human bone marrow-derived mesenchymal stem cells. Int. J. Biol. Sci. 17, 4192-4206. 10.7150 / ijbs.61950. Ambrosi, T.H., Goodnough, L.H., Steininger, H.M., Hoover, M.Y., Kim, E., Koepke, L.S., Marecic, O., Zhao, L., Seita, J., Bishop, J.A., et al. (2020). Geriatric fragility fractures are associated with a human skeletal stem cell defect. Aging Cell 19, e13164.10.1111 / acel.13164. Goodnough, L.H., Ambrosi, T.H., Steininger, H., DeBaun, M.R., Abrams, G.D., McAdams, T.R., Gardner, M.J., Chan, C.K.F., and Bishop, J. A. Delayed Union of a Diaphyseal Forearm Fracture Associated with Impaired Osteogenic Differentiation of Prospectively Isolated Human Skeletal Stem Cells. JBMR Plus n / a. 10.1002 / jbm4.10398. Jaiswal, S., and Ebert, B.L. (2019). Clonal hematopoiesis in human aging and disease. Science 366. 10.1126 / science.aan4673.Haas, S., Trumpp, A., and Milsom, M.D. (2018). Causes and Consequences of Hematopoietic Stem Cell Heterogeneity. Cell Stem Cell 22, 627-638.10.1016 / j. stem.2018.04.003. Ambrosi, T.H., Marecic, O., McArdle, A., Sinha, R., Gulati, G.S., Tong, X., Wang, Y., Steininger, H.M., Hoover, M.Y., Koepke, L.S., et al. (2021 ). Aged skeletal stem cells generate an inflammatory degenerative niche. Nature, 1-7. 10.1038 / s41586-021 -03795-7. Mitchell, C.A., Verovskaya, E.V., Calero-Nieto, F.J., Olson, O.C., Swann, J.W., Wang, X., Herault, A., Dellorusso, P.V., Zhang, S.Y., Svendsen, A.F., et al. (2023). Stromal niche inflammation mediated by IL-1 signalling is a targetable driver of haematopoietic ageing. Nat. Cell Biol. 25, 30-41. 10.1038 / S41556-022-01053-0. Ambrosi, T.H., Sinha, R., Steininger, H.M., Hoover, M.Y., Murphy, M.P., Koepke, L.S., Wang, Y., Lu, W.-J., Morri, M., Neff, N.F., et al. (2021 ). Distinct skeletal stem cell types orchestrate long bone skeletogenesis. eLife 10, e66063. 10.7554 / eLife.66063. Chan, C.K.F., Seo, E.Y., Chen, J.Y., Lo, D., McArdle, A., Sinha, R., Tevlin, R., Seita, J., Vincent-Tompkins, J., Wearda, T., et al. (2015). Identification and specification of the mouse skeletal stem cell. Cell 160, 285-298. 10.1016 / j.cell.2O14.12.002. Debnath, S., Yallowitz, A.R., McCormick, J., Lalani, S., Zhang, T., Xu, R., Li, N., Liu, Y., Yang, Y.S., Eiseman, M., et al. (2018). Discovery of a periosteal stem cell mediating intramembranous bone formation. Nature 562, 133-139. 10.1038 / s41586-018-0554-8. Zhou, B.O., Yue, R., Murphy, M.M., Peyer, J.G., and Morrison, S.J. (2014). Leptin-receptor- expressing mesenchymal stromal cells represent the main source of bone formed by adult bone marrow. Cell Stem Cell 15, 154-168. 10.1016 / j. stem.2014.06.008. Sivaraj, K.K., Jeong, H.-W., Dharmalingam, B., Zeuschner, D., Adams, S., Potente, M., and Adams, R.H. (2021 ). Regional specialization and fate specification of bone stromal cells in skeletal development. Cell Rep. 36, 109352. 10.1016 / j. celrep.2021.109352. Murphy, M.P., Koepke, L.S., Lopez, M.T., Tong, X., Ambrosi, T.H., Gulati, G.S., Marecic, O., Wang, Y., Ransom, R.C., Hoover, M.Y., et al. (2020). Articular cartilage regeneration by activated skeletal stem cells. Nat. Med., 1-10. 10.1038 / s41591 -020-1013-2. Ambrosi, T.H., Scialdone, A., Graja, A., Gohlke, S., Jank, A.-M., Bocian, C., Woelk, L., Fan, H., Logan, D.W., Schumann, A., et al. (2017). Adipocyte Accumulation in the Bone Marrow during Obesity and Aging Impairs Stem Cell-Based Hematopoietic and Bone Regeneration. Cell Stem Cell 20, 771 -784.e6. 10.1016 / j.stem.2017.02.009. He, J., Yan, J., Wang, J., Zhao, L., Xin, Q., Zeng, Y., Sun, Y., Zhang, H., Bai, Z., Li, Z., et al. (2021). Dissecting human embryonic skeletal stem cell ontogeny by single-cell transcriptomic and functional analyses. Cell Res. 31, 742-757. 10.1038 / s41422-021 -00467- z. Kenswil, K.J.G., Pisterzi, P., Sanchez-Duffhues, G., van Dijk, C., Lolli, A., Knuth, C., Vanchin, B., Jaramillo, A.C., Hoogenboezem, R.M., Sanders, M.A., et al. (2021 ). Endothelium-derived stromal cells contribute to hematopoietic bone marrow niche formation. Cell Stem Cell 28, 653-670.e1 1. 10.1016 / j.stem.2021 .01 .006.Cooper, K.L., Oh, S., Sung, Y., Dasari, R.R., Kirschner, M.W., and Tabin, C.J. (2013). Multiple phases of chondrocyte enlargement underlie differences in skeletal proportions. Nature 495, 375-378. 10.1038 / naturel 1940. Gibon, E., Lu, L.Y., Nathan, K., and Goodman, S.B. (2017). Inflammation, ageing, and bone regeneration. J. Orthop. Transl. 10, 28-35. 10.1016 / j.jot.2017.04.002. Panteli, M., Pountos, I., Jones, E., and Giannoudis, P.V. (2015). Biological and molecular profile of fracture non-union tissue: current insights. J. Cell. Mol. Med. 19, 685-713.10.1111 / jcmm.12532. Robey, P.G., Kuznetsov, S., Riminucci, M., and Bianco, P. (2007). The role of stem cells in fibrous dysplasia of bone and the Mccune-Albright syndrome. Pediatr. Endocrinol. Rev. PER 4 Suppl 4, 386-394. Kuznetsov, S.A., Cherman, N., Riminucci, M., Collins, M.T., Robey, P.G., and Bianco, P. (2008). Age-dependent demise of GNAS-mutated skeletal stem cells and “normalization” of fibrous dysplasia of bone. J. Bone Miner. Res. Off. J. Am. Soc. Bone Miner. Res. 23, 1731— 1740. 10.1359 / jbmr.080609. Dabydeen, S.A., Desai, A., and Sahoo, D. (2019). Unbiased Boolean analysis of public gene expression data for cell cycle gene identification. Mol. Biol. Cell 30, 1770-1779. 10.1091 / mbc.E19-01 -0013. Dang, D., Taheri, S., Das, S., Ghosh, P., Prince, L.S., and Sahoo, D. (2020). Computational Approach to Identifying Universal Macrophage Biomarkers. Front. Physiol. 11.10.3389 / fphys.2020.00275. LeBleu, V.S., and Neilson, E.G. (2020). Origin and functional heterogeneity of fibroblasts. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 34, 3519-3536. 10.1096 / fj.201903188R. Serakinci, N., Guldberg, P., Burns, J.S., Abdallah, B., Schrodder, H., Jensen, T., and Kassem, M. (2004). Adult human mesenchymal stem cell as a target for neoplastic transformation. Oncogene 23, 5095-5098. 10.1038 / sj. one.1207651 . Macrae, V.E., Davey, M.G., McTeir, L., Narisawa, S., Yadav, M.C., Millan, J.L., and Farquharson, C. (2010). Inhibition of PHOSPHO1 activity results in impaired skeletal mineralization during limb development of the chick. Bone 46, 1146-1155. 10.1016 / j.bone.2009.12.018. Tevlin, R., Seo, E.Y., Marecic, O., McArdle, A., Tong, X., Zimdahl, B., Malkovskiy, A., Sinha, R., Gulati, G., Li, X., et al. (2017). Pharmacological rescue of diabetic skeletal stem cell niches. Sci. Transl. Med. 9. 10.1126 / scitranslmed.aag2809. Baud’huin, M., Solban, N., Cornwall-Brady, M., Sako, D., Kawamoto, Y., Liharska, K., Lath, D., Bouxsein, M.L., Underwood, K.W., Ucran, J., et al. (2012). A soluble bone morphogenetic protein type IA receptor increases bone mass and bone strength. Proc. Natl. Acad. Sci. U. S. A. 109, 12207-12212. 10.1073 / pnas.1204929109. Meng, X.-M., Nikolic-Paterson, D.J., and Lan, H.Y. (2016). TGF-[3: the master regulator of fibrosis. Nat. Rev. Nephrol. 72, 325-338. 10.1038 / nrneph.2016.48.Lim, C.Y., Wang, H., Woodhouse, S., Piterman, N., Wernisch, L., Fisher, J., and Gottgens, B. (2016). BTR: training asynchronous Boolean models using single-cell expression data. BMC Bioinformatics 77, 355. 10.1 186 / s12859-016-1235-y. Selman, M., and Pardo, A. (2021 ). Fibroageing: An ageing pathological feature driven by dysregulated extracellular matrix-cell mechanobiology. Ageing Res. Rev. 70, 101393.10.1016 / j.arr.2O21.101393. Jiang, H., Lei, R., Ding, S.-W., and Zhu, S. (2014). Skewer: a fast and accurate adapter trimmer for next-generation sequencing paired-end reads. BMC Bioinformatics 15, 182. 10.1186 / 1471 -2105-15-182. Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21. 10.1093 / bioinformatics / bts635. Li, B., and Dewey, C.N. (2011 ). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323. 10.1186 / 1471 -2105- 12-323. Nestorowa, S., Harney, F.K., Pijuan Sala, B., Diamanti, E., Shepherd, M., Laurenti, E., Wilson, N.K., Kent, D.G., and Gottgens, B. (2016). A single-cell resolution map of mouse hematopoietic stem and progenitor cell differentiation. Blood 128, e20-e31 . 10.1 182 / blood- 2016-05-716480. Gulati, G.S., Sikandar, S.S., Wesche, D.J., Manjunath, A., Bharadwaj, A., Berger, M.J., Hagan, F., Kuo, A.H., Hsieh, R.W., Cai, S., et al. (2020). Single-cell transcriptional diversity is a hallmark of developmental potential. Science 367, 405-411 . 10.1 126 / science.aax0249. La Manno, G., Soldatov, R., Zeisel, A., Braun, E., Hochgerner, H., Petukhov, V., Lidschreiber, K., Kastriti, M.E., Lbnnerberg, P., Furlan, A., et al. (2018). RNA velocity of single cells. Nature 560, 494-498. 10.1038 / s41586-018-0414-6. Chen, E.Y., Tan, C.M., Kou, Y., Duan, Q., Wang, Z., Meirelles, G.V., Clark, N.R., and Ma’ayan, A. (2013). Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics 14, 128. 10.1 186 / 1471 -2105-14-128. Sahoo, D., Dill, D.L., Tibshirani, R., and Plevritis, S.K. (2007). Extracting binary signals from microarray time-course data. Nucleic Acids Res. 35, 3705-3712. 10.1093 / nar / gkm284. Sahoo, D., Dill, D.L., Gentles, A.J., Tibshirani, R., and Plevritis, S.K. (2008). Boolean implication networks derived from large scale, whole genome microarray datasets. Genome Biol. 9, R157. 10.1186 / gb-2008-9-10-r157. Sahoo, D., Seita, J., Bhattacharya, D., Inlay, M.A., Weissman, I.L., Plevritis, S.K., and Dill, D.L. (2010). MiDReG: a method of mining developmentally regulated genes using Boolean implications. Proc. Natl. Acad. Sci. U. S. A. 107, 5732-5737. 10.1073 / pnas.0913635107. Varrone, M., Tavernari, D., Santamaria-martinez, A., Walsh, L.A., Ciriello, G. (2024). CellCharter reveals spatial cell niches associated with tissue remodeling and cell plasticity. Nat. Genet. 56 74-84.Bok, S., Yallowitz, A.R., Sun, J., McCormick, J., Cung, M., Hu, L., Lalani, S., et al. (2023). A multi-stem cell basis for craniosynostosis and calvarial mineralization. Nature. 627(7980), 804-812. Sun, J., Hu, L., Bok, S., Yallowitz, A.R., Cung, M / , McCormick, J., Zheng, L.J., et al. (2023). A vertebral skeletal stem cell lineage driving metastasis. Nature. 621(7979), 602-609. To, K., Fei, L., Rett, J.P., Roberts, K., Blain, R., Polanski, K., Li, T., Yayon, N., et al. (2024). A multi-omic atlas of human embryonic skeletal development. Nature. 635(8039), 657-667. Bandyopadhyay, S., Duffy, M.P., Ahn, K.J., Sussman, J.H., Pang, M., Smith, D., Duncan, G., et al. (2024). Mapping the cellular biogeography of human bone marrow niches using single-cell transcriptom ics and proteomic imaging. Cell. 787(12), 3120-3140. e29.

Claims

1. What is claimed is:1 . A method for treating a bone disease in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) an inhibitor of bone morphogenic protein (BMP) / transforming growth factor-beta (TGF-p) signaling, and (b) an activator of Hedgehog (Hh) signaling.

2. The method of claim 1 , wherein the inhibitor of BMP / TGF-p signaling is any inhibitor that inhibits activin receptor-like kinase 1 (ALK1 ) or activin receptor-like kinase 3 (ALK3).

3. The method of claim 1 or 2, wherein the inhibitor of BMP / TGF-p signaling is a selective inhibitor.

4. The method of claim 3, wherein the selective inhibitor of BMP / TGF- signaling is LDN- 193189 2HCI, LDN-193189, dorsomorphin 2HCI, dorsomorphin, K02288, LDN-212854, ML347, or DMH1 (dorsomorphin homolog 1 ).

5. The method of claim 3 or 4, wherein the selective inhibitor of BMP / TGF-p signaling is DMH1.

6. The method of any one of claims 1-5, wherein the activator of Hedgehog signaling is a Smoothened agonist.

7. The method of any one of claims 1-6, wherein the activator of Hedgehog signaling is Hh- Ag1.5, 20(S)-Hydroxycholesterol, SAG, or SAG21 k.

8. The method of any one of claims 1-7, wherein the activator of Hedgehog signaling is SAG21 , SAG, SAG1 , or SAG21 k.

9. The method of any one of claims 1-8, wherein the activator of Hedgehog signaling is SAG21 k.

10. A method for treating a bone disease in a subject, the method comprising contacting skeletal stem cells (SSCs) with a combination of (a) DMH1 , and (b) SAG21 k.

11. The method of any one of claims 1-10, wherein the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are implanted in a drug delivery device.

12. The method of claim 11 , wherein the drug delivery device is a biodegradable implant.

13. The method of claim 12, wherein the biodegradable implant is a block polymer implant.

14. The method of claim 12 or 13, wherein the biodegradable implant comprises poly(caprolactone) (POL), poly(lactic acid) (PLA), or poly(lactic-co-glycolic acid) (PLGA).

15. The method of any one of claims 12-14, wherein the biodegradable implant comprises collagen, hyaluronic acid, cellulose, chitosan, silk, gelatin, albumin, elastin, or milk proteins.

16. The method of any one of claims 12-15, wherein the biodegradable implant is a hydrogel.

17. The method of any one of claims 11 -16, wherein the drug delivery device is implanted at a position topical to a fracture site or to a site afflicted with the bone disease.

18. The method of any one of claims 1-17, wherein the selective inhibitor of BMP / TGF-p signaling and the activator of Hedgehog signaling are administered topically to a fracture site or to a site afflicted with the bone disease of a subject.

19. The method of any one of claims 12-18, wherein the implant is provided immediately following an injury.

20. The method of any one of claims 1-19, wherein the selective inhibitor of BMP / TGF- signaling and the activator of Hedgehog signaling are administered within 3 days of an injury.21 . A drug delivery device comprising of an effective dose of a selective inhibitor of BMP / TGF-p signaling and an activator of Hedgehog signaling for reactivation of SSCs.

22. The method of any one of claims 1-21 , wherein the SSCs are human SSCs (hSSCs).

23. The method of any one of claims 1-20 or 22, wherein the subject is a mammal.

24. The method of any one of claims 1-20, 22, or 23, wherein the subject is a human.

25. A substantially pure population of skeletal stem cells produced by the method according to any one of claims 1-24.

26. A method of treatment, comprising administering to an individual the population of cells according to claim 25.

27. A kit or system for use in the method of any one of claims 1 -23.

Images