Primer-probe set and kit for detecting methylation of slit2 and ZNF154 genes, and use thereof in detection of hepatocellular carcinoma

By using primer and probe sets for SLIT2 and ZNF154 gene methylation detection and digital PCR technology, the problem of low sensitivity in existing hepatocellular carcinoma diagnostic methods has been solved, achieving early diagnosis with high sensitivity and specificity, and reducing unnecessary invasive examinations.

WO2026051460A1PCT designated stage Publication Date: 2026-03-12SHANGHAI CINOPATH MEDICAL TESTING CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/098665
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-05
Filing Date
2025-05-30
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Existing diagnostic methods for hepatocellular carcinoma, such as imaging examinations and AFP biomarker testing, have low sensitivity, leading to missed diagnoses or unnecessary invasive surgeries for some patients. Furthermore, non-invasive testing methods are not sensitive enough to effectively distinguish between benign space-occupying lesions and liver cancer.

Method used

We developed primer and probe sets and detection kits for SLIT2 and ZNF154 gene methylation detection. By combining digital PCR technology, we can achieve highly specific and accurate auxiliary diagnosis of hepatocellular carcinoma by detecting the methylation status of cell-free DNA in plasma. The primer and probe sets are designed at CpG sites near the target gene or promoter, and combined with multiplex fluorescence detection, we can absolutely quantify the number of methylated and unmethylated molecules.

Benefits of technology

It improves the sensitivity and specificity of early diagnosis of hepatocellular carcinoma, can distinguish between benign space-occupying lesions and liver cancer, reduces the risks of unnecessary surgery or puncture, is suitable for large-scale promotion, has high sensitivity and precision, wide applicability, and avoids the result error caused by polyploidy effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025098665_12032026_PF_FP_ABST
    Figure CN2025098665_12032026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a primer-probe set and kit for detecting the methylation of SLIT2 and ZNF154 genes, and the use thereof in the detection of hepatocellular carcinoma. The primer-probe set does not require an additional reference gene; and compared to a reference gene method, the primer-probe set avoids, by means of simultaneously detecting methylated and non-methylated targets, a result error caused by the common polyploidy effect in cancer cells. In addition, on the premise of ensuring the system performance, an amplicon is designed to be as short as possible to adapt to the characteristics of a short cfDNA fragment. It is verified that using the primer-probe combination to detect the methylation of SLIT2 and ZNF154 genes has good specificity and high sensitivity. The primer-probe set can be used as an effective supplement to imaging or tissue biopsy in the diagnosis of primary hepatocellular carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

SLIT2 and ZNF154 gene methylation detection primer probe set, kit and application in detecting hepatocellular carcinoma TECHNICAL FIELD

[0001] The present application relates to the field of gene detection, in particular to the SLIT2 and ZNF154 gene methylation detection primer probe set, kit and application in detecting hepatocellular carcinoma. BACKGROUND

[0002] Hepatocellular carcinoma is one of the most common human tumors, and can be divided into primary and metastatic types. Primary hepatocellular carcinoma mainly includes hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (CCA) and mixed hepatocellular carcinoma-cholangiocarcinoma (cHCC-CCA) of three different pathological types. Hepatocellular carcinoma (HCC) accounts for about 75% of primary hepatocellular carcinoma.

[0003] Early diagnosis of HCC is crucial for early intervention and survival. Multiple studies have shown that early monitoring can improve overall survival, and international guidelines recommend that patients with cirrhosis should undergo HCC screening, as patients with cirrhosis have a 2-4% annual risk of developing HCC. The American Association for the Study of Liver Diseases (AASLD) classifies the following patients as high-risk patients for HCC: patients with cirrhosis (Child Pugh A and B), patients with cirrhosis (Child Pugh C waiting for liver transplantation), and patients without cirrhosis but with HBV.

[0004] The AASLD (American Association for the Study of Liver Diseases) currently recommends that high-risk patients receive abdominal ultrasound monitoring every six months. However, less than one-fifth of high-risk patients receive HCC screening. In addition, the sensitivity of abdominal ultrasound detection for early HCC is only 45%, and additional screening using the AFP biomarker may improve the detection rate of HCC, however, even with a combined approach, the sensitivity of detecting HCC is only 63%. The overall sensitivity of magnetic resonance imaging (MRI) and computed tomography (CT) for diagnosing HCC is 65% and 72%, respectively, however, for HCC smaller than 2 cm, the sensitivity of CT and MRI is only 48% and 62%, respectively, and for HCC smaller than 1 cm, the sensitivity of CT and MRI is even lower, and liver biopsy is still a reliable diagnostic tool for HCC, and percutaneous, ultrasound-guided liver biopsy is the most commonly used method. The main disadvantage of tissue biopsy is its invasiveness, and the most important risk is bleeding. Therefore, the clinical diagnostic needs of hepatocellular carcinoma are far from being met. Based on the concept of precision medicine, developing new blood-based diagnostics is a key strategy to improve early diagnosis of HCC.

[0005] DNA methylation is a form of DNA chemical modification, which plays an important role in the regulation of gene expression. It is the covalent binding of a methyl group to the 5th carbon of cytosine in the CpG dinucleotide of the genome, forming 5-methylcytosine (5mC) DNA. It can affect expression, gene and protein interaction without changing the DNA sequence. DNA methylation mainly occurs at the CpG site. Studies have shown that DNA methylation promotes the occurrence of cancer, and abnormal methylation of some tumor-related genes can occur in the early stages of tumor occurrence, which can be used as a specific marker for diagnosis and monitoring.

[0006] Plasma free DNA (cfDNA) is released into the blood circulation due to apoptosis. In cancer patients, a small amount of DNA can also be released into the blood circulation due to tumor cell necrosis or apoptosis, which is called ctDNA. Analysis of circulating tumor-derived DNA (ctDNA) can be used for early diagnosis of cancer. The emergence of new minimally invasive experimental methods, such as liquid biopsy, provides a good environment for the development and application of methylation-based biomarkers, making cfDNA methylation an innovative biomarker for cancer.

[0007] Among the many methylation detection methods, real-time fluorescence quantitative PCR is one of the main methods, but it cannot absolutely quantify the methylation molecules, and the selection of reference targets is also interfered by CNV variation, and the detection accuracy needs to be improved.

[0008] Therefore, it is necessary to develop a gene methylation detection primer probe set and kit for hepatocellular carcinoma detection, and to use digital PCR method to detect cfDNA methylation, which can be used as an effective supplement to imaging or tissue biopsy in the diagnosis of primary hepatocellular carcinoma. SUMMARY

[0009] The main purpose of the present application is to develop a product based on gene methylation detection for the auxiliary diagnosis of liver cancer, aiming at the lack of high-accuracy non-invasive auxiliary diagnosis technology for hepatocellular carcinoma in the current clinical first-line. Traditional imaging diagnosis, such as ultrasound and CT detection, can diagnose most patients, but some patients still cannot be diagnosed, leading to missed detection of these patients or unnecessary puncture surgery, which brings great economic and physical burden to the patients. The sensitivity of some non-invasive detection methods such as AFP is also poor. The present application provides a SLIT2 and ZNF154 gene methylation detection primer probe set, a detection kit and related applications in the detection of hepatocellular carcinoma, to realize specific, accurate, rapid and suitable for large-scale promotion of methylation gene detection, which can detect hepatocellular carcinoma in the early stage, and also can better distinguish between benign space-occupying lesions and liver cancer, thereby reducing unnecessary surgery or puncture risk.

[0010] In view of this, the scheme of the present application is:

[0011] In the first aspect of the present application, a primer probe set for detecting gene methylation is provided, comprising a first primer probe set for detecting a SLIT2 gene and a second primer probe set for detecting a ZNF154 gene; the first primer probe set comprises a primer pair with a nucleotide sequence as shown in SEQ ID NO: 1-2, and a probe set with a nucleotide sequence as shown in SEQ ID NO: 3-4; the second primer set comprises a primer pair with a nucleotide sequence as shown in SEQ ID NO: 5-6, and a probe set with a nucleotide sequence as shown in SEQ ID NO: 7-8.

[0012] In the second aspect of the present application, a SLIT2 and ZNF154 gene methylation detection kit is provided, comprising the primer probe set described in the first aspect.

[0013] Further, the 5' end of each probe in the kit is provided with a fluorescent group, and the 3' end is provided with a quenching group.

[0014] Further, the kit further comprises at least one of a PCR amplification system, a positive quality control, a negative quality control, a reference dye, and purified water.

[0015] Preferably, the PCR amplification system comprises at least one of a DNA polymerase, dNTP, Mg 2+ , a PCR buffer system, a PCR enhancer, and a PCR stabilizer. Preferably, it contains Tris-KCl (10mM-500mM), (NH4)2SO4 (10mM-500mM), glycerol (1%-50%), BSA (0.001mg / mL-1mg / mL), betaine (0.1M-3M), and DMSO (0.1%-10%).

[0016] Further, the final concentration of each primer pair is 0.2μM, and the final concentration of each probe set is 0.1μM.

[0017] In the third aspect of the present application, the kit described in the second aspect is used in the preparation of a hepatocellular carcinoma detection product.

[0018] In the fourth aspect of the present application, a method for detecting the methylation of SLIT2 and ZNF154 genes for non-diagnostic purposes is provided, comprising the steps of:

[0019] S1. Extracting cfDNA from the sample and performing bisulfite conversion;

[0020] S2. Mixing the converted DNA, the primer probe set described in the first aspect, and the qPCR Probe Master Mix to prepare a ddPCR mixture;

[0021] S3. Placing the ddPCR mixture into a digital PCR instrument to perform a digital PCR amplification reaction;

[0022] S4. Collecting multiplex fluorescence signals of the product after the PCR amplification reaction, and judging the methylation of SLIT2 and ZNF154 genes according to the types of fluorescence signals.

[0023] In the above detection method, the detection for non-diagnostic purposes includes the detection of samples that cannot be traced back to humans, such as the detection of gene methylation of a sample under laboratory conditions, and the detection result only represents the result of the sample itself, i.e., the presence or absence of SLIT2 and ZNF154 gene methylation.

[0024] Further, in step S3, the ddPCR mixture is added to the digital PCR instrument, and the ddPCR mixture is prepared into 15000-20000 micro-reaction droplets.

[0025] Further, in step S3, the PCR amplification reaction program is as follows: 60℃ startup heating micro-droplets for 5min, 95℃ hot start for 10min; 95℃ denaturation for 20s, 57℃ annealing for 40s, a total of 40 cycles.

[0026] Compared with the prior art, the present application has the following advantages:

[0027] The primer probe set for detecting the methylation of SLIT2 and ZNF154 genes in the present application does not require additional internal reference genes, and the methylation target and the non-methylation target are detected at the same time, which avoids the result error caused by the common multiple effect of cancer cells compared with the internal reference gene method; in addition, under the premise of ensuring the performance of the system, the amplicon is designed to be as short as possible to adapt to the characteristics of cfDNA short fragments, and it has been verified that the use of the above primer probe combination for detecting the methylation of SLIT2 and ZNF154 genes has good specificity and high sensitivity; it can be used as an effective supplement to imaging or tissue biopsy in the diagnosis of primary hepatocellular carcinoma.

[0028] The detection kit in the present application can realize 4-fold fluorescence detection in combination with the SNAP digital PCR instrument, the primer probe is designed near the CpG site of the target gene or the promoter of the target gene, and for the CpG site to be detected, the probes for methylation and non-methylation are designed respectively, and are distinguished by different fluorescent labels, and the number of methylation and non-methylation molecules is absolutely quantified by digital PCR, so that the methylation ratio is accurately obtained. Compared with the most common qPCR, the method has the following advantages:

[0029] a) High sensitivity, detection limit as low as single-digit copies, so as to capture low-level cancer signals;

[0030] b) high precision, capable of distinguishing small methylation ratio difference between cancer and normal people, more reliable results;

[0031] c) excluding various PCR inhibitors interference, more widely applicable. BRIEF DESCRIPTION OF DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0033] Figure 1 is a diagram of the SLIT2 gene methylation site primer probe design according to the present application.

[0034] Figure 2 is a diagram of the ZNF154 gene methylation site primer probe design according to the present application.

[0035] Figure 3 is an example of 50% methylation sample (FAM and VIC) in the embodiments of the present application. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solutions and beneficial technical effects of the present application more clear, the present application will be further described in detail below in combination with the drawings and specific embodiments. It should be understood that the specific embodiments described in the present specification are only for the purpose of explaining the present application, and are not intended to limit the present application.

[0037] In one embodiment, 30 methylation targets are preferred from millions of methylation sites through 500 clinical sample RRBS detection and public databases, but the system has poor cost and practicability due to too many sites, therefore, we prefer 12 targets from them, through detection of additional 122 samples, 2 targets are finally screened out and a suitable threshold is determined, the double-target system has a slightly poorer performance than the 30-target system, but is still much higher than the traditional AFP protein detection, in addition, it can be combined with multiplex digital PCR technology to realize multiplex fluorescence detection. In the embodiment, the genes targeted are SLIT2 and ZNF154 genes, and the primer and probe design is shown in FIGS. 1-2, and the red part is the target to be detected. The primer probe is designed at the CpG site near the target gene or the target gene promoter, and the confirmation of the detection site is through the previous RRBS methylation detection on the cancer patient and healthy population queue, and the optimal differential methylation region (DMR) is screened out. For the CpG site to be detected, the methylation and non-methylation probes are designed respectively, and are distinguished by different fluorescent labels, and the absolute quantification of methylation and non-methylation molecules is used to accurately obtain the methylation ratio.

[0038] In the above embodiment, the primer probe combination of SLIT2 and ZNF154 genes does not require an additional internal reference gene, and the methylation target and non-methylation target are detected at the same time, which avoids the result error caused by the common ploidy effect of cancer cells compared with the internal reference gene method; in addition, under the premise of ensuring the performance of the system, the amplicon is designed to be as short as possible to adapt to the characteristics of cfDNA short fragments, and it has been verified that the primer probe combination is used to detect the methylation of SLIT2 and ZNF154 genes, which has good specificity and high sensitivity.

[0039] Specifically, in the above embodiment, the primer probe combination of the SLIT2 and ZNF154 genes is shown in Table 1, and the probe is modified with fluorescein.

[0040] Table 1: 8 PCR amplification primers and fluorescein labeling characteristics of 2 sites

[0041]

[0042]

[0043] It should be noted that the design of any primer is not able to achieve high sensitivity and specificity detection, for two reasons: first, the same gene CpG site can be as many as hundreds, the detection efficiency of different CpG sites is different; second, the detection efficiency of different genes is different, by increasing the number of detection genes can improve the sensitivity and specificity to some extent, but the increase of the number of genes will greatly reduce the detection practicability, the present embodiment optimizes the best CpG site and the best gene combination by screening the methylation site in the genome, realizes the high sensitivity and specificity, meets the clinical needs, and takes into account the better applicability.

[0044] In another embodiment, a method for rapid detection of liver cancer methylation genes SLIT2 and ZNF154 is provided, comprising:

[0045] 1. Extraction and transformation of plasma free DNA (cfDNA);

[0046] 2. Using the nucleic acid solution obtained in step 1 as a template, using probe primer group to establish a digital PCR system for specific amplification of target nucleic acid sequence, amplifying target genes SLIT2 and ZNF154;

[0047] 3. Collecting multiple fluorescence signals of the product after PCR amplification reaction, and judging the methylation of SLIT2 and ZNF154 genes according to the type of fluorescence signal.

[0048] In the above embodiment, the SLIT2 gene target sequence before transformation is (chr4:20255044-20255123(hg19), SEQ ID NO:9):

[0049] GCCCTCCCCACAACAACCGGCCCCTGCATCTTAGCAGCCGTTGGAAG CCCCAGCTCTTTTACCGCCAAGTTCATCCTTGG

[0050] The SLIT2 target sequence after transformation is (CpG methylation, the part to be detected is underlined, SEQ ID NO:10):

[0051] GTTTTTTTTATAATAATCGGTTTTTGTATTTTAGTAGTCGTTGGAAGTTTTAGTTTTTTTATCGTTAAGTTTATTTTTGG

[0052] The ZNF154 gene target sequence (chr19:58220790-58220856(hg19), before transformation, hereinafter referred to as SEQ ID NO:11) is:

[0053] TAATATGCTGTCTGATTACGACCCATTTAAGAAAGGGCGAAGTCCCT CCACTGCCCTAGGACTTGGA

[0054] ZNF154 target transformed sequence, hereinafter referred to as SEQ ID NO: 12 (CpG methylation, underlined part is the target to be detected):

[0055] TAATATGTTGTTTGATTACGATTTATTTAAGAAAGGGCGAAGTTTTTTTA TTGTTTTAGGATTTGGA

[0056] In the above examples, the methylation detection kit for detecting SLIT2 and ZNF154 specifically comprises the components shown in Table 2. The methylation positive control in the kit is a SLIT2 and ZNF154 methylation gene sequence plasmid, and the methylation negative control is a normal human genome transformed DNA sequence plasmid.

[0057] Table 2:

[0058]

[0059] In one embodiment, free DNA is obtained from plasma, combined with digital PCR methylation detection. The plasma samples are derived from hepatocellular carcinoma patients and healthy people, a total of 122 cases. The collection of all human samples and clinical data complies with the principles of the Helsinki Declaration, and all participants have signed a written informed consent for the use of their plasma samples. The blood sample is 10 mL of blood sample collected by intravenous blood sampling before all participants are enrolled.

[0060] The sample type and number are shown in Table 3.

[0061] Table 3:

[0062]

[0063] The sample information and detection results are shown in Table 4.

[0064] Table 4:

[0065]

[0066] As can be seen from Table 4, the combined sensitivity of the two genes reaches 89%, and the specificity reaches 92% in the presence of interfering samples. Of the 20 cirrhosis samples, 16 were judged to be negative, thus better compensating for existing detection means, such as the inability of conventional ultrasound to distinguish between liver cancer and other space-occupying lesions. It is of great significance for timely detection of early lesions of cancer.

[0067] Examples

[0068] 1. Sample pretreatment

[0069] DNA extraction and conversion of the sample are required before detection. The plasma DNA extraction and bisulfite conversion kit is used for sample pretreatment. The kit QIAamp Circulating Nucleic Acid Kit (Qiagen) and EZ DNA Methylation-Lightning Kit (ZYMO RESEARCH) are used for sample pretreatment.

[0070] The volume of the plasma sample required by the kit should be greater than 2 ml, and the pretreatment is carried out according to the requirements of the plasma DNA extraction and bisulfite conversion kit instructions. The pretreated plasma DNA can be directly used for detection of the kit.

[0071] 2. Sample detection

[0072] 1) Take out the kit stored at -15~ -25℃ in the dark, and equilibrate the kit components to room temperature;

[0073] 2) Take out the corresponding number of 96-well plates or PCR reaction tubes;

[0074] 3) Calculate and remove the corresponding amount of reagents according to the number of reactions performed in the experiment. The number of reactions refers to the amount of this test plus 1 positive control and 1 negative control, and the remaining reagents are stored at -15~ -25℃ in the dark;

[0075] 4) Prepare the reaction system according to the following scheme

[0076]

[0077] 5) Template solution refers to the mixed solution of the pretreated sample in 1, methylation positive control, methylation negative control, and blank control;

[0078] 6) Seal the 96-well plate or cover the PCR reaction tube, shake evenly, centrifuge at 2000 rpm for 10 seconds, tear off the cover and put it into the Thinker DQ24 digital PCR instrument;

[0079] 7) Perform PCR amplification according to the following conditions:

[0080]

[0081] Note: The exposure time is set as follows:

[0082]

[0083] 3. Result analysis

[0084] 1) Result quality control: total droplet number is above 18000. The fluorescence channel corresponding to the detected target gene in the detection result of this kit is shown in the following table:

[0085]

[0086] 2) Threshold setting: analyze the 2D map of positive and negative controls, divide the 50% methylation 2D map into four regions of upper, lower, left and right, and move the threshold line so that the oval signal region where the positive and negative control signals overlap is completely in the lower left region. The 50% methylation sample is shown in Figure 3 (FAM and VIC).

[0087] 3) Analyze other sample thresholds, and the software automatically calculates the methylation ratio.

[0088] 4. Quality control

[0089] The kit contains positive and negative controls. These controls should be added in each reaction to detect whether the reaction is successful and to ensure the effectiveness of the reaction. The methylation ratio of the positive control and the negative control should be within the effective range, as shown in the following table, and if the ratio is outside the effective range, the test result is invalid.

[0090]

[0091] 5. Result interpretation

[0092] The judgment of PCR results is shown in the following table:

[0093]

[0094] The present application is not limited to the description and embodiments described in the specification, and therefore additional solutions and modifications can be easily implemented by those skilled in the art, and therefore the present application is not limited to specific details, representative designs and illustrative examples shown and described herein, without departing from the spirit and scope of the general concept defined by the claims and their equivalents.

Claims

1. A gene methylation detection primer probe set, characterized in that, The first probe primer set for detecting the SLIT2 gene and the second primer probe set for detecting the ZNF154 gene; the first primer probe set comprises a primer pair with nucleotide sequences as shown in SEQ ID NO: 1-2, and a probe set with nucleotide sequences as shown in SEQ ID NO: 3-4; the second primer set comprises a primer pair with nucleotide sequences as shown in SEQ ID NO: 5-6, and a probe set with nucleotide sequences as shown in SEQ ID NO: 7-8.

2. A SLIT2 and ZNF154 gene methylation detection kit, characterized in that, The primer probe set of claim 1.

3. The kit of claim 2, wherein In the primer probe set, the 5' end of each probe is provided with a fluorescent group, and the 3' end has a quenching group.

4. The kit of claim 2, wherein The kit further comprises at least one of a PCR amplification system, a positive quality control, a negative quality control, a reference dye, and purified water.

5. The kit of claim 4, wherein The PCR amplification system comprises at least one of a DNA polymerase, dNTP, Mg 2+ , a PCR buffer system, a PCR enhancer, and a PCR stabilizer.

6. The kit of claim 2, wherein The final concentration of each primer pair is 0.2 μM, and the final concentration of each probe set is 0.1 μM.

7. Use of the kit of any one of claims 2-6 in the preparation of a hepatocellular carcinoma detection product.

8. A method for detecting methylation of the SLIT2 and ZNF154 genes for a purpose other than diagnosis, characterized by the steps of Comprising: S1. Extracting cfDNA from the sample and performing bisulfite conversion; S2. Mixing the converted DNA, the primer probe set of claim 1, and the qPCR Probe Master Mix to prepare a ddPCR mixture; S3. Placing the ddPCR mixture in a digital PCR instrument to perform a digital PCR amplification reaction; S4. Collecting multiple fluorescence signals from the product after the PCR amplification reaction, and determining the methylation status of the SLIT2 and ZNF154 genes according to the types of fluorescence signals.

9. The detection method according to claim 8, characterized in that, In step S3, the ddPCR mixture is added to the digital PCR instrument, and the ddPCR mixture is prepared into 15,000-20,000 micro-reaction droplets.

10. The method of claim 8, wherein, In step S3, the PCR amplification reaction program is as follows: 60℃ startup heating droplets for 5 min, 95℃ hot start for 10 min; 95℃ denaturation for 20 s, 57℃ annealing for 40 s, a total of 40 cycles.

Citation Information

Patent Citations

  • Kit for detecting DNA methylation state of peripheral blood cells for analyzing hepatocellular carcinoma

    CN108660217A

  • Methods of amplifying DNA to maintain methylation status

    CN110741092A

  • SLIT2 and ZNF154 gene methylation detection primer probe set, kit and application in hepatocellular carcinoma detection

    CN118995929A

  • Cancer detection methods

    US20180216195A1