Reference genes and primers and probes for exosomal rna detection quantification correction

Abstract

This invention discloses internal reference genes, primers, and probes for quantitative correction of exosomal RNA detection. The internal reference genes are IGF2R and / or ERGIC3 genes. This invention also designs primers and probes targeting the internal reference genes. The main advantages of the internal reference genes IGF2R and ERGIC3 used in this invention are: (1) The detection results of the two reference genes are relatively stable in the mRNA detection results of different samples. (2) IGF2R and ERGIC3, as internal reference genes, can significantly improve the differentiation between tumor patients and patients with inflammation when used for quantitative correction of exosomal RNA detection results, thereby further improving the sensitivity and specificity of the detection system in the detection process of pleural effusion samples.

Description

Technical Field

[0001] This invention belongs to the field of exosome detection technology, specifically relating to internal reference genes, primers, and probes for quantitative calibration of exosome RNA detection. Background Technology

[0002] Different tissues in the human body exhibit different gene expression patterns, but some gene products are essential for maintaining basic cellular functions and are stably expressed in all cells. These genes are called housekeeping genes (HK genes). HK genes are often used as measurements to calibrate gene expression. β-actin or GAPDH have been reported as commonly used housekeeping genes in cells and tissues.

[0003] Malignant pleural effusion (MPE) is an exudative pleural effusion containing malignant cells. MPE is a common symptom and accompanying manifestation of metastatic diseases, most commonly lung cancer, breast cancer, lymphoma, gynecological malignancies, and malignant mesothelioma. Diagnosis of MPE is usually based on pathological analysis, but even with repeated pleural aspirations, cytological sensitivity is only 50-70%, and repeated aspirations are helpful in only 10% of cases. Therefore, a new diagnostic biomarker for MPE is needed.

[0004] Exosomes, also known as exosomes, are small vesicles with a diameter of 30–150 nm. They are formed when a multivesicular body (MVB) is released into the extracellular environment after fusing with the cell membrane. They are enclosed in a lipid bilayer and contain nucleic acids (DNA, mRNA, microRNA (miRNA), lncRNA, circRNA, etc.) and proteins.

[0005] Existing research results show that exosomal RNA from pleural effusion may have the potential to differentiate lung adenocarcinoma. Currently, the housekeeping genes routinely used for quantitative detection of mRNA by fluorescent PCR are β-actin or GAPDH. The main problem with using these two genes for exosomal mRNA detection is that, as housekeeping genes, β-actin or GAPDH genes show large differences in detection results between different samples, have poor stability, cannot be used as internal reference genes for correction, and cannot effectively distinguish between tumor patients and patients with inflammation. Summary of the Invention

[0006] The purpose of this invention is to provide internal reference genes, primers, and probes for quantitative calibration of exosome RNA detection. This aims to address the significant differences in detection results and poor stability between different samples when using existing internal reference genes β-actin or GAPDH for PCR detection in exosome mRNA detection.

[0007] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows:

[0008] This invention provides the application of internal reference genes in quantitative correction of exosomal RNA detection, wherein the internal reference genes are IGF2R and / or ERGIC3 genes.

[0009] As a preferred embodiment, the exosome RNA is pleural effusion exosome mRNA.

[0010] The present invention also provides primers for detecting internal reference genes IGF2R and / or ERGIC3, wherein the primer sequences for the IGF2R gene are shown in SEQ ID NO.1 and SEQ ID NO.2; and the primer sequences for the ERGIC3 gene are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0011] The present invention also provides probes for detecting internal reference genes IGF2R and / or ERGIC3, wherein the probe sequence of the IGF2R gene is shown in SEQ ID NO.3; and the probe sequence of the ERGIC3 gene is shown in SEQ ID NO.6.

[0012] The present invention also provides a PCR detection kit for exosomal RNA, the kit comprising primers and probes for detecting the internal reference gene IGF2R and / or the ERGIC3 gene.

[0013] As a preferred embodiment, the primer sequences of the IGF2R gene are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence is shown in SEQ ID NO.3.

[0014] As a preferred embodiment, the primer sequences of the ERGIC3 gene are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe sequence is shown in SEQ ID NO.6.

[0015] As a preferred embodiment, the final concentration of the primers used to detect the IGF2R gene and / or ERGIC3 gene is between 100-900 nM, and the concentration of the probe is between 25-500 nM.

[0016] In a preferred embodiment, the probe has a fluorescent group at its 5' end and a quenching group at its 3' end.

[0017] In a preferred embodiment, the fluorescent group is selected from VIC, FAM, ROX or HEX groups, and the quenching group is selected from MGB or BHQ1 groups.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] (1) In the mRNA detection results of different samples using the internal reference genes IGF2R and ERGIC3 used in this invention, the detection results of the two reference genes are relatively stable.

[0020] (2) IGF2R and ERGIC3, as internal reference genes, can be used to quantitatively correct the results of exosomal RNA detection, which can significantly improve the differentiation between tumor patients and patients with inflammation, thereby further improving the sensitivity and specificity of the detection system in the process of detecting pleural effusion samples. Attached Figure Description

[0021] Figure 1 This is a graph showing the variation trend of the internal reference gene in different samples in Example 1 of the present invention.

[0022] Figure 2 This is a schematic diagram comparing the tumor group and the inflammation group after differential gene correction by internal reference gene in Example 2 of the present invention.

[0023] Figure 3 This is a schematic diagram comparing the tumor group and the inflammation group after differentially expressed genes were corrected with β-actin in Example 3 of the present invention. Detailed Implementation

[0024] The technical solution of the present invention will be described in detail below with reference to the embodiments. Unless otherwise specified, all reagents and biological materials used below are commercial products.

[0025] Example 1: Screening of exocrine reference genes in pleural effusion

[0026] 1.1 Preparation of exosomes from pleural effusion and extraction of exosome RNA

[0027] 1) Preparation of pleural effusion samples: 20 mL required. 10 pleural effusion samples from patients with pleurisy, numbered N1-N10 in sequence; 10 pleural effusion samples from patients with lung cancer, numbered T1-T10 in sequence.

[0028] 2) Take the prepared pleural fluid sample, centrifuge at 3000g for 15 min at 4℃, transfer the supernatant to a new centrifuge tube, add 10 mL of PEG8000 aqueous solution (concentration 30%), vortex to mix, and let stand at 4℃ overnight. Then, centrifuge at 3000g for 10 min. The resulting precipitate is used to extract RNA from exosomes using the Qiagen miRNeasy Micro Kit (Qiagen, 217084). For detailed operating procedures, please refer to the kit instructions.

[0029] 1.2 Construction of exosome RNA library from pleural effusion

[0030] The pleural effusion exosome library was constructed using the Ovation SoLo RNA-Seq System kit (NuGen, catalog number: M01406), and the operation method is as described in the kit instructions.

[0031] 1.3 Sequencing of exosome RNA library from pleural effusion

[0032] The pleural effusion exosome RNA library was sent to the Mingma Bio Nova platform for sequencing, using PE150 sequencing technology. Each sample required 15G of data.

[0033] 1.4 Sequencing data analysis and internal reference gene screening

[0034] Data from the experimental setup were quality controlled using FastQC, and compared using STAR software. After obtaining the counts, TPM (Transcripts Per Million) was used for data normalization. N1-N10 represented the inflammation group, and T1-T10 represented the tumor group. Differential gene analysis between groups was performed using pvalue < 0.01 & |logF| > 2. The differentially expressed genes that clearly distinguished the tumor group from the healthy group were UBE2C and ANXA10. The TPM values ​​of these two differentially expressed genes are shown in Table 1.

[0035] Table 1

[0036] Gene name N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 UBE2C 192.82 159.56 93.04 147.66 121.28 108.47 228.99 201.46 170.11 182.99 ANXA10 39.78 10.81 6.89 19.79 15.07 12.82 15.6 22.9 25.55 8.84 Gene name T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 UBE2C 2269.19 481.22 411.84 259.37 259.7 1643.52 248.27 102.23 312.34 304.23 ANXA10 116.59 28.62 33.31 21.94 37.38 745.77 70.28 13.43 12.92 21.61

[0037] CV values ​​of all sample genes were analyzed, and genes with CV values ​​less than or equal to 0.3 were selected as internal reference genes. Analysis of the TPM values ​​of the internal reference genes revealed that the CV values ​​of IGF2R and ERGIC3 were less than 0.3 in all samples, and the expression changes of these two genes were basically consistent across different samples. The TPM values ​​of the internal reference genes are shown in Table 2, and the trends of their expression across different samples are as follows. Figure 1 As shown, 1-10 correspond to samples N1-N10, and 11-20 correspond to samples T1-T10.

[0038] Table 2

[0039] Gene name N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 IGF2R 10.43 11.28 9.6 10.97 9 9.54 13.84 11.11 7.25 7.04 ERGIC3 9.19 9.22 6.34 8.21 6.83 6.34 10.14 9.17 6.8 5.71 Gene name T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 IGF2R 14.89 11.26 13.79 17.11 11.53 10.86 6.86 4.41 9.65 9.2 ERGIC3 8.18 4.64 8.26 8.12 6.24 6.59 4.78 3.06 6.96 5.87

[0040] Example 2: Correction of pleural effusion exosome sequencing samples using screened internal reference genes.

[0041] The ratio (IGF2R / ERGIC3) obtained by dividing the two selected internal reference genes was denoted as the correction factor F. The calculation results of the correction factor for each sample are shown in Table 3. Differentially expressed genes were corrected using the following formula: differentially expressed gene / ERGIC3*F. The corrected differentially expressed gene data for each sample are shown in Table 4. The comparison between the tumor group and the inflammation group after differentially expressed gene correction is shown in Table 4. Figure 2 As shown, by Figure 2 It can be seen that the corrected data can clearly distinguish between samples from patients with inflammation and samples from patients with tumors.

[0042] Table 3

[0043] N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 IGF2R 10.43 11.28 9.6 10.97 9 9.54 13.84 11.11 7.25 7.04 ERGIC3 9.19 9.22 6.34 8.21 6.83 6.34 10.14 9.17 6.8 5.71 Correction factor F 1.13 1.22 1.51 1.34 1.32 1.50 1.36 1.21 1.07 1.23 T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 IGF2R 14.89 11.26 13.79 17.11 11.53 10.86 6.86 4.41 9.65 9.2 ERGIC3 8.18 4.64 8.26 8.12 6.24 6.59 4.78 3.06 6.96 5.87 Correction factor F 1.82 2.43 1.67 2.11 1.85 1.65 1.44 1.44 1.39 1.57

[0044] Table 4

[0045] N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 UBE2C 23.81 21.17 22.22 24.03 23.40 25.74 30.82 26.62 26.67 39.51 ANXA10 4.91 1.43 1.65 3.22 2.91 3.04 2.10 3.03 4.01 1.91 T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 UBE2C 504.96 251.68 83.24 67.31 76.90 410.99 74.54 48.15 62.22 81.23 ANXA10 25.94 14.97 6.73 5.69 11.07 186.49 21.10 6.33 2.57 5.77

[0046] Example 3: Differentially identified genes from pleural effusion exosomes were corrected using the traditional internal reference gene β-actin.

[0047] To compare the differences between the internal reference gene of this invention and traditional internal reference genes, this embodiment uses the classic internal reference β-actin to correct for differentially expressed genes. The TPM values ​​of β-actin are shown in Table 5. The formula for correcting differentially expressed genes is: differentially expressed gene / β-actin. The data after differentially expressed gene correction are shown in Table 6. The analysis results of differentially expressed genes after correction with β-actin are as follows: Figure 3 As shown. By Figure 3 The data results show that using β-actin to correct for differentially expressed genes cannot clearly distinguish between the inflammation group samples and the tumor group samples.

[0048] Table 5

[0049] Gene name N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 β-actin 493.13 481.96 573.73 516.43 598.18 443.46 357.76 479.45 319.76 356.48 Gene name T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 β-actin 204.54 413.32 1064.25 483.29 658.34 417.47 1322.27 562.15 283.44 472.75

[0050] Table 6

[0051] N1 N2 N3 N4 N5 N6 N7 N8 N9 N10 UBE2C 0.39 0.33 0.16 0.29 0.20 0.24 0.64 0.42 0.53 0.51 ANXA10 0.08 0.02 0.01 0.04 0.03 0.03 0.04 0.05 0.08 0.02 T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 UBE2C 11.09 1.16 0.39 0.54 0.39 3.94 0.19 0.18 1.10 0.64 ANXA10 0.57 0.07 0.03 0.05 0.06 1.79 0.05 0.02 0.05 0.05

[0052] Example 4: qPCR verification of IGF2R and ERGIC3 genes in pleural effusion exosomes across different samples.

[0053] To test the relative stability of IGF2R and ERGIC3 gene detection in different samples, pleural effusion samples from 5 patients with pleurisy and 5 patients with lung cancer were collected, numbered S1-S10. Exosomes and exosomal RNA were prepared according to the method in Example 1. The two genes were then verified by qPCR. The primer and probe sequence information is shown in Table 7.

[0054] Table 7

[0055] Primer and probe names Sequence information (5′---3′) SEQ ID IGF2R forward primer TTGAGTGGCGAACGCAGTAT SEQ ID NO:1 IGF2R reverse primer TGCCAGCCCCATCTTTGAAT SEQ ID NO:2 IGF2R probe ACCTTTCGATCTGACTGAATG SEQ ID NO:3 ERGIC3 forward primer GGCTTCTTGGAAGTCAATAAGGTGG SEQ ID NO:4 ERGIC3 reverse primer CGTACATGCTGTGGAGATCCATG SEQ ID NO:5 ERGIC3 probe ACTTCCACTTTGCCCCTGG SEQ ID NO:6

[0056] qPCR assays were performed using reagents from Thermo Fisher Scientific (China) Co., Ltd., specifically the EXPRESS qPCR Supermix, universal (catalog number: 1178501K). The sample well reaction system was prepared as follows:

[0057] Element Volume (μL) 2X qPCR SuperMix 25 Primer and probe solution 2 template 5 Enzyme-free water 18

[0058] The reaction process is as follows:

[0059]

[0060]

[0061] The PCR test results are shown in Table 8:

[0062] Table 8

[0063] Sample Name RNF25 Ct value UIMC1 Ct value S1 29.42 33.42 S2 31.46 34.06 S3 32.73 33.73 S4 31.75 33.55 S5 31.98 33.98 S6 31.38 34.33 S7 32.29 34.29 S8 32.08 34.17 S9 31.48 33.38 S10 32.21 33.21 CV value 0.03 0.01

[0064] The data in Table 8 show that the coefficient of variation (CV) values ​​of the two internal reference genes were all below 0.1 in different samples, indicating that the expression of these two internal reference genes is relatively stable in different samples and can be used for quantitative correction of subsequent exosomal RNA sample qPCR detection.

[0065] The above are merely some preferred embodiments of the present invention, and the present invention is not limited to the contents of these embodiments. For those skilled in the art, various changes and modifications can be made within the scope of the present invention's technical solutions, and any such changes and modifications are within the protection scope of the present invention. sequence list <110> Shanghai 3D Biomedical Technology Co., Ltd. <120> Internal reference genes, primers, and probes for quantitative calibration of exosome RNA detection <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Primer <400> 1 ttgagtggcg aacgcagtat 20 <210> 2 <211> 20 <212> DNA <213> Primer <400> 2 tgccagcccc atctttgaat 20 <210> 3 <211> twenty one <212> DNA <213> probe <400> 3 acctttcgat ctgactgaat g 21 <210> 4 <211> 25 <212> DNA <213> Primer <400> 4 ggcttcttgg aagtcaataa ggtgg 25 <210> 5 <211> twenty three <212> DNA <213> Primer <400> 5 cgtacatgct gtggagatcc atg 23 <210> 6 <211> 19 <212> DNA <213> probe <400> 6 acttccactt tgcccctgg 19

Claims

1. The application of a reagent for detecting the expression level of an internal reference gene in a PCR detection kit for preparing exosomal RNA, characterized in that: The internal reference genes are IGF2R and ERGIC3 genes; the exosome RNA is pleural effusion exosome RNA.

2. The application according to claim 1, characterized in that: The primer sequences for the IGF2R gene are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence is shown in SEQ ID NO.

3.

3. The application according to claim 2, characterized in that: The primer sequences for the ERGIC3 gene are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe sequence is shown in SEQ ID NO.

6.

4. The application according to claim 2 or 3, characterized in that: The primers used to detect the IGF2R and ERGIC3 genes have a final concentration between 100-900 nM, and the probe concentration is between 25-500 nM.

5. The application according to claim 2 or 3, characterized in that: The probe has a fluorescent group at its 5' end and a quenching group at its 3' end.

6. The application according to claim 5, characterized in that: The fluorescent group is selected from VIC, FAM, ROX or HEX groups, and the quenching group is selected from MGB or BHQ1 groups.

Images