Reference gene of irpex lacteus and primer and application thereof

By screening and designing internal reference genes and primers suitable for *Amanita muscaria*, the problems of instability of traditional internal reference genes and time-consuming primer design were solved, and efficient and stable qPCR analysis under different conditions was achieved.

CN116426683BActive Publication Date: 2026-04-28INST OF BIOLOGICAL & MEDICAL ENG GUANGDONG ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF BIOLOGICAL & MEDICAL ENG GUANGDONG ACAD OF SCI
Filing Date
2023-04-20
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

In the existing technology, the selection of internal reference genes for *Aureobasidium stearans* is not suitable for different culture conditions and developmental processes. The expression of the traditional internal reference gene *gapdh* is unstable, which affects the accuracy of qPCR analysis. Furthermore, primer design is time-consuming and costly, and non-specific amplification occurs frequently.

Method used

Internal reference genes and their primers suitable for *Amanita muscaria* were screened out, including ubiquitin-conjugating enzyme 1, autophagy protein Atg8, ubiquitin-conjugating enzyme 2, calcineurin, and fungal protein kinase. A highly specific primer set was designed, and the amplification efficiency and stability were ensured by whole-genome sequence BLAST screening.

Benefits of technology

It provides stable internal reference genes and primers for different research scenarios and expression levels, which improves the accuracy and efficiency of qPCR analysis, reduces primer screening costs, and ensures the specificity and stability of amplification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116426683B_ABST
    Figure CN116426683B_ABST
Patent Text Reader

Abstract

The application discloses a reference gene of Irpex lacteus, primers and application thereof. The reference gene comprises ubiquitin conjugating enzyme 1, autophagy protein Atg8, ubiquitin conjugating enzyme 2, calmodulin-dependent phosphatase and fungal protein kinase gene. The five reference genes disclosed in the application are suitable for expression level research of different expression level genes. The reference gene provided by the application has stable expression in different development periods and different culture conditions, and the reference primers have high specificity, stable amplification and amplification efficiency close to 100%. In addition, according to the expression level of a target gene, a suitable reference gene can be selected from the five reference genes for expression level research. The application provides new candidate reference genes which are more stable and more extensive than common reference genes such as gapdh for gene expression research of Irpex lacteus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to internal reference genes, primers, and applications suitable for the study of growth, development, carbon source utilization, and high-temperature growth of *Amanita muscaria*. Background Technology

[0002] Real-time quantitative PCR (qPCR) has become an important tool for studying gene expression levels due to its high sensitivity, specificity, and reliability. However, the effectiveness of qPCR analysis largely depends on the selection of internal control genes and primer design. Therefore, screening genes that are relatively stable in expression under different conditions as internal control genes and designing primers is crucial to the success of qPCR.

[0003] In previous studies, we used the traditional internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference gene for studying the gene expression levels of *Foietinus stearothermium*. However, GAPDH expression is affected by certain factors, and its expression level is relatively high, making it less suitable for studying low-expression genes. Currently, there is no systematic study of internal control genes and their primers for *Foietinus stearothermium* under different culture conditions and developmental processes.

[0004] Accurate gene sequences are a prerequisite for primer design and correct amplification. Existing gene annotation software usually predicts gene structure based on existing models. However, gene structures may vary greatly between different species and even different varieties. Therefore, it is of great significance to correct gene structures based on transcriptome data to obtain accurate gene information.

[0005] Since primer sequences are typically short nucleotide sequences of 18-22 bp, numerous similar base sites exist within the genome, easily leading to non-specific amplification. Traditional methods of verifying primer specificity one by one using experimental techniques are time-consuming, inefficient, and costly. Therefore, performing BLAST based on the whole genome sequence before primer synthesis to remove primers with potential multiple binding sites can significantly reduce primer screening workload and improve screening efficiency. Summary of the Invention

[0006] The purpose of this invention is to screen internal reference genes and primers suitable for different research scenarios and gene expression levels of *Fodium stearothermum*. The screening method used in this invention is simple and rapid, and has yielded internal reference gene primers for *Fodium stearothermum* with high amplification efficiency and good stability.

[0007] The first objective of this invention is to provide an internal reference gene for *Amanita muscaria*, wherein the internal reference gene comprises genes for ubiquitin-conjugating enzyme 1, autophagy protein Atg8, ubiquitin-conjugating enzyme 2, calcineurin, and fungal protein kinase; the nucleotide sequence of the ubiquitin-conjugating enzyme 1 gene is shown in SEQ ID NO.1; the nucleotide sequence of the autophagy protein Atg8 gene is shown in SEQ ID NO.2; the nucleotide sequence of the ubiquitin-conjugating enzyme 2 gene is shown in SEQ ID NO.3; the nucleotide sequence of the calcineurin gene is shown in SEQ ID NO.4; and the nucleotide sequence of the fungal protein kinase gene is shown in SEQ ID NO.5.

[0008] The nucleotide sequence of the ubiquitin-binding enzyme 1 gene is shown in SEQ ID NO.1, specifically as follows:

[0009] ATGGCCCTCAAGCGCATTAACAAGTTAATCGATCTCGGCCGGGACCCGCCCTCCTCGTGCAGCGCA

[0010] GGCCCAACTGGCGATAACATGTTCCAGTGGCAAGCAACGATCATGGGACCGGCGGATTCACCATAC

[0011] GCTGGTGGCGTGTTCTTCCTGTCTATCACTTTCCCACGGACTACCCCTTCAAGCCGCCCAAGGTCA

[0012] GCTTCACGACCAAGATCTACCACCCGAACATCAACGCGAACGGGTCGATCTGTCTCGATATCCTGA

[0013] GGGACCAGTGGAGTCCAGCATTGACTATCTCGAAAGTTCTGCTTTCGATTTGCTCAATGCTCACGGA

[0014] CCCCAATCCCGACGATCCGCTTGTCCCCGACATCGCTCATCTATACAAGAACGACCCGGAGCGATACGCGGCAACGGCTCGGGAGTGGACACGGAAGTATGCTATGTAG.

[0015] The nucleotide sequence of the autophagy protein Atg8 gene is shown in SEQ ID NO.2, specifically: ATGAGGTCCAAGTTCAAGGATGAGCACCCCTTTGACAAGCGCAAGGCGGAGGCGGAGCGTATCAGGCAGAAGTACCCAGATCGTATCCCTGTCATCTGCGAGAAGGCGGACAAGACGGACATCCCTACCATCGACAAGAAGAAGTATCTGGTCCCATCAGACCTCACTGTGGGCCAGTTCGTCTATGTTATCCGGAAGCGAATCAAGCTCGCACCGGAGAAGGCGATCTTCATCTTCGTAGACGAGGTGCTGCCCCCAACAGCAGCACTGATGAGCGCCATATACGAGGAGCACAAGGACGAGGACGGGTTCCTGTACGTGAGCTACTCGGGTGAGAACACCTTTGGCTCGCGGTGA。

[0016] The nucleotide sequence of the ubiquitin-conjugating enzyme 2 gene is shown in SEQ ID NO.3, specifically: ATGGACCAGATCACCTCGCCACTCGCACCCCGTGCAACCACGAAGCCGTCTGTGGCGGGAGCGGGAGGAGACCCTGCGGGTAGTGTCACGAAACGCCTCACGAGTGAACTTATGAGCCTAATGATGTCCTCTTCCCCCGGAATCTCCGCATTCCCGAGGACCGACGCGAACTTGTTTGACTGGGTGGGAACTATTGAGGGTCCAGCGGGCACGGTTTACGCTGGTTTGTCGTTCAAGATCGCGATAGCGTTCCCTCCAAACTACCCAATGGCACCTCCTGCCATTAAGTTCGACTCACCTTGCTTCCACCCCAATGTTGACATCAACGGCGGAGGGATCTGTCTTGACATTTTGCAGGACAAATGGTCTGCCGTTTACAGCGTGCAGACAATCCTATTGTCTCTCCAGTCGTTGCTTGGTGAGCCCAACAATGCGTCACCGCTGAACCCCGATGCCGCTGCTGTCTGGGACAACCCCGATGAATTCAAGGCGCAGGTGTTGAAGTACTATCGCCCCATGAACGACGAGTCGACTTGA。

[0017]

[0018]

[0019] A second objective of this invention is to provide a primer set for amplifying the aforementioned internal reference gene, the primer set sequence of which is as follows:

[0020] The amplification primers for the ubiquitin-binding enzyme 1 gene are shown in SEQ ID NO. 6-7, specifically:

[0021] F:GTGGCGTGTTCTTCCTGTCT; R:CGTTCTTGTATAGATGAGCGATGT;

[0022] The amplification primers for the autophagy protein Atg8 gene are shown in SEQ ID NO. 8-9, specifically:

[0023] F:GCCAGTTCGTCTATGTTATCCG; R:CGTCCTTGTGCTCCTCGTAT;

[0024] The primers for amplifying the ubiquitin-binding enzyme 2 gene are shown in SEQ ID NO.10-11, specifically:

[0025] F:CGAGTGAACTTATGAGCCTAATGA; R:CGAACTTAATGGCAGGAGGTG;

[0026] The primers for amplifying the calcineurinase gene are shown in SEQ ID NO.12-13, specifically:

[0027] F: GCCTTCCTATCGCTGCTATTG; R: ACTGACTCCTCGTTCGTTGT;

[0028] The primers for amplifying the fungal protein kinase gene are shown in SEQ ID NO.14-15, specifically:

[0029] F:GCCTCTGTTCTCGTTCTCCAA; R:CATCCGCATCCATAATCACTCTC.

[0030] A third objective of this invention is to provide the application of reagents for detecting the aforementioned internal reference gene in the quantitative detection of the internal reference gene in *Amanita muscaria*.

[0031] A fourth objective of this invention is to provide the application of the above-described primer set in the quantitative detection of internal reference genes in *Apertureobacterium tumefaciens*.

[0032] A fifth objective of this invention is to provide the application of the above-described primer set in the preparation of a kit for gene expression analysis of *Amanita muscaria*.

[0033] A sixth object of the present invention is to provide a kit comprising the primer set described above.

[0034] Preferably, the kit also contains other reagents used in PCR.

[0035] A seventh objective of this invention is to provide the application of the aforementioned internal reference gene, primer set, or kit in gene expression analysis of *Amanita muscaria*. Preferably, it is used in the quantitative detection of genes at different expression levels in *Amanita muscaria*.

[0036] The eighth objective of this invention is to provide a method for quantitative detection of genes at different expression levels in *Amanita muscaria*. This method uses the aforementioned internal reference genes to quantitatively detect genes at different expression levels. Specifically, the fungal protein kinase gene serves as the internal reference gene for quantitative detection of low-expression genes; the calcineurin esterase gene serves as the internal reference gene for quantitative detection of low-to-medium expression genes; the ubiquitin-binding enzyme 2 gene serves as the internal reference gene for quantitative detection of moderately expressed genes; the autophagy protein Atg8 gene serves as the internal reference gene for quantitative detection of medium-to-high expression genes; and the ubiquitin-binding enzyme 1 gene serves as the internal reference gene for quantitative detection of high-expression genes.

[0037] This invention discloses five internal reference genes suitable for studies on the growth and development of *Amanita muscaria* and its application under different culture conditions (carbon source utilization and high-temperature growth). These genes include a fungal protein kinase, calcineurin, the autophagy protein Atg8 gene, and two ubiquitin-binding enzyme genes. The screening method involves calculating gene expression levels from multiple transcriptome datasets and then selecting target genes based on transcriptional levels and stability. The five internal reference genes disclosed in this invention are suitable for studying gene expression levels at different stages. The internal reference genes provided by this invention exhibit stable expression at different developmental stages and under different culture conditions, and the primers used for these internal references are highly specific, amplify stably, and have amplification efficiency approaching 100%. Furthermore, suitable internal reference genes can be selected from these five genes based on the expression level of the target gene. This provides a more stable and broader range of new candidate internal reference genes for gene expression studies in *Amanita muscaria* than common internal reference genes such as GAPDH. Attached Figure Description

[0038] Figure 1 This is an electrophoresis diagram of the amplification products of the internal reference gene primers screened in this invention.

[0039] Figure 2 This is the melting curve of the internal reference gene screened in this invention.

[0040] Figure 3 The stability of Ct values ​​of the internal reference gene screened in this invention and the traditional internal reference gene gapdh in samples heat-treated at 45℃ for 30 min, 1 h, 3 h and 6 h.

[0041] Figure 4 Five genes expressing low to high levels were randomly selected from *Aureobasidium stearans*. qPCR was performed using the five internal reference genes of this invention, and the expression levels obtained showed higher consistency with the transcriptome than with the traditional internal reference gene gapdh. Detailed Implementation

[0042] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0043] Example 1

[0044] 1. Selection of internal control genes: Transcriptome data of mycelia of *Amanita muscaria* Ct001 (deposited in the strain bank of the Institute of Biomedical Engineering, Guangdong Academy of Sciences) at 25℃ and 35℃ and in five different carbon source media (formula: ammonium sulfate 1.5 g / L, dipotassium hydrogen phosphate 1.0 g / L, magnesium sulfate 0.3 g / L, vitamin B1 0.5 mg / L, agar powder 20 g / L, carbon source 20 g / L, solvent: water, carbon sources: glucose, sucrose, cellulose, lignin and hemicellulose, respectively) and transcriptome data of primordia and fruiting bodies were used to screen for genes that showed no significant difference in expression level (stable TPM, CV < 10%) and whose expression abundance increased from low to high (5 ≤ TPM ≤ 2500) in all samples, and were selected as candidate internal control genes.

[0045] 2. Candidate gene structure correction: The gene structure of candidate genes is manually corrected based on transcriptome data to obtain the most accurate full-length sequence of the gene.

[0046] 3. Design of primers for internal reference genes: Primers were designed based on the gapdh sequences of candidate internal reference genes and traditional internal reference genes. The primer sequences were then BLASTed across the entire genome, and primers with fewer potential binding sites were selected for synthesis. This method of BLASTing first and then selecting primers can maximize the accuracy and specificity of primer amplification and significantly reduce the experimental time for selecting suitable primers.

[0047] 4. Screening of internal reference gene primers: qPCR amplification was performed on cDNA from *Pheromus spp.* at serially 2-fold dilutions using the above primers. The results were then analyzed using agarose gel electrophoresis. Figure 1 ), dissolution curve ( Figure 2 ), amplification efficiency (Table 1), Ct value stability ( Figure 3 The optimal internal reference gene primers were selected based on indicators such as ( ).

[0048] The sequences of the five internal reference genes and their amplification primers obtained from the screening are shown in Table 1 below.

[0049] Table 1

[0050]

[0051]

[0052] Ct value stability verification process:

[0053] 1) The mycelium of *Amanita muscaria* Ct001 was cultured at 35℃ for 5 days, and then treated at 45℃ for 30 min, 1 h, 3 h and 6 h respectively.

[0054] 2) Extract RNA from the mycelia treated with the above high temperature, adjust to the same concentration, and reverse transcribe into cDNA;

[0055] 3) The above samples were amplified by qPCR using the primers for the internal reference gene of the present invention and the primers for the traditional internal reference gene gapdh in Table 1, respectively.

[0056] 4) The reaction system consisted of: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of forward and reverse primers (10 μmol / L), 8.2 μL of double-distilled water, and 1 μL of cDNA. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 3 s, 60℃ annealing for 32 s, 40 cycles; and 72℃ extension for 30 s.

[0057] 5) Determine the stability of the internal reference gene based on the Ct value of each internal reference gene in different samples.

[0058] 5. Application of internal control primers: Genes with different gene expression levels in the transcriptome data of mycelia cultured in glucose medium (25℃ and 35℃) were randomly selected. qPCR amplification was performed using the internal control gene primers provided in this invention and traditional gapdh primers, respectively. The primers provided in this invention showed higher consistency between gene expression levels and transcriptome data. Figure 4 ).

[0059] The specific method is as follows:

[0060] 1) Based on the gene expression levels in the transcriptome data, select 5 genes with expression levels from low to high: ABC transporter_1, heat shock transcription factor_1, heat shock transcription factor_2, peptidase, and ABC transporter_2;

[0061] 2) Design qPCR primers for the above 5 genes and the traditional internal reference gene gapdh, as shown in Table 2:

[0062] Table 2

[0063]

[0064] 3) qPCR was performed on cDNA from mycelial cultures cultured in glucose medium (25℃ and 35℃). The reaction mixture consisted of: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL each of forward and reverse primers (10 μmol / L), 8.2 μL of double-distilled water, and 1 μL of cDNA. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 3 s, 60℃ annealing for 32 s, 40 cycles; and 72℃ extension for 30 s.

[0065] 4) Utilize 2 –ΔΔCt The relative expression levels of genes were calculated using this method, and the results showed that the expression levels of the internal reference gene provided in this invention were more consistent with the transcriptome than those of the traditional internal reference gene gapdh. Figure 4 ).

[0066] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An internal reference gene of *Porphyra yezoensis*, characterized in that, The gene includes ubiquitin-conjugating enzyme 1, autophagy protein Atg8, ubiquitin-conjugating enzyme 2, calcineurin, and fungal protein kinase genes; the nucleotide sequence of the ubiquitin-conjugating enzyme 1 gene is shown in SEQ ID NO.1; the nucleotide sequence of the autophagy protein Atg8 gene is shown in SEQ ID NO.2; the nucleotide sequence of the ubiquitin-conjugating enzyme 2 gene is shown in SEQ ID NO.3; the nucleotide sequence of the calcineurin gene is shown in SEQ ID NO.4; and the nucleotide sequence of the fungal protein kinase gene is shown in SEQ ID NO.

5.

2. A primer set for amplifying the internal reference gene of claim 1, characterized in that, The primer set sequence is as follows: The primers for amplifying the ubiquitin-binding enzyme 1 gene are: F:GTGGCGTGTTCTTCCTGTCT; R:CGTTCTTGTATAGATGAGCGATGT; The primers for amplifying the autophagy protein Atg8 gene are: F:GCCAGTTCGTCTATGTTATCCG; R:CGTCCTTGTGCTCCTCGTAT; The primers for amplifying the ubiquitin-binding enzyme 2 gene are: F:CGAGTGAACTTATGAGCCTAATGA; R:CGAACTTAATGGCAGGAGGTG; The primers for amplifying the calcineurinase gene are: F:GCCTTCCTATCGCTGCTATTG; R:ACTGACTCCTCGTTCGTTGT; The primers for amplifying the fungal protein kinase gene are: F:GCCTCTGTTCTCGTTCTCCAA; R:CATCCGCATCCATAATCACTCTC.

3. The application of the reagent for detecting the internal reference gene as described in claim 1 in the quantitative detection of the internal reference gene of *Amanita muscaria*.

4. The application of the primer set described in claim 2 in the quantitative detection of internal reference genes in *Amanita muscaria*.

5. The application of the primer set according to claim 2 in the preparation of a kit for gene expression analysis of *Amanita muscaria*.

6. A reagent kit, characterized in that, It includes the primer set as described in claim 2.

7. The reagent kit according to claim 6, characterized in that, It also contains other reagents used in PCR.

8. The application of the internal reference gene of claim 1, the primer set of claim 2, or the kit of claim 6 in gene expression analysis of *Amanita muscaria*.

9. The application according to claim 8, characterized in that, It is used in the quantitative detection of genes with different expression levels in *Amanita muscaria*.

10. A method for quantitative detection of genes at different expression levels in *Pheromus spp.*, characterized in that, The internal reference gene described in claim 1 is used for quantitative detection of genes with different expression levels. The fungal protein kinase gene is used as the internal reference gene for quantitative detection of low-expression genes; the calcineurin gene is used as the internal reference gene for quantitative detection of medium-low expression genes; the ubiquitin-binding enzyme 2 gene is used as the internal reference gene for quantitative detection of medium-expression genes; the autophagy protein Atg8 gene is used as the internal reference gene for quantitative detection of medium-high expression genes; and the ubiquitin-binding enzyme 1 gene is used as the internal reference gene for quantitative detection of high-expression genes.

Citation Information

Patent Citations

  • Primer pairs and kit for identifying mating type of Coriolopsis trogii protoplast monokaryon and application of primer pairs

    CN112126701A

  • Screening and application of fluorescent quantitative reference gene under sugarcane hand-cutting dense seed abiotic stress condition

    CN115820915A