Internal reference genes of different tissues of industrial cannabis sativa under waterlogging stress and application of internal reference genes

Abstract

The invention discloses reference genes of different tissues of industrial cannabis sativa under waterlogging stress and application of the reference genes. The reference genes comprise three genes of ScActin2, ScTATA and ScTIP41. The stable reference gene disclosed by the invention can be used as a reliable reference for functional gene expression analysis under waterlogging stress of industrial cannabis sativa, a key technical support is provided for researches such as mining of subsequent waterlogging-resistant related functional genes, analysis of signal channels and the like, and the research on stress-resistant molecular breeding of industrial cannabis sativa is promoted.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology, and in particular relates to internal reference genes in different tissues of industrial hemp under waterlogging stress and their applications. Background Technology

[0002] Industrial hemp ( Cannabis sativa Industrial hemp (L.) is a crop with both economic and ecological value. Its fiber can be used in textiles and construction, and its seeds can be processed into food and oils. However, industrial hemp is susceptible to waterlogging stress during its growth cycle, which damages root cell structure, inhibits photosynthesis, and disrupts metabolism, leading to stunted plant growth, sharp yield reduction, or even death, severely restricting its large-scale cultivation and industrial development.

[0003] Gene expression analysis is a core tool for elucidating the molecular mechanisms of plant responses to abiotic stress. Real-time quantitative polymerase chain reaction (qRT-PCR) is widely used to detect the expression levels of target genes due to its advantages of high specificity, high sensitivity, and good reproducibility. However, the accuracy of qRT-PCR results is highly dependent on the stability of the internal reference gene—the internal reference gene must maintain constant expression under different experimental conditions (such as stress treatment), different tissues and organs, and different varieties in order to serve as a "benchmark" for calibrating the expression level of the target gene and offset errors caused by differences in RNA extraction efficiency, reverse transcription efficiency, and PCR reaction system.

[0004] Currently, in plant stress-related research, the commonly used internal reference genes are mostly traditional housekeeping genes, such as those encoding actin (…). ACT ), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ), 18S ribosomal RNA ( 18S rRNA These genes, such as those for *Arabidopsis thaliana*, exhibit a degree of stability in some plants or under specific stresses. However, this "stability" is highly species-specific, tissue-specific, and stress-condition-specific—for example, genes stably expressed in *Arabidopsis thaliana* under drought stress. ACT Gene expression fluctuated significantly under waterlogging stress in rice; the same gene, while stable in industrial hemp leaves, could exhibit drastic changes in expression levels in roots due to stress response. Research on the molecular mechanisms of waterlogging stress in industrial hemp is still in its early stages. No studies have systematically screened and validated internal reference genes that are stably expressed in different tissues (such as roots, stems, and leaves) of industrial hemp under waterlogging stress. Existing studies often directly borrow internal reference genes from other plants or select housekeeping genes from industrial hemp that have not been validated under waterlogging stress, leading to doubts about the accuracy of target gene expression levels detected by qRT-PCR. This, in turn, interferes with the screening, functional analysis, and molecular breeding work of key genes responding to waterlogging in industrial hemp.

[0005] Therefore, it is urgent to establish a scientific screening system to screen out internal reference genes with high expression stability under waterlogging stress and in different tissues from industrial hemp candidate genes, so as to provide reliable technical support for accurately analyzing the molecular mechanism of industrial hemp's response to waterlogging and cultivating waterlogging-resistant industrial hemp varieties. Summary of the Invention

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: This invention relates to internal reference genes in different tissues of industrial hemp under waterlogging stress, which include ScActin2 , ScTATA and ScTIP41 .

[0007] Another aspect of this invention relates to using the aforementioned internal reference gene as a reference for functional gene expression analysis under waterlogging stress in industrial hemp.

[0008] In a preferred embodiment of the present invention, the ScActin2 Internal reference genes as roots.

[0009] In a preferred embodiment of the present invention, the ScTATA Genes used as internal references for stems and leaves.

[0010] In a preferred embodiment of the present invention, the ScTIP41 As an internal reference gene for roots, stems, and leaves.

[0011] In a preferred embodiment of the present invention, the functional gene expression analysis is performed by real-time quantitative qRT-PCR.

[0012] In a preferred embodiment of the present invention, an internal reference gene ScActin2 The primers for real-time quantitative qRT-PCR amplification are: F:ATGAATGCCGATACGCTGTT; R:TTGAACCTGTCCTTGGAGC.

[0013] In a preferred embodiment of the present invention, an internal reference gene ScTATA The primers for real-time quantitative qRT-PCR amplification are: F:CTGAAGTAAGGGTATCGTC; R:TTCTGTAATGTTGGGACTA.

[0014] In a preferred embodiment of the present invention, an internal reference gene ScTIP41 The primers for real-time quantitative qRT-PCR amplification are: F:TCTGATTCTGCTGCTTACA; R:TAGAGGTTACCAGGGACTT.

[0015] The beneficial effects of this invention are: (1) This invention selects 13 candidate internal reference genes with diverse functions (covering categories such as ribosomal proteins, cytoskeleton, and metabolism-related genes) to avoid screening bias caused by relying on a single type of gene and to provide a rich gene pool for subsequent stability analysis.

[0016] (2) Multi-algorithm comprehensive evaluation system: Combine the three mainstream internal reference gene evaluation software, geNorm, NormFinder and BestKeeper, and the RefFinder online integration tool to cross-validate the expression stability of candidate genes from different algorithm principles (geometric mean method, analysis of variance, correlation analysis, etc.), avoid the limitations of a single software, and improve the credibility of the screening results.

[0017] (3) The screened stable internal reference genes can serve as a reliable reference for the functional gene expression analysis of industrial hemp under waterlogging stress, providing key technical support for subsequent research such as the discovery of waterlogging-related functional genes and signal pathway analysis, and promoting molecular breeding research on stress resistance of industrial hemp. Attached Figure Description

[0018] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings: Figure 1 The results of agarose gel electrophoresis detection of total RNA from different tissues of industrial hemp under waterlogging stress are shown. A: "Yunma No. 7"; B: "Yunma No. 10"; M: DL2000 DNA Maker; RNA samples from roots under waterlogging stress 1–5 (0, 2, 4, 6, 8 days); RNA samples from stems under waterlogging stress 6–10 (0, 2, 4, 6, 8 days); RNA samples from leaves under waterlogging stress 11–15 (0, 2, 4, 6, 8 days). Figure 2 The results show the PCR amplification of the candidate internal reference gene in different tissues of industrial hemp, where A: root; B: stem; C: leaf; M: DL2000 DNA Maker; 1–12: Sc18S rRNA , ScUBQ , ScTUB , ScGAPDH , ScEF1α , ScPP2A , SceIF4E , ScTIP41 , ScTATA , ScF-box , ScSAND , ScActin2 ; Figure 3 Melting curves of candidate internal reference genes for industrial hemp under waterlogging stress; Figure 4 The Ct values ​​are for 10 candidate internal reference genes in different tissues of industrial hemp, where A: root; B: stem; C: leaf; Figure 5 Line graphs showing the stability of candidate internal reference genes in different tissues of industrial hemp, where A: root; B: stem; C: leaf; D: comprehensive analysis of root, stem, and leaf. Figure 6 To analyze the overall stability of candidate internal reference genes in different tissues of industrial hemp using RifFinder software, where A: root; B: stem; C: leaf; D: root-stem-leaf integrated analysis; Figure 7 Industrial hemp under the threat of flooding LOC115696956 Gene stability verification: The left image shows "Yunma No. 7", the right image shows "Yunma No. 10", A and B are roots, C and D are stems, E and F are leaves, and G and H are comprehensive verification of roots, stems and leaves. Figure 8 Industrial hemp under the threat of flooding LOC115695657 Gene stability verification: The left image shows "Yunma No. 7", the right image shows "Yunma No. 10", A and B are roots, C and D are stems, E and F are leaves, and G and H are a comprehensive verification of roots, stems and leaves. Detailed Implementation

[0019] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings, but the present invention is not limited thereto.

[0020] Example 1 The present invention discloses the screening and expression stability analysis of internal reference genes in different tissues of industrial hemp under waterlogging stress, including the following steps: 1. Material preparation and cultivation: The test materials were "Yunma No. 7" and "Yunma No. 10," provided by the Institute of Economic Crops, Yunnan Academy of Agricultural Sciences. Seeds were sown in plastic flowerpots with a planting substrate of peat moss:garden soil:perlite = 5:4:1 (v:v:v), and 10 g of compound fertilizer (N+P2O5+K2O≥38.0%) was added to each pot as base fertilizer. During the rapid growth period of industrial hemp (approximately 70 cm tall), the two hemp varieties were subjected to waterlogging stress using a "double-pot" method (a perforated flowerpot for waterlogging stress was placed inside a non-perforated flowerpot). Each treatment was replicated 12 times, with 6 plants per replicate. Water was added daily at 9:00 AM and 6:00 PM to achieve supersaturation of the soil moisture content, maintaining the water level 3 cm above the substrate surface. Simultaneously, samples were taken on days 0, 2, 4, 6, and 8 of waterlogging stress, selecting roots, stems, and leaves from both varieties as experimental materials. Three biological replicates were set for each variety at each time point. After sampling, the samples were quickly placed in liquid nitrogen for flash freezing and stored in an ultra-low temperature freezer at -80°C for later use.

[0021] 2. RNA extraction and cDNA synthesis: Total RNA was extracted from roots, stems, and leaves of 'Yunma 7' and 'Yunma 10' varieties at different time points under waterlogging stress treatment. 50–100 mg of each sample was weighed and ground into powder using liquid nitrogen. RNA extraction was performed using the TransZol Up Plus RNA Kit (TransGen Biotech Ltd.). RNA quality and concentration were detected by 1% agarose gel electrophoresis and a NanoReady 2000 micro spectrophotometer. The results are shown below. Figure 1 As shown, the 28S and 18S bands are clear and bright, with the 28S band being approximately twice as bright as the 18S band, indicating that the RNA has not been degraded and is of good quality. The A260 / A280 value is between 1.8 and 2.1, indicating high RNA purity and no protein contamination, suitable for subsequent experiments. cDNA reverse transcription was performed using the EasyScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit (TransGen Biotech Ltd.), following the instructions, and stored at -20°C.

[0022] 3. Primer synthesis: Selecting industrial hemp Sc18S rRNA , ScUBQ , ScTUB , ScGAPDH , ScEF1α , ScPP2A , SceIF4E , ScTIP41 , ScTATA , ScPCS1 , ScF-box , ScSAND , ScActin2 Thirteen genes were selected as candidate internal reference genes (Table 1), and primers were synthesized by Kunming Qingke Biotechnology Co., Ltd.

[0023] Table 1 Primer sequences of 13 candidate internal reference genes from industrial hemp

[0024] 4. Real-time quantitative qRT-PCR reaction The expression levels of the internal reference gene were detected using the Tap SYBR® Green qPCR Premix (Universal) kit (Jiangsu Bestway Biotechnology Co., Ltd.) on a Roche LightCycler® 96 real-time quantitative PCR instrument. The reaction system is shown in Table 2, the qPCR amplification program is shown in Table 3, and the melting curve was obtained using the instrument's default acquisition program. Each sample was replicated in triplicate.

[0025] Table 2 qPCR reaction system

[0026] Table 3 qPCR reaction procedure

[0027] 5. Primer specificity identification and amplification efficiency calculation Equal volumes of cDNA from different tissues (roots, stems, and leaves) of "Yunma 7" and "Yunma 10" were mixed on days 0, 2, 4, 6, and 8 of waterlogging stress. The resulting stock solution was then diluted 5 times. 0 5 1 5 2 5 3 5 4 qRT-PCR reactions were performed at multiples. The standard curve was plotted with the logarithm of the known serial dilution concentration on the x-axis and the corresponding Ct (cycle threshold) value on the y-axis, thus obtaining the slope (k) and its linear correlation coefficient (R²). 2 Amplification efficiency (E) is calculated using the formula E(%) = 10. -1 / k -1 is calculated.

[0028] The results showed that the amplification efficiency of 12 out of the 13 candidate genes was between 90% and 110%, and their linear correlation coefficient R was [missing value]. 2 All values ​​were above 0.99, indicating that these 12 primers had good amplification efficiency (Table 4). ScPCS1 The gene qRT-PCR results did not show a linear relationship and the amplification efficiency was less than 90%, so this candidate internal reference gene was removed.

[0029] Table 4. Amplification efficiency and correlation coefficient of candidate internal reference genes

[0030] The roots, stems, and leaves of the remaining 12 candidate internal reference genes were subjected to routine PCR electrophoresis detection, and the results are as follows: Figure 2 As shown, in the root ScUBQ and ScF-box Genes have multiple bands in the stem ScUBQ The gene bands are lighter in color and appear in the leaves. ScF-box The gene has two bands, so it is removed. ScUBQ and ScF-box Two candidate genes were identified. The target amplification bands of the remaining 10 candidate genes were clear and correct in size, and all had a single band position (100–250 bp), with no other non-specific bands. To further ensure the reliability of the data in subsequent analyses, the primer specificity of the remaining 10 candidate internal control genes was detected by real-time quantitative PCR. The results showed that the melting curves of the products of all 10 candidate internal control genes exhibited a clear single signal peak. Figure 3 The amplification curves show good repeatability and specificity, allowing for further experiments.

[0031] 6. Data Analysis 6.1 Expression analysis of candidate internal reference genes Based on the qRT-PCR detection results, box plots were generated for the Ct values ​​of candidate internal reference genes in different tissues of industrial hemp. Figure 4 The Ct values ​​of the 10 candidate internal reference genes in root tissue ranged from 21.45 to 31.98, showing a wide distribution. Among them, the expression level was most significantly affected by waterlogging stress treatment. ScTUB For genes, the difference between the maximum and minimum values ​​is 8.00, and the expression level is less affected in the genes with the following values: ScGAPDH The difference between the maximum and minimum values ​​of the gene is 2.55. Figure 4 -A). The Ct values ​​of 10 candidate internal reference genes in stem tissue ranged from 24.75 to 31.74, among which the expression level was most significantly affected by waterlogging stress treatment. Sc18S rRNA For genes, the difference between the maximum and minimum values ​​is 5.53, and the expression level is less affected in the genes with the following values: ScPP2A The difference between the maximum and minimum values ​​of the gene is 1.97. Figure 4 -B). The Ct values ​​of 10 candidate genes in leaf tissue ranged from 19.64 to 27.02, among which the expression level was most significantly affected by waterlogging stress treatment. ScGAPDH The gene with a maximum and minimum value differing by 5.84 indicates that its expression level is less affected. ScTATA The difference between the maximum and minimum values ​​of the gene is 3.07. Figure 4 -C).

[0032] 6.2 Analysis of expression stability of candidate internal reference genes in different tissues of industrial hemp under waterlogging stress 6.2.1 Analysis using geNorm software The geNorm software uses the M-value to screen for internal reference genes with good stability. When M < 1.5, it indicates stable gene expression; the smaller the M-value, the better the stability of the internal reference gene, and vice versa. (See Table 5 and...) Figure 5 It can be seen that the M values ​​of the 10 candidate internal reference genes in different tissues are all less than 1.5, which meets the requirements for stable expression of internal reference genes. Among them, in the root tissue of industrial hemp... SceIF4E and ScActin2 Gene expression stability is the best. ScGAPDH Gene expression stability is the worst. In stem tissues... ScTATA and ScSAND Gene expression stability is the best. ScActin2 Gene expression stability is the worst. In leaf tissues... ScPP2A and ScTATA Gene expression stability is the best. ScGAPDH Gene expression stability is the worst. Considering the root, stem, and leaf tissues... SceIF4E and ScTIP41 Gene expression stability is the best. Sc18S rRNA Gene expression stability is the worst.

[0033] Table 5. Average expression stability values ​​of internal reference genes analyzed by geNorm software.

[0034] 6.2.2 NormFinder Software Analysis The NormFinder software, similar to the geNorm software, obtains the expression stability value (S) of the internal reference gene by comparing the expression differences and inter-group variations of candidate internal reference genes. The internal reference gene with the smallest S value is the most suitable internal reference gene. The analysis results (Table 6) show that under waterlogging stress, among the 10 candidate genes... ScActin2 Genes are most stable in the root tissue of industrial hemp. SceIF4E The gene is most stable in the stem tissue of industrial hemp. ScTATA Genes are most stable in the leaf tissue of industrial hemp. A comprehensive analysis of the root, stem, and leaf tissues... ScTIP41 Genes are the most stable.

[0035] Table 6. Expression stability values ​​(S) of internal reference genes analyzed by NormFinder software.

[0036] 6.3.3 BestKeeper Software Analysis BestKeeper software analysis calculates the standard deviation (SD) and correlation coefficient (CV) of the internal reference genes based on their Ct values, and uses these to assess the stability of each internal reference gene. Lower SD and CV values ​​indicate greater stability of the internal reference gene. The BestKeeper software analysis results (Table 7) show that under waterlogging stress, in the root tissue of industrial hemp... ScGAPDH The gene had a SD and CV of 0.45 and 1.46, respectively, indicating the most stable expression. In industrial hemp stem tissue... ScTATA The gene had a SD and CV of 0.41 and 1.54, respectively, indicating the most stable expression. In industrial hemp leaf tissue... ScTATA The gene had a SD and CV of 0.66 and 2.66, respectively, indicating the most stable expression. Meanwhile, ScTATA The gene was also the most stable gene after comprehensive analysis of the root, stem, and leaf tissues, with SD and CV values ​​of 1.06 and 4.07, respectively.

[0037] Table 7 Stability analysis of internal reference genes in BestKeeper software

[0038] 6.3.4 Comprehensive Analysis of RifFinder Software The RifFinder software integrates multiple algorithms, including geNorm, NormFinder, and BestKeeper, to rank the overall stability of candidate internal reference genes. The results are as follows: Figure 6 As shown, the expression stability of 10 candidate internal reference genes in industrial hemp root tissues under waterlogging stress was ranked as follows: ScActin2>ScEF1α>ScTIP41>SceIF4E>Sc18S rRNA> ScSAND>ScTATA>ScGAPDH>ScPP2A>ScTUB ( Figure 6 -A); its order in stem tissue is: ScTATA>SceIF4E> ScSAND>ScPP2A>ScTUB>ScTIP41>ScGAPDH>ScEF1α>Sc18S rRNA>ScActin2 ( Figure 6 -B); its order in leaf tissue is: ScTATA>ScPP2A>ScEF1α>ScTIP41>ScSAND>ScActin2>ScTUB>Sc18S rRNA> SceIF4E>ScGAPDH ( Figure 6 -C); The overall order of the root, stem, and leaf tissues is: ScTIP41>ScSAND>ScEF1α> ScPP2A>ScTUB>ScTATA>Sc18S rRNA>ScActin2>SceIF4E>ScGAPDH ( Figure 6 -D).

[0039] 7. Stability verification of the internal reference gene To further verify the stability of the screened internal reference genes, this study used two relatively stable internal reference genes from the root tissue of industrial hemp under waterlogging stress. ScActin2 and ScEF1α And the most unstable internal reference gene ScTUB Two relatively stable internal reference genes in stem tissue ScTATA and SceIF4EAnd the most unstable internal reference gene ScActin2 Two relatively stable internal reference genes in leaf tissue ScTATA and ScPP2A And the most unstable internal reference gene ScGAPDH Two relatively stable internal reference genes from the root, stem, and leaf tissues were combined. ScTIP41 and ScSAND And the most unstable internal reference gene ScGAPDH These genes were identified as being related to two flood-tolerant genes screened from the transcriptome sequencing results of industrial hemp under previous flood stress. LOC115696956 and LOC115695657 (Table 8) shows the relative expression levels of the target gene. LOC115696956 Belonging to the ERF family of genes, this gene acts on chloroplasts and encodes photosystem I chlorophyll a / b binding protein 5. (Target gene) LOC115695657 It belongs to the NF-YB family of genes and encodes the protein MIZU-KUSSEI 1. Both are related to photosynthesis and are associated with waterlogging stress in industrial hemp.

[0040] The verification results are as follows Figure 7 and Figure 8 As shown, when using the two most stable internal reference genes selected from different tissues of roots, stems, and leaves, as well as the combined analysis of roots, stems, and leaves, as standardized internal reference genes, LOC115696956 Genes and LOC115695657 The expression levels and trends of the two target genes in different tissues of “Yunma 7” and “Yunma 10” were similar. However, when the most unstable internal reference gene was used as the standardized internal reference gene for verification, the relative expression levels of the two target genes in “Yunma 7” and “Yunma 10” changed significantly, and their expression trends showed excessively high or low values ​​at different time points.

[0041] Table 8 Primer sequences for flood-resistant target genes

[0042] Conclusion: This study used qRT-PCR combined with geNorm, NormFinder, BestKeeper, and RefFinder software to screen and analyze the expression stability of internal reference genes in different tissues of industrial hemp under waterlogging stress. The results showed that the optimal internal reference gene in roots was [missing information]. ScActin2 The optimal internal reference gene for stems and leaves is ScTATA The optimal internal reference gene for the root, stem, and leaf tissues is... ScTIP41 This study provides an internal reference gene selection method for analyzing the expression of functional genes in industrial hemp under waterlogging stress.

Claims

1. Internal reference genes in different tissues of industrial hemp under waterlogging stress, including ScActin2 , ScTATA and ScTIP41 Three types of genes.

2. The internal reference gene described in claim 1 is used as a reference for the functional gene expression analysis of industrial hemp under waterlogging stress.

3. The application according to claim 2, wherein... ScActin2 Internal reference genes as roots.

4. The application according to claim 2, wherein ScTATA Genes used as internal references for stems and leaves.

5. The application according to claim 2, wherein... ScTIP41 As an internal reference gene for roots, stems, and leaves.

6. In the application according to claim 2, the functional gene expression analysis is performed by real-time quantitative qRT-PCR.

7. The application according to claim 6, the internal reference gene ScActin2 The primers for real-time quantitative qRT-PCR amplification are: F:ATGAATGCCGATACGCTGTT; R:TTGAACCTGTCCTTGGAGC.

8. The application according to claim 6, the internal reference gene ScTATA The primers for real-time quantitative qRT-PCR amplification are: F:CTGAAGTAAGGGTATCGTC; R:TTCTGTAATGTTGGGACTA.

9. The application according to claim 6, the internal reference gene ScTIP41 The primers for real-time quantitative qRT-PCR amplification are: F:TCTGATTCTGCTGCTTACA; R:TAGAGGTTACCAGGGACTT.

Images