Therapeutic treatments for aging-associated neurodegenerative diseases and disorders
A combination of OXT and GnRH, along with hypothalamic stem cell-derived vesicles, offers a synergistic therapeutic approach for aging-related neurodegenerative diseases, effectively reducing symptoms and reversing pathological changes in Alzheimer's Disease models.
Patent Information
- Application Number
- PCT/US2025/046201
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-16
- Filing Date
- 2025-09-12
- Publication Date
- 2026-03-19
AI Technical Summary
Current treatments for aging-associated neurodegenerative diseases, such as Alzheimer's Disease, are inadequate, with individual neuropeptides like OXT and GnRH showing limited effectiveness, and the synergistic potential of these peptides for therapeutic benefits remains unexplored.
A combination therapy using oxytocin (OXT) and gonadotropin-releasing hormone (GnRH) is administered to synergistically treat aging-related neurological diseases, supported by the administration of hypothalamic neural/progenitor stem cell-derived extracellular vesicles (htNSC EVs) containing parathymosin (PTMS), which are effective in reducing symptoms and preventing disease progression.
The OXT-GnRH combination therapy demonstrates a synergistic effect in reversing neurological symptoms and reducing amyloid plaques, with htNSC EVs and PTMS-containing vesicles providing significant therapeutic benefits in animal models of Alzheimer's Disease.
Smart Images

Figure US2025046201_19032026_PF_FP_ABST
Abstract
Description
THERAPEUTIC TREATMENTS FOR AGING-ASSOCIATED NEURODEGENERATIVE DISEASES AND DISORDERSCROSS REFERENCE TO RELATED APPLICATIONSThis application claims priority to U. S. Provisional Application 63 / 694,987 filed on September 16, 2024, which is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH & DEVELOPMENTThis invention was made with government support under AG031774 awarded by The National Institutes of Health. The government has certain rights in the invention.INCORPORATION OF ELECTRONICALLY FILED MATERIALThe Instant Application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 11, 2025 is named “EIC0081PCT” and is 47,592 bytes in size.BACKGROUND
[0001] Aging drives fundamental biological changes that predispose the nervous system to neurodegenerative disorders, including Alzheimer’ s Disease (AD) and related dementias. Intriguingly, the nervous system itself has been implicated as a key regulator of organismal aging across multiple species, from the nematode Caenorhabditis elegans and fruit fly Drosophila melanogaster to mammalian. Among mammalian brain regions, the hypothalamus has emerged as a pivotal regulator of whole-body aging. It integrates diverse environmental and physiological signals and orchestrates endocrine and autonomic responses that impact aging and longevity. Despite these advances, the contribution of the hypothalamus to brain aging and neurodegenerative disease mechanisms remains poorly understood.
[0002] Aging research during the past years has led to many understandings on age-related DNA methylation changes and notably the discovery of DNA methylation clocks. It remains unknown if profiling age-related DNA methylation in the hypothalamus versus other brain regions could lead to a target for much needed therapeutic treatments for aging- associated neurodegenerative diseases such as AD.BRIEF SUMMARY OF THE INVENTION
[0003] This disclosure meets the need above for a therapeutic treatment for aging-associated neurodegenerative diseases.
[0004] OXT and GnRH are two hypothalamic neuropeptides that regulate reproductive physiology. However, whether these peptides interact within the central nervous system remains unknown. Through analyzing age-related DNA methylation in the hypothalamus and other brain regions and following observations that OXT and GnRH were co-downregulated at the gene transcriptional levels in an aging-related AD model, new treatments for addressing aging-related neurological diseases were discovered, based on a combination of OXT and GnRH. These neuropeptides, provided in combination, were surprisingly found to synergistically provide a strong effect for treating an AD model.
[0005] A few recent studies have suggested that OXT may improve cognition and reduce amyloid-P accumulation in rodent models; however, it remained unclear whether OXT alone could effectively treat AD. The present study demonstrates that OXT alone is not effective for treating AD in animal models. Further, although earlier work suggested that GnRH may help slow normal aging and was suggested as a factor to aid in the treatment of Down syndrome (a congenital disease not related to aging or age-related neurodegeneration), this study indicates that GnRH alone is insufficient to treat AD in animal models. In view of these results, a combination of OXT and GnRH was tested and found to exert a synergistic effect, leading to an effective therapy against AD.
[0006] The molecular mechanisms or mediators of such potential interactions, as well as the possibility that downstream effectors could be developed as therapeutic targets for AD, have not been explored. There was no prior knowledge regarding whether OXT and GnRH can act synergistically to protect neurological function, what the downstream mechanisms or effectors might be, or whether this interaction and downstream mediators could lead to novel strategies and therapeutic targets for treating aging-related neurological diseases such as AD.
[0007] Also described herein is a cellular mechanism showing that an OXT- GnRH combination is required to restore hypothalamic neural / progenitor stem cells (htNSCs) and secretion of extracellular vesicles (EVs) derived from these cells (termed htNSC EVs) were confirmed to have a therapeutic effect for treating AD based on multiple animal models including amyloid beta (A|3) pathology 5xFAD model and tau pathology P301S model.
[0008] Further, a molecular mechanism was discovered, showing that parathymosin (PTMS) is contained in htNSC EVs, and that PTMS is important for the therapeutic of these EVs for treating aging-related neurodegenerative disease and AD in animal models.
[0009] Therefore, in an aspect, a method of treating a subject with an aging- related neurological disease or disorder, comprises administering to the subject a therapeutically effective amount of a composition comprising a combination of oxytocin (OXT) and gonadotropin-releasing hormone (GnRH), in an amount effective to reduce or reverse the aging-related neurological disease or disorder, and wherein the administering reduces at least one symptom of the aging-related neurological disease or disorder, or prevents advancement of the aging-related neurological disease or disorder, in the subject.
[0010] In another aspect, a method of treating a subject with an aging-related neurological disease or disorder, comprises administering to the subject a dose of EVs derived from native htNSCs, or derived from a native or cultured cell that resembles a htNSC, for example a reprogram-induced htNSC-like cell derived by converting or reprogramming a mature non neural cell, a neural cell, or an induced neural stem cell (iNSC), in an amount effective to reduce or reverse the aging-related neurological disease or disorder, and wherein the administering reduces at least one symptom of the aging-related neurological disease or disorder, or prevents advancement of the aging-related neurological disease or disorder, in the subject. By ‘native’ is meant the natural, unmodified cell as it exists inside the body. By ‘cultured cell’ is meant cells that have been grown and maintained outside of their original organism.
[0011] In one aspect, a method of treating a subject with an aging-related neurological disease or disorder, comprises administering to the subject a dose of PTMS- containing or PTMS-loaded vesicles (such as EVs, exosomes, microvesicles, nanoparticles or other synthetic vesicles), in an amount effective to reduce or reverse the aging-related neurological disease or disorder, and wherein the administering reduces at least one symptom of the aging-related neurological disease or disorder, or prevents advancement of the aging- related neurological disease or disorder, in the subject.
[0012] In another aspect, a composition comprising OXT, an analog or variant thereof, GnRH, an analog or variant thereof, EVs derived from native htNSCs or from a cell that resembles htNSC reprogrammed or induced to produce EVs, and PTMS-containing vesicles, or any combination thereof, for treating an agin -related neurological disease or disorder.
[0013] In another aspect, a pharmaceutical dosage form comprising OXT, an analog or variant thereof, and GnRH, an analog or variant thereof. In one aspect, the pharmaceutical dosage form comprises 0.1 to 1000 micrograms each of OXT and GnRH, or 1 to 500 micrograms each of OXT and GnRH, or 1 to 50 micrograms each of OXT and GnRH.
[0014] In one aspect, a method of treating a neurodegenerative disease comprising administering a therapeutically effective amount of OXT and GnRH to a patient in need of such treatment. In one aspect, the neurodegenerative disease is Alzheimer’ s dementia, age-related cognitive decline, frontal cortex dementia, or Lewy body dementia. In one aspect, the therapeutically effective amount comprises 0.1 to 1000 micrograms each of OXT and GnRH, or 1 to 500 micrograms each of OXT and GnRH, or 1 to 50 micrograms each of OXT and GnRH. In another aspect, the OXT and GnRH are administered together, either in the same dosage form or in separate dosage forms but at the same time (within one hour). In another aspect, the OXT and GnRH are administered sequentially. In yet another aspect, the OXT and GnRH are both administered at least once per month, once per week, twice per week, or daily. In one aspect, the OXT and GnRH are administered by injection.BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGs. 1A-B show general information based on age-related differential methylation regions (DMRs) of genomic DNA in multiple brain regions. DMRs in the hypothalamus (HT), hippocampus (HC), and olfactory bulb (OB) between 2 and 12 months of age were calculated per DNA length of 500 pair-bases, with at least 10% of total regional methylation difference with q< 0.05 (false discovery rate, FDR). (A) Venn Diagram plot for numbers of the underlying genes per age-related DMRs that are either common or unique among HT, HC, and OB. (B) A total of 173 common genes per age-related DMRs among HT, HC and OB were processed with KEGG pathway analysis and grouped according to functions. The left Y axis and bar graphs indicate the numbers of genes, and the right Y axis and dots indicate p values in the logarithm. All analyses were based on n - 3 independent animals for each age and tissue type, Fisher’s Exact test, and data were based on FDR values of less than 0.05.
[0016] FIG. 2 shows age-related DMRs in co-components versus individual components within OXT signaling pathway and GnRH signaling pathway in the hypothalamus (HT), hippocampus (HC), and olfactory bulb (OB). The size of each circle indicates the levels of hypermethylation or hypomethylation. All analyses were based on n =3 independent animals for each age and tissue type, statistics: logistic regression with MethylKit; all computations and data were based on q<0.05.
[0017] FIGs. 3A-B show aging-associated GnRH and OXT gene methylation profiles. Differentially methylated cytosines (DMCs) were analyzed in BOCS metadata (see the methods in the section of non-limiting examples) covering OXT gene (A) and GnRH gene (B) for the hypothalamic samples of mice between 2 months and 12 months of age. The analysis was based on logistic regression with MethylKit and false discovery rate was set as q < 0.05. The graphs present the DMCs with at least 1% methylation difference, and genomic positions of cytosines are labelled in the Y axis.
[0018] FIGs. 4A-B show co-downregulation of GnRH and OXT gene transcription in middle age or 5xFAD model. The mRNA levels of expressing OXT and GnRH were measured for hypothalamic tissues from male C57BL / 6 mice under middle age (15 months old) vs. young age (2 months old) (A) and from male 5xFAD mice vs. male littermate wildtype (WT) control at the age of 8 months (B). Statistics: **p<0.01, ***p<0.001, n = 5 independent mice per group, two-tailed unpaired student t-test. Data are expressed as mean ± SEM.
[0019] FIG. 5 shows a computational model of OXT and GnRH co-signaling network. A computational model of the protein-protein interaction (PPI) between the OXT signaling pathway and the GnRH signaling pathway was developed with the Cytoscape program.
[0020] FIGs. 6A-C show Adcy family gene methylation and transcription in middle age or 5xFAD model. (A) Diagrams represent the promoter regions and subregions of Adcy genes for age-related methylation difference in the hippocampus. The comparisons were based on average methylation levels in each promoter region or subregion in mice between middle age (12 months old) and young age (2 months old). The promoters were divided into CG island, distal subregion, and proximal subregion. The statistical significance was determined using a t-test, and p-values are given in the graphs, with n = 3 independent mice per group. (B, C) The mRNA levels of Adcy genes in hippocampal tissues were obtained from male C57BL / 6 mice under middle age (15 months old) vs. young age (2 months old) (B) and from male 5xFAD mice vs. male littermate wildtype (WT) control at the age of 8 months (C). *p<0.05, **p<0.01, ***p<0.001, n = 5 independent mice per group, two-tailed unpaired student t-test. Data are expressed as mean ± SEM.
[0021] FIGs. 7A-H show the strong and synergistic effects of OXT-GnRH treatment on physiological disorders in 5xFAD model. Male 5xFAD mice (9 months old)received 2-month OXT (50 ng) and GnRH (5 ng) treatment individually or in combination vs. vehicle control through daily nasal administration and were subsequently examined for a battery of neurobehavioral assays. Results demonstrated body weight (A), locomotion in open field test (B), muscle strength in grip test (C), cognitive function in Y-maze test (D), novel object recognition in novel object test (E), social function in sociality test (F), and spatial learning / memory function in Morris Water Maze (MWM) test (G-H) which consisted of 5-day training session followed by probe test while swimming speed in the probe trial was provided as a technical control. *p<0.05, **p<0.01, ***p<0.001, compared between the indicated groups (A-F, H) and between combinational treatment and vehicle control (G), ANOVA and Tukey post-hoc test, n = 10 independent mice per group. Data are expressed as mean ± SEM.
[0022] FIGs. 8A-D show the effects of OXT-GnRH treatment on eliminating amyloid P (AP) plaques in 5xFAD model. Aged male 5xFAD mice received 2-month OXT and GnRH treatment individually or in combination vs. vehicle control, as detailed in Fig. 7. At the end of neurobehavioral tests, subgroups of mice were processed for brain sections and AP immunostaining. (A) Representative AP immunostaining in the hippocampal subregions CAI, CA3 and dentate gyrus (DG)-. Bar, 100 pm. Individual peptide treatments had no or modest effects and were not shown. (B)-(D) Quantification of amyloid P plaques in the indicated brain areas. ***p<0.001, two-tailed Student t’s test, n = 5 independent mice per group. Data are expressed as mean ± SEM.
[0023] FIGs. 9A-B show the synergistic effects of OXT and GnRH on Adcy gene methylation in 5xFAD model. Following the completion of therapeutic study in Fig. 7, DNA samples were obtained from the hippocampus of animals for target bisulfite sequencing assay focusing on the proximal promoter regions of Adcy genes, represented by Adcy7 (A) and Adcy9 (B). Cytosine positions per reference mouse genome are given in the x-axis. Circle size reflects the magnitude of methylation, empty circles indicating hypomethylation, solid circles indicating hypermethylation. All analyses were based on n = 5 mice per group, statistically via logistic regression with MethylKit (two-sided test), and all data were based on q < 0.05.
[0024] FIGs. 10A-B show the synergistic effects of oxytocin-GnRH combination for treating female 5xFAD model. Female 5XFAD mice received 2-month OXT (3 pg / kg) and GnRH (0. 1 pg / kg) combinational treatment compared to oxytocin treatment alone (3 pg / kg) and vehicle control through tail vein injection. Data show Morris Water Maze (MWM) test containing training (A) and probe trial (B). Statistics: *p<0.05, **p<0.01,compared between treatment group vs. control or OXT group, n = 9 independent mice per group, and ANOVA and Turkey’s post hoc test. Data are expressed as mean ± SEM.
[0025] FIG. 11 shows co-expression of OXT receptor and GnRH receptor in htNSCs. Hypothalamic brain sections from standard C57BL / 6 mice were immunostained for OXT receptor and GnRH receptor, together with the neural stem cell marker Nestin to identify htNSCs. Scale bar, 50 pm.
[0026] FIGs. 12A-B show deficient htNSCs and htNSC-derived EVs in 5xFAD model. (A) Brain sections from male 5xFAD mice and age-matched WT littermates (5 months old) were immunostained with Nestin for htNSCs. Scale bar = 100 pm. Additional data (not shown) indicate that cell senescence is a major cause for reduced htNSCs in 5xFAD model. (B) Regional htNSCs were isolated from new-born 5xFAD pups and littermate wildtype (WT) controls, cultured through selection medium, and examined for EVs released by the same number of cells into an EV-free medium over 48 hours. Statistics: *p<0.05, **p<0.01, ***p<0.001, n = 3 independent samples per group, two-tailed Student t’s test. Data are expressed as mean ± SEM.
[0027] FIGs. 13A-B show the synergistic effects of OXT-GnRH treatment on htNSC rejuvenation in 5xFAD mice. Male 5xFAD mice (9 months old) received daily intranasal administration of OXT (50 ng), GnRH (5 ng), or the combination for 2 months, with vehicle-treated mice as controls. Following treatment, hypothalamic brain sections were immunostained for Nestin to identify htNSCs (A). Nestin expression levels were quantified and are presented as bar graphs (B). Statistics: **p<0.01, ***p<0.001, ANOVA with Tukey post-hoc test; n = 5 mice per group. Data are expressed as mean ± SEM.
[0028] FIGs. 14A-B show the synergistic effects of OXT-GnRH combination on htNSC EVs. (A-B) In vitro htNSCs were treated with OXT (100 nM), GnRH (0 nM), or the combination vs. vehicle, and examined for EV secretion (A) and EV biogenesis (B). Statistics: ****p<0.0001, ANOVA with Tukey post-hoc test; n = 5-17 samples per group. Data are expressed as mean ± SEM.
[0029] FIGs. 15 A-B show the effects of htNSC EVs for treating AD using two AD models (including A[3 pathology 5xFAD model and tau pathology P301S model). (A) Male 5xFAD mice (about8 months old) were implanted with a cannula targeting the hypothalamic third ventricle. After a 2-week recovery, mice received htNSC EVs (100 ng) or vehicle via the cannula 3 times per week for 4 months before neurobehavioral assays. (B) Tau pathology model P301S mice (4-month-old male) were intra-nasally treated with htNSC EVs (1 pg) vs. vehicle (Veh), 3 times per week for 2 months and tested for neurobehavioralfunctions. Statistics: *p<0.05, **p<0.01, ***p < 0.001, 2-tailed unpaired t-test, n = 6-7 mice / group. Data are expressed as mean ± SEM.
[0030] FIG. 16 shows the presence of PTMS in htNSC EV subpopulations. (A) EVs were collected from the in vitro culture model of htNSCs and analyzed by nano-flow cytometry for PTMS and canonical EV tetraspanins (CD63, CD81). (B) EVs were released from htNSCs expressing HA-tagged PTMS, harvested and purified for co-immunostaining of HA and PTMS. Scale bar, 1 pm.
[0031] FIG. 17 shows reductions in PTMS-positive EVs in the hypothalamic cerebrospinal fluid (CSF) of 5xFAD model. The CSF samples from male 5xFAD mice and littermate WT controls (5 months old) were analyzed for PTMS-positive EVs via nano flow cytometry according to subpopulations expressing tetraspanins (CD9, CD63, CD81). Statistics: **p < 0.01, ***p < 0.001, two-tailed unpaired Student’s t-test; n = 6 mice per group. Data are expressed as mean ± SEM.
[0032] FIGs. 18A-G show the anti-neurodegenerative role of PTMS and the contribution by htNSCs. (A-C) Nissl staining of brain sections from aged male PTMS-KO and littermate wildtype (WT) mice (24 months old), showing representative images of parietal cortex (A), while quantification of parietal cortical thicknesses (B) and hippocampal CAI thicknesses (C) in young (4 months old) and aged (24 months old) PTMS-KO and WT controls is presented. Scale bar, 0.5 mm. Statistics: *p < 0.05, **p < 0.01, ANOVA with Tukey’s post hoc test; n = 4 mice per group; data are presented as mean ± SEM. (D-G) Middle-aged PTMS-KO male mice (15 months old) received intra-cerebroventricular (i.c.v.) administration of 100 ng purified EVs derived from WT htNSCs (labelled as WT EVs) compared with EVs from PTMS-KO htNSCs (labelled as KO EVs), which were derived from WT mice and PTMS-KO mice, respectively. Vehicle administration provides basal control. The administration was through pre-implanted cannulas in the third ventricle of the brain. Treatments were administered three times per week for 3 months. After treatment, mice were evaluated for neurobehavioral assays including Morris Water Maze (MWM) training (D) and probe test (E), and subsets of mice were used for brain immunostaining of DNA damage marker pH2A.X, quantified and represented by parietal cortex (F) and hippocampal CA3 region (G). Scale bar, 25 pm. Statistics: *p < 0.05, **p < 0.01, ***p < 0.001; two-tailed unpaired Student’s t-test, n = 4 mice per group (B, C); ANOVA with Tukey’s post hoc test, n = 9-10 mice per group (D-E), and n = 5 mice per group (F-G). Data are expressed as mean ± SEM.
[0033] FIGs. 19A-F show that PTMS-dependent therapy against neurodegeneration in 5xFAD model by htNSC EVs. Male 5xFAD mice and littermate WT control mice (5 months old) were treated intranasally on a daily basis for 6 weeks with either vehicle or 1 pg purified EVs derived from WT htNSCs (labelled as WT EVs) compared with EVs from PTMS-KO htNSCs (labelled as KO EVs), which were derived from WT mice and PTMS-KO mice, respectively. Vehicle administration provides basal control. During the final 2 weeks of treatment, mice were subjected to neurobehavioral assays, including Y maze (A), novel object recognition (B), social interaction function (C), and Morris Water Maze (MWM) training (D) and probe trial (E, F). Statistics: *p < 0.05, **p < 0.01, ***p < 0.001, ANOVA with Tukey’s post hoc test n = 8-9 mice per group. Data are expressed as mean ± SEM.
[0034] FIGs. 20 A-C show that PTMS-dependent effect of htNSC EVs in protecting neuronal damage in 5xFAD model. At the end of study in Fig 19, subsets of mice were used for immunostaining of DNA damage marker pH2A.X, showing representative images of the hippocampal CA3 subregions (A), and quantification of hippocampal CA3 (B) and parietal cortex (C). Scale bar, 25 pm. Statistics: *p < 0.05, **p < 0.01, ***p < 0.001, ANOVA with Tukey’s post hoc test, n = 4 mice per group (E). Data are expressed as mean ± SEM.
[0035] The above-described and other features will be appreciated and understood by those skilled in the art from the following detailed description, drawings, and appended claims.DETAILED DESCRIPTION
[0036] The disclosure provides compositions and methods of treatment for a neurological aging-related disease.
[0037] Age-related DNA methylation changes were modeled in the hypothalamus of standard mice and comparatively analyzed versus the hippocampus, two major components in the limbic system, with the hippocampus known as a key target in aging disorders and especially aging -related neurodegenerative diseases. In addition, the modeling included the olfactory bulb (OB), another limbic system component, the function of which differs from the endocrine regulation by the hypothalamus or the cognitive regulation by the hippocampus. Surprisingly, comparative modeling revealed that age-related DNA methylation changes in these different brain regions commonly involved various hypothalamic endocrine pathways, notably hypothalamic neuropeptide oxytocin (OXT) and gonadotropin-releasing hormone (GnRH) pathways. In this background, using an aging-related Alzheimer's disease (AD) model (5xFAD mice), results suggested that downregulation in Oxt and Gnrh pathways are similarly significant in this disease. This led to a study to compare OXT-GnRH combinational treatment vs. individual peptide treatment in a 9-month-old 5xFAD mouse model with strong manifestation of AD phenotypes. In contrast to absent or modest effects from either single peptide treatment, results indicate that the OXT-GnRH combinational treatment had a strong and synergistic effect against various neurological disorders (including locomotive, cognitive, leaming / memory, and social disorders). In addition, the treatment led to a nearly complete reversal of amyloid plaques (Ap) deposition. Taken together, compared to single peptide treatment, OXT-GnRH combinational therapy had an important synergy and strong effectiveness in treating AD and related neurological problems .
[0038] The inventors have surprisingly discovered that administering a combination of OXT-GnRH composition as compared to administering OXT or GnRH alone had a synergistically positive effect on physiological symptoms of an aging-related neurological disease as well as a reduction in the number of amyloid plaques in the brain. These effects were not merely additive but synergistic, as the combined action of the two peptides produced significantly greater effects than the sum of their individual actions, and in many cases, individual peptides had no observable effect, whereas their combination led to robust therapeutic effect. In addition, this synergy was further supported by two-way ANOVA, which confirmed a significant interaction between OXT and GnRH. Pharmaceutical compositions and dose formulations relating to use of the combinations described herein are also provided.
[0039] Definitions
[0040] As used herein, the articles “a” and “an” refer to one or to more than one (e.g., to at least one) of the grammatical object of the article.
[0041] The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless context clearly indicates otherwise.
[0042] “About” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values.
[0043] By “a combination” or “in combination with,” it is not intended to imply that the therapy or the therapeutic agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scopedescribed herein. The therapeutic agents in the combination can be administered concurrently with, prior to, or subsequent to, one another. The combination can be administered concurrently with, prior to, or subsequent to one or more other additional therapies or therapeutic agents. The therapeutic agents or therapeutic protocol can be administered in any order. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent. It will further be appreciated that the additional therapeutic agent utilized in this combination may be administered together in a single composition or administered separately in different compositions. In general, it is expected that additional therapeutic agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower or higher than those utilized individually.
[0044] In certain embodiments, the concentration of the first therapeutic agent that is required to achieve a positive effect, e.g., reduction of neurological disease, or reduction of disease symptoms, or improvement of an aging-related neurological disease, is lower when the first therapeutic agent is administered in combination with the second therapeutic agent than when the first therapeutic agent is administered individually. In certain embodiments, in a combination therapy, the concentration of the second therapeutic agent that is required to achieve a positive effect, e.g., reduction of neurological disease, or reduction of disease symptoms, is lower than the therapeutic dose of the second therapeutic agent as a monotherapy, e.g., 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% lower. In certain embodiments, in a combination therapy, the concentration of the first therapeutic agent that is required to achieve a positive effect, e.g., reduction of neurological disease, or reduction of disease symptoms, is lower than the therapeutic dose of the first therapeutic agent as a monotherapy, e.g., 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% lower.
[0045] The "blood-brain barrier", or BBB refers to the physiological barrier between the peripheral circulatory system and the brain and spinal cord, formed by tight contacts in the plasma membrane of the endothelium of the capillaries of the brain, which create a dense barrier that restricts the transport of molecules to the brain, even small molecules such as urea (60 Daltons ). The BBB in the brain, the blood-spinal barrier in the spinal cord, and the hematoretinal barrier in the cornea constitute a continuous barrier between capillary blood and the CNS and are collectively referred to herein as the bloodbrain barrier, or BBB. The BBB also encompasses the blood-brain barrier (choroid plexus), where the barrier consists of ependymocytes rather than capillary endothelial cells.
[0046] The term “improvement of an aging-related neurological disease” refers to a biological effect which can be manifested by various means, including but not limited to, e.g., an amelioration of various physiological symptoms associated with the disease condition, such as body weight, locomotion or spontaneous activity, improved motor function, improved neuropsychiatric behavior, improved neuromuscular integrity, improved spatial memory, improved spatial learning, improved socialization, improved working memory function, improved social interaction, improved recognition memory.
[0047] As used herein, the terms “treat,” “treatment” and “treating” denotes a clinical intervention in an attempt to alter the natural course of a disease in an individual or subject receiving treatment, and can be carried out for both prevention and the presence of a pathological condition. Desirable effects of the treatment include, but are not limited to, preventing the onset or recurrence of the disease, reduction or amelioration of the progression, severity and / or duration of a disease or disorder, e.g., a neurological disease or disorder, or the amelioration of one or more symptoms (preferably, one or more discernible symptoms) of the disorder resulting from the administration of one or more therapies, reducing any direct or indirect pathological or physiological consequences of the disease, and remission or improved prognosis. In specific embodiments, the terms “treat,” “treatment” and “treating” refer to the amelioration of at least one measurable physical parameter of an aging- related neurological disease or disorder not necessarily discernible by the patient. In other embodiments the terms “treat,” “treatment” and “treating” refer to the inhibition of the progression of an aging -related neurological disease or disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both. In other embodiments the terms “treat,” “treatment” and “treating” refer to the reduction or stabilization of amyloid plaques.
[0048] The compositions, formulations, and methods of the present invention encompass polypeptides and nucleic acids having the sequences specified, or sequences substantially identical or similar thereto, e.g., sequences at least 85%, 90%, 95% identical or higher to the sequence specified. In the context of an amino acid sequence, the term “substantially identical” is used herein to refer to a first amino acid that contains a sufficient or minimum number of amino acid residues that are i) identical to, or ii) conservative substitutions of aligned amino acid residues in a second amino acid sequence such that the first and second amino acid sequences can have a common structural domain and / or common functional activity. For example, amino acid sequences that contain a common structuraldomain having at least about 85%, 90%. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to a reference sequence, e.g., a sequence provided herein.
[0049] In the context of nucleotide sequence, the term “substantially identical” is used herein to refer to a first nucleic acid sequence that contains a sufficient or minimum number of nucleotides that are identical to aligned nucleotides in a second nucleic acid sequence such that the first and second nucleotide sequences encode a polypeptide having common functional activity, or encode a common structural polypeptide domain or a common functional polypeptide activity. For example, nucleotide sequences having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to a reference sequence, e.g., a sequence provided herein.
[0050] The term “functional variant” refers to polypeptides that have a substantially identical amino acid sequence to the naturally-occurring sequence, or are encoded by a substantially identical nucleotide sequence, and are capable of having one or more activities of the naturally-occurring sequence.
[0051] Calculations of homology or sequence identity between sequences (the terms are used interchangeably herein) are known in the art.
[0052] The nucleic acid and protein sequences described herein can be used as a “query sequence” to perform a search against public databases, for example, to identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs and others as known to those with skill in the art.
[0053] It is understood that the molecules of the present invention may have additional conservative or non-essential amino acid substitutions, which do not have a substantial effect on their functions.
[0054] The term “amino acid” is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids. Exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing. As used herein the term “amino acid” includes both the D- or L-optical isomers and peptidomimetics.
[0055] A “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g.,aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0056] The terms “polypeptide,” “peptide” and “protein” (if single chain) are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. The polypeptide can be isolated from natural sources, can be produced by recombinant techniques from a eukaryotic or prokaryotic host, or can be a product of synthetic procedures.
[0057] The terms “nucleic acid,” “nucleic acid sequence,” “nucleotide sequence,” or “polynucleotide sequence,” and “polynucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The polynucleotide may be either single-stranded or double-stranded, and if single-stranded may be the coding strand or non-coding (antisense) strand. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. The nucleic acid may be a recombinant polynucleotide, or a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in a nonnatural arrangement.
[0058] The term “isolated,” as used herein, refers to material that is removed from its original or native environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated by human intervention from some or all of the co-existing materials in the natural system, is isolated. Such polynucleotides could be part of a vector and / or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of the environment in which it is found in nature.
[0059] As used herein, the term "variant" refers to a polynucleotide or polypeptide having a sequence substantially similar to a reference polynucleotide or polypeptide. In the case of a polynucleotide, a variant can have deletions, substitutions, additions of one or more nucleotides at the 5' end, 3' end, and / or one or more internal sites in comparison to the reference polynucleotide. Similarities and / or differences in sequences between a variant and the reference polynucleotide can be detected using conventional techniques known in the art, for example polymerase chain reaction (PCR) and hybridization techniques. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis. Generally, a variant of a polynucleotide, including, but not limited to, a DNA, can have at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polynucleotide as determined by sequence alignment programs known by skilled artisans. In the case of a polypeptide, a variant can have deletions, substitutions, additions of one or more amino acids in comparison to the reference polypeptide. Similarities and / or differences in sequences between a variant and the reference polypeptide can be detected using conventional techniques known in the art, for example Western blot. Generally, a variant of a polypeptide, can have at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polypeptide as determined by sequence alignment programs known by skilled artisans.
[0060] An "individual" or "subject" as used herein is a mammal. Mammals include, but are not limited to, domesticated animals (eg, cows, sheep, cats, dogs, and horses), primates (eg, humans and non-human primates such as monkeys), rabbits and rodents (eg, mice and rats). In some embodiments, the individual or subject is a human.
[0061] The term "pharmaceutical composition" refers to a formulation that is in a form that effectively displays the biological activity of the active ingredient contained therein and does not contain additional components that are unacceptably toxic to the subject to whom the composition will be administered.
[0062] "Pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical composition, other than an active ingredient, that is non-toxic to a subject. The pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
[0063] Various aspects of the invention are described in further detail below. Additional definitions are set out throughout the specification.
[0064] Physiological symptoms which might be influenced by underlying physiological changes in the brain associated with a neurological disease or disorder pathology include those measured by the following, including:
[0065] Body weight: weight loss and disturbances in food intake;
[0066] Motor function, e.g. spontaneous activity and general locomotion (distance) which can be measured by open field tests (OFT) (distance), reflecting motor function.
[0067] Anxiety levels: anxiety is a common neuropsychiatric symptom observed in human AD patients and is frequently modeled in rodent models using OFT. This test also assesses anxiety levels by looking at preference of a rodent to go to the periphery of the open field due to innate fear of predation. Measures like time spent in the center zone or number of entries into the center are indicators of anxiety-like behavior.
[0068] Muscle strength and neuromuscular integrity: quantifiable data is provided by measuring grip strength in rodents which measures peak force a mouse exerts while grasping a bar connected to a force meter.
[0069] Spatial learning and memory: measured in rodents by the Morris Water Maze training tests. Mice learn to find a hidden platform in a pool of water, measuring their ability to recall spatial information: time to find platform(s), MWM probe test, swim speed.
[0070] Spatial working memory: measure in rodents with a Y-maze which evaluates spatial working memory based on mice’s tendency to explore novel arms in a Y- shaped maze. Spontaneous alteration percentage is calculated as the ratio of arm choices differing from the previous two choices divided by the total number of entries, this indicates basic mnemonic processing. Time spent in each arm allows for assessing preference for novel vs. familiar environments or assessing specific arm exploration patterns. Sequence of arm entries analyzes the sequence of arm visits and can reveal patterns related to spatial memory and working memory function. Hippocampal function is particularly sensitive to changes in the Y-maze.
[0071] Novel object recognition index test measures the difference in exploration time between a novel and a familiar object. A higher index indicates better recognition memory.
[0072] Sociability and social memory: interaction, measured with a three- chamber rodent test. It measures a mouse’s preference for spending time in chamberscontaining either another mouse or a novel object, or a familiar mouse versus a novel mouse. Studies have shown that AD mouse models exhibit reduced sociability and social memory compared to wild-type mice, indicating social communication deficits in AD.
[0073] Amyloid-beta ( Ap) plaque assessment: quantifies amyloid deposits in the brain using immunohistochemistry and imaging techniques. The main pathological hallmarks in AD are the presence of extracellular amyloid plaques, primarily consisting of amyloid-p (A[3) peptide in different parts of the brain, CAI, CA3, Dentate Gyrus (DG), and the entorhinal cortex, which are key components of the hippocampal formation, a brain region critical for memory and spatial recognition. CAI is particularly important for memory consolidation and retrieval. CA3 is involved in pattern completion and rapid acquisition of novel spatial representations. DG is a structure that received input from the entorhinal cortex and projects to CA3. It’s involved in pattern separation, distinguishing between similar experiences. The entorhinal cortex region serves as the main input and output pathway between the hippocampus and other brain areas. It plays a crucial role in memory, navigation, and time perception. Hypothalamus, while not part of the hippocampal formation, is connected to it and plays a role in regulating various functions, including memory consolidation and retrieval. It should be noted that human beta-amyloid exists in several naturally occurring forms, with the forms occurring in the human body designated as A[339, A[340, A[341, A[342 and A[343, with the most common form being A[342. A041, A 4O, A[339 lack the C-terminal amino acids A, IA and VIA, respectively. Form A[>43 has an additional threonine residue at the C-terminus.
[0074] Oxytocin (OXT)
[0075] Oxytocin, OXT, (Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly-NHi) (SEQ IDNO:1) is a peptide hormone produced in the brain of most mammals, including humans. Oxytocin is considered to be the principal agent to treat post-partum haemorrhage. It is degraded in the gastrointestinal tract, therefore it is administered as aqueous formulation by injection or as nasal spray. Its half-life in the blood is typically about three minutes. Synthetic oxytocin is commercially available as ready-to-use aqueous formulations under the trade names Pitocin® and Syntocinon® or as generic oxytocin. The oxytocin analogues desaminooxytocin and carbetocin (trade name Duratocin®) are also commercially available.
[0076] The term "oxytocin" or OXT as used herein includes both synthetic and natural version of the original nonapeptide having the amino acid sequence as described above, as well as functional variants, homologs, and analogs. Homologs include those fromplacental mammals such as inotocin in invertebrates, isotocin in Osteichthyes, mesotocin found in most marsupials, nonmammalian tetrapods and lungfishes, and other forms identified in New World Primates. Analogs include but are not limited to, desaminooxytocin, carbetocin, 4-threonine-l-hydroxy-deaminooxytocin, 9-deamidooxytocin, 7-D- prolins-oxytocin and its deamino analog, (2,4-diisoleucine)-oxytocin, 1 -desamino- 1. monocarba-E12-Tyr (OMe)]-OT(dCOMOT), [Th4-Gly7]-oxytocin (TG-OT), the oxytocin agonist as described by Olson et al., (Peptides 12(1), 113-118, 1991), oxypressin and deamino-6-carba-oxytoxin (dC60). Further oxytoxin analogs (oxytocies) can for instance be found in MX 9 707 899 , disclosing the oxytocin analogues (Mpal) oxytocin, (Mpal, D- Tyr(Et)2, Thr4, Om8) oxytocin, (Mpal, Ile2) oxytocin, (Mpal, Ala2) oxytocin, (Ile2) oxytocin, Gly-Leu4, Ile8) oxytocin, (D-Asn5) oxytocin, (D-Cysl) oxytocin, (Glyl) oxytocin, (Leu4, D-Arg9) oxytocin, (Mpal, Leu4, D-Arg8) oxytocin, (Arg8) oxytocin and (Ilee) oxytocin. In some cases, a therapeutic composition as discussed herein may also include GnRH, as discussed herein.
[0077] Gonadotropin-releasing hormone (GnRH)
[0078] GnRH is also known as also known as luteinizing -hormone-releasing hormone (LHRH) or luliberin. As is known to those of ordinary skill in the art, native mammalian GnRH has the structure pyroGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2 (SEQ ID NO: 2), and GnRH and its functional variants and analogs can be readily obtained from commercial sources. Non-limiting examples of GnRH or GnRH analogs include gonadorelin hydrochloride (Factrel®), gonadorelin diacetate tetrahydrate (Cystorelin®), leuprolide, leuprolide acetate, deslorelin as well as salts and analogs of any of the foregoing. Substitution of natural L-amino acids with D-amino acids, and / or modifications to enhance binding affinity and potency such as alterations in side chains are an aspect of this invention and are known in the art.
[0079] GnRH is a trophic peptide hormone that has multiple effects, including release of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) from the anterior pituitary. It is typically produced and released endogenously from neurons within the hypothalamus. GnRH may also have an effect on mitochondrial activity in some cells (for example, certain cardiac cells such as myocardiocytes).
[0080] In one aspect, the peptide may be a fusion protein of OXT and GnRH. A “fusion protein” and a “fusion polypeptide” refer to a polypeptide having at least two portions covalently linked together, where each of the portions is a polypeptide having a different property. The property may be a biological property, such as activity in vitro or in vivo. Theproperty can also be simple chemical or physical property, such as binding to a target molecule, catalysis of a reaction, etc. The two portions can be linked directly by a single peptide bond or through a peptide linker, but are in reading frame with each other.
[0081] In some aspects, peptides are provided which are useful as therapeutic agents, e.g., to treat, ameliorate, reverse, one or more symptoms of an aging-related neurological disease or disorder. In some aspects, compositions comprising peptides provided herein are effective in treating such, alone or in combination. It is contemplated that peptides may be purified and / or isolated from natural sources or prepared by recombinant or synthetic methods. Amino acid sequences may be encoded by naturally or non-naturally occurring nucleic acid sequences or synthesized by recombinant nucleic acid sequences or artificially synthesized. A peptide may be a linear peptide or a cyclopeptide, e.g. cyclic including bicyclic. In some cases, a “peptide” may be interchangeably referred to as a “therapeutic peptide.” In some cases, the peptide is a “pseudo-peptide” or a “peptidomimetic,” which are compounds designed to functionally mimic a peptide.
[0082] Formulations
[0083] In one aspect, a formulation comprising OXT and GnRH, optionally in combination with one or more other composition, where the other composition is a therapeutic, a buffer, a stabilizer.
[0084] In one aspect, the additional therapeutic composition comprises EVs derived from native htNSC, or derived from a cell that resembles a htNSC, for example a reprogram-induced htNSC-like cell derived by converting or reprogramming a mature non neural cell, a neural cell, or an induced neural stem cell (iNSC). As discussed in the Examples below, htNSC EVs were found as a key mediator for the effect of OXT- GnRH combination in treating AD in mouse models. Administration of htNSC EVs counteracted neurological deficits in both A[3 and tau pathology AD models.
[0085] In another aspect, the additional therapeutic comprises a composition comprising PTMS -containing or PTMS-loaded vesicles. PTMS is a hypothalamic secretory protein found to have neuroprotective potential. The sequence of human PTMS is mseksveaaa elsakdlkek kekveekasr kerkkevvee eengaeeeee etaedgeeed egeeedeeee eeddegpalk raaeeedead pkrqktenga sa (SEQ ID NOG)
[0086] As discussed in the Examples below, htNSCs were identified as a key source of EVs that contain PTMS. Administration of htNSC EVs counteracted neurological deficits and DNA damage in both PTMS-KO mice and 5xFAD model, in a PTMS-dependent manner. PTMS-containing EVs can be isolated by techniques known in the art, for example,from cultured htNSCs or other cell types that produce a natural form of human or animal PTMS, or cells transduced with a vector, e.g. lentivirus vector, encoding an engineered form of human or animal PTMS. PTMS, an analog or variant thereof, including recombinantly engineered mutants and variants, fragments, functional equivalents, derivatives, homologs and fusions of the native gene so long as the encoded product retains the selectable property. Useful derivatives generally have substantial sequence similarity (at the amino acid level) in regions or domains of the gene associated with the selectable property. PTMS, an analog or variant thereof, can also be loaded into a type of EVs, nanoparticles or synthetic vesicles designed to mimic natural vesicles as is known in the art.
[0087] Any of the OXT-GnRH formulations described herein can be provided in a dose formulation or dosage form suitable for administration (e.g., by injection or via intranasal administration) to a subject as described herein. The formulations described herein can be a liquid formulation, a lyophilized formulation, or a reconstituted formulation.
[0088] In certain embodiments, the formulation is a liquid formulation. In some embodiments, the formulation comprises an OXT molecule and a GnRH molecule as described herein and a buffering agent.
[0089] In some embodiments, the formulation (e.g., liquid formulation) comprises an OXT molecule present at a concentration of 25 mg / mL to 250 mg / mL, e.g., 50 mg / mL to 200 mg / mL, 60 mg / mL to 180 mg / mL, 70 mg / mL to 150 mg / mL, 80 mg / mL to 120 mg / mL, 90 mg / mL to 110 mg / mL, 50 mg / mL to 150 mg / mL, 50 mg / mL to 100 mg / mL, 150 mg / mL to 200 mg / mL, or 100 mg / mL to 200 mg / mL, e.g., 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 110 mg / mL, 120 mg / mL, 130 mg / mL, 140 mg / mL, or 150 mg / mL. In certain embodiments, OXT is present at a concentration of 80 mg / mL to 120 mg / mL, e.g., 100 mg / mL.
[0090] In some embodiments, the formulation (e.g., liquid formulation) comprises an GnRH molecule present at a concentration of 25 mg / mL to 250 mg / mL, e.g., 50 mg / mL to 200 mg / mL, 60 mg / mL to 180 mg / mL, 70 mg / mL to 150 mg / mL, 80 mg / mL to 120 mg / mL, 90 mg / mL to 110 mg / mL, 50 mg / mL to 150 mg / mL, 50 mg / mL to 100 mg / mL, 150 mg / mL to 200 mg / mL, or 100 mg / mL to 200 mg / mL, e.g., 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 110 mg / mL, 120 mg / mL, 130 mg / mL, 140 mg / mL, or 150 mg / mL. In certain embodiments, GnRH is present at a concentration of 80 mg / mL to 120 mg / mL, e.g., 100 mg / mL.
[0091] In some embodiments, the formulation further comprises EVs, htNSC EVs or PTMS-loaded EVs, both naturally or synthetically derived, present at a concentrationof 25 mg / mL to 250 mg / mL, e.g., 50 mg / mL to 200 mg / mL, 60 mg / mL to 180 mg / mL, 70 mg / mL to 150 mg / mL, 80 mg / mL to 120 mg / mL, 90 mg / mL to 110 mg / mL, 50 mg / mL to 150 mg / mL, 50 mg / mL to 100 mg / mL, 150 mg / mL to 200 mg / mL, or 100 mg / mL to 200 mg / mL, e.g., 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 110 mg / mL, 120 mg / mL, 130 mg / mL, 140 mg / mL, or 150 mg / mL. In certain embodiments, htNSC EVs are present at a concentration of 80 mg / mL to 120 mg / mL, e.g., 100 mg / mL.L0092J The appropriate dosage of a component (OXT, GnRH, or EVs) of a formulation of the invention (when used alone or in combination with one or more additional therapeutic agents) for preventing or treating a disease will depend on the type of disease to be treated, the severity and course of the disease, and whether the therapy is administered for the purpose of prevention or treatment, prior treatment, the patient's medical history and patient’s response, and the choice of the treating physician. It is appropriate to administer the formulation to a patient once or in a series of treatments. Depending on the type and severity of the disease, a possible initial dosage of a component in the formulation for administration to a patient may be from about 1 pg / kg to 15 mg / kg (e.g. 0.5 mg / kg to 10 mg / kg), for example, as one or more separate administrations, or as a continuous infusion. A typical daily dosage can range from about 1 pg / kg to 100 mg I kg or more, depending on the factors mentioned above. With repeated administration for several days or more, depending on the pathological condition, treatment should be continued until the desired suppression of the symptoms of the disease occurs. One example of the dosage of a component in the formulation may be in the range of about 0.05 mg / kg to about 10 mg / kg. Thus, one or more doses of about 0.5 mg I kg, 2.0 mg / kg, 4.0 mg I kg, or 10 mg / kg (or any combination thereof) can be administered to a patient. These doses can be administered intermittently, for example, every week or every three weeks (for example, so that the patient receives from about two to about twenty, or, for example, about six doses). An initial loading dose may be administered followed by one or more lower doses. However, other dosing regimens can be used. The success of such therapy is easy to track using known techniques and tests.
[0093] The pharmaceutical compositions of the combinations described herein can be prepared in the form of lyophilized compositions or aqueous solutions by mixing the desired combination of OXT, GnRH and / or EVs with one or more of the possible pharmaceutically acceptable carriers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). Pharmaceutically acceptable carriers at the dosages and concentrations employed are generally non-toxic to recipients and include: buffers, e.g, phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives(such as octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol; 3- pentresanol; and m-centresanol); low molecular weight (less than 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; carbohydrates such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (eg Zn-protein complexes); and I or nonionic surfactants such as, but not limited to, polyethylene glycol (PEG). Examples of pharmaceutically acceptable carriers herein also include agents for dispersing drugs in the interstitial space, such as neutral active soluble hyaluronidase glycoproteins (sHASEGP), for example, human soluble hyaluronidase PH-20 glycoproteins such as rHuPH20 (HYLENEX®, Baxter International Inc.). Examples of some sHASEGPs and methods of their use, including rHuPH20, are described in US 2005 / 0260186 and US 2006 / 0104968. In one aspect, sHASEGP is further combined with one or more glycosaminoglycanases such as chondroitinase.
[0094] The composition comprising the combination described herein can be administered to the subject systemically (e.g., orally, parenterally, subcutaneously, intravenously, rectally, intramuscularly, intraperitoneally, intranasally, transdermally, or by inhalation or intracavitary installation), topically, or by application to mucous membranes, such as the nose, throat and bronchial tubes. A formulation is preferably administered via the subcutaneous route, the mucosal route, or a combination thereof. The mucosal route may be exemplified by, but is not limited to, the pulmonary, nasal, sublingual or buccal route. Accordingly, in one embodiment the invention provides the use of formulations according to the invention, for the manufacture of a medicament formulated for subcutaneous or mucosal administration, or a combination thereof.
[0095] Compositions to be administered in vivo are generally sterile. Sterility can be achieved, for example, by filtration through sterile filtration membranes. In one embodiment, the composition is isotonic.
[0096] For intravenous, subcutaneous or intramuscular administration, the formulation may be provided as a sterile solution, suspension or an emulsion. The formulation may be applied by means of an injection or an infusion. For mucosal administration, the formulation may be provided as an aqueous spray and may be applieddirectly by means of a spray container or an inhalator. Alternatively, but not limited to, the formulation may be administered to the mucosa as an aqueous gel.
[0097] Intranasal delivery of drugs utilizes several types of devices such as nebulizers, pressurized devices, dry powder nebulizers, and bi-directional nasal devices. Nasal delivery devices and methods for delivering substances to the nasal airways of a subject, preferably to the posterior regions of the nasal airways, preferably to the upper posterior regions of the nasal airways, including the olfactory bulb and the trigeminal nerve are contemplated.
[0098] According to another aspect of the invention, the invention provides a method for treating or preventing an aging-related neurological disease or disorder in a subject in need thereof, comprising administering to said subject an effective dosage amount of a formulation comprising OXT and GnRH according to the invention. In another aspect, there is provided an OXT-GnRH formulation for use as a medicament. In other aspects, there is provided an OXT-GnRH formulation for use in the prevention and / or treatment of a disease associated with amyloidogenesis and / or amyloid plaque formation. In some embodiments, an OXT-GnRH formulation is provided for use in a method of treatment. In some embodiments, an OXT-GnRH formulation is provided for use in a method of treating an individual having a disease associated with amyloidogenesis and / or amyloid plaque formation, comprising administering to the individual an effective amount of an OXT-GnRH formulation. In one such embodiment, the method further comprises administering to the subject an effective amount of at least one additional therapeutic agent, such as EVs as described above. In further embodiments, an OXT-GnRH formulation is provided for use in inhibiting plaque formation and I or disintegration of beta- amyloid plaques. In some embodiments, an OXT-GnRH formulation is provided for use in a method for inhibiting plaque formation and I or disintegration of P-amyloid plaques in an individual, comprising administering to the individual an effective amount of an OXT-GnRH formulation inhibiting plaque formation and / or disintegration of P-amyloid plaques. An "individual" according to any of the above embodiments is preferably a human.
[0099] In a further aspect, the invention provides a method for treating a disease associated with an aging-related neurological disease or disorder. In one embodiment, the method comprises administering to an individual having a disease associated with an aging- related disease or disorder an effective amount of an OXT-GnRH formulation. In one such embodiment, the method further comprises co-administering to the subject an effective amount of at least one additional therapeutic agent. In one aspect, the additional therapeuticagent comprises EVs, NSC-derived EVs or PTMS-loaded vesicles. Examples of additional therapeutic agents include: various neurological drugs described above, cholinesterase inhibitors (such as donesepil, galantamine, rovastigmine, and tacrine), N-methyl-D-aspartate (NMD A) receptor antagonists (such as memantine), inhibitors of amyloid beta aggregation , antioxidants, y-secretase modulators, nerve growth factor (NGF) mimetics or NGF gene therapy, peroxisome proliferator-activated receptor agonists (PPARy, from Peroxisome proliferator-activated receptors), 3-hydroxy inhibitors -3-methylglutaryl-coenzyme A reductase (statins), ampakines, calcium channel blockers, gamma-aminobutyric acid receptor antagonists, glycogen synthase kinase inhibitors, intravenous immunoglobulin, muscarinic receptor agonists, nicotinic receptor modulators, amyloidiide active or passive inhibitors, antagonists of serotonin receptors and antibodies to beta-amyloid, but are not limited to them. In some embodiments, the at least one additional therapeutic agent is selected for its ability to suppress one or more side effects of the neurological drug.
[0100] Such combination therapies, mentioned above, include combined administration (when two or more therapeutic agents are included in one or more formulations) and separate or sequential administration, when the administration of one of the therapies of the invention is carried out before, simultaneously and / or after administration of the additional therapeutic agent or agents. In one embodiment, administration of the OXT- GnRH and administration of the additional therapeutic agent occurs over about one month, or over about one, two, or three weeks, or over about one, two, three, four, five or six days. The therapies described herein can also be used in combination with other interventions such as radiation therapy, psychotherapy, or other therapies known in the art and suitable for treating, ameliorating, or preventing an aging-related neurological disease or disorder.
[0101] Effective amounts of oxytocin or an analogue or variant thereof and / or GnRH or an analog or variant thereof are amounts that are sufficient to bring about an efficacious effect against symptoms associated with the neurological disease, and can be determined by those skilled in the art by routine experimentation. Furthermore, professional guidelines on the use of oxytocin or GnRH in various indications exist and their use has been described in handbooks (e.g. AHFS Drug Information or Martindale, The Extra Pharmacopoeia).
[0102] In general, an effective dosage of oxytocin or an analog and / or GnRH or an analog thereof for the purposes of this invention is expected to comprise a bolus amount of between 2 and 10 IU. In one aspect the invention provides a method for treating a neurological disease in a subject in need thereof, comprising administering to said subject abolus amount of up to 2 IU of oxytocin or an analog thereof in combination with 2 IU of GnRH or an analog thereof, preferably up to 5 IU, more preferably up to 10 IU.
[0103] In some embodiments, the formulation (e.g., liquid formulation) further comprises a surfactant. In certain embodiments, the surfactant is polysorbate 20. In some embodiments, the surfactant or polysorbate 20) is present at a concentration of 0.005% to 0.1% (w / w), e.g., 0.01% to 0.08%, 0.02% to 0.06%, 0.03% to 0.05%, 0.01% to 0.06%, 0.01% to 0.05%, 0.01% to 0.03%, 0.06% to 0.08%, 0.04% to 0.08%, or 0.02% to 0.08% (w / w), e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w / w). In some embodiments, the formulation comprises a surfactant or polysorbate 20 present at a concentration of 0.03% to 0.05%, e.g., 0.04% (w / w).
[0104] Also disclosed herein are pharmaceutical compositions comprising one or more of the formulations disclosed herein and one or more pharmaceutically acceptable carriers. The compositions can also comprise additional ingredients such as diluents, stabilizers, excipients, and adjuvants. As used herein, "pharmaceutically acceptable" carriers, excipients, diluents, adjuvants, or stabilizers are the ones nontoxic to the cell or subject being exposed thereto (preferably inert) at the dosages and concentrations employed or that have an acceptable level of toxicity as determined by the skilled practitioners.
[0105] The carriers, diluents and adjuvants can include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides (e.g., less than about 10 residues); proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween™, Pluronics™ or polyethylene glycol (PEG). In some embodiments, the physiologically acceptable carrier is an aqueous pH buffered solution.
[0106] Titers of the active components of the formulation to be administered will vary depending, for example, on the particular formulation, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and can be determined by methods standard in the art.
[0107] As will be readily apparent to one skilled in the art, the useful in vivo dosage of the formulation to be administered and the particular mode of administration will vary depending upon the age, weight, the severity of the affliction, and animal speciestreated. The determination of effective dosage levels, that is the dosage levels necessary to achieve the desired result, can be accomplished by one skilled in the art using routine pharmacological methods. Typically, human clinical applications of products are commenced at lower dosage levels, with dosage level being increased until the desired effect is achieved. Alternatively, acceptable in vitro studies can be used to establish useful doses and routes of administration of the compositions identified by the present methods using established pharmacological methods.
[0108] In one embodiment, formulations can be distributed throughout a wide region of the CNS, by injection into the cerebrospinal fluid, e.g., by lumbar puncture.
[0109] In one aspect, a method of treating an aging-related neurological disease. In one aspect, the disease is selected from the group consisting of dementia, Alzheimer's disease, motor neuropathy, Down syndrome, Creutzfeldt- Jakob disease, hereditary cerebral hemorrhage with Dutch type amyloidosis, Parkinson's disease, HIV-associated dementia, cognitive changes due to Amyotrophic Lateral Sclerosis (ALS). In one aspect, the formulations are for the treatment of Alzheimer’s disease. In one embodiment, the formulations described herein are for inhibiting / slowing down the formation of amyloid plaques, or disintegrating [3-amyloid plaques, in the brain.
[0110] Alternatively, precise delivery of the formulation into specific sites of the brain, can be conducted using stereotactic microinjection techniques. For example, the subject being treated can be placed within a stereotactic frame base (MRI-compatible) and then imaged using high resolution MRI to determine the three-dimensional positioning of the particular region to be treated. The MRI images can then be transferred to a computer having the appropriate stereotactic software, and a number of images are used to determine a target site and trajectory for antibody microinjection. The software translates the trajectory into three-dimensional coordinates that are precisely registered for the stereotactic frame. In the case of intracranial delivery, the skull will be exposed, burr holes will be drilled above the entry site, and the stereotactic apparatus used to position the needle and ensure implantation at a predetermined depth. The formulation can be delivered to regions, such as the cells of the spinal cord, brainstem, (medulla, pons, and midbrain), cerebellum, diencephalon (thalamus, hypothalamus), telencephalon (corpus striatum, cerebral cortex, or within the cortex, the occipital, temporal, parietal or frontal lobes), or combinations, thereof. In another preferred embodiment, the formulation is delivered via intravascular approaches in combination with approaches for disruption of the blood-brain barrier, such as focused ultrasound. In anotheraspect, the formulation is delivered using other delivery methods suitable for localized delivery, such as localized permeation of the blood-brain barrier. Particularly preferred delivery methods are those that deliver the formulation or components thereof to regions of the brain that require treatment.
[0111] Therapeutic compositions can be formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration. Sterile injectable solutions can be prepared by incorporating the active compound (i.e., OXT, GnRH or EVs) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
[0112] Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile, lyophilized powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and spray-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
[0113] In certain embodiments, the active compound may be prepared with a carrier that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are generally known to those skilled in the art.
[0114] For therapy (e.g., of neurological disease or disorders which may be ameliorated by the product) a therapeutically effective amount or dose of the formulation is administered to a subject in need of such treatment. The use of the formulation disclosed herein in the manufacture of a medicament for providing therapy to a subject is within the scope of the present application.
[0115] The formulations disclosed herein can be administered to a subject (e.g., a human) in need thereof. The disclosure provides a method of treating an aging-related neurologic disease or disorder, comprising administering to the subject a therapeutically effective amount of a composition comprising the OXT in combination with GnRH, optionally in combination with another therapy, e.g. EVs, and pharmaceutically acceptable salt thereof. In some embodiments of the methods of the disclosure, administering the composition reduces a symptom of the disease or disorder, or prevents further progression of the disease or disorder in the subject.
[0116] A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of the therapeutic composition may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the composition to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the composition are outweighed by the therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
[0117] In instances where human dosages for the composition have been established for at least some condition, those same dosages, or dosages that are between about 0.1% and 500%, more preferably between about 25% and 250% of the established human dosage can be used. Where no human dosage is established, as will be the case for newly discovered pharmaceutical compositions, a suitable human dosage can be inferred from ED50 or ID50 values, or other appropriate values derived from in vitro or in vivo studies, as qualified by toxicity studies and efficacy studies in animals.
[0118] As used herein, the term "treatment" refers to an intervention made in response to a disease, disorder or physiological condition manifested by a patient, particularly a patient suffering from one or more serotonin-related diseases. The aim of treatment may include, but is not limited to, one or more of the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and the remission of the disease, disorder or condition. The term "treat" and "treatment" includes, for example, therapeutic treatments, prophylactic treatments, and applications in which one reduces the risk that a subject will develop a disorder or other risk factor. Treatment does notrequire the complete curing of a disorder and encompasses embodiments in which one reduces symptoms or underlying risk factors. In some embodiments, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already affected by a disease or disorder or undesired physiological condition as well as those in which the disease or disorder or undesired physiological condition is to be prevented. This can take place at primary, secondary and / or tertiary prevention levels, wherein: a) primary prevention avoids the development of symptoms / disorder / condition; b) secondary prevention activities are aimed at early stages of the condition / disorder / symptom treatment, thereby increasing opportunities for interventions to prevent progression of the condition / disorder / symptom and emergence of symptoms; and c) tertiary prevention reduces the negative impact of an already established condition / disorder / symptom by, for example, restoring function and / or reducing any condition / disorder / symptom or related complications. The term "prevent" does not require the 100% elimination of the possibility of an event. Rather, it denotes that the likelihood of the occurrence of the event has been reduced in the presence of the compound or method.
[0119] The invention is further illustrated by the following non-limiting examples. EXAMPLES
[0120] The following Materials & Methods were used in the Examples below.
[0121] Animal models - C57BL / 6 mice and 5xFAD mice were obtained from Jackson Laboratory. The PTMS knockout and conditional knockout founders (F0) were generated by Einstein’s transgenic core using CRISPR technology as established. In brief, a guide RNA (gRNA) targeting Intron 1 of Ptms gene denoted as Ptms gRNAl (targeting ggtgggagcctcagcgactc tgg, SEQ ID NO:4) and a gRNA targeting a downstream sequence following exon 5 denoted as ptms gRNA2 (targeting tgatatagtgtgcactgctg agg, SEQ ID NO:5) were generated by in-vitro transcription. For generating knockout, two single stranded homologous donor DNAs were synthesized (IDT) mixed with Cas9 protein (PNB) and Ptms gRNA were injected into fertilized eggs of C57BL / 6 mice. The injected fertilized eggs were transferred to pseudo-pregnant CD1 female mice for producing pups. Animals with the excision of Ptms exon 2 to 5 for knockout were screened through PCR and sequencing. Knockout founders were used to produce the next generation of mice (Fl) by mating with laboratory C57BL / 6 mice and have always been maintained in C57BL / 6 stain background. The heterozygous progenies were inbred to produce knockout mice and genetically-matched littermate controls for experiments. All mice were normally kept in standard, infection-freehousing conditions, with 12 light / 12 dark cycles and 4-5 mice per cage. All mice were kept under standard, infection-free housing with 3 to 5 mice per cage. All mice were fed a standard chow from Lab Diet. All animal models and use were approved by the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.
[0122] Cell models - Primary culture of htNSC was performed as we described previously. In brief, the hypothalamic tissue was dissected from newborn C57BL / 6 mice, cut into small pieces of approximately 1 mm3, and followed by digestion using TrypLE Express enzyme (Life Technologies1M) for 10 min at 37°C. After centrifugation, cells were suspended in the neurobasal-A and B27 medium (NA / B27) medium containing neurobasal-A (Life Technologies™), 2% B27 without vitamin A (Life Technologies™), 10 ng ml-1 EGF (Sigma-Aldrich®), 10 ng ml-1 bFGF (Life Technologies™), 0.25% GlutaMAX™ supplement (Life Technologies™), and 1% penicillin-streptomycin, and were cultured under 37°C and 5% CO2. One week later, neurospheres were collected by centrifugation and trypsinized into single cells and continued to be sub-cultured in neurospheres, while NA / B27 medium was replaced every 2 days to completely remove debris due to death of other types of cells in this selection medium. Through this selection, htNSC population survived and gradually expanded in neurospheres and were weekly passaged. This htNSC model was established after 4 to 5 passages, and the identity of htNSC was confirmed through immunostaining with cell-specific biomarkers including Sox2 and Nestin, while it was also confirmed that htNSC did not contain any other cell types such as neurons, astrocytes, microglia, and oligodendrocytes through immunostaining of cell type-specific markers. Culture of neuronal models in this study included a generic neuronal cell line Neuro-2A (ATCC) and two hypothalamic neuronal cell lines mHypoA-2 / 21 (Cedarlane®) and GT1-7. Additional in-vitro system in this study included HEK293T (ATCC®). All these neuronal models were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin-streptomycin under 37°C and 5% CO2. All cell lines in experiments were free of microbial infection or mycoplasma contamination, and morphology and growth characteristics of these cells were confirmed consistent with published information and authenticity.
[0123] Brain procedures - Injections of lentiviruses into the MBH region and hypothalamic third ventricle wall were well established in our previous research. In brief, bilateral MBH injections were directed to the coordinates at -1.7 anterior-posterior and -5.8 dorsal-ventral from the bregma and at 0.25 lateral from the middle-line at each side, and injection of lentiviruses into the hypothalamic third ventricle within the MBH were based onthe coordinates at -1.7 anterior-posterior and -5.0 dorsal- ventral from the bregma and at the middle line. Lentiviruses diluted in artificial CSF (aCSF) were injected under an ultra-precise stereotactic apparatus (KOPF®, David Kopf Instruments) via a 26-gauge guide cannula and a 33-gauge internal injector (Plastics One®) connected to a 5-pl Hamilton syringe and infusion pump (WPI Instruments). The volume was 0.2 to 0.4 pl per site for MBH tissue injection, and 0.5 to 1.0 pl per hypothalamic third ventricle injection, and aCSF was used as the vehicle. For the procedure of CSF sampling, mice were placed on to an ultra-precise stereotactic apparatus (KOPF®, David Kopf Instruments) under 2-3% isoflurane anesthesia, and CSF was collected through the exposed cistema magna using a bent 33G needle with tubing connected to 1-ml syringe under microscope; mice were euthanized following the collection. Animal treatment: animals were treated with ultracentrifugation-purified EVs through i.c.v. administration for a treatment period specified in each experiment. The injection was performed 3 times per week, and the dosage and duration are specified in each experiment. For i.c.v. treatment, a mouse received an injection of purified EVs suspended in 0.5 pl aCSF or vehicle control through an injection cannula pre-implanted into the third ventricle of the hypothalamus. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.
[0124] EV assays - EVs in the medium of cultured cells and the CSF were isolated and purified through the method of filtration and ultracentrifugation, as described in our previous work. EV-free media (through ultracentrifugation) were used in cell culture for releasing EVs. In brief, samples of EVs were pre-cleared by centrifugation at 2,000g for 10 min, followed by filtration with a 0.8-pm-pore-size filter (Corning). EV were pelleted by ultracentrifugation at 110,000g for 90 min and the pellet was resuspended with PBS. The quantity of EVs was assessed regularly through using the Pierce® BCA protein assay kit (Thermo Fisher Scientific) and through using NanoSight LM10 system (Malvern Instruments Ltd). For nano-FCM, purified EVs were incubated with target antibodies and processed through the Flow Cytometry Core at Albert Einstein College of Medicine. In brief, EVs were stained with antibodies, including PTMS antibody (Pierce® Biotechnology) conjugated with APC (Lightning-Link®, abeam®, cat# ab201807), PE-conjugated CD63 antibody (BD biosciences, cat# BDB564222), PE / Dazzle 594-conjugated CD9 (Biolegend®, cat# 124822) and PE / Cyanin7-conjugated CD81 antibody (Biolegend®, cat# 104914). To enhance antibody penetration, EV samples underwent a few rounds of room temperature-ice switches and then incubated with antibodies on ice for 1 hour in the dark before being washed 3 times. Isotype controls stained with APC-conjugated rabbit IgG isotype control (Cell SignalingTechnology®, cat# 12445s), PE-conjugated rat IgG2a, K isotype control (BD biosciences, cat# BD554689), PE / Dazzle 594 rat IgG2a, K isotype control (Biolegend®, cat# 400557) or PE / Cyanin7 conjugated armenian hamster IgG isotype control (Biolegend®, cat# 400921) was used to assess unspecific binding. Besides isotype controls, unstained control, buffer only control, buffer only with antibody controls and 0.1% triton X-100 detergent control for purity assessment were prepared and analyzed by Aurora™ spectral flow cytometer (Cytek™ Biosciences) under the same optimized condition. The threshold for side scatter (SSC) and forward scatter (FSC) were set to 1000, and the gain FSC, SSC, SSC-B, B2 (FITC), R1 (APC), YG1 (PE), YG3 (PE / Dazzle 594) and YG9 (PE / Cyanin7) detectors were set to 532, 1500, 138, 288, 137, 288, 217 and 328, respectively, with the aid of Apogee sizing beads (Apogee Flow Systems, cat #1527). Apogee beads contain a mixture of various reference size beads which were detected with gating strategy, and each bead population was separated from the noise population along with the SSC axis and B2 axis. Buffer control was used to calculate background noise. The same volume of samples was recorded for all samples with low flow rate (up to 15 ul / min) to minimize the swarming effect. Data was collected, analyzed and compensated using SpectroFlo software. The compensation was adjusted with unstained and single-color controls by the spectral unmixing, which considers the entire spectrum of fluorescence to distinguish the overlapping signals from different fluorescent channels. FlowJo software was used to generate plot images. EV labeling with PKH67 or PKH26 lipophilic dye (Sigma-Aldrich®) was performed according to the previously reported method with slight modifications. PKH26-labelled EVs were purified through ultracentrifugation with 30% sucrose in PBS solution to remove any unlabeled chemical. For immunostaining, purified EVs were applied to a coverslip, blocked with the serum of appropriate species, treated with primary antibodies, including rabbit anti-PTMS (Pierce® Biotechnology), rabbit anti-HA (Cell Signaling Technology®, 3724), rabbit anti-Sox2 (R&D Systems, MAB2018), mouse anti-CD9 (Santa Cruz), mouse anti-CD63 (Santa Cruz), mouse anti-CD81 (Santa Cruz), subsequently incubated with AlexaFluor™ 488 or 555- conjugated secondary antibodies. Technical controls included naive IgGs of the appropriate species. Images were captured using Leica SP8 confocal microscope.
[0125] Bisulfite oligonucleotide-captured sequencing (BOCS) - DNA was extracted from using a Qiagen® kit (Cat# 69506). The extracted DNA samples were then sheared into fragments of 150-200 base pairs using sonication, and the fragment sizes were verified using the Agilent TapeStation with D1000 ScreenTape. The fragmented DNA underwent library preparation using the SureSelectXT Methyl-Seq Library Prep Kit. Thegenerated libraries were subsequently hybridized with the SureSelectXT Mouse Methyl-Seq capture set for 16 h at 65 °C, specifically targeting all CG regions including all annotated promoters, CG islands and shore regions (±2 kb from islands) as well as shelf regions (±2 kb from shores and ±4 kb from islands). The hybridized libraries were captured using DynaBeads™ MyOne™ Streptavidin T1 magnetic beads. The captured libraries were eluted from magnetic beads using 0.1 M NaOH. Unmethylated cytosine residues in the captured DNA libraries were then converted to uracil through bisulfite conversion using the EZ DNA Methylation-Gold1MKit from Zymo Research. Following bisulfite conversion, DNA was desulfonated and amplified via PCR. The amplified libraries were purified using AMPure XP beads. The purified libraries were indexed, allowing for the multiplexing of samples in a single sequencing run. Quantification of DNA libraries was performed using the TapeStation with D1000 ScreenTape. The libraries were normalized to a concentration of 4 nM, pooled together, and further diluted to a final concentration of 12 pM. The DNA libraries were sequenced on an Illumina MiSeq™ PE75 for quality control and sequenced on NextSeq®500 High PE75 to obtain DNA methylation profiles.
[0126] DNA methylation analysis - FASTQ files were accessed from bisulfite sequencing for quality control with FastQC and paired-end reads were trimmed for quality with Illumina’s BaseSpace sequence hub having MethylSeq v2.0.0. Trimming involved removing 3 nucleotides at the 5' end and 4 nucleotides at the 3' end, as well as adapter removal using FASTQ Toolkit v2.2. Only reads with a Q-score >30 were used for mapping, reads which did not meet criteria after trimming were discarded. Alignment of trimmed bisulfite converted sequences was carried out using Bismark Bisulfite Mapper v0.14.4 / Bowtie 2 v2.2.2 against the mouse reference genome (GRCm38 / mml0)68,69. Each sample yielded over 25 million aligned reads, resulting in an average target sequence coverage ranging from 18 to 20x. The aligned BAM files were processed using SAMtools v 1.270. After read mapping, methylation calling was carried out using the Bismark methylation extractor. The percentage of methylation was determined by calculating the ratio of methylated cytosines to the total number of cytosines covered in the genome for each specific cytosine position. Differential methylation analysis was primarily conducted in R v4.1.2, using MethylKit vl.20.071. Differentially methylated cytosines were determined from sites passing coverage criteria of minimum 10. Logistic regression was employed to determine differentially methylated sites between tissues, and p- values were adjusted using a false-discovery rate (q-value). Sites with q- value < 0.05 and methylation difference of >25% were considered statistically significant. For computing DMRs, criteria were set at a length of500 bp showing >10% average methylation difference. Gene annotation files for the mouse (GRCm38) were downloaded from Gencode and mapped with DMRs using BEDTools v2.30.071,72. Deconvolution analysis, a method for analyzing cellular heterogeneity based on methylation sequencing data36,73,74,75, was used to computationally assess tissue heterogeneity of cell populations. The computation was based on using DXM (Deconvolution of Subpopulations Existing in Methylation Data), a reference-free approach offering versatility across various Bisulfite Sequencing (BS) methodologies39 which was established in the literature to accurately infer cell-type proportions40. DXM’s initial module “dxm_estimateFracs” was used within the Python environment. Enrichr was used to perform KEGG pathway analysis, allowing the identification and enrichment analysis of genes within specific biological pathways76. Cytoscape, in conjunction with the String module, with confidence >0.4 as the cut-off criteria, was employed to construct protein-protein interaction network, visualization and analysis of interconnections between pathway components77,78.
[0127] Animal behavioral assays- All behavioral tests were performed in an isolated and designated mouse behavioral room. An anymaze video-tracking system (version 4.99 m, Stoelting®) connected with a digital camera and computer was used to record the activities of mice during behavioral procedures. Grip test: Each mouse was positioned on a square grid with a 1-cm mesh, which was then inverted 30 cm above a protective pad. The mouse was then allowed to hang by its paws for a specified period, and the duration for which the mouse remained suspended was recorded. Three repeats were performed for each animal with 30 min rest time between trials. Open field test: A mouse was placed in the lower right comer of a spacious, empty white plastic chamber (40 cm length x 40 width and x 40 cm height) and was allowed to freely move in the chamber while movement and behavior were recorded by the camera for 10 min. Y-maze test: A mouse was placed in the center of Y-maze apparatus and allowed to freely explore for 10 min. The time spent in each arm and the number of arm entries were recorded and analyzed. An entry was considered a success when all four limbs entered an arm. Novel object recognition: A mouse was allowed to freely explore an open-field box (40 cm in length, 40 cm in width, and 40 cm in height) for 10 min prior to experimental sessions. During the familiarization session, the mouse was then allowed to freely explore two similar objects for 10 min. During the test session, one of the two objects was replaced by a novel object for 10 min. The amount of time that the mouse spent exploring each object was recorded. A preference index was calculated using the ratio of the amount of time exploring each object over the total time exploring both objects. Morris water maze (MWM): The test was performed using a round water tank (90 cm in diameter)containing water at temperature of 22 to 23 °C and a non-toxic paint which was added to make opaque and white background. A circular, background color-matched platform with a diameter of 10 cm was placed 25 cm from the wall of the tank and about 1 cm below the water surface which was thus invisible. Animals were trained for 5 days, 4 training sessions each day, and the beginning positions for each training day were randomly chosen. At each training session, mice were placed in a beginning position in the maze and were trained to find the platform within 60 s. Latency to reach the platform of each trial was recorded. On the next day following 5-day training sessions, probe trials were performed by removing the platform and the animal was allowed to swim for 60 s and measured for swimming speed and the latency that the mouse swam to cross the location where the platform was previously located. Sociality: Social interaction was tested in a gray 3-chamber neutral box cage (60 cm in length, 40 cm in width, and 22 cm in height). For adaptation phase, animals were allowed to explore freely for 10 min in the neutral cage for habituating the testing conditions. For social affiliation phase, a new mouse (stranger) in a wire containment cup was placed in a side chamber. The subject mouse was allowed free access to explore each of three chambers for 10 min. For preference testing phase, a second new mouse (new stranger) in a wire containment cup was placed in the opposite side chamber. The subject mouse was allowed to freely explore each of three chambers for 10 min. The time spent in social interaction by sniffing was recorded.
[0128] Brain sections and immunostaining- To obtain brain samples, mice were anesthetized with 3-5% isoflurane inhalation and were transcardially perfused with saline over 5 min before brains were collected. Brain hemispheres were post-fixed with 4% PFA and then infiltrated with 20-30% sucrose for immunostaining. Brain sections were generated with a thickness of 20 pm using a cryostat. Brain sections were incubated overnight at 4 °C with a primary antibody, including anli-Af> (anti-fl-Amyloid, BioLegend®), rabbit anti-PTMS (Pierce® Biotechnology), rabbit anti-HA (Cell Signaling Technology®, 3724), rabbit anti- pH2A.X (Cell Signaling Technology®, 9178), rabbit anti-Sox2 (R&D Systems™, MAB2018), mouse anti-NeuN (Millipore®, MAB377), and mouse anti-HuC / D (Millipore®, A21271). Technical controls included appropriate species-matched naive IgGs. Following three washes, the sections were incubated with secondary antibody (Goat anti-mouse IgG antibody Alexa Fluor™ 555, Thermo Fisher, #A21422, 1:500), and after three washes, sections were covered with a mounting medium containing DAPI for visualizing the nuclei of cells in the sections. For Fluro-Jade C (FJC) staining, fluorescent FJC (Sigma™) was applied to frozen sections for 10 min at room temperature before washing and imaging. Brainsections were imaged for a target region using the LAS X software-equipped Leica Stellaris 8 confocal microscope.
[0129] Quantitative RT-PCR -The hypothalamus and hippocampus samples were obtained from standard male C57BL / 6 mice at the age of 2 vs. 15 months and from male 5xFAD mice and littermate male WT controls at the age of 8 months for extraction of total RNA using TRIzol™ reagent (Invitrogen™), followed by reverse transcription using High-Capacity RNA to cD A kit (Thermo Fisher) according to the manufacturer’s instructions. Quantitative real-time PCR was conducted using PowerUP1MSYBR1MGreen PCR Master Mix (Thermo Fisher) with specific primer sets (see below). 0-actin was used as a reference and changes were calculated using 2-AACt method.
[0130] Oxt: 5'-GCTGCCAGGAGGAGAACTAC-3' (SEQ ID NO:6); 5'- GGCAGCCATCTGCAAGAGAA-3'(SEQ ID NO:7)
[0131] Gnrhl: 5'-GCATTCTACTGCTGACTGTGTGTT-3' (SEQ ID NO:8); 5'- GTTCTGCCATTTGATCC ACCT-3' (SEQ ID NO:9)
[0132] Adcy3: 5'-TCTTTGACTGCTACGTGGTAGT-3' (SEQ ID NO:10); 5'- GGCCCGTGAAAAGTTCAGG-3'(SEQ ID NO: 11)
[0133] Adcy5: 5'-AAGATCCTCGGGGATTGTTACT-3' (SEQ ID NO:12); 5'- CTCCCGGACCAACGAGATG-3'(SEQ ID NO: 13)
[0134] Adcy7: 5'-AAGGGGCGCTACTTCCTAAAT-3'(SEQ ID NO: 14); 5'- GTGTCTGCGGAGATCCTCA-3'(SEQ ID NO: 15)
[0135] Adcy9: 5'-CAACAGCGTGAGGGTCAAGAT-3'(SEQ ID NO: 16); 5'- CATGGAGTCGAATTTGGGGTC-3'(SEQ ID NO: 17)
[0136] p-actin: 5'-CCTCTATGCCAACACAGTGC-3'(SEQ ID NO: 18); 5'-GCTAGGAGCCAGAGCAGTAA-3'(SEQ ID NO: 19)
[0137] RNA immunoprecipitation and sn / snoRNA assays - RNA immunoprecipitation assays were conducted using the EZ-Magna RIP Kit (Merck Millipore® 17-700, USA), brief, pre-equilibrated magnetic protein A / G beads (#88802, Thermo Scientific) and mouse IgG (#CS200621, Sigma) or anti-HA (#2367, Signaling Technology) were mixed and incubated at 4°C on a horizontal shaker overnight. The EVs were obtained from the cell culture media, purified and dissolved in lysis buffer, and incubated with a mixture of magnetic protein A / G beads and mouse IgG or anti-HA at 4°C on a horizontal shaker overnight. Finally, the mixture was spun down and sequentially resuspended with Proteinase K, TRIzol™, chloroform, isopropanol, and 75% ethanol. The final mixture was dissolved in DEPC water, target small RNAs in precipitates were quantified byqRT-PCR after polyadenylation and cDNA synthesis using the Lucigen poly(A) polymerase tailing kit (PAP5104H) and the SuperScript™ III First-Strand Synthesis System (18080-051; Invitrogen™) with a universal RT primer. For cellular small RNA levels, small RNAs were isolated from cells using mirVana™ miRNA isolation kit on the basis of the manufacturer’s instructions (Invitrogen™). Real-time qPCR using the SYBR™ Green PCR Master Mix (Applied Biosystems™) was performed for small RNAs. Relative levels of small RNAs in the cells were normalized according to levels of U6. PCR primer sequences of sn / snoRNA species are listed as follows:Gm22448: 5'-TTAGCATGGCCCCTGAACAA-3' (SEQ ID NO:20), Gm24407: 5'-TTTATCCGAGGCGCGATTAT-3'(SEQ ID NO:21), Gm23814: 5'-AAGGATGACACGCAAATTCG-3' (SEQ ID NO:22), Gm25313: 5'-ATTTCCGTGGAGAGGAACAA-3'(SEQ ID NO:23), Gm24265: 5'-AGCCAATGAGGTTTATCCGA-3' (SEQ ID NO:24), Rnu5g: 5'-CAGAGAAGATTAGCATGGCC-3' (SEQ ID NO:25), Gm25793: 5'-AGAGAAGATTAGCATGGCCC-3' (SEQ ID NO:26), Gm27607 5'-GGAGGGAGAACAAGTCTAGC-3' (SEQ ID NO:27), Gm22247: 5'-CTTTGGGACATTGGAATTGG-3' (SEQ ID NO:28), Gm25461: 5'-CCCAATGTCATGAAGAAAGGT-3 (SEQ ID NO:29), Gm22776: 5’-GATTGCCAGTCAAACATTCC-3’ (SEQ ID NO:30), Gm23787: 5'-CCAAGGTATGAGAGAGATGACG-3' (SEQ ID NO:31), Gm25133: 5'-TTCCTTTGTCAGTGGGGTCA-3' (SEQ ID NO:32), Scarna9: 5'-GAATTTTGTCACTGTGAAGGC-3' (SEQ ID NO:33), Gm22962: 5'-TATGGGGTTTCTGACCAAGG-3' (SEQ ID NO:34), Gm25087: 5'-GATGACAACCCAATGTCATGA-3' (SEQ ID NO:35), Gm23723: 5'-GGTAGCAGTTGTAGCATTCC-3' (SEQ ID NO:36), Snord90: 5'-ATAGGGCAGATTCTGAGGTG-3' (SEQ ID NO:37), AF357428: 5'-GATCTGATGGTGTCTGAGTG-3' (SEQ ID NO:38), Gm25635: 5'-GGACATTGAAATTGGCTGAG-3' (SEQ ID NO:39), Gm24518: 5'-CCCAGTCAAACATTCCTTGG-3' (SEQ ID NO:40), universal reverse primer: 5’- CAGTGC AGG GTC CGA GGT-3’ (SEQ ID N0:41)
[0138] Statistics and reproducibility - Sample sizes were designed considering the relevant literature for physiological, biochemical, histological experiments, and DNA bisulfite sequencing. Neurobehavioral tests were performed making group information blind to experimental performers when collecting the data. All physiological and histological results represented repeated observations independently and through complimentary approaches. All data with biological replicates were presented as mean ± S.E.M. Data were analyzed for parametric or non-parametric distributions with statistical tools such as Shapiro- Wilk test, D’Agostino-Pearson test, Anderson-Darling test, and Kolmogorov- Smirnov test. Data that followed parametric distribution were analyzed using ANOVA with Tukey’s multiple comparisons when involving more than two groups and two-tailed unpaired Student’s t-test when involving only two groups. Data that did not follow parametric distribution were analyzed including Kruskal-Wallis test and Dunn’s multiple comparisons when having more than two groups and two-tailed Mann-Whitney test when having only two groups. Additional statistics included logistic regression and Fisher’s Exact test contained in applied computational programs. Statistical significance of all data was determined at p < 0.05. For computing differential methylation sites and regions, logistic regression-based modeling was applied with a false discovery rate set at q < 0.05.EXAMPLE 1: Identification of OXT and GnRH co-relevance in aging through DNA epigenetic screening.We analyzed age-dependent differential methylation regions (DMRs) per DNA length ranging from 300 to 1,000 base pairs (bps). While the analysis yielded variable numbers of DMRs due to changes in DNA lengths, three brain regions consistently exhibited similar patterns, reflected by an analysis with DNA length of 500 bps (data not shown). Afterwards, we explored genes which were involved in age-related DMRs in these brain regions. Overall, we identified 173 genes mapped onto DMRs due to aging across all three brain regions (Fig. 1A). Subsequently, we conducted pathway analysis based on these 173 shared genes. As demonstrated in Fig. IB, many of these genes were associated with hypothalamic functions, notably including OXT signaling pathway and GnRH signaling pathway which are classically known for hypothalamic regulation of reproductive physiology. These results highlight asystemic analysis indicating OXT and GnRH co-relevance in aging-related conditions and a potential novel approach for addressing aging-related diseases.EXAMPLE 2: Age-related epigenetic changes of OXT and GnRH signaling components.
[0139] We performed further analysis focusing on individual brain regions to explore the specific molecular pathways affected by age-related changes in DNA methylation. Our investigation involved subsequent mapping of the genes associated with DMRs to a manually curated database of mouse cell signaling and metabolic pathways. Our findings highlighted the pathways which are influenced in terms of age-related differential DNA methylation, characterized by the number of genes and their collective significance. Specifically, the pathways identified for the hypothalamus contained many components in regulating circadian rhythms and the hypothalamic reproductive peptides OXT and GnRH network (data not shown). Of interest, the pathways identified for the hippocampus and OB are also found to be significantly related to hypothalamic regulatory functions, for example, the circadian entrainment pathway, reproductive OXT pathway, cortisol synthesis and secretion pathway, Cushing syndrome pathway, and aldosterone synthesis and secretion pathway for the hippocampus (data not shown) and the circadian entrainment pathway, OXT signaling pathway, and GnRH secretion pathway for OB (data not shown). Most notably, based on multiple computational approaches, reproductive neuropeptide OXT and GnRH pathways repeatedly emerged not only in the hypothalamus but also in the hippocampus and OB. Utilizing BOCS metadata, we investigated how aging affects the methylation statuses of genes encoding OXT signaling and GnRH signaling components. As laid out in Fig. 2, by middle age, many components in OXT signaling and GnRH signaling pathways show agedependent changes in DNA methylation status in the hypothalamus, hippocampus, and OB. Interestingly, in each brain region, a specific set of OXT and GnRH signaling components was differentially methylated between young and middle-age samples. Hence, aging is associated with diverse DNA methylation changes in the genes responsible for molecular components of OXT and GnRH signaling, with these variations being brain region-specific.EXAMPLE 3: DNA methylation and transcription of OXT and GnRH genes in aging or AD model
[0140] Given the relevance of OXT and GnRH pathways as revealed by our epigenetic screening and DMR analysis, we decided to directly examine methylation statuses of Oxt and Gnrhl genes between young and middle age. Since the hypothalamus exclusivelyproduces both peptides during adulthood, we focused on analyzing DNA methylation data from the hypothalamic samples. We found that a list of cytosines in gene body and promoter region of Oxt became hypomethylated, while a list of cytosines became hypermethylated in the hypothalamus by middle age (Fig. 3A). There was also a list of cytosines in Gnrhl gene body and promoter, which underwent hypomethylation or hypermethylation by middle age (Fig. 3B). Subsequently, we examined the mRNA levels of Oxt and Gnrhl in the hypothalamus of mice at young age (2 months) vs. middle age (15 months). Through qRT- PCR method, we obtained data showing that mRNA levels of Oxt and Gnrhl both dramatically dropped in the hypothalamus of mice during the transition from young age to middle age (Fig. 4A). Given our interest in aging-related disease, we employed 5xFAD mice, an aging-related AD model to assess if similar changes might occur in the hypothalamus prior to the onset of AD phenotype. Indeed, transcription of Oxt and Gnrhl were also both dramatically downregulated in the hypothalamus of 5xFAD mice compared to wildtype controls (Fig. 4B). In the context of these findings, we employed the 5xFAD model to study the potential significance of OXT and GnRH pathways in aging-related AD.EXAMPLE 4: DNA methylation and transcription of Adcy family members in aging or AD model
[0141] We analyzed how OXT signaling could be related to GnRH signaling using a protein-protein interaction program, showing a good number of co-components in OXT and GnRH signaling pathways which notably include multiple adenylate cyclase (Adcy) family members (Fig. 5). Modulating cAMP levels, Adcy members link OXT and GnRH stimulation to downstream protein kinases for regulating various events ranging from gene expression and neurotransmitter release to synaptic plasticity. Abnormal Adcy expression is found in and associated with many neurological disorders, including AD and depressive disorders. For instance, loss of Adcy5 results in Parkinson disease-like disorders, and Adcy 7 is linked to familial major depression in both mice and humans. Hence, our methylation analysis further narrowed down to the promoter regions of Adcy members given the important role of promoters on gene expression, focusing on the hippocampus because of its critical role in cognitive regulation. We found that total methylation levels in the promoter regions of several Adcy genes were significantly lower in mice of middle age compared to young age, while Adcy genes often underwent hypomethylation in the proximal promoter regions by middle age (Fig. 6A). In this context, we examined hippocampal mRNA levels and found that middle age was associated with significant downregulation across many Adcygenes (Fig. 6B). Also, we examined the hippocampus of 5xFAD model and observed that hippocampal mRNA levels of several Adcy members were lower in this AD model compared to littermate control (Fig. 6C). Taken together, hypothalamic transcription for Oxt and Gnrhl and hippocampal transcription for signaling components Adcy members are commonly defective in the aging model and the 5xFAD model.
[0142] These results revealed a substantial degree of interconnectivity between OXT and GnRH pathways, indicating strong potential for signaling and functional synergy. This integrated model supports the concept that OXT and GnRH do not function in isolation but instead operate within a coordinated network. In this context, interconnected components such as members of the adenylate cyclase (ADCY) family exhibit enzymatic activity that can amplify signaling in a synergistic, multiplicative, or even exponential manner, rather than through a simple additive effect.EXAMPLE 5: Synergistic effects of OXT-GnRH combinational treatment for treating AD in 5xFAD mouse model.
[0143] A few recent studies have suggested that OXT may improve cognition and reduce amyloid-0 accumulation in rodent models; however, it remained unclear whether OXT alone could effectively treat AD. Our study demonstrated that OXT alone was not effective for treating AD in mouse models. Also, although our earlier work suggested that GnRH may help slow normal aging, and it was also suggested to aid in the treatment of Down syndrome (a congenital disease not related to aging or age-related neurodegeneration), our recent study indicates that GnRH alone is insufficient to treat AD in animal models. Our results in Figs. 1 to 6 strongly suggest that OXT and GnRH are co-important for targeting aging-related neurological diseases. This background prompted us to investigate whether a combination of OXT and GnRH might exert a synergistic effect, leading to an effective therapeutic strategy for AD.Here, we studied a 9-month-old 5xFAD mouse model with strong manifestation of AD phenotypes, focusing to compare OXT-GnRH combinational treatment vs. individual peptide treatment. Nasal administration was used, a well-established method for delivering peptides into the brain to treat neurological diseases. To help discern the effects from combinational vs. individual treatment, OXT and GnRH were nasally administrated at relatively low doses (50 ng and 5 ng, respectively) and for a relative short treatment duration (2 months) in this trial.
[0144] After the completion of therapy, animals were assessed with a battery of non-invasive neurobehavioral assays, including an open field, grip strength, y-maze, novel object recognition, social interaction, and Morris water maze for various aspects of physical and cognitive functions. As demonstrated in Fig. 7A-7H, OXT-GnRH combinational treatment led to a strong effect against various neurological disorders compared to vehicle treatment in this AD model. In contrast, we observed absent effects from either single peptide treatment. We also assessed how OXT- GnRH therapy could affect Ap in this 5xFAD model at the end of the study, although Ap is not an important target for treating AD, it could be used as a biomarker of AD. OXT-GnRH combinational treatment led to a nearly complete reversal of Ap deposition (Fig. 8A-8D), which was consistent with the strong therapeutic effect of OXT-GnRH combination treatment.
[0145] The treatment effects were synergistic, given that individual peptides had no observable effect, whereas their combination led to robust therapeutic effect, therefore the combined action of the two peptides produced significantly greater effects than the sum of their individual actions. Moreover, this synergy was further supported by two-way ANOVA, which confirmed a significant interaction between OXT and GnRH. The superior efficacy of the combined treatment highlights the synergistic potential of these two neuropeptides, rather than additive effect, consistent with their signaling network. These results also highlight the characteristic that combined OXT-GnRH treatment produced broad therapeutic benefits in 5xFAD mice, while neither OXT nor GnRH alone achieved any significant effects. The behavioral rescue observed across multiple domains suggests that OXT-GnRH co-treatment restores integrated neuroendocrine and cognitive functions disrupted by AD pathology, supporting the translational potential of dual neuropeptide therapy.
[0146] The doses and treatment duration used in this study are standard for the 5xFAD model. Extending treatment duration or increasing doses is unlikely to enhance the effects of individual peptide treatments, as they are insufficient on their own to correct the key brain mechanism, which we have confirmed experimentally (see examples below). In contrast, combinational therapy is effective, and its synergistic action suggests that lower doses may still yield therapeutic benefits. Regarding delivery methods, although nasal administration was used in this study, we have evidence that alternative routes, such as subcutaneous or intravenous injection, are also effective. Example 6 below provides supporting data in a subsequent study involving a female AD model.
[0147] Given the observed and epigenetic changes of Adcy members in 5xFAD model (Fig. 6A), we additionally assessed how OXT-GnRH treatment vs. individual peptidetreatment might affect promoter methylation of these Adcy genes. Thus, we utilized the Next- Generation Sequencing-based Bisulfite Sequencing PCR (NGS-BSP) method to sequence the promoters of candidate Adcy genes, focusing on the proximal regions between CG island and encoding sequence. We performed target sequencing on hippocampal tissues obtained from the 5xFAD mice following combinational versus individual treatment with OXT and GnRH, as described in Fig. 7. The results (FIGs 9A-B) show the synergistic effects of OXT and GnRH on Adcy gene methylation in 5xFAD model. Following the completion of the therapeutic study in Fig. 7, DNA samples were obtained from the hippocampus of animals for the target bisulfite sequencing assay focusing on the proximal promoter regions of Adcy genes, represented by Adcy 7 (Fig. 9 A) and Adcy9 (Fig. 9B). These results show that, compared with treatment with individual peptides, OXT-GnRH co-treatment produced a markedly distinct pattern of Adcy promoter hyper- and hypomethylation. This finding provides additional evidence that the combined therapy acts synergistically rather than additively, reinforcing the concept that dual modulation of OXT and GnRH is required to effectively restore epigenetic and transcriptional regulation of key signaling genes in counteracting AD.EXAMPLE 6: The effect of OXT-GnRH co-treatment on aged female 5xFAD model.
[0148] Since the therapeutic studies in EXAMPLE 5 were conducted using male 5xFAD mice, we next investigated whether the treatment would also be effective in female 5xFAD mice. This is particularly relevant, as females exhibit more severe AD-like pathology than males in both human patients and the 5xFAD model. To increase the rigor of testing, we used aged female 5xFAD mice (approximately 1 year old), which exhibit advanced AD pathology and near-complete loss of learning and memory functions. In this study, we also tested an alternative delivery method via intravenous (tail vein) injection. Female 5xFAD mice received a 2-month combinational treatment of OXT (3 pg / kg) and GnRH (0.1 pg / kg), compared to groups receiving OXT alone (3 pg / kg) or vehicle control. This study did not include GnRH alone, because it was impractical to have a larger number of such aged female 5xFAD mice, but our evidence already confirmed that GnRH alone barely had effects even for treating AD which was less severe. Cognitive performance was assessed using the Morris Water Maze (MWM) training (Fig. 10A) and probe trial (Fig. 10B). Mice in the vehicle group showed no learning or memory despite a prolonged 7-day training period, consistent with the severity of AD pathology in this aged female model. OXT alone had no therapeutic effect, whereas the combined OXT-GnRH treatment resulted in a significant improvement inlearning and memory. These results suggest that OXT-GnRH co-treatment is effective in both sexes, supporting the generalizability of this therapeutic approach.EXAMPLE 7: Synergistic action of OXT-GnRH co-treatment in rejuvenating htNSCs and enhancing htNSC EVs for AD therapy.
[0149] Given the therapeutic synergy demonstrated between OXT and GnRH inAD models, we investigated how this combinational treatment could directly influence hypothalamic cell types. Through Immunostaining screening, we found that htNSCs, which are located in the 3V wall and positive with NSC biomarker Nestin, are the major hypothalamic cell type which can co-express OXT receptor and GnRH receptor (Fig. 11). This co-expression supports the idea that htNSCs are direct targets of both neuropeptides and capable of integrating their signals, providing a mechanistic basis for the observed synergy in our therapeutic studies.
[0150] To further develop a mechanistical study, we compared htNSC populations in 5-month-old male 5xFAD mice and wild-type littermates. Nestin staining showed a significant reduction in htNSCs of 5xFAD mice (Fig. 12A), which was further proved due to cellular senescence (data not shown). Furthermore, htNSCs derived from newborn 5xFAD and WT controls were cultured and assessed for EV secretion. Even when cell numbers were normalized to be the same for EV release assay, EVs were significantly less produced by htNSCs from 5xFAD model compared to WT control (Fig. 12B), which further contributed to reduced htNSC EVs in the AD model.
[0151] To test the therapeutic potential of the OXT-GnRH combination, 9- month-old male 5xFAD mice were treated intranasally for two months with OXT (50 ng), GnRH (5 ng), their combination, or vehicle. Following treatment, hypothalamic sections were analyzed for Nestin expression (Fig. 13 A), and quantification confirmed a significant increase in htNSC numbers only in the combinational treatment group (Fig. 13B). Neither OXT nor GnRH alone produced significant effects. Two-way ANOVA confirmed a statistically significant interaction between the two peptides, supporting a true synergistic effect. These findings demonstrate that OXT-GnRH co-treatment robustly rejuvenates the htNSC pool in AD mice.|00152| Further in vitro studies investigated how this combination therapy affectsEV secretion. Cultured htNSCs were treated with OXT (100 nM), GnRH (10 nM), their combination, or vehicle. Combinational treatment significantly enhanced both EV secretion(Fig. 14A) and biogenesis (Fig. 14B), while individual peptide treatments had no or modest effects (Figs. 14A-B). Two-way ANOVA again confirmed synergistic interactions between OXT and GnRH.
[0153] To determine whether htNSC EVs could serve as functional effectors ofOXT-GnRH therapy, we evaluated their therapeutic potential in two independent AD models. In the first model, ~8-month-old male 5xFAD mice were implanted with a cannula targeting the third ventricle and treated with htNSC-derived EVs (100 ng) or vehicle three times per week for four months (Fig. 15A). In the second model, 4-month-old male P301S tauopathy mice received intranasal htNSC EVs (1 pg) or vehicle three times per week for two months (Fig. 15B). In both models, EV treatment significantly improved neurobehavioral performance compared to controls. These findings indicate that htNSC-derived EVs can independently exert therapeutic effects in AD models and may serve as a downstream mechanism through which OXT-GnRH exerts its benefits.EXAMPLE 8: htNSC EVs containing PTMS and their decline in AD model
[0154] In our previous research, we appreciated that htNSCs can release PTMS which might be neuroprotective, but it was unknown if this protein could be physiologically or pharmacologically important for AD or other aging-related neurodegenerative diseases. Also, because PTMS is an acidic protein, which is unstable if directly released out of cells, it was unknown what format is required for secreting PTMS and if this format could be therapeutically important. We thus studied whether htNSC EVs might be important for containing and releasing PTMS. In the procedure, htNSC EVs were analyzed for canonical tetraspanin markers (CD63, CD81) alongside PTMS labeling to define EV subtypes. Results revealed that htNSCs abundantly produced and released PTMS-enriched EVs, particularly within the CD63+and CD81+subpopulations (Fig. 16A). Immunostaining further confirmed the presence of PTMS within htNSC-derived EVs across all three tetraspanin-defined EV subtypes (data not shown). To validate PTMS loading into EVs, we transduced htNSCs with a lentiviral vector encoding HA-tagged PTMS. Immunostaining for the HA epitope revealed efficient incorporation of exogenous PTMS into secreted EVs (Fig. 16B).
[0155] To investigate the molecular cargo associated with PTMS in htNSC EVs, we focused on small RNAs, as htNSC-derived EVs are known to be highly enriched in diverse small RNA species. Given the nuclear localization of PTMS, we studied whether PTMS may interact with small nuclear RNAs (snRNAs) and small nucleolar RNAs (snoRNAs), which are themselves confined to the nucleus and implicated in RNA processing,ribosomal biogenesis, and chromatin regulation. To explore this possibility, we used htNSCs transduced with a lentiviral construct encoding HA-tagged PTMS (data not shown), enabling us to perform HA-based immunoprecipitation (IP) assays on EV lysates. We curated a panel of approximately 50 sn / snoRNAs and screened for expression in our htNSC model using qPCR with species-specific primers. Approximately 20 sn / snoRNAs were confirmed to be robustly expressed in htNSCs and were therefore selected for further IP analysis. HA-IP was performed on lysates of purified htNSC EVs, and the specificity of enrichment was validated by using IgG as an isotype control. Our qPCR profiling revealed that multiple sn / snoRNA species were significantly enriched in the HA-PTMS pulldown compared to IgG control, indicating direct or complex-mediated interaction with PTMS in the context of EVs (data not shown). In addition, a number of microRNA species were also detected in PTMS pulldown assay. As a negative control, the same HA-IP procedure was performed using EVs derived from a non-hypothalamic neuronal cell line (Neuro-2A), which did not yield detectable pulldown of the sn / snoRNAs, supporting the specificity of the PTMS-sn / snoRNA interaction in htNSC EVs.
[0156] To study the relevance of the above findings to AD, we profiled PTMS- positive EVs in the cerebrospinal fluid (CSF) and observed that their abundance was significantly reduced in 5xFAD mice compared to WT littermates (Fig. 17). This was consistent with our observation that there is a pronounced decline in the htNSC population in 5xFAD mice compared to WT controls (Fig. 12A).EXAMPLE 9: AD-like phenotypes in PTMS knockout model and therapy by htNSC EVs.
[0157] Prompted by the above discovery, we investigated if loss of PTMS could be sufficient to cause neurological disease. Thus, we generated a PTMS knockout (KO) mouse model by deleting the genomic region encompassing exons 2 through 5, thereby removing most of the coding sequence, including the nuclear localization signal and zinc- binding domains). The KO line was established on a C57BL / 6 background. Heterozygous progenies were intercrossed to generate homozygous KO mice and wild-type (WT) littermate controls. We established longitudinal cohorts of KO and WT littermates for neurobehavioral evaluation. Under young adult conditions (2-6 months of age), PTMS-KO mice exhibited neurobehavioral performance comparable to that of WT controls. In contrast, under aged conditions (>20 months old), KO mice showed marked impairments, along with significantly shortened lifespan compared to WT mice (data not shown). Histological examination revealed no differences in gross brain morphology between young adult KO and WT mice.However, aged PTMS-KO mice developed pronounced neurodegenerative changes affecting multiple brain regions (Fig. 18A-C). Signs of neurodegeneration evidenced by reductions in the thickness of various brain regions such as the cortex and hippocampus were already evident in animals under middle-aged conditions, revealed by Fluoro-Jade C staining and pH2A.X immunostaining (data not shown). Together, these findings demonstrate that PTMS deficiency leads to progressive neurodegeneration and neurological decline in mice.[00158J We then studied whether the neurodegenerative phenotype observed in PTMS KO mice could be ameliorated by htNSC EVs. Middle-aged PTMS-KO animals were treated with either WT htNSC EVs, PTMS-deficient htNSC EVs, or vehicle control. EVs were administered i.c.v. at a dose of 100 ng per injection, three times per week, for a duration of three months. Neurobehavioral assessments were performed to evaluate physical, cognitive, and social function. Treatment with WT htNSC-derived EVs produced substantial improvements across these functional domains, whereas PTMS-deficient EVs exerted minimal effects. MWM data are shown in Fig. 18D-E as a representative neurobehavioral assay, other data are not shown. At the conclusion of treatment, brain tissues were harvested and analyzed for DNA damage using pH2A.X immunostaining. Consistent with the behavioral outcomes, WT htNSC EVs significantly reduced DNA damage across several brain regions, whereas PTMS-deficient EVs failed to confer similar protection (Fig. 18F-G). These findings demonstrate that neurodegenerative deficits in the PTMS-KO model can be markedly attenuated by htNSC EVs, in a manner dependent on the presence of PTMS.
[0159] To assess the long-term effect of hypothalamic PTMS delivery, we employed a lentiviral approach to induce PTMS overexpression in the mediobasal hypothalamus (MBH), testing if it could mitigate aging-related neurodegeneration. Using stereotactic delivery, we introduced a recombinant lentivirus encoding HA-tagged PTMS into the MBH of middle-aged mice. The lentiviruses were delivered into the third ventricle (3V) to target htNSCs lining the ventricular wall. To expand the MBH coverage, we additionally included bilateral injections of lentiviral PTMS under a neuron- specific promoter directly into the MBH parenchyma to transduce local neurons. Successful transduction of both htNSCs and MBH neurons was confirmed by immunostaining for HA-tagged PTMS versus HA-tagged scramble controls. A cohort of PTMS gain-of-function and control mice was thus established at middle age and monitored longitudinally into aged conditions. Our results revealed that aged control mice exhibited extensive neuronal DNA damage across multiple brain regions, whereas mice with PTMS gain-of-function displayed a marked reduction in these pathologies (data not shown). To assess whether this neuroprotection translated intosystemic aging benefits, we conducted a lifespan study in a larger cohort. Remarkably, hypothalamic PTMS gain-of- function conferred a significant longevity advantage. During this follow-up, cognitive performance was assessed using non-invasive behavioral assays. Mice with hypothalamic PTMS gain-of-function consistently outperformed controls in tests of novel object recognition, spatial memory, and social memory, indicating broad improvements in cognitive aging (data not shown). Together, these results demonstrate that increasing PTMS expression in the hypothalamus can attenuate aging-related neurodegeneration, improve cognitive function, and extend lifespan.EXAMPLE 10: PTMS-dependent role for the therapy of htNSC EVs against AD.
[0160] We then directly employed 5xFAD model to study if PTMS could be important for the therapeutic effect of htNSC EVs. Treatment was initiated at 5 months of age, a time point at which 5xFAD mice already exhibit significant cognitive deficits and neurodegenerative pathology, whereas WT controls remain phenotypically normal. To determine the role of PTMS in mediating therapeutic effects, we compared htNSC EVs either containing or missing PTMS. Using a daily intranasal administration regimen, we observed that treatment with WT htNSC EVs led to significant improvements in cognitive performance and social interaction in 5xFAD mice, whereas PTMS-deficient htNSC EVs produced minimal effects (Fig. 19A-F). At the conclusion of treatment, brain tissues were collected for pathological analysis. Consistent with behavioral findings, htNSC EVs markedly reduced DNA damage in the brain, while PTMS-deficient htNSC EVs were substantially less effective (Fig. 20A-C). Taken together, these results demonstrate that htNSC EVs possess robust therapeutic potential in an AD-like model and highlight the critical role of PTMS in mediating these anti-neurodegenerative effects.Discussion
[0161] This project started by computing age-related DNA methylation in the hypothalamus compared to two other limbic system components including the hippocampus and OB in mouse model. This computational analysis led to a surprising discovery that these brain regions co-involve age-related DNA methylation which commonly underlie multiple hypothalamic endocrine pathways and notably OXT and GnRH pathways. Hence, we intensively focused on hypothalamic neuropeptide OXT and GnRH pathways for potential therapeutic development. Following observation that OXT and GnRH were both downregulated at gene transcriptional levels in an aging-related AD model, we were furtherkeen to evaluate the effects of these two neuropeptides in combination versus individually for treating this AD model. This effort led to another major finding, that is, OXT-GnRH combinational therapy can yield a robust, synergistic and comprehensive effect against the severe symptoms in an aged 5xFAD mouse model, much more than by either individual peptide alone or the sum. This finding is significant for the field, as it provides a new strategy for targeting AD, which could potentially lead to clinical development.
[0162] For the downstream mechanism of OXT-GnRH combination, we demonstrated that PTMS -containing htNSC EVs are important. PTMS loss-of-function results in pronounced neurodegenerative pathology and reduced lifespan, whereas hypothalamic PTMS gain-of- function mitigates age-related neurodegeneration and extends both healthspan and lifespan. Notably, htNSC EVs conferred therapeutic benefits in two complementary models of neurodegeneration, including PTMS-deficient mice and the 5xFAD model, with effects that were PTMS-dependent.
[0163] Our study reveals that the anti-neurodegenerative effects of htNSC- derived EVs are linked to their capacity to attenuate neuronal DNA damage, a process that requires the presence of PTMS cargo. This finding is particularly relevant given that neurons, as post-mitotic cells, are highly vulnerable to cumulative genomic insults. Although the precise mechanisms by which PTMS confers DNA protection remain to be elucidated, we observed that PTMS associates with sn / snoRNAs within EVs, a class of small RNAs implicated in genome stability and stress responses. While it would be informative to dissect the specific roles of these sn / snoRNAs and other types of small RNAs, current limitations in selectively depleting or modifying these species within EVs present a significant technical challenge to direct functional validation. -
[0164] PTMS -containing EVs can also be produced by other hypothalamic or brain cell types, while htNSCs are particularly significant physiologically. Located along the 3V wall, htNSCs release EVs directly into the CSF, enabling their widespread distribution throughout the brain. Despite their relatively small population, the steady-state release of PTMS -containing EVs from htNSCs appears to constitute an essential support to brain and neuronal health. Overall, our findings support a conceptual framework in which htNSC- derived EVs represent an important neuroprotective secretome and therapeutic supplementation with such EVs offers a compelling strategy to combat neurodegeneration.
[0165] Materials and Methods for Examples 11 to 18.
[0166] Cell culture - Primary culture of htNSC was performed as we described previously. In brief, the hypothalamic tissue was dissected from newborn C57BL / 6 mice, cut into small pieces of approximately 1 mm3, and followed by digestion using TrypLE Express enzyme (Life Technologies™) for 10 min at 37°C. After centrifugation, cells were suspended in the neurobasal-A and B27 medium (NA / B27) medium containing neurobasal-A (Life Technologies), 2% B27 without vitamin A (Life Technologies™), 10 ng ml-1 EGF (Sigma- Aldrich), 10 ng ml-1 bFGF (Life Technologies™), 0.25% GlutaMAX supplement (Life Technologies™), and 1% penicillin-streptomycin, and were cultured under 37°C and 5% CO2. One week later, neurospheres were collected by centrifugation and trypsinized into single cells and continued to be sub-cultured in neurospheres, while NA / B27 medium was replaced every 2 days to completely remove debris due to death of other types of cells in this selection medium. Through this selection, htNSC population survived and gradually expanded in neurospheres and were weekly passaged. This htNSC model was established after 4 to 5 passages, and the identity of htNSC was confirmed through immunostaining with cell-specific biomarkers including Sox2 and Nestin, while it was also confirmed that htNSC did not contain any other cell types such as neurons, astrocytes, microglia, and oligodendrocytes through immunostaining of cell type-specific markers. Culture of neuronal models in this study included a generic neuronal cell line Neuro-2A (ATCC®) and two hypothalamic neuronal cell lines mHypoA-2 / 21 (Cedarlane®) and GT 1-7. Additional in-vitro system in this study included HEK293T (ATCC®). All these neuronal models were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin-streptomycin under 37°C and 5% CO2. All cell lines in experiments were free of microbial infection or mycoplasma contamination, and morphology and growth characteristics of these cells were confirmed consistent with published information and authenticity.
[0167] Mouse models - The PTMS knockout and conditional knockout founders (F0) were generated by Einstein’s transgenic core using CRISPR technology as established. In brief, a guide RNA (gRNA) targeting Intron 1 of Ptms gene denoted as Ptms gRNAl (targeting ggtgggagcctcagcgactc tgg (SEQ ID NO:4)) and a gRNA targeting a downstream sequence following exon 5 denoted as ptms gRNA2 (targeting tgatatagtgtgcactgctg agg (SEQ ID NO:5) were generated by in-vitro transcription. For generating knockout, two single stranded homologous donor DNAs were synthesized (IDT) mixed with Cas9 protein (PNB) and Ptms gRNA were injected into fertilized eggs of C57BL / 6 mice. The injected fertilized eggs were transferred to pseudo-pregnant CD1 femalemice for producing pups. Animals with the excision of Ptms exon 2 to 5 for knockout were screened through PCR and sequencing. Knockout founders were used to produce the next generation of mice (Fl) by mating with laboratory C57BL / 6 mice and have always been maintained in C57BL / 6 stain background. The heterozygous progenies were inbred to produce knockout mice and genetically-matched littermate controls for experiments. All mice were normally kept in standard, infection-free housing conditions, with 12 light / 12 dark cycles and 4-5 mice per cage. The 5xFAD mouse strain in this study was purchased from Jackson Laboratory. Standard C57BL / 6 mice at young and middle age in this study were from Jackson Laboratory and the National Institute on Aging (NIA) aging mouse breeding program. All animal models and use were approved by the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine (including 00001111, 00001385, 00001397, 00001398, 00001399 and their previously approved versions).
[0168] Brain procedures - Injections of lentiviruses into the MBH region and hypothalamic third ventricle wall were well established in our previous research. In brief, bilateral MBH injections were directed to the coordinates at -1.7 anterior-posterior and -5.8 dorsal-ventral from the bregma and at 0.25 lateral from the middle-line at each side, and injection of lentiviruses into the hypothalamic third ventricle within the MBH were based on the coordinates at -1.7 anterior-posterior and -5.0 dorsal- ventral from the bregma and at the middle line. Lentiviruses diluted in artificial CSF (aCSF) were injected under an ultra-precise stereotactic apparatus (David Kopf Instruments®) via a 26-gauge guide cannula and a 33- gauge internal injector (Plastics One®) connected to a 5- pl Hamilton syringe and infusion pump (WPI Instruments). The volume was 0.2 to 0.4 pl per site for MBH tissue injection, and 0.5 to 1.0 pl per hypothalamic third ventricle injection, and aCSF was used as the vehicle. For the procedure of CSF sampling, mice were placed on to an ultra-precise stereotactic apparatus (David Kopf Instruments®) under 2-3% isoflurane anesthesia, and CSF was collected through the exposed cistema magna using a bent 33G needle with tubing connected to 1-ml syringe under microscope; mice were euthanized following the collection. Animal treatment: animals were treated with ultracentrifugation-purified EVs through i.c.v. administration for a treatment period specified in each experiment. The injection was performed 3 times per week, and the dosage and duration are specified in each experiment. For i.c.v. treatment, a mouse received an injection of purified EVs suspended in 0.5 pl aCSF or vehicle control through an injection cannula pre-implanted into the third ventricle of the hypothalamus. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.
[0169] EV assays - EVs in the medium of cultured cells and the CSF were isolated and purified through the method of filtration and ultracentrifugation, as described in our previous work. EV-free media (through ultracentrifugation) were used in cell culture for releasing EVs. In brief, samples of EVs were pre-cleared by centrifugation at 2,000g for 10 min, followed by filtration with a 0.8-pm-pore-size filter (Corning). EV were pelleted by ultracentrifugation at 110,000g for 90 min and the pellet was resuspended with PBS. The quantity of EVs was assessed regularly through using the Pierce BCA protein assay kit (Thermo Fisher Scientific) and through using NanoSight LM10 system (Malvern Instruments Ltd). For nano-FCM, purified EVs were incubated with target antibodies and processed through the Flow Cytometry Core at Albert Einstein College of Medicine. In brief, EVs were stained with antibodies, including PTMS antibody (Pierce® Biotechnology) (Yu et al., 2020b) conjugated with APC (Lightning-Link®, abeam®, cat# ab201807), PE-conjugated CD63 antibody (BD biosciences, cat# BDB564222), PE / Dazzle 594-conjugated CD9 (Biolegend®, cat# 124822) and PE / Cyanin7-conjugated CD81 antibody (Biolegend®, cat# 104914). To enhance antibody penetration, EV samples underwent a few rounds of room temperature-ice switches and then incubated with antibodies on ice for 1 hour in the dark before being washed 3 times. Isotype controls stained with APC-conjugated rabbit IgG isotype control (Cell signaling technology®, cat# 12445s), PE-conjugated rat IgG2a, K isotype control (BE biosciences, cat# BD554689), PE / Dazzle 594 rat IgG2a, K isotype control (Biolegend®, cat# 400557) or PE / Cyanin7 conjugated armenian hamster IgG isotype control (Biolegend®, cat# 400921) was used to assess unspecific binding. Besides isotype controls, unstained control, buffer only control, buffer only with antibody controls and 0.1% triton X-100 detergent control for purity assessment were prepared and analyzed by Aurora™ spectral flow cytometer (Cytek™ Biosciences) under the same optimized condition. The threshold for side scatter (SSC) and forward scatter (FSC) were set to 1000, and the gain FSC, SSC, SSC-B, B2 (FITC), R1 (APC), YG1 (PE), YG3 (PE / Dazzle 594) and YG9 (PE / Cyanin7) detectors were set to 532, 1500, 138, 288, 137, 288, 217 and 328, respectively, with the aid of Apogee sizing beads (Apogee Flow Systems, cat #1527). Apogee beads contain a mixture of various reference size beads which were detected with gating strategy, and each bead population was separated from the noise population along with the SSC axis and B2 axis. Buffer control was used to calculate background noise. The same volume of samples was recorded for all samples with low flow rate (up to 15 ul / min) to minimize the swarming effect. Data was collected, analyzed and compensated using SpectroFlo software. The compensation was adjusted with unstained and single-color controls by the spectralunmixing, which considers the entire spectrum of fluorescence to distinguish the overlapping signals from different fluorescent channels. FlowJo software was used to generate plot images. EV labeling with PKH67 or PKH26 lipophilic dye (Sigma- Aldrich®) was performed according to the previously reported method with slight modifications. PKH26-labelled EVs were purified through ultracentrifugation with 30% sucrose in PBS solution to remove any unlabeled chemical. For immunostaining, purified EVs were applied to a coverslip, blocked with the serum of appropriate species, treated with primary antibodies, including rabbit anti- PTMS (Pierce® Biotechnology), rabbit anti-HA (Cell Signaling Technology®, 3724), rabbit anti-Sox2 (R&D Systems, MAB2018), mouse anti-CD9 (Santa Cruz), mouse anti-CD63 (Santa Cruz), mouse anti-CD81 (Santa Cruz), subsequently incubated with AlexaFluor™ 488 or 555-conjugated secondary antibodies. Technical controls included naive IgGs of the appropriate species. Images were captured using Leica SP8 confocal microscope.
[0170] Plasmids and recombinant lentiviruses - Plasmid plenti-CMV- m / .v- HA was obtained by inserting coding sequence of / rv-11 A into the plenti6 backbone (Invitrogen™) with BamHI and Xhol sites. HA was tagged at the C-terminal of PTMS to protect its N-terminal for secretion of this protein. The size-matched control sequence was based on scrambled version of ptms which was synthesized and verified by Genewiz® and was inserted into the plenti6 backbone to generate plenti-CMV-control-HA. The scrambled control sequence o ptms: 5-GGATCCGCCACCATGCGCGAAGAAAAAGAAGAT GAAAAAGATGAAGATGCGATGCTGAAACCGGAAGATAACGGCGAAGAAAAAGA AGCGGATGAAGTGGAAGGCGATACCGCGAAAGAAGATGAAACCCTGGCGGAAG CGGAACGCAGCGAAAAAGAAAAAGAAGAAGGCGCGGCGGAAGAAGCGGATGA ACGCGAAAAAGAAAAAGAAGAAAGCGAACGCACCGTGGATGAAGAAAACGAAA AAGAACAGAAAGGCAGCCCGGAAAGCAAAGCGAAAGAAGCGGGCGATGCGCGC GTGGTGGGCGTGGAAGAAGGAAGCGGATACCCATACGATGTTCCAGATTACGCT TGACTCGAG-3 (SEQ ID NO:42). Synapsin promoter-directed lentiviral vector was obtained by inserting ptms or its scrambled control sequence into the Synapsin lentiviral plasmid with BamHI and Pcil sites. Lentiviruses were produced by transfecting HEK293T cells with corresponding viral and packaging plasmids, purified by ultracentrifugation and titrated using p24 ELISA kit.
[0171] Western blot - Protein lysate was prepared by sonication in ice-cold RIP A lysis buffer (20 mM Tris-HCI, pH 7.4, 10 mM NaCl, 1 mM EDTA, 0.01 % SDS, 1 % Triton X-100 and lx protease inhibitor cocktail). Protein samples after heat denaturation were separated by SDS-PAGE and were transferred onto PVDF membranes, which were thenfixed, washed, blocked, and incubated with primary antibodies overnight at 4°C, then reacted with HRP-conjugated anti-rabbit (1:3000, Cell Signaling Technology®) or anti-mouse secondary antibody (1:3000, Cell Signaling Technology®) at room temperature for 40 to 60 min before Electrochemiluminescence (ECL) reaction and imaging. Primary antibodies included rabbit anti-PTMS antibody (1: 1000, Pierce® Biotechnology) (Yu et al., 2020b), rabbit anti-phospho-Histone H2A.X (1: 1000, Cell Signaling Technology®, 9178), rabbit anti- HA (1: 1000, Cell Signaling Technology®, 3724), rabbit anti-[3-Actin (1: 1000, Cell Signaling Technology® 4967), mouse anti-TSGlOl (1:1000, Santa cruz, sc-7964), and mouse anti- GAPDH (1:1000, Cell Signaling Technology®, 97166).
[0172] RNA immunoprecipitation (RIP) and RNA assays - RIP assays were conducted using the EZ-Magna RIP® Kit (Merck Millipore® 17-700, USA). In brief, preequilibrated magnetic protein A / G beads and mouse IgG or anti-HA (6E2, Cell Signaling Technology®) were mixed and incubated at 4°C on a horizontal shaker overnight. The EVs were obtained from the cell culture media, purified and dissolved in lysis buffer, and incubated with a mixture of magnetic protein A / G beads and mouse IgG or anti-HA at 4 °C on a horizontal shaker overnight. Finally, the mixture was spun down and sequentially resuspended with Proteinase K, TRIzol™, chloroform, isopropanol, and 75% ethanol. The final mixture was dissolved in DEPC water, target small RNAs in precipitates were quantified by qRT-PCR after poly adenylation and cDNA synthesis using the Lucigen® poly(A) polymerase tailing kit (PAP5104H) and the SuperScript® III First-Strand Synthesis System (18080-051; Invitrogen1M) with a universal RT primer. For cellular small RNA levels, small RNAs were isolated from cells using mirVana™ miRNA isolation kit on the basis of the manufacturer’s instructions (Invitrogen™). Real-time qPCR using the SYBR™ Green PCR Master Mix (Applied Biosystems™) was performed for small RNAs. Relative levels of small RNAs in the cells were normalized according to levels of U6 (forward: 5'- CTCGCTTCGGCAGCACA-3' (SEQ ID NO:43); reverse: 5'- AACGCTTCACGAATTTGCGT-3') (SEQ ID NO:44). PCR primer sequences of individual sn / snoRNA species are listed as follows:
[0173] Gm22448: 5'-TTAGCATGGCCCCTGAACAA-3'(SEQ ID NO:20),Gm24407: 5'-TTTATCCGAGGCGCGATTAT-3' (SEQ ID NO:21), Gm23814: 5'- AAGGATGACACGCAAATTCG-3' (SEQ ID NO:22), Gm25313: 5'- ATTTCCGTGGAGAGGAACAA-3' (SEQ ID NO:23), Gm24265: 5'- AGCCAATGAGGTTTATCCGA-3'(SEQ ID NO:24), Rnu5g: 5'- CAGAGAAGATTAGCATGGCC-3' (SEQ ID NO:25), Gm25793: 5'-AGAGAAGATTAGCATGGCCC-3' (SEQ ID NO:26), Gm27607 5'- GGAGGGAGAACAAGTCTAGC-3' (SEQ ID NO:27), Gm22247: 5'- CTTTGGGACATTGGAATTGG-3' (SEQ ID NO:28), Gm25461: 5'- CCCAATGTCATGAAGAAAGGT-3’ (SEQ ID NO:29), Gm23787: 5'- CCAAGGTATGAGAGAGATGACG-3' (SEQ ID N0:31), Gm25133: 5'- TTCCTTTGTCAGTGGGGTCA-3' (SEQ ID NO:32), Scarna9: 5'- GAATTTTGTCACTGTGAAGGC-3' (SEQ ID NO:33), Gm22962: 5'- TATGGGGTTTCTGACCAAGG-3'(SEQ ID NO:34), Gm25087: 5'- GATGACAACCCAATGTCATGA-3' (SEQ ID NO:34), Gm23723: 5'- GGTAGCAGTTGTAGCATTCC-3' (SEQ ID NO:35), Snord90: 5'- ATAGGGCAGATTCTGAGGTG-3' (SEQ ID NO:37), AF357428: 5'- GATCTGATGGTGTCTGAGTG-3'(SEQ ID NO:38), Gm25635: 5'- GGACATTGAAATTGGCTGAG-3' (SEQ ID NO:39), Gm24518: 5'- CCCAGTCAAACATTCCTTGG-3' (SEQ ID NO:40)
[0174] Neurobehavioral assays - All behavior assays were performed in a designated behavioral testing room. An Anymaze video-tracking system (Stocking®) equipped with a digital camera and computer was used for the course of animal behaviors in training and tests. The procedures including the following tests were slightly modified from our previous approaches. (1) The grip test: A mouse was lifted by the tail and placed on a homemade grid (1 cm mesh size), which was then inverted over a soft pad, and the mouse was allowed to hang by paws for 5 min. Three repeats were performed for each mouse with 10-min rest between trials. (2) Open field test: A mouse was placed into a comer of a white plastic chamber (40 cm length x 40 width and x 40 cm height) in an appropriate room environment. The mouse was allowed to freely explore the chamber, and locomotion was recorded for 10 min. (3) Novel object recognition: A mouse was allowed to freely explore an open-field box for 10 min before experimental sessions. During the familiarization session, the mouse was allowed to freely explore two similar objects, and then during test session, one of the two objects was replaced by a novel object for 10 min. Interval time between two sessions was 6 hours. The amount of time that the mouse spent exploring each object was recorded. A preference index was calculated using the ratio of the amount of time spent exploring novel object over the total time spent exploring both objects. (4) Y maze: The test was performed in a Y-shaped maze with three plastic arms with 120-degree angle from each other. A mouse was placed into one arm facing the center junction, and allowed to freely explore the maze for 10 min. An arm entry occurred when all 4 paws cross the arm-centerzone boundary with the mouse’ s snout towards the end of an arm. A spontaneous alteration occurred when the mouse made three consecutive arm entries of Y maze clockwise or counterclockwise. Y -maze index is defined as the number of spontaneous alternations divided by the total number of arm entries. (5) Social function test: The test occurred in a plastic three-chamber neutral box cage (plexiglas, 60 cm length, 40 cm width, 22 cm height). Each mouse was allowed to explore freely for 5 min in the cage to habituate to the testing conditions as adaptation phase. During the social affiliation session, a new mouse as Stranger 1 was placed in a wire containment cup that was located in one side chamber. Subject mouse was allowed free access to explore each of the three chambers for 10 min. During social recognition session, a second new mouse as Stranger 2 placed to a wire containment cup was put in the opposite side chamber. The subject mouse freely explored each of the three chambers for 10 min during two sections. The time spent in each chamber and time spent in sniffing were recorded to calculate social exploring index and social interaction index, respectively. (6) Morris water maze (MWM): The test was performed using a water tank that was filled with 22-23 °C water, crayola non-toxic paint was added to make opaque and white background. The diameter of the maze was 90 cm and virtually divided into four quadrants. A circular, background color-matched platform with a diameter of 10 cm was placed 25 cm from the wall of the tank, 0.5 to 1 cm below the water surface for its invisibility to mouse. Animals were trained for 4 or 5 days, 2 training sessions each day, and the starting positions of each training day were semi-randomly chosen. On each training day, mice were placed in the desired starting position in the maze and were trained to find the platform within 60 s, guided by a glass stirring rod if necessary. The latency to reach the platform of each trail was recorded. Spatial memory was assessed on the next day following the completion of the training session, by removing the platform, and the animal was allowed to swim for 60 s. The latency and number of times to cross the location of the former platform, and the swimming speed were measured. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.
[0175] Histology and biochemistry - Mice under anesthesia were transcardially perfused with PBS followed by 4% PFA, and then the brains and peripheral tissues were removed, PFA-fixed and equilibrated with 20-30% sucrose, followed by cryosectioning at a thickness of 10 pm (brain) or 20 pm (peripheral tissues). Tissue sections were blocked with the serum of the appropriate species, treated with primary antibodies at 4°C overnight, then washed and followed reaction with secondary antibodies and washing before imaging. Primary antibodies included rabbit anti-PTMS (Pierce® Biotechnology) (Yuet al., 2020b), rabbit anti-HA (Cell Signaling Technology®, 3724), rabbit anti-phospho- Histone H2A.X (Cell Signaling Technology®, 9178), rabbit anti-Sox2 (R&D Systems™, MAB2018), mouse anti-NeuN (Millipore®, MAB377), and mouse anti-HuCD (Millipore, A21271). Secondary antibodies included AlexaFluor™488 and 555-conjugated IgG. Technical controls included naive IgGs of the appropriate species. For PKH26 fluorescence, brain tissues were obtained from animals which received delivery of PKH26-labelled EVs using the same procedure described above and brain sections were used for co- immunostaining. For Fluro-Jade C (FJC) staining, fluorescent FJC (Sigma™) was applied to frozen sections for 10 min at room temperature before washing and immunostaining. DAPI in the mounting medium was used to reveal the nuclei of all cells. Images were captured using Leica SP8 confocal microscope. Nissl staining (Sigma™) was conducted on frozen brain sections according to the manufacturer’s instruction, and Nissl staining was scanned with Perkin Elmer® P250 High-Capacity side scanner. Images presented in this study represented observations based on at least 6 sections per animal and 4 animals per group across the middle of a target brain subregion. For biochemistry, PKH26 fluorescence in tissues of injected mice were measured by generating tissue lysates and examined under a microplate reader at excitation 485 nm and emission 525 nm (Molecular Devices), and the same tissue types from vehicle injection were used to provide noise which was subtracted for calculating fluorescence signal.
[0176] Statistics and reproducibility - All measured data were presented as mean ± SEM. Sample sizes with sufficient power were designed according to our published studies, relevant literature and preliminary studies. Animals as well as in-vitro models were randomized and randomly assigned into treatment versus control. All experiments were repeated independently or through complementary approaches. For neurobehavioral assays, an experimental performer was blind to group information before data being recorded, and researchers were arranged to perform independently to provide independent evaluations on key experiments of testing a hypothesis. Lifespan survey was based on natural death of animals, but when a mouse was under terminal stage suffering from severe complications and was expected to die within a few days or less, euthanasia was used per animal protocols following consultation with attending veterinarians. All numeric values were subjected to parametric analysis to evaluate parametric distribution. Only parametric data were analyzed using two-tailed unpaired Student’s t-test for 2-group comparisons and using ANOVA for >2-group comparisons followed by post-hoc Tucky’s test only after overall comparisons across all groups were statistically significant. Lifespan analysis was based on using Kaplan-Meier survival curve and p values were based on log-rank (Mantel-Cox) test. Software for performing statistics included GraphPad Prism and Excel, and p value of less than 0.05 was considered significant.
[0177] Aging-related neurodegeneration underlies a broad spectrum of neurological disorders, but the molecular mechanisms involved and corresponding therapeutic strategies remain undefined. Here, we investigate the role of the secretory protein parathymosin (PTMS) in aging, with a specific focus on associated neurodegenerative changes. In PTMS knockout (KO) mice, loss of PTMS led to severe, age-dependent neurodegeneration and reduced lifespan. Conversely, a hypothalamic PTMS gain-of- function model exhibited attenuated neurodegenerative phenotypes and extended lifespan. Mechanistically, we identified hypothalamic neural stem / progenitor cells (htNSCs) as a key source of extracellular vesicles (EVs) that contain PTMS. Within these EVs, PTMS interacts with small nuclear and nucleolar RNAs, with a function to protect recipient neurons from DNA damage. Therapeutically, administration of htNSC-derived EVs counteracted neurological deficits and DNA damage in both PTMS-KO mice and an Alzheimer’s disease (AD)-like 5xFAD model, in a PTMS -dependent manner. These findings establish PTMS as a key neuroprotective factor and position hypothalamic extracellular vesicles as a promising therapeutic platform for mitigating aging-associated neurodegenerative changes and diseases.
[0178] We developed a study to investigate whether specific secretory factors from the hypothalamus could provide therapeutic targets for aging-related neurodegeneration. In prior work, we conducted a screen for hypothalamic secretory proteins with rejuvenating potential and identified PTMS as a promising candidate. We found that PTMS is prominently present in the brain, with a distinct localization to neuronal nuclei. Biochemically, PTMS contains two zinc -binding domains and a bipartite nuclear localization signal, features that facilitate its interaction with chromatin components such as histones, implicating it in the regulation of gene expression and chromatin structure. However, it remained unexplored if PTMS could be a significant target in aging associated neurodegeneration.
[0179] Therefore, we generated multiple experimental models to investigate PTMS function in vivo. These included PTMS knockout mice to assess loss-of-function effects and hypothalamic site-specific overexpression models to examine gain-of-function impacts. Following the characterization of PTMS-containing EVs secreted by htNSCs, we developed therapeutic delivery strategies using htNSC-derived EVs to evaluate their neuroprotective capacity in two complementary animal models of neurodegeneration. Our findings establish PTMS as a key neuroprotective factor and show that hypothalamic EVseffectively elicit PTMS -dependent mechanisms to counteract neurodegenerative disease, including AD.
[0180] EXAMPLE 11 - Neurodegeneration Resulting from PTMS Loss-of- Function in a Mouse Model. Prompted by our recent discovery that PTMS is broadly expressed in the brain, we investigated its physiological role in vivo. To this end, we generated a PTMS knockout (KO) mouse model by deleting the genomic region encompassing exons 2 through 5, thereby removing most of the coding sequence, including the nuclear localization signal and zinc -binding domains (data not shown). The KO line was established on a C57BL / 6 background. Heterozygous progenies were intercrossed to generate homozygous KO mice and wild-type (WT) littermate controls. Loss of PTMS expression in the brains of KO mice was confirmed by immunostaining (data not shown). PTMS-KO mice exhibited normal development and growth. We established longitudinal cohorts of KO and WT littermates for neurobehavioral evaluation. Under young adult conditions (2-6 months of age), PTMS-KO mice exhibited neurobehavioral performance comparable to that of WT controls (data not shown). In contrast, under aged conditions (>20 months old), KO mice showed marked impairments (data not shown), along with significantly shortened lifespan compared to WT mice (data not shown).
[0181] Histological examination revealed no differences in gross brain morphology between young adult KO and WT mice. However, aged PTMS-KO mice developed pronounced neurodegenerative changes affecting multiple brain regions (Fig. 18A- C and data not shown). Importantly, signs of neurodegeneration were already evident in animals under middle-aged conditions (10-16 months old), as shown by Fluoro-Jade C staining (a chemical indicator of neurodegeneration; data not shown) and phosphorylated H2A.X (pH2A.X) immunostaining (a biomarker of DNA damage; data not shown). Together, these findings demonstrate that PTMS deficiency leads to progressive neurodegeneration and functional neurological decline in mice.
[0182] EXAMPLE 12 - Protection against Aging-Related Neurodegeneration by Hypothalamic PTMS. Given that PTMS-KO model involved global gene deletion, we next sought to determine whether the observed neurodegenerative phenotype could be attributable to PTMS deficiency specifically within the brain. To address this, we employed a site-specific gain-of-function approach to test whether targeted elevation of PTMS expression in the hypothalamus could mitigate aging-related neurodegeneration. We focused on the mediobasal hypothalamus (MBH), the location containing htNSCs which we initially identified as a key source of producing PTMS. Using stereotactic delivery, weintroduced a recombinant lentivirus encoding HA-tagged PTMS into the MBH of middle- aged mice. The lentiviruses were delivered into the third ventricle (3V) to target htNSCs lining the ventricular wall. To expand the MBH coverage, we additionally included bilateral injections of lentiviral PTMS under a neuron- specific promoter directly into the MBH parenchyma to transduce local neurons. Successful transduction of both htNSCs and MBH neurons was confirmed by immunostaining for HA-tagged PTMS versus HA-tagged scramble controls (data not shown). Low-magnification hypothalamic imaging and examination of extra-hypothalamic regions confirmed the anatomical specificity of MBH- targeted lentiviral delivery (data not shown). A cohort of PTMS gain-of-function and control mice was thus established at middle age and monitored longitudinally into aged conditions. We found that aged control mice exhibited extensive neuronal DNA damage across multiple brain regions, whereas mice with PTMS gain-of-function displayed a marked reduction in these pathologies (data not shown). To assess whether this neuroprotection translated into systemic aging benefits, we conducted a lifespan study in a larger cohort. Remarkably, hypothalamic PTMS gain-of-function conferred a significant longevity advantage. During this follow-up, cognitive performance was assessed using non-invasive behavioral assays. Mice with hypothalamic PTMS gain-of-function consistently outperformed controls in tests of novel object recognition, spatial memory, and social memory (data not shown), indicating broad improvements in cognitive aging. Together, these results demonstrate that increasing PTMS expression in the hypothalamus can attenuate aging-related neurodegeneration, improve cognitive function, and extend lifespan.
[0183] EXAMPLE 13 - Subtypes of Hypothalamic EVs Characterized by PTMS Content. While the hypothalamus is classically recognized for its secretion of neuropeptides, we previously uncovered an additional role for htNSCs in releasing EVs. Separately, we have reported that htNSCs are also a key source of PTMS in the hypothalamus (Yu et al., 2020b). These findings prompted us to investigate whether htNSCs serve as a major source of PTMS-containing EVs. To address this, we utilized a purified in vitro htNSC model developed in our prior studies. These htNSCs were enriched through serum-free neurosphere culture in N2 / B27 medium, which supports self-renewal of htNSCs while depleting other cell types. After serial passaging, the resulting cell population was highly enriched for htNSCs. For comparison, we included a hypothalamic neuronal cell line (htNeuron; mHypoA-2 / 21) obtained from Cedarlane, previously validated in several studies. Equal numbers of htNSCs and htNeurons were cultured in EV-depleted medium, and EVs were isolated via ultracentrifugation following a standardized incubation period. EVs wereanalyzed using nano-flow cytometry for canonical tetraspanin markers (CD9, CD63, CD81) alongside PTMS labeling to define EV subtypes. Both cell types were found to secrete PTMS-positive EVs; however, htNSCs generated significantly more PTMS-enriched EVs, particularly within the CD63+and CD81+subpopulations (Fig. 16A-B, and data not shown). Immunofluorescence staining further confirmed the presence of endogenous PTMS within htNSC-derived EVs across all three tetraspanin-defined EV subtypes (data not shown). To validate PTMS loading into EVs, we transduced htNSCs with a lentiviral vector encoding HA-tagged PTMS (Fig. 16B). Immunostaining for the HA epitope revealed efficient incorporation of exogenous PTMS into secreted EVs (Fig. 16B), confirming that PTMS can be experimentally introduced into htNSC-derived EVs through targeted expression. Together, these findings demonstrate that htNSCs are a major source of PTMS-positive EVs in the hypothalamus and are capable of producing both endogenous and engineered forms of this neuroprotective cargo.
[0184] EXAMPLE 14 - PTMS Associates with Small Nuclear and Nucleolar RNAs in htNSC-Derived EVs. To investigate the molecular cargo associated with PTMS in htNSC-derived EVs, we focused on small RNAs, as htNSC-derived EVs are known to be highly enriched in diverse small 8 RNA species. Given the nuclear localization of PTMS, we studied whether PTMS may interact with small nuclear RNAs (snRNAs) and small nucleolar RNAs (snoRNAs), which are themselves confined to the nucleus and implicated in RNA processing, ribosomal biogenesis, and chromatin regulation.
[0185] To develop this study, we used htNSCs transduced with a lentiviral construct encoding HA-tagged PTMS, enabling us to perform HA-based immunoprecipitation (IP) assays on EV lysates. We curated a panel of approximately 50 sn / snoRNAs based on recent literature and screened for expression in our htNSC model using qPCR with species-specific primers. Approximately 20 sn / snoRNAs were confirmed to be robustly expressed in htNSCs and were therefore selected for further IP analysis. HA-IP was performed on lysates of purified htNSC-derived EVs, and the specificity of enrichment was validated by using IgG as an isotype control. Our qPCR profiling revealed that multiple sn / snoRNA species were significantly enriched in the HA-PTMS pulldown compared to IgG control, indicating direct or complex-mediated interaction with PTMS in the context of EVs (data not shown). A number of microRNA species were also pulled down by PTMS in these EVs. As a negative control, the same HA-IP procedure was performed using EVs derived from a non-hypothalamic neuronal cell line (Neuro-2A), which did not yield detectablepulldown of the sn / snoRNAs (data not shown), supporting the specificity of the PTMS- sn / snoRNA interaction in htNSC-derived EVs.
[0186] EXAMPLE 15 - PTMS-dependent Small RNA Transfer into Neurons by htNSC-Derived EVs. We next asked whether these sn / snoRNAs could be transferred to recipient cells via PTMS -containing EVs. Based on prior studies indicating efficient uptake of htNSC-derived EVs by neurons, we used several cell lines such as GT1-7 hypothalamic neuronal cells as recipient models. To block endogenous RNA synthesis and isolate transferred RNA species, recipient cells were pretreated with a transcriptional inhibitor before being exposed to htNSC-derived EVs for a brief 1-hour incubation. After EV exposure, cells were washed and harvested for RNA analysis via qPCR. To rigorously test PTMS dependency, we compared the effects of EVs released by htNSCs from WT and PTMS-KO mice. These EVs exhibited comparable size profiles and expression of canonical tetraspanin markers, indicating that the loss of PTMS did not alter general EV characteristics. The results demonstrated that PTMS -positive EVs effectively delivered sn / snoRNAs into recipient neurons, as evidenced by a marked increase in these RNA species within GT 1-7 cells following treatment (data not shown). In addition, a number of microRNA species were found deliverable to recipient cells in a PTMS-dependent manner. In contrast, cells treated with PTMS -deficient EVs showed no such increase, likely due to the absence of PTMS- mediated RNA binding and cargo stabilization. These observations indicate that PTMS is essential for associating with sn / snoRNAs in htNSC-derived EVs and for facilitating their efficient transfer into recipient neurons. Together, these findings establish PTMS as a molecular chaperone for small RNAs and particularly sn / snoRNAs within hypothalamic EVs, enabling functional RNA delivery to target cells.
[0187] EXAMPLE 16 - Protection against DNA damage by htNSC-derived EVs containing PTMS. Recent studies have implicated sn / snoRNAs in cellular defense mechanisms against DNA damage. In light of our finding that PTMS facilitates the transfer of sn / snoRNAs via htNSC-derived EVs, we investigated whether this PTMS-sn / snoRNA complex contributes to genomic protection in recipient neurons. To address this, we developed an in vitro system using the hypothalamic neuronal cell line GT 1-7, in which nuclear DNA damage was induced by ultraviolet (UV) light exposure. We compared the effects of PTMS-containing versus PTMS-deficient htNSC EVs, previously characterized and matched for size and surface markers (data not shown), on DNA damage outcomes. Following UV exposure, recipient neurons displayed elevated levels of phosphorylated histone H2A.X (pH2A.X), a canonical marker of DNA double-strand breaks. Notably, thisUV-induced pH2A.X signal was substantially attenuated in the presence of PTMS-containing htNSC EVs, but only minimally reduced by PTMS -deficient EVs (data not shown), indicating that PTMS confers protective capacity against DNA damage. To further test whether small RNAs are essential mediators of this effect, we generated a Dicer knockdown model in htNSCs to impair biogenesis of small RNAs. Dicer knockdown led to an about 70% reduction in small RNA content within EVs, while preserving overall EV size distribution and tetraspanin expression (data not shown). Strikingly, Dicer-deficient htNSC-derived EVs failed to protect recipient neurons from UV-induced pH2A.X accumulation (data not shown), mirroring the effects of PTMS -deficient EVs. Together, these results demonstrate that the PTMS-small RNA system within htNSC-derived EVs plays a crucial role in protecting recipient neurons from DNA damage. This EV-mediated neuroprotective mechanism may represent a therapeutic axis for mitigating neurodegeneration associated with genomic instability.
[0188] EXAMPLE 17 - Effects of htNSC-derived EVs on Neurological Dysfunction in PTMS Knockout Model. We then decided to study whether the neurodegenerative phenotype observed in PTMS KO mice could be ameliorated by htNSC- derived EVs. Prior to therapeutic intervention, we characterized the biodistribution and cellular uptake of htNSC-derived EVs in the brain following intracerebroventricular (i.c.v.) administration of a therapeutic dose. To this end, EVs were labeled with the fluorescent membrane dye PKH26 and tracked in vivo (data not shown). Compared to vehicle control which did not yield any signal, uptake of htNSC-derived EVs in the brain was specifically visualized through PKH26 fluorescence. We confirmed that neurons are major recipients of these EVs (data not shown). Following i.c.v. injection, EVs were rapidly taken up by neurons in the hypothalamus and, to a lesser extent, in extra-hypothalamic regions such as the cortex. Co-localization with the neuronal marker NeuN revealed that the majority of EVs were internalized by neurons. Notably, many EVs trafficked into the perinuclear and nuclear compartments of recipient neurons. Time-course analysis revealed that neuronal uptake began within 1-2 hours post-injection and persisted for more than 24 hours (data not shown). We then evaluated whether administration of htNSC-derived EVs, compared to PTMS- deficient htNSC EVs, could influence neurological outcomes in PTMS-KO mice. Middle- aged PTMS-KO animals were treated with either WT htNSC EVs, PTMS -deficient htNSC EVs, or vehicle control. EVs were administered i.c.v. at a dose of 100 ng per injection, three times per week, for a duration of three months. Neurobehavioral assessments were performed to evaluate physical, cognitive, and social function. As shown in Fig. 18A-G, treatment withWT htNSC-derived EVs produced substantial improvements across these functional domains, whereas PTMS -deficient EVs exerted minimal effects. At the conclusion of treatment, brain tissues were harvested and analyzed for DNA damage using pH2A.X immunostaining. Consistent with the behavioral outcomes, WT htNSC EVs significantly reduced DNA damage across several brain regions, whereas PTMS-deficient EVs failed to confer similar protection (data not shown). These findings demonstrate that neurodegenerative deficits in the PTMS-KO model can be markedly attenuated by htNSC-derived EVs, in a manner dependent on the presence of PTMS.
[0189] EXAMPLE 18 - Anti-Neurodegenerative Effects of htNSC EVs in the 5xFAD Mouse Model. To extend our investigation into aging-related neurodegeneration, we examined the therapeutic potential of htNSC EVs in 5xFAD mouse model with AD-like neurodegeneration, which recapitulates hallmark features of AD-related neurodegenerative disorders. We first profiled endogenous htNSCs in 5xFAD mice and found a pronounced decline in the htNSC population beginning in early life (Fig. 12A and data not shown). Using nano-flow cytometry, we further quantified PTMS -positive EVs in the cerebrospinal fluid (CSF) and observed that their abundance was significantly reduced in 5xFAD mice compared to WT littermates (Fig. 17 and data not shown). In this context, we initiated a therapeutic study to evaluate whether htNSC-derived EVs could attenuate disease progression in 5xFAD mice. Treatment was initiated at 5 months of age, a time point at which 5xFAD mice already exhibit significant cognitive deficits and neurodegenerative pathology, whereas WT controls remain phenotypically normal. To determine the role of PTMS in mediating therapeutic effects, we compared htNSC-derived EVs either containing or missing PTMS, as previously characterized. To enhance translational relevance, we employed intranasal administration, a non-invasive route amenable to repeated dosing and more applicable in clinical settings. This approach is further supported by recent studies demonstrating brain delivery of EVs via the nasal route. Notably, when we compared therapeutic doses delivered by intranasal versus i.c.v. administration, intranasal delivery proved more effective in targeting outer brain regions such as the olfactory bulb and cortex (data not shown). Using a daily intranasal administration regimen, we observed that treatment with WT htNSC EVs led to significant improvements in cognitive performance and social interaction in 5xFAD mice, whereas PTMS-deficient htNSC EVs produced minimal effects (Fig. 19A-F). Importantly, neither EV treatment altered behavioral performance in WT mice, indicating that the observed benefits were specific to the neurodegenerative context. At the conclusion of treatment, brain tissues were collected for pathological analysis. Consistent with behavioral findings, htNSC EVsmarkedly reduced DNA damage in the brain, while PTMS -deficient htNSC EVs were substantially less effective (Fig. 20A-C, and data not shown). Taken together, these results demonstrate that htNSC EVs possess robust therapeutic potential in an AD-like model and highlight the critical role of PTMS in mediating these anti-neurodegenerative effects.
[0190] Discussion. In this study, we identified PTMS as a previously unrecognized neuroprotective factor. Using mouse models, we demonstrated that PTMS loss- of- function results in pronounced neurodegenerative pathology and reduced lifespan, whereas hypothalamic PTMS gain-of-function mitigates age-related neurodegeneration and extends both healthspan and lifespan. Mechanistically, we discovered that specific subtypes of hypothalamic EVs, in particular those secreted by htNSCs, are critical for carrying and transferring PTMS. Notably, EVs derived from htNSCs conferred therapeutic benefits in two complementary models of neurodegeneration, including PTMS-deficient mice and the 5xFAD model, with effects that were PTMS-dependent.
[0191] Our study reveals that the anti-neurodegenerative effects of htNSC- derived EVs are linked to their capacity to attenuate neuronal DNA damage, a process that requires the presence of PTMS cargo. This finding is particularly relevant given that neurons, as post-mitotic cells, are highly vulnerable to cumulative genomic insults. Although the precise mechanisms by which PTMS confers DNA protection remain to be elucidated, we observed that PTMS associates with sn / snoRNAs within EVs — a class of small RNAs implicated in genome stability and stress responses. While it would be informative to dissect the specific roles of these sn / snoRNAs, current limitations in selectively depleting or modifying these species within EVs present a significant technical challenge to direct functional validation. In conclusion, this study uncovers a previously unrecognized role for PTMS, delivered via htNSC-secreted EVs, in protecting against neuronal DNA damage and preserving brain and neuronal health. These findings offer a proof-of-concept for harnessing hypothalamic EV-based strategies including PTMS -loaded vesicles as a therapeutic avenue to counteract aging-associated neurodegenerative diseases.
[0192] The use of the terms “a” and “an” and “the” and similar referents (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms first, second etc. as used herein are not meant to denote any particular ordering, but simply for convenience to denote a plurality of, for example, layers. The terms “comprising”, “having”, “including”, and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. “About” or “approximately”as used herein is inclusive of the stated value and means within an acceptable range of deviation for the particular value as determined by one of ordinary skill in the art, considering the measurement in question and the error associated with measurement of the particular quantity (i.e., the limitations of the measurement system). For example, “about” can mean within one or more standard deviations, or within + 10% or 5% of the stated value.Recitation of ranges of values are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. The endpoints of all ranges are included within the range and independently combinable. All methods described herein can be performed in a suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention as used herein.
[0193] While the invention has been described with reference to an exemplary embodiment, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims. Any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
What is claimed is:
1. A composition comprising oxytocin (OXT), an analog or a variant thereof and Gonadotropin releasing hormone (GnRH), an analog or a variant thereof.
2. The composition of Claim 1, further comprising extracellular vesicles (EVs) derived from native hypothalamic neural stem / progenitor cells (htNSCs) or derived from a native or cultured cell type which is found to resemble htNSCs or a reprogram-induced htNSC-like cell, or vesicles containing parathymosin or loaded with parathymosin.
3. The composition of claim 1 or 2, wherein the composition in a pharmaceutical dosage form.
4. The composition of claim 3, wherein the dosage form comprises 0.1 to 1000 micrograms, or 1 to 500 micrograms, or 1 to 50 micrograms of each of OXT and GnRH.
5. The composition of claim 3, wherein the dosage form comprises 0.1 to 1000 micrograms, or 1 to 500 micrograms, or 1 to 50 micrograms of EVs comprising PTMS.
6. The composition of any of claims 3-5, wherein the dosage form is an injectable or intranasal dosage form.
7. The composition of any one of claims 1-6, for use in treating an aging -related neurological disease or disorder.
8. A method for treating a subject with an aging-related neurological disease or disorder, comprising administering to the subject a composition according to any one of claims 1-6.
9. The method of claim 8, wherein the composition is administered once or multiple times daily, once or multiple times weekly, once or multiple times monthly.
10. The method of any one of claims 8 or 9, wherein the OXT and GnRH are administered together, either in the same dosage form or in separate dosage forms but at the same time.
11. The method of any one of claims 8-9, wherein the EVs are administered together with OXT and GnRH, either in the same dosage from or in separate dosage forms but at the same time.
12. The method of any one of claims 8-9, wherein the OXT and GnRH are administered sequentially.
13. The method of any one of claim 8-9, wherein the EVs are administered sequentially after or before OXT and GnRH.
14. The method of any one of claims 8-13, wherein the aging-related neurological disease is Alzheimer’s disease, Parkinson’s disease, dementia, motor neuropathy, Down syndrome, Creutzfeldt- Jakob disease, hereditary cerebral hemorrhage with Dutch type amyloidosis, HIV-associated dementia, or cognitive changes due to Amyotrophic Lateral Sclerosis (ALS).
15. The method of claim 14, wherein treating results in improvement of a symptom of the aging-related neurological disease or disorder, or an amelioration of a physiological symptom associated with the disease or disorder, or retarding of a further neurological deterioration or degeneration due to the disease or disorder.
16. The method of claim 15, wherein a physiological symptom associated with the disease of disorder includes body weight, locomotion or spontaneous activity, motor function, neuropsychiatric behavior, neuromuscular integrity, spatial memory, spatial learning, socialization, working memory function, social interaction, recognition memory.
17. The method of claim 16, wherein treating results in reducing, delaying or slowing amyloidogenesis or amyloid plaque deposition in brain tissue.
18. A composition comprising extracellular vesicles (EVs) derived from native hypothalamic neural stem / progenitor cells (htNSCs) or derived from a native orcultured cell type found to resemble htNSCs or a reprogram-induced htNSC-like cell, or vesicles which natively contain parathymosin or loaded with parathymosin.
Citation Information
Patent Citations
Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases
US20050260186A1
Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminogly ycanases
US20060104968A1