Methods and compositions for dosing a cell therapy for parkinson's disease
Administering midbrain dopaminergic progenitor cells expressing FOXA2+/LMX1+ addresses the limitations of current Parkinson's disease therapies by improving cell engraftment, proliferation, and innervation, reducing disease burden and symptoms through targeted cell therapy.
Patent Information
- Application Number
- PCT/US2025/045820
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-18
- Filing Date
- 2025-09-10
- Publication Date
- 2026-03-26
AI Technical Summary
Current Parkinson's disease therapies are symptomatic and do not arrest or reverse the disease process, necessitating improved methods for cell therapy that enhance viability, engraftment, proliferation, migration, and differentiation of administered cells.
Administering a first dose of midbrain dopaminergic progenitor cells expressing FOXA2+/LMX1+ cells, followed by consecutive doses if necessary, at specific depositional sites, to treat Parkinson's disease, with each trajectory containing 8 sites and a volume of 1-5 pL, and administering cells within 1-10 hours or 6-12 months.
The method leads to a reduction in Parkinson's disease burden by improving engraftment, proliferation, migration, and innervation, potentially reducing symptoms such as tremor, bradykinesia, flexed posture, and rigidity, and enhancing dopamine neuron survival and function.
Smart Images

Figure US2025045820_26032026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: 87874.01416Methods And Compositions for Dosing a Cell Therapy For Parkinson’s DiseaseCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 696.340, filed on September 18, 2024 and entitled “Methods And Compositions for Dosing a Cell Therapy For Parkinson's Disease,” the entire contents of which are incorporated by reference herein.SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing XML which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The attached sequence listing is 8 KB in size and has the file name “87874_01450.xml” and has a production date of September 19, 2024.FIELD OF THE INVENTION
[0003] The disclosure relates to cell therapy involving the administration of cells, and methods, compositions, and articles of manufacture for use in the same.BACKGROUND
[0004] Cell therapy is a therapy in which viable cells are injected, grafted or implanted into a patient in order to effectuate a medicinal effect. Improved methods are needed, for example, to improve viability, engraftment, proliferation, migration, innervation, and / or differentiation of the administered cells.
[0005] Current Parkinson’s disease (PD) therapies are symptomatic, mostly focused on ameliorating motor deficits. Since no current PD therapy arrests or reverses the disease process, there is a major unmet need for new and effective PD treatments. Provided are methods, compositions, and articles of manufacture that meet such needs.SUMMARY
[0006] Disclosed is a method of treatment, comprising, consisting of, or consisting essentially of administering to a subject having a disease or condition a first dose of cells expressing both forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 (LMX1)Attorney Docket No.: 87874.01416(F0XA2+ / LMX1+), the first dose comprising no more than about 10 x 106cells / hemisphere to 5 trajectories, each trajectory with 8 depositional sites.
[0007] Disclosed is a method of treating Parkinson's disease, comprising, consisting of, or consisting essentially of: (a) administering to a subject having a disease or condition a first dose of midbrain dopaminergic progenitor cells expressing both forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 (LMX1) (FOXA2+ / LMX1+), the first dose comprising no more than about 10 x io6cells / hemisphere to 5 trajectories, each trajectory with 8 depositional sites. In some embodiments, a consecutive dose or a plurality of consecutive doses of midbrain dopaminergic progenitor cells expressing FOXA2+ / LMX1+ is / are administered to the patient the consecutive dose(s) comprising no more than about 10 x 106cells / hemisphere administered to 5 trajectories, each trajectory with 8 depositional sites. In some embodiments, the consecutive dose(s) is / are administered between 1 minute and 10 hours of the administration in (a). In some embodiments, the consecutive dose(s) is / are administered between 6-12 months of the administration in (a). In some embodiments, the midbrain dopaminergic progenitor cells in the consecutive dose(s) is / are identical to the administered cells in the first dose or is substantially identical to the administered cells in the first dose. In some embodiments, the administered cells in the first dose engraft in the host, proliferate in the host, migrate in the host, innervate in the host, differentiate in the host, or improve the function of DA neuronal cells already in the host. In some embodiments, the administration in (a) leads to a reduction in burden of the disease or condition in the subject, as indicated by a reduction in one or more factors indicative of disease burden following the administration in (a) wherein the one or more factors is selected from the group comprising tremor, bradykinesia (extreme slowness of movement), flexed posture, postural instability, and rigidity. In some embodiments, the disease or condition persists following the administration of the first dose and / or the administration of the first dose is not sufficient to eradicate the disease or condition in the subject. In some embodiments, the disease or condition persists following the administration of the consecutive dose and / or the administration of the consecutive dose is not sufficient to eradicate the disease or condition in the subject. In some embodiments, the first dose has a volume of between 1-5 pL / deposit. In some embodiments, the depositional sites are made in 1-5 mm intervals.
[0008] Disclosed is a method of treating Parkinson’s disease, comprising, consisting of, or consisting essentially of administering to a subject having a disease or condition a first dose of midbrain dopaminergic progenitor cells, the first dose comprising less than a maximum feasible dose of cells. In some embodiments, the method further comprises administering to the subject aAttorney Docket No.: 87874.01416 consecutive dose of midbrain dopaminergic progenitor cells comprising less than a maximum feasible dose of cells. In some embodiments, at month 9 following the initiation the administration, rescue or increase survival of dopamine neurons and / or DA neuronal function in the subject is seen. In some embodiments, the first and / or second dose comprises genetically engineered cells. In some embodiments, the first dose and / or second dose of genetically engineered cells comprise genetic modifications to be miR-155-3p biased or miR-155-5p biased.
[0009] Disclosed is a method of treating Parkinson's disease, comprising, consisting of, or consisting essentially of administering to a subject having a disease or condition a first dose of midbrain dopaminergic progenitor cells. In some embodiments, the method further comprises administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells to a second putamen of the subject. In some embodiments, the administered midbrain dopaminergic progenitor cells are not plated prior to administration.BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Fig. 1 shows schematic representation of the injection tracts for midbrain dopaminergic progenitor cell administration.DETAILED DESCRIPTION
[0011] Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure to more fully describe the state of the art to which this disclosure pertains.
[0012] The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology , cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature for example in the following publications. See, e.g.. Sambrook and Russell eds. MOLECULAR CLONING: A LABORATORY MANUAL, 3rd edition (2001); the senes CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel et al. eds. (2007)); the senes METHODS IN ENZYMOLOGY (Academic Press, Inc., N.Y ); PCR 1: A PRACTICAL APPROACH (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A PRACTICAL APPROACH (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)); ANTIBODIES, A LABORATORY MANUAL (Harlow and Lane eds. (1999)); CULTURE OFAttorney Docket No.: 87874.01416ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUE (R. I. Freshney 5th edition (2005)); OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait ed. (1984)); Mullis et al. U.S. Pat. No. 4,683,195; NUCLEIC ACID HYBRIDIZATION (B. D. Hames & S. J. Higgins eds. (1984)); NUCLEIC ACID HYBRIDIZATION (M. L. M. Anderson (1999)); TRANSCRIPTION AND TRANSLATION (B.D. Hames & S. J. Higgins eds. (1984)); IMMOBILIZED CELLS AND ENZYMES (IRL Press (1986)); B. Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING (1984); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. H. Miller and M. P. Calos eds. (1987) Cold Spring Harbor Laboratory ); GENE TRANSFER AND EXPRESSION IN MAMMALIAN CELLS (S. C. Makrides ed. (2003)) IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLOGY (Mayer and Walker, eds., Academic Press, London (1987)); WEIR’S HANDBOOK OF EXPERIMENTAL IMMUNOLOGY (L. A. Herzenberg et al. eds (1996)).Definitions
[0013] As used herein, certain terms may have the following defined meanings. As used in the specification and claims, the singular form "a." “an"’ and “the” include singular and plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a single cell as well as a plurality of cells, including mixtures thereof.
[0014] As used herein the term “about” refers to + / - 10%.
[0015] As used herein, the term “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean are intended to mean that the compositions and methods include the recited elements, but not excluding others. “Consisting essentially of’ when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition or method. “Consisting of’ shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
[0016] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (-) by increments of 0.1. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term “about”. The term “about” also includes the exact value “X” in addition to minorAttorney Docket No.: 87874.01416 increments of "X" such as “X+O. I” or “X-0.1.” It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are know n in the art.
[0017] While some embodiments comprise / include the disclosed features and may therefore include additional features not specifically described, other embodiments may be essentially free of or completely free of non-disclosed elements - that is, non-disclosed elements may optionally be essentially omitted or completely omitted.
[0018] The term “Administration” “transplantation”, “cell replacement” or “grafting” are used interchangeably herein and refer to the act of giving a treatment, such as a cell therapy, to a patient. It can also refer to the way it is given, the dose, or how often it is given. As mentioned, the administered cells can be derived from the recipient or from an allogeneic, semi-allogeneic or xenogeneic donor.
[0019] As used herein A10 means a cell that predominately is characterized as having a GIRK27Calbindin+phenotype.
[0020] As used herein A9 means a cell that predominantly is characterized by having a GIRK27C al bindin phenotype.
[0021] As used herein, the term “Cell” refers to a single cell as well as to a population of (i.e., more than one) cells. The population may be a pure population comprising one cell type, such as midbrain dopaminergic progenitors. Alternatively, the population may comprise more than one cell ty pe, for example a mixed cell population. The term “cell” is not meant to limit the number of cells in a population.
[0022] A “Cell Suspension” or “Suspension Culture” is a type of cell culture in which single cells or small aggregates of cells are allowed to function and multiply in an agitated growth medium, thus forming a suspension.
[0023] “DA Neuronal Cells” or “DA neurons” are cells of the midbrain fate that express FOXA2+, LMX1A+, and TH+.
[0024] As used herein, “delaying development of a disease” and the like means to defer, hinder, slow, retard, stabilize, suppress and / or postpone development of the disease (such as PD). ThisAttorney Docket No.: 87874.01416 delay can be of varying lengths of time, depending on the history of the disease and / or individual being treated.
[0025] As used herein, the term “Cell Differentiation” means a process by which a less specialized cell (e.g.. stem cell) forms progeny of at least a new cell type which is more specialized (e.g., neuron, brain cell, heart, liver, or muscle cell). Differentiation is controlled by the interaction of a cell’s genes with the physical and chemical conditions outside the cell, usually through signaling pathways involving proteins embedded in the cell surface.
[0026] The term “Derived From” or “Established From” or “Differentiated From” when made in reference to any cell disclosed herein refers to a cell that was obtained from (e.g., isolated, purified, etc.) a parent cell in a cell line or tissue (such as a dissociated embryo) using any manipulation.
[0027] As used herein, the term “Directed Differentiation” refers to a manipulation of a less specialized cell (e.g., stem cell) to culture conditions to induce differentiation into a particular (for example, desired) cell type, such as floor plate midbrain progenitor cells and midbrain fate F0XA2 / LMX1A+ dopamine (DA) neurons.
[0028] As used herein, the term “Dopamine Neuron” or “dopaminergic neuron” in general refers to a cell capable of expressing dopamine. “Midbrain dopamine neurons” or “mDA” refer to presumptive dopamine expressing cells in forebrain structures and dopamine expressing cells in forebrain structures.
[0029] The term “dose” means one injection or multiple injections in different tracts / deposition sites. A “first dose” means one injection or multiple injections in different tracts / deposition sites. A “second dose” means one injection or multiple injections in different tracts / deposition sites. A “consecutive dose” means one injection or multiple injections in different tracts / deposition sites. In some embodiments, a low dose is no more than about 10 x io5cells / hemisphere, 1 x 106cells / hemisphere, 2x 106cells / hemisphere, 3x 106cells / hemisphere, 4 106cells / hemisphere, 5 106cells / hemisphere, 6x 106cells / hemisphere, 7x 106cells / hemisphere, 8x 106cells / hemisphere, 9x 106cells / hemisphere, or 10x 106cells / hemisphere. In some embodiments, a high dose is no more than about 10 x 108cells / hemisphere, 10 x 107cells / hemisphere, or 10. 1 x io6cells / hemisphere.Attorney Docket No.: 87874.01416
[0030] The term '‘An Effective Amount’’ intends to indicate the amount of a composition, compound or agent (cell populations) administered or delivered to the subject that is most likely to result in the desired response to treatment.
[0031] The term “Embryonic Stem (ES) Cells” means pluripotent stem cells derived from early embryos. The phrase “embryonic stem cells” refers to embryonic cells which are capable of differentiating into cells of all three embryonic germ layers (i.e., endoderm, ectoderm and mesoderm), or remaining in an undifferentiated state. The phrase “embryonic stem cells” may comprise cells which are obtained from the embryonic tissue formed after gestation (e.g., blastocyst) before implantation of the embryo (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBCs) which are obtained from a post-implantation / pre-gastrulation stage blastocyst (see W02006 / 040763) and embryonic germ (EG) cells which are obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
[0032] The term “Essentially Free” refers to a medium that does not have, or that have essentially none of, the specified component from a source other than the administered cells in the medium.
[0033] As used herein, “First Dose” means the initial dose. The term does not necessarily imply a consecutive or subsequent dose.
[0034] The term “Genetic Engineering” is a process that uses laboratory-based technologies to alter the DNA / RNA makeup of an organism.
[0035] The term “Induced Pluripotent Stem Cells” commonly abbreviated as “iPS cells” or “iPSCs,” refer to a type of pluripotent stem cell artificially prepared from a non-pluripotent cell, ty pically an adult somatic cell, or terminally differentiated cell, such as fibroblast, a hematopoietic cell, a myocyte, a neuron, an epidermal cell, or the like, by introducing or contacting with reprogramming factors. Induced pluripotent stem cells are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm). According to some embodiments, the induced pluripotent stem cells are formed by inducing the expression of Oct-4.
[0036] As used herein, the term “Kit” refers to any delivery system for delivering materials.
[0037] As used herein the term “Method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques andAttorney Docket No.: 87874.01416 procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0038] The terms “Neurons” or “Neural Cells” or “Neural Cell Types” or “Neural Lineage” may include any neuron lineage cells and can be taken to refer to cells at any stage of neuronal ontogeny without any restriction, unless otherwise specified. For example, neurons may include both neuron precursor cells, mature neurons and neural cell types such as astrocytes.
[0039] As used herein, the term “Neural Lineage Cell” refers to a cell that contributes to the nervous system (both central and peripheral) or neural crest cell fates during development or in the adult. The nervous system includes the brain, spinal cord, and peripheral nervous system. Neural crest cell fates include cranial, trunk, vagal, sacral, and cardiac, giving rise to mesectoderm, cranial cartilage, cranial bone, thymus, teeth, melanocytes, iris pigment cells, cranial ganglia, dorsal root ganglia, sympathetic / parasympathetic ganglia, endocrine cells, enteric nervous system, and portions of the heart.
[0040] The term “Parkinsonism” refers to a group of diseases that are all linked to an insufficiency of dopamine in the basal ganglia which is a part of the brain that controls movement. Symptoms include tremor, bradykinesia (extreme slowness of movement), flexed posture, postural instability, and rigidity. A diagnosis of parkinsonism requires the presence of at least two of these symptoms, one of which must be tremor or bradykinesia. The most common form of parkinsonism is idiopathic, or classic, Parkinson’s disease (PD). but for a significant minority of diagnoses, about 15 percent of the total, one of the Parkinson’s plus syndromes (PPS) may be present. These syndromes also known as atypical parkinsonism, include cortico-basal degeneration, Lewy body dementia, multiple system atrophy, and progressive supranuclear palsy.
[0041] The term a “Pharmaceutical Composition” or “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
[0042] A “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to. a buffer, excipient, stabilizer, or preservative.Attorney Docket No.: 87874.01416
[0043] The terms '’Pluripotency" or ’‘Pluripotent” refers to a stem cell or undifferentiated cell that has the potential to differentiate into all cells constituting one or more tissues or organs, for example, any of the three germ layers: endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), or ectoderm (epidermal tissues and nervous system).
[0044] In one aspect of the disclosure, a “Predetermined Threshold Level” or “Threshold Value” is used to categorize expression as high or low. As a non-limiting example of the disclosure, the threshold level of can be a level of expression found in subjects that have been diagnosed with a certain disease or an associate disorder. Alternatively, or in addition, the predetermined threshold level is the measured expression level for that individual subject prior to a subsequent measurement, e.g., prior to therapy or prior to a cell dose.
[0045] “Preventing,” as used herein, includes providing prophylaxis with respect to the occurrence or recurrence of a disease in a subject that may be predisposed to the disease but has not yet been diagnosed with the disease. In some embodiments, the provided cells and compositions are used to delay development of a disease or to slow the progression of a disease.
[0046] The terms “Purified,” “To Purify,” “Purification,” “Isolated,” “To Isolate,” “Isolation,” and grammatical equivalents thereof as used herein, refer to the reduction in the amount of at least one contaminant from a sample.
[0047] As used herein, the term “stem cell” refers to a cell with the ability to divide for indefinite periods in culture and to give rise to specialized cells. A stem cell may be obtained from animals and patients, including humans; for example, a human stem cell refers to a stem cell that is human. A stem cell may be obtained from a variety of sources including embryonic and nonembryonic, such as umbilical cord cells, cells from children and cells from adults. Adult stem cells in general refer to cells that were not originally obtained from a fetus, in other words, cells from babies, cast off umbilical cords, cast off placental cells, cells from children, cells from adults, etc.
[0048] The terms “Subject,” “Individual” or “Patient” are used interchangeably herein, and refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, rats, rabbits, simians, bovines, ovines, porcines, canines, felines, farm animals, sport animals, pets, equines, and primates, particularly humans.Attorney Docket No.: 87874.01416
[0049] The terms "Suitable for A Therapy” or “Suitably Treated With A Therapy” mean that the patient is likely to exhibit one or more desirable clinical outcome as compared to patients having the same disease and receiving the same therapy but possessing a different characteristic that is under consideration for the purpose of the comparison.
[0050] As used herein, to “Suppress” a function or activity is to reduce the function or activity when compared to otherwise same conditions except for a condition or parameter of interest, or alternatively, as compared to another condition.
[0051] As used herein, the term “Treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition. For example, in the case of Parkinson’s disease, the term “treatment” intends a more favorable clinical assessment by a treating physician or assistant and / or reduced expression of fibrosis markers, e.g., aSMA, CTGF, collagen, matrix molecules and / or a shift toward normal readouts in tests that diagnose liver function and / or Parkinson’s disease.
[0052] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0053] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there betw een.
[0054] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice orAttorney Docket No.: 87874.01416 testing of embodiments disclosed herein, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
[0055] Before explaining at least one embodiment in detail, it is to be understood that the disclosure is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The disclosure is capable of other embodiments or of being practiced or carried out in various ways.Parkinson’s Disease
[0056] Parkinson’s disease (PD) is the second most common neurodegenerative disease after Alzheimer’s disease. It is characterized by prodromal symptoms, motor difficulties, and psychological and cognitive problems. As a progressive neurodegenerative disease, PD causes focal degeneration of midbrain dopamine neurons. This reduces the release of dopamine from projecting midbrain dopamine neurons to the striatum.
[0057] Clinically, the defining cardinal symptoms / signs of PD are bradykinesia (slowness of movement) and at least one of the following: tremor at rest (including tremor of the hands, arms, legs, jaw and face), cogwheel rigidity, postural instability, or impaired balance and coordination (‘ PD Symptoms”). With disease progression motor features can be accompanied by several nonmotor signs / symptoms including dementia, depression, sleep disorders and loss of smell and taste.
[0058] Exemplary clinical tests for detecting and diagnosing Parkinson’s disease or symptoms of Parkinson’s disease can include without limitation: PGA index, FIB-4 index, Fibrometer, FibroSure, Act-test, SAFE, Heapscore, FibroQ, AAR, APRI, CDS, API, Pohls score, Loks model, liver biopsy, ultrasonography, computed tomography, ultrasound elastography, and magnetic resonance elastography. Often the approach includes the use of PET or SPECT scanning to show diminished mDA function and / or the FDG PET signature known as the Parkinson’s related pattern (PDRP), fMRI to show? Parkinson’s related rest-state network changes, DNA analysis to identify etiologic variants and / or mutations, and responsiveness of levodopa to naive presumptive Parkinson’s patients and CSF and blood synuclein seed amplification assays (SSA).
[0059] Approximately 10% of patients have a genetic basis for the disease (familial cases), while the remaining 90% are sporadic / idiopathic w here the etiology' is not understood and likelyAttorney Docket No.: 87874.01416 multifactorial. The motor features at diagnosis are due to loss of -80% striatal dopamine secondary to the degeneration of dopaminergic neurons that lie in midbrain structure, the substantia nigra.
[0060] The principal pharmacologic therapies for PD are oral L-3,4-dihydroxyphenylalanine (Levodopa or L-DOPA) or dopaminergic agonists, which initially provide potent relief from motor symptoms, but after 5-10 years most patients experience debilitating motor fluctuations and dyskinesia. Deep brain stimulation of the subthalamic nucleus (STN) or internal segment of the globus pallidus (GPi) provides an alternate and effective approach to treat PD motor symptoms but is primarily indicated for younger patients who do not display cognitive decline and requires periodic battery changes.
[0061] Cell transplantation is regarded as a potential future PD treatment. There is a long history' of attempting to transplant many different cell or tissue types, but in most cases the efficacy and longterm cell survival of the grafts has been very' poor. The most successful approach has been direct replacement of the cell type lost, using fetal ventral mesencephalon (fVM) as the source of midbrain neural progenitors. Although the clinical trials utilizing fVM provided proof of concept for midbrain dopamine neuron replacement, the efficacy results from the different studies were mixed, which could be attributed to any number of differences between the studies, including differences in tissue preparation, surgical technique, patient selection, endpoints, and / or immunosuppression regimen. In addition, in some studies, patients experienced significant graft- induced dyskinesia, and therefore further clinical trials were not pursued at the time.
[0062] The methods and compositions disclosed herein are useful for the treatment of disease, such as neurologic disease, Parkinson’s disease and associated disorders, including but not limited to Parkinsonian disorders. In particular, the methods and compositions replace the dopaminergic neurons that are lost in PD patients to provide a significant advancement in the long-term treatment of PD motor symptoms.Midbrain Dopaminergic Progenitor
[0063] Midbrain dopaminergic progenitor cells are a population of neural progenitor cells with specific affinity' to form and support the formation of dopaminergic neurons. As used herein, the terms “midbrain dopaminergic progenitor" and “dopaminergic progenitor cell’' refer to the same cell population.Attorney Docket No.: 87874.01416
[0064] Midbrain dopaminergic progenitor cells express forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 (LMX1) (FOXA2+ / LMX1+).
[0065] Dopamine progenitor cells, rather than fully differentiated cells, are considerably better at engrafting and innervating the striatum compared to the post-mitotic neurons, resulting in significantly better reversal of behavioral deficits.Methods of Treatment
[0066] Disclosed is a method to treat Parkinson’s Disease in a subject comprising, consisting of, or consisting essentially of administering to a subject in need thereof a therapeutic amount of midbrain dopaminergic progenitors. Disclosed is a method to rescue or increase survival of dopaminergic neurons in a subject comprising, consisting of, or consisting essentially of administering to a subject in need thereof a therapeutic amount of midbrain dopaminergic progenitors. Disclosed is a cell therapy for the treatment of diseases or conditions including PD. Disclosed is a treatment for PD patients of a single intraputamenal administration of midbrain dopaminergic progenitor cells via stereotactic surgery.
[0067] The methods and compositions are useful for the preparation of a medicament and / or to perform methods for one or more of: a) inhibiting the progression of, b) preventing or c) treating, PD or an associated disorder in a subject in need thereof. These conditions are well known in the art and can be diagnosed by a treating physician.
[0068] In some embodiments, the subject is a mammal such as a human. In some embodiments, the subject shows at least one neurological symptom. In some embodiments, neurological symptom is selected from the group consisting of tremor, bradykinesia (extreme slow ness of movement), flexed posture, postural instability and rigidity. In one embodiment, the subject shows reduction of the neurological symptom after treatment. In some embodiments, the subject is a patient with a symptom of Parkinson’s Disease (PD).
[0069] In some embodiments, the methods include preparing, processing, culturing, and / or engineering the cell population, and introducing them into the subject, before or after cry opreservation.Attorney Docket No.: 87874.01416Administration generally
[0070] In some embodiments, administered cells are administered as a single dose in a single surgical procedure. In some embodiments, administered cells are administered as a single dose in a single surgical procedure either unilaterally or bilaterally. In some embodiments, administered cells are administered as a single dose in a single surgical procedure unilaterally into the most affected putamen side as determined by18F-L-DOPA PET imaging. Fluorodopa, also known as FDOPA or F-L-DOPA is indicated for use in positron emission tomography (PET) to visualize dopaminergic nerve terminals in the striatum for the evaluation of adults with suspected Parkinsonian syndromes (PS).
[0071] In some embodiments, midbrain dopaminergic progenitor cells are administered as a single dose in a single surgical procedure unilaterally. In some embodiments, midbrain dopaminergic progenitor cells are administered as two doses in a single surgical procedure bilaterally. The dosage form, route of administration, and dosing regimen have been carefully selected to achieve even distribution of the administered cells and complete or near complete innervation throughout the putamen. which is necessary for optimal functional recovery and minimizes "‘hot spots” of graft- derived dopaminergic innervation, which otherwise could contribute to a greater risk for graft- induced dyskinesias (GID).Site and route of administration
[0072] In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in one or more neurosurgical procedures. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in a plurality of injection tracts in one hemisphere. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in a plurality of injection tracts in two hemispheres. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in a plurality of injection tracts per hemisphere, each injection tract comprising, consisting of, or consisting essentially of a plurality of deposits along each tract. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in 1-10 injection tracts (preferably 1 injection track, 2 injection tracks, 3 injection tracks, 4 injection tracks. 5 injection tracks, 6 injection tracks. 7 injection tracks, 8 injection tracks. 9 injection tracks, or 10 injection tracks) per hemisphere. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure withAttorney Docket No.: 87874.014161-16 deposits (preferably 1 deposit, 2 deposits, 3 deposits, 4 deposits, 5 deposits, 6 deposits. 7 deposits, 8 deposits, 9 deposits, 10 deposits, 11 deposits. 12 deposits, 13 deposits, 14 deposits. 15 deposits, or 16 deposits) along each tract. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in five injection tracts per hemisphere, with a plurality of deposits along each tract. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in five injection tracts per hemisphere, with 8 deposits along each tract. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in a plurality of injection tracts per hemisphere, with a plurality of deposits along each tract. In some embodiments, the midbrain dopaminergic progenitor cells are delivered in a single neurosurgical procedure in a plurality of injection tracts per hemisphere, with 8 deposits along each tract.
[0073] Fig. 1 shows a schematic representation of the localization of the plurality (about, at least, or at most 5) of injection tracts. In some embodiments, there are at most 16 injection tracts. Fig. 1 shows unilateral treatment. If midbrain dopaminergic progenitor cells are implanted bilaterally, they are similarly implanted in the left hemisphere.
[0074] In some embodiments, the administered cells are administered to one or more of the putamen, the caudate, or both. In some embodiments, the administered cells are administered to the putamen (anterior and / or posterior dimension). In some embodiments, the administered cells are administered to the putamen and not the caudate. In some embodiments, the administered cells are administered to the putamen (right and / or left). In some embodiments, the administered cells are administered with foetal tissue transplantation to the caudate (right and / or left). In some embodiments, the administered cells are administered to both putamen (right and left), both caudate (right and left). In some embodiments, the administered cells are administered to one putamen (right or left), one caudate (right or left), or combinations thereof. In some embodiments, the administered cells are administered to one or both putamen (right or left), one or both caudate (right or left), or combinations thereof. In some embodiments, the administered cells are administered to the striatum.
[0075] In some embodiments, the patient receives a single transplant of midbrain dopaminergic progenitor cells into the putamen. By “single transplant" is meant one surgical procedure with one or a plurality7of deposits of cells to one hemisphere. In some embodiments, the patient receives one or more transplants of midbrain dopaminergic progenitor cells into both putamen. By “one or more transplants” is meant one surgical procedure with one or a plurality of deposits of cells to more thanAttorney Docket No.: 87874.01416 one hemisphere. In this case, delivery of two doses (DI and D2) of cells are administered in a single transplant procedure. In some embodiments, delivery of two doses (DI and D2) of cells are administered in two different transplant procedures. In some embodiments, delivery of a plurality (more than 2) doses of cells are administered in a plurality (more than 2) different transplant procedures. In some embodiments, delivery of two doses (DI and D2) of cells are administered in a single transplant procedure or in two different transplant procedures.
[0076] . In some embodiments, the midbrain dopaminergic progenitor cells are not injected to the dopamine pathway. In some embodiments, the midbrain dopaminergic progenitor cells are not injected to the substantia nigra (the location of midbrain dopamine neuron cell bodies lost in PD) because of the long distance needed to innervate from the nigra to the striatum. In some embodiments, the midbrain dopaminergic progenitor cells are not injected to the pars compacta (SNpc), the pars reticulata (SNpr). motor association cortex, thalamus, sensory association cortex, subthalamic nucleus, globus pallidus intemus, globus pallidus extemus, striatum, anterior putamen, posterior putamen, medial-lateral putamen, the putamen, the frontal lobe, the caudate nucleus, mesolimbic system, mesocortical DA system, ventral tegmental area, nigrostriatal DA system, amygdala, the pituitary gland, dopaminergic neurons, midbrain dopamine (DA) neurons, microglial cells, astrocytes, nerve cells, astrocytes, neurons and combinations thereof.
[0077] In some embodiments, the midbrain dopaminergic progenitor cells are injected to the dopamine pathway. In some embodiments, the midbrain dopaminergic progenitor cells are injected to the substantia nigra (the location of midbrain dopamine neuron cell bodies lost in PD) because of the long distance needed to innervate from the nigra to the striatum. In some embodiments, the midbrain dopaminergic progenitor cells are injected to the pars compacta (SNpc), the pars reticulata (SNpr), motor association cortex, thalamus, sensory association cortex, subthalamic nucleus, globus pallidus intemus, globus pallidus extemus. striatum, putamen (anterior, posterior dimension and / or medial-lateral), the frontal lobe, the caudate nucleus, mesolimbic system, mesocortical DA system, ventral tegmental area, nigrostriatal DA system, amygdala, the pituitary gland, dopaminergic neurons, midbrain dopamine (DA) neurons, microglial cells, astrocytes, nen e cells, astrocytes, neurons and combinations thereof.
[0078] In some embodiments, the administered midbrain dopaminergic progenitor cells do not form endogenous synaptic connections. In some embodiments, the administered midbrain dopaminergic progenitor cells do not form G protein-coupled receptors (GPCRs), accelerated axon regeneration, a-synuclein (SNCA), Glucocerebrosidase (GBA). glutamate receptors, molecularAttorney Docket No.: 87874.01416 chaperones, SV2C, c-Abl, GPR109A, transcription factors, neurotransmitters, neuromodulator receptors, or intracellular signaling pathways.
[0079] In some embodiments, the administered midbrain dopaminergic progenitor cells form connections onto denervated targets and mediate regulated dopamine release and / or improve motor deficits. In some embodiments, the administered midbrain dopaminergic progenitor cells do form endogenous synaptic connections. In some embodiments, the administered midbrain dopaminergic progenitor cells do form G protein-coupled receptors (GPCRs), accelerated axon regeneration, a- synuclein (SNCA). Glucocerebrosidase (GBA). glutamate receptors, molecular chaperones, SV2C, c-Abl, GPR109A, transcription factors, neurotransmitters, neuromodulator receptors, and / or intracellular signaling pathways.
[0080] In some embodiments, the administered cells are administered in an isotonic aqueous solution, cell suspension, emulsion, dispersion, or viscous composition, which may in some aspects be buffered to a selected pH. In some embodiments, the cells are administered with a carrier. In some embodiments, the administered cells are administered by seeding them into a scaffold material. In some embodiments, the scaffolding contains one or more biocompatible synthetic polymers or naturally-occurring proteins or peptides. In another embodiment, the scaffolding is configured as a porous scaffold suitable for trapping or attaching mammalian cells. In other embodiments, the scaffolding is configured as a gel suitable for embedding, attaching, or coating mammalian cells. In some embodiments, the administered cells are administered as a single layer or two-dimensional monolayer culture. In some embodiments, the administered cells are administered as a neotissue construct, via cellular encapsulation, ultrasound microbubbles, scaffold-free tissue engineering (single layer systems or multi-layer systems) system, cell sheet, composite scaffold, electrospun scaffold, microcarrier beads, with an injectable hydrogel, material carriers, and combinations thereof. In some embodiments, the midbrain dopaminergic progenitor cells are administered as a cell suspension. In some embodiments, cellular encapsulation is a cellencapsulation device or cell-device combination product.
[0081] In some embodiments, the plurality of tracts will be made in each putamen. In some embodiments, the plurality of tracts cover both the pre- (1 tract) and post-commissural (4 tracts) regions in the anterior to posterior dimension, roughly following the curvature of the putamen. In some embodiments, the most anterior tract will be approximately 1 -5 mm from the anterior putaminal border. In some embodiments, the most anterior tract will be approximately 1 mm, 2 mm, 3 mm, 4 mm. 5 mm. 6 mm, 7 mm, 8 mm 9 mm or 10 mm from the anterior putaminal border.Attorney Docket No.: 87874.01416In some embodiments, there is approximately 1-10 mm spacing between tracts. In some embodiments, there is approximately 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, or 10 mm spacing between tracts. In some embodiments, the tracts will be cantered in medial-lateral dimension of the putamen.
[0082] In some embodiments, the cellular deposits will have a volume of between 1-5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 1 pL / deposit. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit. In some embodiments, the cellular deposits will have a volume of 2.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit.
[0083] In some embodiments, the cellular deposits will have a volume of between 1-10 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 5-10 pL / deposit. In some embodiments, the cellular deposits will have a volume of 5.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 6 pL / deposit. In some embodiments, the cellular deposits will have a volume of 6.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 7 pL / deposit. In some embodiments, the cellular deposits will have a volume of 7.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 8 pL / deposit. In some embodiments, the cellular deposits will have a volume of 8.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 9 pL / deposit. In some embodiments, the cellular deposits will have a volume of 9.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 10 pL / deposit.
[0084] In some embodiments, the cellular deposits will have a volume of between 1-15 pL / deposit. In some embodiments, the cellular deposits will have a volume of 10.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 11 pL / deposit. In some embodiments, the cellular deposits will have a volume of 11.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 12 pL / deposit. In some embodiments, the cellular deposits will have a volume of 12.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 13 pL / deposit. In some embodiments, the cellular deposits will have a volume of 13.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 14 pL / deposit. InAttorney Docket No.: 87874.01416 some embodiments, the cellular deposits will have a volume of 14.5 pL / deposit. In some embodiments, the cellular deposits will have a volume of 15 pL / deposit.
[0085] In some embodiments, the cellular deposits will have a volume of between 1-20 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-25 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-20 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-25 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-30 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-35 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-40 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-45 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-50 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-55 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-60 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-65 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-70 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-75 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-80 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-85 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-90 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-95 pL / deposit. In some embodiments, the cellular deposits will have a volume of between 1-100 pL / deposit.
[0086] In some embodiments, cellular deposits will be made in 1-5 mm intervals. In some embodiments, cellular deposits will be made in 1 mm intervals. In some embodiments, cellular deposits will be made in 1.5 mm intervals. In some embodiments, cellular deposits will be made in 2 mm intervals. In some embodiments, cellular deposits will be made in 2.5 mm intervals. In some embodiments, cellular deposits will be made in 3 mm intervals. In some embodiments, cellular deposits will be made in 3.5 mm intervals. In some embodiments, cellular deposits will be made in 1 mm intervals. In some embodiments, cellular deposits will be made in 4.5 mm intervals. In some embodiments, cellular deposits will be made in 4 mm intervals. In some embodiments, cellular deposits will be made in 4.5 mm intervals. In some embodiments, cellular deposits will be made in 5 mm intervals.Attorney Docket No.: 87874.01416
[0087] In some embodiments, cellular deposits will be made in 5-10 mm intervals. In some embodiments, cellular deposits will be made in 5.5 mm intervals. In some embodiments, cellular deposits will be made in 6 mm intervals. In some embodiments, cellular deposits will be made in6.5 mm intervals. In some embodiments, cellular deposits will be made in 7 mm intervals. In some embodiments, cellular deposits will be made in 7.5 mm intervals. In some embodiments, cellular deposits will be made in 8 mm intervals. In some embodiments, cellular deposits will be made in8.5 mm intervals. In some embodiments, cellular deposits will be made in 9 mm intervals. In some embodiments, cellular deposits will be made in 9.5 mm intervals. In some embodiments, cellular deposits will be made in 10 mm intervals.
[0088] In some embodiments, the cellular deposits will have a volume of 1.0 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of2.5 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 1.0 mm interv als (total 7 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in 1.0 mm intervals (total 7 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 1.0 mm intervals (total7 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0089] In some embodiments, the cellular deposits will have a volume of 1.0 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 12 pL per one injection tract if8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2Attorney Docket No.: 87874.01416 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2.5 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 1.5 mm intervals (total10.5 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in1.5 mm intervals (total 10.5 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 1.5 mm intervals (total 10.5 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0090] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of2.5 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, theAttorney Docket No.: 87874.01416 cellular deposits will have a volume of 5 pL / deposit and will be made in 2 mm intervals (total 14 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0091] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2.5 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 2.5 mm intervals (total17.5 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in2.5 mm intervals (total 17.5 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 2.5 mm intervals (total 17.5 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0092] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of2.5 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits willAttorney Docket No.: 87874.01416 have a volume of 3.5 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 3 mm intervals (total 21 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0093] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2.5 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 3.5 mm intervals (total24.5 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in3.5 mm intervals (total 24.5 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 3.5 mm intervals (total 24.5 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0094] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2Attorney Docket No.: 87874.01416 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of2.5 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in 4 mm intervals (total 28 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 4 mm interv als (total 28 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0095] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 4.5 mm intervals (total 31.5 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 4.5 mm interv als (total 31.5 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 4.5 mm intervals (total 31.5 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2.5 pL / deposit and will be made in 4.5 mm intervals (total 31.5 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 4.5 mm intervals (total 31.5 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 4.5 mm intervals (total31.5 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 4.5 mm intervals (total 31.5 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in4.5 mm intervals (total 31.5 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and willAtorney Docket No.: 87874.01416 be made in 4.5 mm intervals (total 31.5 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0096] In some embodiments, the cellular deposits will have a volume of 1 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 8 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 1.5 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 12 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 16 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 2.5 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 20 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 24 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 3.5 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 28 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 32 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 4.5 pL / deposit and will be made in 5 mm intervals (total 35 mm) amounting to 36 pL per one injection tract if 8 deposits are made / tract. In some embodiments, the cellular deposits will have a volume of 5 pL / deposit and will be made in 5 mm interv als (total 35 mm) amounting to 40 pL per one injection tract if 8 deposits are made / tract.
[0097] If the patient receives 5 injection tracks and 8 deposits are made / tract, the patient will receive a total of 25 pL of midbrain dopaminergic progenitor cells per hemisphere, i.e., a total of 25 pL for patients receiving unilateral administration, and 50 pL for patients receiving bilateral administration. If the patient receives 5 injection tracks and 8 deposits are made / tract, the patient will receive a total of 50 pL of midbrain dopaminergic progenitor cells per hemisphere, i.e., a total of 50 pL for patients receiving unilateral administration, and 100 pL for patients receiving bilateral administration. If the patient receives 5 injection tracks and 8 deposits are made / tract, the patient will receive a total of 75 pL of midbrain dopaminergic progenitor cells per hemisphere, i.e., a total of 75 pL for patients receiving unilateral administration, and 150 pL for patients receiving bilateral administration. If the patient receives 5 injection tracks and 8 deposits are made / tract, the patient will receive a total of 100 pL of midbrain dopaminergic progenitor cells per hemisphere, i.e., a total of 100 pL for patients receiving unilateral administration, and 200 pL for patients receivingAttorney Docket No.: 87874.01416 bilateral administration. If the patient receives 5 injection tracks and 8 deposits are made / tract, the patient will receive a total of 150 pL of midbrain dopaminergic progenitor cells per hemisphere, / .e., a total of 150 pL for patients receiving unilateral administration, and 300 pL for patients receiving bilateral administration. If the patient receives 5 injection tracks and 8 deposits are made / tract. the patient will receive a total of 200 pL of midbrain dopaminergic progenitor cells per hemisphere, i.e., a total of 200 pL for patients receiving unilateral administration, and 400 pL for patients receiving bilateral administration. If the patient receives 5 injection tracks and 8 deposits are made / tract, the patient will receive a total of 250 pL of midbrain dopaminergic progenitor cells per hemisphere, i.e., a total of 250 pL for patients receiving unilateral administration, and 500 pL for patients receiving bilateral administration.
[0098] If l x 106cells / hemisphere are administered, each deposit receives 25,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 2 x io6cells / hemisphere are administered, each deposit receives 50,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 3 x 106cells / hemisphere are administered, each deposit receives 75,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 4x 106cells / hemisphere are administered, each deposit receives 100.000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 5 x io6cells / hemisphere are administered, each deposit receives 125,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 6 x 106cells / hemisphere are administered, each deposit receives 150,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 7 x 106cells / hemisphere are administered, each deposit receives 175,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 8 x io6cells / hemisphere are administered, each deposit receives 200,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 9 x io6cells / hemisphere are administered, each deposit receives 225,000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). If 10 x io6cells / hemisphere are administered, each deposit receives 250.000 cells (assuming 40 deposits are made with 5 tracts and 8 deposits / tract). In some embodiments, each deposit receives about 50,000 cells to about 250.000 cells. In some embodiments, each deposit receives about 75,000 cells to about 250,000 cells. In some embodiments, each deposit receives about 100,000 cells to about 250,000 cells. In some embodiments, each deposit receives about 125,000 cells to about 250,000 cells. In some embodiments, each deposit receives about 150,000 cells to about 250,000 cells. In some embodiments, each deposit receives about 175,000 cells to about 250,000 cells. In some embodiments, each deposit receives about 200,000 cells to about 250,000 cells. In some embodiments, each deposit receives about 100,000 cells to about 275,000 cells. In someAttorney Docket No.: 87874.01416 embodiments, each deposit receives about 50,000 cells to about 100,000 cells. In some embodiments, each deposit receives about 75,000 cells to about 100,000 cells. In some embodiments, each deposit receives about 100,000 cells to about 200,000 cells. In some embodiments, each deposit receives about 150,000 cells to about 200,000 cells. In some embodiments, each deposit receives about 75.000 cells to about 100,000 cells. In some embodiments, each deposit receives about 75,000 cells to about 200,000 cells. In some embodiments, each deposit receives about 75,000 cells to about 250,000 cells.
[0099] In some embodiments, each deposit receives no less than about 50,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 75,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 100,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 150,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 175,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 200,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 225,000 cells and no more than about 275,000 cells. In some embodiments, each deposit receives no less than about 250.000 cells and no more than about 275.000 cells.
[0100] In some embodiments, each deposit receives no less than about 50,000 cells and no more than about 250,000 cells. In some embodiments, each deposit receives no less than about 75.000 cells and no more than about 250,000 cells. In some embodiments, each deposit receives no less than about 100,000 cells and no more than about 250,000 cells. In some embodiments, each deposit receives no less than about 150,000 cells and no more than about 250,000 cells. In some embodiments, each deposit receives no less than about 175,000 cells and no more than about 250,000 cells. In some embodiments, each deposit receives no less than about 200.000 cells and no more than about 250,000 cells.
[0101] In some embodiments, each deposit receives no less than about 50,000 cells and no more than about 200,000 cells. In some embodiments, each deposit receives no less than about 75.000 cells and no more than about 200,000 cells. In some embodiments, each deposit receives no less than about 100,000 cells and no more than about 200,000 cells. In some embodiments, each deposit receives no less than about 150,000 cells and no more than about 200,000 cells. In some embodiments, each deposit receives no less than about 175,000 cells and no more than about 200,000 cells.Attorney Docket No.: 87874.01416
[0102] In some embodiments, each deposit receives no less than about 50,000 cells and no more than about 175,000 cells. In some embodiments, each deposit receives no less than about 75,000 cells and no more than about 175,000 cells. In some embodiments, each deposit receives no less than about 100,000 cells and no more than about 175,000 cells. In some embodiments, each deposit receives no less than about 150,000 cells and no more than about 175,000 cells. .
[0103] In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-60 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1- 60 seconds, preferably over 5 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-60 seconds, preferably over 10 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-60 seconds, preferably over 15 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-60 seconds, preferably over 20 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-60 seconds, preferably over 5-20 seconds.
[0104] In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1- 120 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-120 seconds, preferably over 25 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-120 seconds, preferably over 30 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-120 seconds, preferably over 35 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-120 seconds, preferably over 40 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-120 seconds, preferably over 25-40 seconds .
[0105] In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1- 180 seconds. In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-180 seconds, preferably over 45 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-180 seconds, preferably over 50 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-180 seconds, preferably over 55 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-180 seconds, preferably over 60 seconds . In some embodiments, each midbrain dopaminergic progenitor deposit is be made over 1-180 seconds, preferably over 45-60 seconds .Attorney Docket No.: 87874.01416
[0106] In some embodiments, between deposits, the waiting period will be 1-180 seconds, preferably 5 seconds. In some embodiments, between deposits, the waiting period will be 1-180 seconds, preferably 10 seconds. In some embodiments, between deposits, the waiting period will be 1-180 seconds, preferably 15 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 30 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 45 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 60 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 75 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 90 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 105 seconds. In some embodiments, betw een deposits, the waiting period will be 15-90 seconds, preferably 120 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 135 seconds. In some embodiments, between deposits, the waiting period will be 15- 90 seconds, preferably 15 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 150 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 165 seconds. In some embodiments, between deposits, the waiting period will be 15-90 seconds, preferably 180 seconds.
[0107] In some embodiments, between tracts, the w aiting period will be 1-20 minutes, preferably 1 -minute. In some embodiments, between tracts, the w aiting period will be 1-20 minutes, preferably 2-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 3-minutes. In some embodiments, between tracts, the waiting period will be 1- 20 minutes, preferably 4-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 5-minutes. In some embodiments, betw een tracts, the waiting period will be 1-20 minutes, preferably 6-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 7-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 8-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 9-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 10-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 11 -minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 12-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 13 -minutes. In some embodiments, between tracts, the w aiting period will be 1-20 minutes, preferably 14-minutes. In some embodiments, between tracts, the w aiting period will be 1-20 minutes, preferably 15-Attorney Docket No.: 87874.01416 minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 16-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 17-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 18-minutes. In some embodiments, between tracts, the waiting period will be 1-20 minutes, preferably 19-minutes. In some embodiments, between tracts, the waiting period will be 1 -20 minutes, preferably 20-minutes. The waiting periods between injection sites allow any residual pressure to dissipate, and the transplanted cells to stabilize. As understood by skilled artisans, each injection tract extends the time of surgery and carries a small risk of hemorrhage. Yet too many cells in too few deposit sites may increase the risk of dopamine ‘"hot spots’7potentially associated with graft-induced dyskinesia. Thus, the time, number of injections, and concentration of injections needs to fit within a goldilocks’ range.
[0108] In some embodiments, the deposit is made over 10 seconds with a 2-minute wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 15 seconds with a 2-minute wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait betw een deposits and an 8- minute wait between tracts. In some embodiments, the deposit is made over 25 seconds with a 2- minute wait betw een deposits and an 8-minute wait between tracts.
[0109] In some embodiments, the deposit is made over 20 seconds with a 1 -minute w ait betw een deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 1.5-minute wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and an 8- minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2.5- minute wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 3-minute wait between deposits and an 8-minute wait between tracts.
[0110] In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and a 3-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and a 4-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute w ait between deposits and a 5- minute wait betw een tracts. In some embodiments, the deposit is made over 20 seconds with a 2- minute wait between deposits and a 6-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and a 7-minute waitAttorney Docket No.: 87874.01416 between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and a 9-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and a 10-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait between deposits and a 15-minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 2-minute wait betw een deposits and a 20-minute wait between tracts.
[0111] In some embodiments, the deposit is made over 15 seconds with a 1 -minute wait between deposits and a 5-minute wait between tracts. In some embodiments, the deposit is made over 10 seconds with a 30 second wait between deposits and a 5-minute wait between tracts. In some embodiments, the deposit is made over 30 seconds with a 3-minute wait between deposits and a 5- minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 3.5- minute wait between deposits and a 5-minute wait between tracts.
[0112] In some embodiments, the deposit is made over 15 seconds with a 1 -minute wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 10 seconds with a 30 second wait between deposits and an 8-minute wait between tracts. In some embodiments, the deposit is made over 30 seconds with a 3-minute wait betw een deposits and an 8- minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 3.5- minute wait between deposits and an 8-minute wait between tracts.
[0113] In some embodiments, the deposit is made over 15 seconds with a 1 -minute wait betw een deposits and a 10-minute wait between tracts. In some embodiments, the deposit is made over 10 seconds with a 30 second wait between deposits and a 10-minute wait between tracts. In some embodiments, the deposit is made over 30 seconds with a 3-minute wait between deposits and a 10- minute wait between tracts. In some embodiments, the deposit is made over 20 seconds with a 3.5- minute wait between deposits and a 10-minute wait between tracts.
[0114] In some embodiments, the administered cells innervate the striatum within 6-12 months (preferably by month 6) after administration. It is expected that deposition of cells at multiple deposit sites along multiple needle tracts leads to total innervation of the putamen. It is expected that deposition of cells at multiple deposit sites along multiple needle tracts leads to at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% innervation of the putamen. In some embodiments, innervation is assessed by anAttorney Docket No.: 87874.01416 observed reduction in disease burden / neurological symptom. In some embodiments, innervation is assessed by fiber density7measurements. In some embodiments, innervation is assessed by imaging and other fluorescent measurement technology7known in the art, including but not limited to in vivo imaging modeling, electroencephalograms, microelectrodes, and other software tools. In some embodiments, innervation is assessed post-mortem by detecting fluorescent material that has been applied to a patient sample, imaging nerves, and / or by histology.
[0115] In some embodiments, midbrain dopaminergic progenitor cells are stored at about <-150 °C (vapor phase of liquid nitrogen). In some embodiments, midbrain dopaminergic progenitor cells are shipped at about <-150 °C (vapor phase of liquid nitrogen). In some embodiments, the midbrain dopaminergic progenitor cells are stored and / or shipped in AT2 vials.
[0116] In some embodiments, a single vial is allocated to each hemisphere that is transplanted. In some embodiments, a single vial is allocated for the entire surgical procedure, so if the subject will receive a dose to each hemisphere, a single vial is allocated. In some embodiments, a plurality of vials (preferably 1-10 vials) is allocated to each hemisphere that is transplanted. In some embodiments, a plurality of vials (1. 2, 3, 4, 5, 6, 7, 8. 9, or 10) is allocated to each hemisphere that is transplanted. In some embodiments, a plurality of vials (preferably 1-5) is allocated to each hemisphere that is transplanted. In some embodiments, a plurality of vials (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) is allocated to each hemisphere that is transplanted. In some embodiments, on the day of use, midbrain dopaminergic progenitor cells are thawed, washed, resuspended in buffer, and viable cells enumerated and subjected to gram stain. In some embodiments, the administered cells are reconstituted in reconstitution buffer. In some embodiments, the reconstitution buffer is BSS plus. All steps will be undertaken in an aseptic clean room near the operating room. In some embodiments, cells are then stored at 2 - 8 °C until needed for administration. In some embodiments, cells are then stored at 2 - 8 °C for until needed for administration up to 8 hours. In some embodiments, cells are then stored at 2 - 8 °C for until needed for administration up to 10 hours.
[0117] In some embodiments, if the cells do not meet specification criteria they are discarded. In some embodiments, the dose is discarded if less than 50%, 55%, 60%, 65% 70%, 75% 80%, 85%, 90%, 95% or 98% of the cells are not viable, outside of the desired concentration range of 50-80 X 103cells / vial for dose 1, outside of the desired concentration range of 80-100 X 103cells / vial for dose 2, if gram staining is positive, thawed for greater than 8, 9, 10, 11. 12. 13, 14, 15 or between 8-15 hours, and combinations thereof.Attorney Docket No.: 87874.01416
[0118] In some embodiments, the resuspended midbrain dopaminergic progenitor cells retain bioactivity for at least 10 hours (preferably 1-24 hours). In some embodiments, if the procedure takes longer than the bioactivity of the resuspended cells, another vial of midbrain dopaminergic progenitor cells is thawed and prepared approximately 8-20 hours into the surgery to ensure stability of the midbrain dopaminergic progenitor cells used.
[0119] In some embodiments, administered cells are freshly thawed from the cryovial prior to administration. In some embodiments, the administered cells are plated prior to administration. In some embodiments, the administered cells are plated for 1-5 days (preferably 2 days) prior to administration. In some embodiments, the administered cells are not plated prior to administration. In some embodiments, administered cells are freshly thawed from the cryovial prior to administration. In some embodiments, administered cells are freshly thawed from the cryovial for about 30 minutes to 8 hours prior to administration.Administration of cells
[0120] The methods generally involve delivering cells via a delivery device known in the art including but not limited to a syringe, injector, or needle.
[0121] In some embodiments, the subject is placed under general anesthesia and orotracheally intubated. In some embodiments, pre-planned trajectories that traverse the putamen, avoiding cortical veins and sulci, will be identified. In some embodiments, subject-specific anatomical considerations may require use of certain trans-frontal trajectories for putamenal midbrain dopaminergic progenitor delivery. In some embodiments, patient receives a craniotomy. In some embodiments, patient receives a frontal lobe surgery. In some embodiments, patient receives endoscopic brain surgery. In some embodiments, patient receives a coronal incision. In some embodiments, patient receives an intracranial injection. In some embodiments, the patient receives an injection bilaterally. In some embodiments, the patient receives an injection unilaterally. In some embodiments, patient receives a unilateral intracranial injection. In some embodiments, patient receives a bilateral intracranial injection. In some embodiments, patient receives an injection into the striatum. In some embodiments, the patient receives an injection in the putamen. In some embodiments, the patient receives an injection in the putamen as determined by18F-L- DOPA PET imaging, In some embodiments, the patient receives an injection using a trans-frontal approach or transcranial approach. In some embodiments, the patient receives an injection using the nasal passages and the sphenoid sinus. In some embodiments, the patient receives an injection using a pituitary surgery. In some embodiments, the entry point is near the subfrontal region,Attorney Docket No.: 87874.01416 frontal trans-sinusal transglabellar, or coronal suture. In some embodiments, the entry point is near the coronal, sagittal, lambdoid, or metopic sutures. In some embodiments, the entry point is between the cranial bones (frontal and the parietal bones).
[0122] In some embodiments, the surgical sites will be prepped and draped in a standard neurosurgical fashion and proposed scalp incisions anesthetized with local anaesthetic. In some embodiments, the scalp is opened and burr or twist drill holes will be placed, the dura will be opened, and the syringe with midbrain dopaminergic progenitor cells will be passed to the initial target depth.
[0123] In some embodiments, the operative plan for delivery7of midbrain dopaminergic progenitor to the putamen is performed via a syringe loaded with the midbrain dopaminergic progenitor cell emulsion using endoscopic brain surgery. In some embodiments, the operative plan for delivery of midbrain dopaminergic progenitor to the putamen is performed via a syringe loaded with the midbrain dopaminergic progenitor cell viscous composition using endoscopic brain surgery. In some embodiments, the operative plan for delivery7of midbrain dopaminergic progenitor to the putamen is performed via a syringe loaded with the midbrain dopaminergic progenitor cell suspension using endoscopic brain surgery. In some embodiments, the operative plan for delivery of midbrain dopaminergic progenitor to the putamen is performed via a syringe loaded with the midbrain dopaminergic progenitor cell suspension using a frontal approach. In some embodiments, the operative plan for delivery of midbrain dopaminergic progenitor to the putamen is performed via a syringe loaded with the midbrain dopaminergic progenitor cell emulsion using a frontal approach. In some embodiments, the operative plan for delivery7of midbrain dopaminergic progenitor to the putamen is performed via a syringe loaded with the midbrain dopaminergic progenitor cell viscous composition using a frontal approach.Attorney Docket No.: 87874.01416Disclosed is a method of treating Parkinson's disease, comprising, consisting of, or consisting essentially of: administering to a subject having a disease or condition a first dose of midbrain dopaminergic progenitor cells, the first dose administered to a first putamen of the subject. In some embodiments, the method further comprising further administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells to a second putamen of the subject. In some embodiments, the administered midbrain dopaminergic progenitor cells are deposited at a plurality of deposit sites along a plurality of needle tracts and are not plated prior to administration.Route and Dose Levels
[0124] The intended route of administration of midbrain dopaminergic progenitor cells is intracranial injection via a trans-frontal approach.
[0125] In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease comprises, consists of, or consists essentially of one dose (DI). In some embodiments, DI is at a concentration of 10.0 x 103cells / vial. In some embodiments, DI is at a concentration of 20.0 x 10’ cells / vial. In some embodiments, DI is at a concentration of 30.0 x 103cells / vial. In some embodiments, DI is at a concentration of 40.0 x 103cells / vial. In some embodiments, DI is at a concentration of 50.0 x IO3cells / vial. In some embodiments, DI is at a concentration of 60.0 x I O' cells / vial. In some embodiments, DI is at a concentration of 70.0 x 103cells / vial. In some embodiments, DI is at a concentration of 80.0 x 103cells / vial. In some embodiments, DI is at a concentration of 90.0 x 103cells / vial. In some embodiments, DI is at a concentration of 100.0 x 103cells / vial. In some embodiments, DI is at a concentration of 10.0 x 103to 100.0 x 103cells / vial. In some embodiments, DI is at a concentration of 50.0 x 103to 80.0 x 103cells / vial. In some embodiments, DI is at a concentration of 60.0 x 10’ to 70.0 x 103cells / vial.
[0126] In some embodiments, DI is 1.0 x 106cells / hemisphere. In some embodiments, DI is 2.0 x 106cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere. In some embodiments, DI is 4.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere. In some embodiments, DI is 6.0 x 106cells / hemisphere. In some embodiments, DI is 7.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere. In some embodiments, DI is 9.0 x 106cells / hemisphere. In some embodiments, DI is 10.0 x 106cells / hemisphere.
[0127] In some embodiments, DI is at a concentration of about 10.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 20.0 x 103cells / vial. In some embodiments, DI isAttorney Docket No.: 87874.01416 at a concentration of about 30.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 40.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 50.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 60.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 70.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 80.0 x 103cells / vial. In some embodiments. DI is at a concentration of about 90.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 100.0 x 103cells / vial. In some embodiments, DI is 10.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 1.0 x 103to 10.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 50.0 x 103to 80.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 60.0 x 103to 70.0 x 103cells / vial.
[0128] In some embodiments, DI is about 1.0 x 106cells / hemisphere. In some embodiments, DI is about 2.0 x 106cells / hemisphere. In some embodiments, DI is about 3.0 x 106cells / hemisphere. In some embodiments, DI is about 4.0 x 106cells / hemisphere. In some embodiments, DI is about 5.0 x 106cells / hemisphere. In some embodiments, DI is about 6.0 x 106cells / hemisphere. In some embodiments, DI is about 7.0 x 106cells / hemisphere. In some embodiments, DI is about 8.0 x 106cells / hemisphere. In some embodiments, DI is about 9.0 x 106cells / hemisphere. In some embodiments, DI is about 10.0 x 106cells / hemisphere.
[0129] In some embodiments, DI is between 1.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, DI is between 1.0 x 106cells / hemisphere and 6.0 x 106cells / hemisphere. In some embodiments, DI is between 2.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, DI is between 2.0 x 106cells / hemisphere and 6.0 x 106cells / hemisphere. In some embodiments, DI is between 3.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, DI is between 3.0 x 106cells / hemisphere and 6.0 x 106cells / hemisphere. In some embodiments, DI is between 4.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, DI is about 4.0 x 106to about 6.0 x 106cells / hemisphere.In some embodiments, DI is 5.0 x 106cells / hemisphere - 10 * 106cells / hemisphere. . In some embodiments, DI is 5.0 x 106cells / hemisphere - 6 x 106cells / hemisphere. In some embodiments, DI is about 5.0 x 106cells / hemisphere - 10 x io6cells / hemisphere. In some embodiments, DI is about 4.0 x 106to about 11.0 x 106cells / hemisphere. As used herein one dose can mean a single dose (only one dose and no second dose) or a first dose (followed by a second dose).
[0130] In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is a first dose (DI) followed by a second and, in some embodiments, consecutive dose(s) (second andAttorney Docket No.: 87874.01416 consecutive doses referred to collectively as D2). In some embodiments, D2 is at a concentration of 50.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 60.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 70.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 80.0 x I O' cells / vial. In some embodiments, D2 is at a concentration of 90.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 100.0 x IO3cells / vial. In some embodiments, D2 is at a concentration of 110.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 120.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 130.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 140.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 150.0 x 103cells / vial. In some embodiments. D2 is at a concentration of 160.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 170.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 50 x 103cells / vial to 150.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 80 x 103cells / vial to 140.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 110 x 103cells / vial to 140.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 110 x 103cells / vial to 150.0 x 103cells / vial. In some embodiments, D2 is at a concentration of 110 x 103cells / vial to 160.0 x 10Jcells / vial.
[0131] In some embodiments. D2 is 1.0 x 106cells / hemisphere. In some embodiments, D2 is 2.0 x 106cells / hemisphere. In some embodiments, D2 is 3.0 x 106cells / hemisphere. In some embodiments, D2 is 4.0 x 106cells / hemisphere. In some embodiments, D2 is 5.0 x 106cells / hemisphere. In some embodiments, D2 is 6.0 x 106cells / hemisphere. In some embodiments, D2 is 7.0 x 106cells / hemisphere. In some embodiments, D2 is 8.0 x 106cells / hemisphere. In some embodiments, D2 is 9.0 x 106cells / hemisphere. In some embodiments, D2 is 10.0 x 106cells / hemisphere.
[0132] In some embodiments, D2 is at a concentration of about 50.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 60.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 70.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 80.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 90.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 100.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 110.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 120.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 130.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 140.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 150.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 160.0 x 103cells / vial. In some embodiments, D2 isAttorney Docket No.: 87874.01416 at a concentration of about 170.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 50 x 103to 150.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 80 x 103to 140.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 110 x 103to 140.0 x 10Jcells / vial. In some embodiments, D2 is at a concentration of about 110 x 103cells / vial to 150.0 x 103cells / vial. In some embodiments, D2 is at a concentration of about 110 x 103cells / vial to 160.0 x 103cells / vial.
[0133] In some embodiments, D2 is about 1.0 x 106cells / hemisphere. In some embodiments, D2 is about 2.0 x 106cells / hemisphere. In some embodiments, D2 is about 3.0 x 106cells / hemisphere. In some embodiments, D2 is about 4.0 x 106cells / hemisphere. In some embodiments, D2 is about 5.0 x 106cells / hemisphere. In some embodiments, D2 is about 6.0 x 106cells / hemisphere. In some embodiments, D2 is about 7.0 x 106cells / hemisphere. In some embodiments, D2 is about 8.0 x 106cells / hemisphere. In some embodiments, D2 is about 9.0 x 106cells / hemisphere. In some embodiments, D2 is about 10.0 x 106cells / hemisphere.
[0134] In some embodiments, D2 is between 1.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, D2 is between 1.0 x 106cells / hemisphere and 6.0 x 106cells / hemisphere. In some embodiments, D2 is between 2.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, D2 is between 6.0 x 106cells / hemisphere and 6.0 x 106cells / hemisphere. In some embodiments, D2 is between 3.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, D2 is between 3.0 x 106cells / hemisphere and 6.0 x 106cells / hemisphere. In some embodiments, D2 is between 4.0 x 106cells / hemisphere and 10.0 x 106cells / hemisphere. In some embodiments, D2 is about 4.0 x 106to about 6.0 x 106cells / hemisphere. In some embodiments, D2 is 5.0 x 106cells / hemisphere - 10 * 106cells / hemisphere. In some embodiments, D2 is about 5.0 x 106cells / hemisphere - 6 * 106cells / hemisphere. In some embodiments, D2 is about 4.0 x 106to about 11.0 x 106cells / hemisphere
[0135] In some embodiments, more cells are implanted in DI than D2. In some embodiments, the same amount of cells are implanted in DI and D2. In some embodiments, more cells are impanted in D2 than D.
[0136] In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 3.0 x 106cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 4.0 x 106cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 5.0 x 106. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 6.0 x 106cells / hemisphere. cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 7.0 x 106Attorney Docket No.: 87874.01416 cells / hemisphere. cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 9.0 x IO6cells / hemisphere. cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 11.0 x 106cells / hemisphere. cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 12.0 x IO6cells / hemisphere.In some embodiments, DI is at a concentration of about 50.0 x 103cells / vial and D2 is at a concentration of about 80.0 x 103cells / vial. In some embodiments. DI is at a concentration of about 60.0 x 103cells / vial and D2 is at a concentration of about 90.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 70.0 x 103cells / vial and D2 is at a concentration of about 100.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 80.0 x 103cells / vial and D2 is at a concentration of about 120.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 50.0 x 103cells / vial and D2 is at a concentration of about 110.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 60.0 x 103cells / vial and D2 is at a concentration of about 120.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 70.0 x 103cells / vial and D2 is at a concentration of about 130.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 80.0 x 103cells / vial and D2 is at a concentration of about 140.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 50.0 x 103cells / vial and D2 is at a concentration of about 120.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 60.0 x 103cells / vial and D2 is at a concentration of about 130.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 70.0 x 103cells / vial and D2 is at a concentration of about 140.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 80.0 x 103cells / vial and D2 is at a concentration of about 110.0 x 103cells / vial. In some embodiments, DI is at a concentration of about 50-80 x 103cells / vial and D2 is at a concentration of about 110.0-140.0 x 103cells / vial.
[0137] In some embodiments, DI is 1.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 2.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 4.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 6.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 7.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 9.0 x 106cells / hemisphere and D2 is 8.0 x 106Attorney Docket No.: 87874.01416 cells / hemisphere. In some embodiments, DI is 10.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere.
[0138] In some embodiments, DI is 1.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 2.0 x 106cells / hemisphere and D2 is 10.0 x IO6cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 4.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 6.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 7.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 9.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere.
[0139] In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 1.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 2.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 3.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 4.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 5.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 6.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 7.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 8.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 9.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere.
[0140] In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 710 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 2.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 3.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 4.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 5.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 6.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 7.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 8.0 x 106Attorney Docket No.: 87874.01416 cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 9.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 10.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 11.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere.
[0141] In some embodiments, DI is 1.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 2.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 3.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 4.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 5.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 6.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 7.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 8.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 9.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere. In some embodiments, DI is 10.0 x 106cells / hemisphere and D2 is 12.0 x 106cells / hemisphere.
[0142] In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one dose comprising, consisting of, or consisting essentially of 5.0 x 106cells / hemisphere (DI or Dose 1). In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one dose comprising, consisting of, or consisting essentially of 10.0 x 10scells / hemisphere. In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one first dose comprising, consisting of, or consisting essentially of about, at least or at most 5.0 x 106cells / hemisphere or about, at least or at most 10.0 x 106cells / hemisphere and one second dose comprising, consisting of, or consisting essentially of about, at least or at most 5.0 x 106cells / hemisphere, or about, at least or at most 10.0 x 106cells / hemisphere. In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one first dose comprising, consisting of, or consisting essentially of about, at least or at most 5.0 x 106cells / hemisphere to about 10.0 x 106cells / hemisphere and one second dose comprising, consisting of, or consisting essentially of about, at least or at most 5.0 x 106cells / hemisphere to about 10.0 x 106cells / hemisphere. In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one dose comprising, consisting of, or consisting essentially of about 4.0 x 106to 11.0 x 106cells / hemisphere or about 4.0 x 105to 11.0 x 107cells / hemisphere. In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one first dose comprising, consisting of. or consisting essentially ofAttorney Docket No.: 87874.01416 about 4.0 x 106to 11.0 x 106cells / hemisphere administered to a first hemisphere and at least one second dose comprising, consisting of, or consisting essentially of about 4.0 x 106to 11.0 x 106cells / hemisphere administered to a second different hemisphere (contralateral side). In some embodiments, the dose for idiopathic and / or familial Parkinson’s disease is one first dose comprising, consisting of, or consisting essentially of about 4.0 x 106to 11.0 x 106cells / hemisphere administered to a first hemisphere and at least one second dose comprising, consisting of, or consisting essentially of about 4.0 x 106to 11.0 x 106cells / hemisphere administered to the same a first hemisphere.
[0143] In some embodiments, a single dose is administered unilaterally. In some embodiments, two doses are administered bilaterally. Stated another way, a first dose is administered to a first hemisphere and a second dose is administered to a second different hemisphere (contralateral side). In some embodiments, two doses are administered unilaterally. Stated another way, a first dose is administered to a first hemisphere and a second dose is administered to the same first hemisphere.
[0144] The dose of cells in humans is based on the Maximum Feasible Dose (MFD) in rats. In rats, the MFD is about 350,000-550,000 cells per striatum, or 700.000-1,100,000 cells total. Cells can be re-suspended in a variety of concentrations such as from 75,000 / pL, 100,000 / pL, 150, 000 / pL, 175,000 / pL, 200,000 / pL. As previously discussed the injection volume can be between 1-100 3 pL. In some embodiments, the 0.10X MFD, 0.15X MFD, 0.20X MFD, 0.25X MFD, 0.30X MFD, 0.35X MFD, 0.40X MFD, 0.45X MFD, 0.50X MFD, 0.55X MFD, 0.60X MFD, 0.65X MFD, 0.70X MFD. 0.75X MFD, 0.80X MFD, 0.85X MFD, 0.90X MFD, or 0.95X MFD is used.
[0145] In some embodiments, the 2-fold dilution of the high dose results in a total of 225,000 cells per striatum. In some embodiments, the 3-fold dilution of the high dose results in a total of 150,000 cells per striatum. In some embodiments, the 0.25X MFD was a 4-fold dilution of the high dose resulting in a total of 1 12,500 cells per striatum. In some embodiments, the 5-fold dilution of the high dose results in a total of 90,000 cells per striatum. In some embodiments, the 6-fold dilution of the high dose results in a total of 75,000 cells per striatum. In some embodiments, the 7-fold dilution of the high dose results in a total of 64,000 cells per striatum. In some embodiments, the 8- fold dilution of the high dose results in a total of 56,250 cells per stnatum. In some embodiments, the 9-fold dilution of the high dose results in a total of 50,000 cells per striatum. In some embodiments, the 10-fold dilution of the high dose results in a total of 45,000 cells per striatum.
[0146] In some embodiments, the MFD in rat hemi -parkinsonian model is the MFD of 1.0 x 105, 1.5 x 105, 2 x 105, 2.5 x 105, 3 x 105, 3.5 x 105, 4.0 x 105, 4.5 x 105, 5 x 105, 5.5 x 105, 6 x 105, 6.5 xAttorney Docket No.: 87874.01416IO5, 7.0 x IO3, 7.5 x IO3, 8 x 105, 8.5 x IO3, 9 x IO3, 9.5 x IO3, or 10 x IO3cells. In some embodiments, the rat hemi-parkinsonian MFD is multiplied 50x, 75x, lOOx, 125x, 150x, 175x, 200x, 225x, 250x, 275x, 300x, 300x, 325x, 350x, 375x, 400x, 400x, 425x, 450x, 475x, 500x.
[0147] In some embodiments, the human MFD is 1.0 x 107. 2.0 x 107, 3.0 x 107, 4.0 x 107. 5.0 x 107, 6.0 x 107, 7.0 x 107, 8.0 x 107,9.0 x 107, 1.0 x 108, 2.0 x IO8, 3.0 x IO8, 4.0 x 108,cells per hemisphere.
[0148] The human dose (1.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (2.0 x IO6cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (3.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (4.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (5.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (6.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (7.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (8.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (9.0 x 106cells / hemisphere) is lower than the scaled MFD from rat data.
[0149] The human dose (1.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (2.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (3.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (4.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (5.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (6.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (7.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (8.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (9.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (10.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (11.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (12.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data. The human dose (13.0 x 107cells / hemisphere) is lower than the scaled MFD from rat data.
[0150] The rat MFD was not associated with any toxicity when studied in a 9-month GLP tumorgenicity, biodistribution and toxicity study. In some embodiments, the human dose is 30x, 25x, 20x, 18x, 15x, 10X, 9x, 8x, 7x, 6x, 5x, 4x, 3x, 2x, or lx lower than the scaled MFD from rat data. In some embodiments, the human dose is 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%,Attorney Docket No.: 87874.0141640%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% 85%, 90%, 95% less than a maximum feasible human dose of cells
[0151] In some embodiments, dose selection was (1) first determined by scaling allometrically from the rat striatum to human putamen (about 150-250x greater). (2) Second, survival of tyrosine hydroxylase positive (TH+) cells at 6 months in the athymic (genetically immunocompromised) nude rat were then scaled proportionately to address midbrain dopamine neuron loss at PD diagnosis relative to a normal complement of midbrain dopamine neurons dopamine neurons in healthy subjects. (3) Third, as athymic nude rat data were euthanized at 6 months and it is anticipated that further maturation and activity dependent attrition of TH+ will occur in patients through 12 months the scaled estimates are adjusted downward by 1-15%, 2-15%, 3-15%, 4-15%, 5-15%, 6-15%, 7-15%, 8-15%, 9-15%, 10-15%, 11-15%, 12-15%, 13-15%, or 14-15%. In some embodiments, the scaled estimates are adjusted downward by 1-10%. 2-10%, 3-10%, 4-10%, 5- 10%, 6-10%, 7-10%, 8-10%, or 9-10%. In some embodiments, the scaled estimates are adjusted downward by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. In some embodiments, the scaled estimates are adjusted downward by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%. 9%, 10%, 11%, 12%, 13%, 14%, or 15%. (4) Fourth, after immunosuppression is tapered (at 12 months) it is anticipated that additional attrition through the next 24 months, a likely steady state; accordingly, the scaled estimates are adjusted downward by an additional . 1-15%, 2- 15%, 3-15%, 4-15%, 5-15%, 6-15%, 7-15%, 8-15%, 9-15%, 10-15%, 11-15%, 12-15%, 13-15%, or 14-15%. In some embodiments, the scaled estimates are adjusted downward by an additional 1- 20%. 2-20%. 3-10%. 4-20%, 5-20%, 6-20%, 7-20%, 8-20%, 9-20%, 10-20%, 11-20%. 12-20%, 13- 20%, 14-20%, 15-20%, 16-20%, 17-20%, 18-20%, or 19-20%. In some embodiments, the scaled estimates are adjusted downward by an additional 1-10%, 2-10%, 3-10%, 4-10%, 5-10%, 6-10%, 7-10%, 8-10%, or 9-10%. In some embodiments, the scaled estimates are adjusted downward by an additional 1%, 2%. 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. In some embodiments, the scaled estimates are adjusted downward by about an additional 1%, 2%. 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. In some embodiments, dose selection was determined by 1, 2, 3, or 4 above and combinations thereof.
[0152] In some embodiments, dose selection is based on (i) estimating survival of tyrosine hydroxylase positive (TH+) cells at 6 months post engraftment based on human clinical data, (ii) estimating survival of tyrosine hydroxylase positive (TH+) cells based on human clinical data through 12 months post engraftment (iii) immunosuppression taper (at about 12 months) based on human clinical trial data and (iv) combinations thereof.Attorney Docket No.: 87874.01416
[0153] In some embodiments. Dose 1 at 24 months post administration produces an estimated 1.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 2. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 3.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 4.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 5. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 6. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments. Dose 1 at 24 months post administration produces an estimated 6. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 7. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 8.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 9.1 x 105midbrain dopamine neurons per hemisphere. These estimates correcting for a 1-10% and subsequent 1-15% decline discussed above.
[0154] In some embodiments. Dose I at 24 months post administration produces an estimated I.I x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 2.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 3.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments. Dose 1 at 24 months post administration produces an estimated 4. 1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 5.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 6. 1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 7.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 8.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 9. 1 x 105to about 10. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 1 at 24 months post administration produces an estimated 5.0 x 104to about 6.0 x 106midbrain dopamine neurons per hemisphere.Attorney Docket No.: 87874.01416
[0155] In some embodiments, the Dose 2 at 24 months post administration produces an estimated1.1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 2.1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 3. 1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 4. 1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 5. 1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 6. 1 x 106midbrain dopamine neurons per hemisphere. In some embodiments, the Dose 2 at 24 months post administration produces an estimated 7. 1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 8.1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 9. 1 x 106midbrain dopamine neurons per hemisphere In some embodiments, the Dose 2 at 24 months post administration produces an estimated 10. 1 x 106midbrain dopamine neurons per hemisphere. These estimates correcting for a 1- 10% and subsequent 1-15% decline discussed above.
[0156] In some embodiments, Dose 2 at 24 months post administration produces an estimated 1.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 2 at 24 months post administration produces an estimated 2.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 2 at 24 months post administration produces an estimated 3.1 x 105to about 10. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 2 at 24 months post administration produces an estimated 4. 1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. Dose 2 at 24 months post administration produces an estimated 5. 1 x 105to about 6. 1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 2 at 24 months post administration produces an estimated6.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments. Dose 2 at 24 months post administration produces an estimated 7.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 2 at 24 months post administration produces an estimated 8.1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. In some embodiments, Dose 2 at 24 months post administration produces an estimated9. 1 x 105to about 10.1 x 105midbrain dopamine neurons per hemisphere. Dose 2 at 24 monthsAttorney Docket No.: 87874.01416 post administration produces an estimated 5.0 x 104to about 6.0 x 106midbrain dopamine neurons per hemisphere.
[0157] In some embodiments, the cell dose is agnostic of the subject's body weight. In some embodiments, the cell dose is based on the subject’s body weight.
[0158] In some embodiments, in-life duration and tissue analysis will be assessed at a plurality of time points such as about 1 month, 3 months, 6 months. 9 months, 12 months, 15 months, 18, months, 21 months, 24 months, 27 months, and 36 months.
[0159] In some embodiments, the administered cells comprise iPSCs wherein the iPSCs are below the limited of detection. In some embodiments, the administered cells comprise about 0.02% to about 0.1% iPSCs. In some embodiments, the administered cells comprise no more than about 0.1 % iPSCs.First Dose
[0160] In particular, the methods involve administering a first dose of cells to a subject. In particular, the methods involve administering a first dose of cells to the putamen of a subject.
[0161] In some embodiments, the methods involve administering a first dose of cells to the dopamine pathway generally. In some embodiments, the methods involve administering a first dose of cells to the putamen, caudate, caudate nucleus, pars compacta (SNpc), the pars reticulata (SNpr), motor association cortex, thalamus, sensory association cortex, subthalamic nucleus, globus pallidus intemus, globus pallidus extemus. striatum, substantia nigra, the frontal lobe, the mesolimbic system, mesocorti cal DA system, ventral tegmental area, nigrostriatal DA system, amygdala, pituitary gland, dopaminergic neurons, midbrain dopamine (DA) neurons, microglial cells, astrocytes, nen e cells, astrocytes, neurons and combinations thereof of a subject.
[0162] In some embodiments, the first dose is generally large enough to be effective in reducing disease burden wherein the disease burden is a neurological symptom. In some cases, the first dose is large enough to reduce disease burden / neurological symptom, without effecting severe unwanted outcomes. In some embodiments, the first dose is a low dose, such as a neurological symptom reducing dose, such as a dose that is lower than that required to eradicate the disease or condition but that may affect a reduction in burden of such disease or condition. In some embodiments, the disease or condition persists following the administration of the first dose. StatedAttorney Docket No.: 87874.01416 another way, administration of the first dose is not sufficient to eradicate the disease or condition in the subj ect.
[0163] In some embodiments, the first dose contains no more than 5 x 106cells / hemisphere, or no more than 10 x 106cells / hemisphere. In some embodiments, the first dose contains no more than about 5 x io6cells / hemisphere, or no more than about 10 x io6cells / hemisphere. In some embodiments, the first dose contains no more than about 11 x 106cells / hemisphere. In some embodiments, the first dose contains no more than about 5 x io6cells / hemisphere (total 10 x io6cells) or no more than about 10 x io6cells / hemisphere (total 20 x io6cells). In some embodiments, the first dose contains about 5 x 106cells / hemisphere to about 10 x 106cells / hemisphere. In some embodiments, the first dose contains about 4 x io6cells / hemisphere to about 11 x io6cells / hemisphere. In some embodiments, the first dose is administered unilaterally. In some embodiments, the second dose is administered unilaterally. In some embodiments, the first dose is administered bilaterally, i.e., to two hemispheres. In some embodiments, the second dose is administered bilaterally, i.e., to two hemispheres. In some embodiments, the first dose is administered to 1 hemisphere. In some embodiments, the first dose is administered to one first hemisphere and the second dose is administered to one second different hemisphere. In some embodiments, the first dose is administered to the putamen most affected by the disease process. In some embodiments, the first dose is administered to the putamen most affected by the disease process <?.g., greatest denervation as assessed by 18F-L-DOPA PET. In some embodiments, denervation is assessed by 18F-L-DOPA PET, SPECT imaging, or FDG PET. FDG PET does not quantify mDA loss, rather it discloses a network change characteristic known as the Parkinson's Disease Related Pattern (PDRP).
[0164] In some embodiments, the administration of the first dose does not induce an immune response in the subject. In some embodiments, the administration of the first dose does not induce an immune response encompassing one or more of a persistent fever (fever of at least 103 degrees Fahrenheit (39.4 degrees C) for at least three days), hypotension, hypoxia, neurologic disturbances, or a serum level of an inflammatory cytokines, such as interferon gamma (IFNy). granulocytemacrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNFa), IL-6, IL-10, IL- 1[3, IL-8, IL-2, MIP-1, F1I-3L, fracktalkine. and IL-5, and C reactive protein (CRP). In some embodiments, based on clinical data, administration of the first dose does not induce a severe immune response in a majority of treated subjects.Attorney Docket No.: 87874.01416
[0165] In some embodiments, administration of the first dose does not induce grade 3 or higher neurotoxicity in the subject. In some embodiments, based on clinical data, administration of the first dose does not induce grade 3 or higher neurotoxicity7in a majority of subjects. In some embodiments, symptoms associated with a clinical risk of neurotoxicity and / or grade 3 or higher neurotoxicity include confusion, delirium, expressive aphasia, obtundation, myoclonus, lethargy, altered mental status, convulsions, seizure-like activity, seizures (optionally as confirmed by electroencephalogram [EEG]), elevated levels of beta amyloid (A(3), elevated levels of glutamate, and elevated levels of oxygen radicals.
[0166] In some embodiments, the administered cells of the first dose specifically engraft, proliferate, migrate, innervate, and / or differentiate in the hemisphere where they are implanted. In some embodiments, the administered cells of the first dose rescue or increase survival of dopamine neurons in the hemisphere where they are implanted. In some embodiments, the administered cells of the first dose engraft, proliferate, migrate, innervate, and / or differentiate and rescue or increase survival of dopamine neurons in the hemisphere where they are implanted and not in the hemisphere where they are not implanted. In some embodiments, the administered cells of the first dose engraft, proliferate, migrate, innervate, and / or differentiate and rescue or increase survival of the cell type where they are implanted, e.g., cells of the dopamine pathway. In some embodiments, the administered cells of the first dose engraft, proliferate, migrate, innervate, and / or differentiate and rescue or increase survival of the putamen, caudate, caudate nucleus, pars compacta (SNpc), the pars reticulata (SNpr), motor association cortex, thalamus, sensory7association cortex, subthalamic nucleus, globus pallidus intemus. globus pallidus extemus, striatum, substantia nigra, the frontal lobe, the mesolimbic system, mesocortical DA system, ventral tegmental area, nigrostriatal DA system, amygdala, pituitary7gland, dopaminergic neurons, midbrain dopamine (DA) neurons, microglial cells, astrocytes, nerve cells, astrocytes, neurons and combinations thereof.
[0167] In some embodiments, a majority of subjects treated with a first dose exhibit reduced PD symptoms as determined by clinical data. In some embodiments, at least 1%, 3%, 5%, 10%, 15% 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%. 60%. 65%. 70%. 75%. 80%. 85%. 90%. 95%. or more of subjects treated with a first dose exhibit reduced PD symptoms as determined by clinical data. In some embodiments, a majority of subjects treated with a first dose exhibit improved clinical outcomes regarding overall disease severity, motor symptoms, and activities of daily life (ADL) in the ‘off state as determined by clinical data.Attorney Docket No.: 87874.01416
[0168] In some embodiments, the subject does not exhibit a detectable humoral or cell-mediated immune response against the administered cells.
[0169] The therapy and subject's health can be monitored by determining the level of inflammatory response, during and after the therapy. In some embodiments, a subject’s health can be monitored by determining the expression level of at least one anti-inflammatory marker. The therapy and patient's health can be monitored by determining the level of one or more, two or more, three or more, or all of pro-inflammatory or anti-inflammatory markers in a sample isolated from the patient prior to, during and after the therapy. Measurement of expression level or activity level can be accomplished by methods known in the art and briefly described herein, e.g., by PCR, qPCR, miRNA arrays, RNA-seq, multiplex miRNA profiling. The tools and methodologies are known in the art and commercially available from various suppliers. The measurement can be compared to suitable controls, e.g., a prior measurement for that subject or a threshold value.Consecutive Dose(s)
[0170] In some embodiments, the subject only receives one dose of administered cells, z.e., to one hemisphere. In some embodiments, the subject receives a first dose of administered cells and then one or more consecutive doses of administered cells , z.e., to a second different hemisphere than the first dose and / or to the same hemisphere as the first dose, i.e., to the contralateral side.
[0171] In some embodiments, the methods further involve the administration of additional consecutive or subsequent doses, such that a first and single consecutive dose, or first and multiple consecutive doses are administered, e.g., in accordance with the dosing amounts, spacing, and timing schedules as specified for the first dose.
[0172] In some embodiments, a consecutive dose or consecutive doses of cells are administered to the subject at a time after administration of the first or initial dose of cells. In some embodiments, the time is 1-60 minutes or 9-36 months after the first dose. In some embodiments, the time is 1-10 years after the first dose. In some embodiments, the time is 1-60 minutes or 9-36 months after the prior consecutive dose. In some embodiments, the time is 1 -10 years after the prior consecutive dose.
[0173] In some embodiments, at the time of the administration of the consecutive dose, the subject does not exhibit a detectable humoral or cell-mediated immune response against the administered cells of the first dose.Attorney Docket No.: 87874.01416
[0174] In some embodiments, the administered cells of the consecutive dose(s) are identical or substantially identical to the administered cells in the first dose. In some embodiments, the administered cells of the consecutive dose(s) are not identical or not substantially identical to the administered cells in the first dose. In some embodiments, the administered cells of the first consecutive dose are identical or substantially identical to the administered cells in subsequent consecutive doses. In some embodiments, the administered cells of the first consecutive dose are not identical or not substantially identical to the administered cells in subsequent consecutive doses.
[0175] The consecutive dose(s) may be the same, lower, or a higher dose as compared with the first dose. In some embodiments, multiple consecutive doses are administered after a first dose. The consecutive dose(s) may be the same, lower, or a higher dose as compared with a prior consecutive dose.
[0176] Thus, the provided methods in some embodiments involve administering one or more consecutive doses after symptom reducing or reducing disease burden with a first dose, and after a window of risk for toxicity, but before the mounting of an immune response to the administered cells. In some embodiments, one or more consecutive doses are administered after little or no symptom reducing or reducing disease burden with a first dose, and after a window of risk for toxicity, but before the mounting of an immune response to the administered cells.
[0177] In particular, the methods involve administering consecutive dose(s) of cells to a subject. In particular, the methods involve administering consecutive dose(s) of cells to the putamen of a subject.
[0178] In some embodiments, the methods involve administering a consecutive dose(s) of cells to the dopamine pathway generally. In some embodiments, the methods involve administering consecutive dose(s) of cells to the putamen, caudate, caudate nucleus, pars compacta (SNpc), the pars reticulata (SNpr), motor association cortex, thalamus, sensory association cortex, subthalamic nucleus, globus pallidus intemus, globus pallidus extemus, striatum, substantia nigra, the frontal lobe, the mesolimbic system, mesocortical DA system, ventral tegmental area, nigrostriatal DA system, amygdala, pituitary gland, dopaminergic neurons, midbrain dopamine (DA) neurons, microglial cells, astrocytes, nene cells, astrocytes, neurons and combinations thereof of a subject.
[0179] In other embodiments, the number of cells administered in the consecutive dose(s) is the same as, higher or lower than the number of cells administered in the first dose. In other embodiments, the number of cells administered in the consecutive dose(s) is the same as, higher orAttorney Docket No.: 87874.01416 lower than the number of cells administered in a prior consecutive dose. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 10 x io6cells / hemisphere while the first dose administered about or no more than I / 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 10 * 106cells / hemisphere while the first dose administered about or no more than 2 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 10 x io6cells / hemisphere while the first dose administered about or no more than 3 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 10 x io6cells / hemisphere while the first dose administered about or no more than 4 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 10 x io6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 1 x io6cells / hemisphere while the first dose administered about or no more than 5 x io6cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 2 x 1Q6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 3 x io6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 4 x io6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 5 x io6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 6 x 1Q6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 7 x io6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 8 x io6cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 9 x 106cells / hemisphere while the first dose administered about or no more than 5 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 1 x io6cells / hemisphere while the first dose administered about orAttorney Docket No.: 87874.01416 no more than 10 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 2 x io6cells / hemisphere while the first dose administered about or no more than 10 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 3 x io6cells / hemisphere while the first dose administered about or no more than 10 x io6cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 4 x 1 o6cells / hemisphere while the first dose administered about or no more than 10 x 1 o6cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 5 x io6cells / hemisphere while the first dose administered about or no more than 10 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 10 x io6cells / hemisphere while the first dose administered about or no more than 10 x 106cells / hemisphere. In some embodiments, the number of cells administered in the consecutive dose(s) is about or no more than 11 x 1 o6cells / hemisphere while the first dose administered about or no more than 11 x i6cells / hemisphere.
[0180] In some embodiments, based on the assessment, the subject is administered a second dose containing less than, more than, or about the same number of cells as the number of cells in the first dose. In some embodiments, the consecutive dose comprises an increased number of cells as compared to the first dose, such as at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8- fold, 9-fold, or 10-fold greater than the number in the first dose. In some embodiments, the consecutive dose comprises an increased number of cells as compared to the first dose, such as at least 1-10 -fold greater than the number in the first dose.
[0181] In some embodiments, the administered cells of the consecutive dose engraft, proliferate, migrate, innervate, and / or differentiate and rescue or increase survival of the cell type where they are implanted, e.g.. cells of the dopamine pathway. In some embodiments, the administered cells of the consecutive dose engraft, proliferate, migrate, innervate, and / or differentiate and rescue or increase survival of the putamen, caudate, caudate nucleus, pars compacta (SNpc), the pars reticulata (SNpr), motor association cortex, thalamus, sensory association cortex, subthalamic nucleus, globus pallidus intemus, globus pallidus extemus, striatum, substantia nigra, the frontal lobe, the mesolimbic system, mesocortical DA system, ventral tegmental area, nigrostriatal DA system, amygdala, pituitary gland, dopaminergic neurons, midbrain dopamine (DA) neurons, microglial cells, astrocytes, nerve cells, astrocytes, neurons and combinations thereof.
[0182] In some embodiments, a second or consecutive dose is not administered to the patient.Attorney Docket No.: 87874.01416Effective Amount
[0183] In some embodiments, the administered cells are administered in an effective amount.
[0184] In some embodiments, the administered cells engraft, proliferate, migrate, innervate, and / or differentiate in vivo in the subject. In some embodiments, the dose amount(s) and / or timing thereof are designed to promote viability, engraftment, proliferation, migration, innervation, and / or differentiation of the administered cells over time and / or for rescuing or increasing survival of dopaminergic neurons in a subject.
[0185] In some embodiments, the effective amount is the dose of cells that can promote an increased response or efficacy, such as improved or greater reduction in neurological symptoms and / or an improved viability, engraftment, proliferation, migration, innervation, and / or differentiation of the administered cells and / or rescue or increase survival of dopamine neurons and / or DA neuronal function in the host. Specifically, in some embodiments, the administered cells innervate midbrain dopaminergic (DA) neuron target regions and innervate over long distances. Specifically, in some embodiments, the subject exhibited functional recovery (functional recovery means reversal or near reversal of motor asymmetry). Specifically, in some embodiments, the administered cells demonstrate long-range axonal growth to multiple host targets normally innervated by the mesotelencephalic dopamine system.
[0186] In some embodiments, after administration of the first dose the subject is assessed for administered cell viability, engraftment, proliferation, migration, innervation and / or differentiation, and / or rescue or increase survival of dopamine neurons and / or DA neuronal function in the host.
[0187] In some embodiments, the disease or condition is a disease of the central nervous system (CNS).
[0188] Representative examples of CNS diseases or disorders that can be beneficially treated with the administered cells described herein include, but are not limited to, a pain disorder, a motion disorder, a dissociative disorder, a mood disorder, an affective disorder, a neurodegenerative disease or disorder, psychiatric disorders and a convulsive disorder. More specific examples of such conditions include, but are not limited to, Parkinson's disease, ALS. Multiple Sclerosis, Huntington's disease, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, diabetic neuropathy, glaucatomus neuropathy, macular degeneration, action tremors and tardive dyskinesia, panic, anxiety, depression, alcoholism, insomnia, manic behavior, schizophrenia, autism-spectrumAttorney Docket No.: 87874.01416 disorder, manic-depressive disorders, Alzheimer’s and epilepsy. As used herein ‘'beneficially treated” means preventing, treating, managing, ameliorating or eliminating at least one symptom of the disease or disorder or not making the disease or disorder worse. In some embodiments, the at least one symptom is selected from the group consisting of tremor, bradykinesia, flexed posture, postural instability, rigidity, dysphagia, and dementia.
[0189] The use of midbrain dopaminergic progenitor cells may also be used for treatment of traumatic lesions of the nervous sy stem including spinal cord injury' and also for treatment of stroke caused by bleeding or thrombosis or embolism.
[0190] In some embodiments, the administered cells have no obvious safety7concerns. In some embodiments, the administered cells show no signs of tumor formation. In some embodiments, the administered cells show no signs of teratoma formation, tumor formation, malignant neoplastic transformation, and / or neural overgrowth.
[0191] In some embodiments, the administered cells have long-term (> 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months) engraftment of cells that maintain the midbrain dopamine neuron phenotype FOXA2+ / LMX1+, extensive innervation of the striatum, and / or reversal of functional deficits (such as neurological symptoms) in the subject. In some embodiments, the administered cells express at least one marker selected from the group comprising or consisting of or consisting essentially of FOXA2, LMX1 A. tyrosine hydroxylase (TH), nuclear receptor related 1 protein (NURR1), neuronspecific class III beta-tubulin (Tujl), Trefoil factor family 3 (TTF3), paired-like homeodomain 3 (PITX3), achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF- 3), transthyretin (TTR), synapsin, dopamine transporter (DAT), or G-protein coupled, inwardly rectifying potassium channel (Kir3.2 / GIRK2). > 3 months, > 6 months. > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration. In some embodiments, the administered cells express at least one marker selected from the group comprising or consisting of or consisting essentially of Girk2, CD142, DCSM1, CD63, CD99, or ALDH1. > 3 months. > 6 months, > 9 months. > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration. In some embodiments, the administered cells express at least one marker of A9 subtype neurons > 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration.Attorney Docket No.: 87874.01416
[0192] In some embodiments, at least about 20-80% of the administered cells have long-term (> 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months) engraftment of cells that maintain the midbrain dopamine neuron phenotype (FOXA2 / LMX I ), extensive innervation of the striatum, and / or reversal of functional deficits (such as neurological symptoms) in the subject. In some embodiments, at least about 20-80% of the administered cells express at least one marker selected from the group comprising or consisting of or consisting essentially of FOXA2, LMX1 A, tyrosine hydroxylase (TH), nuclear receptor related 1 protein (NURR1), neuron-specific class III beta-tubulin (Tujl), Trefoil factor family 3 (TTF3), paired-like homeodomain 3 (PITX3), achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF-3), transthyretin (TTR), synapsin, dopamine transporter (DAT), or G-protein coupled, inwardly rectifying potassium channel (Kir3.2 / GIRK2). > 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration. In some embodiments, at least about 20-80% of the administered cells express at least one marker selected from the group comprising or consisting of or consisting essentially of Girk2, CD 142, DCSM1, CD63, CD99, or ALDH1. > 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration.
[0193] In some embodiments, at least 1 X 106of the administered cells have long-term (> 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months) engraftment of cells that maintain the midbrain dopamine neuron phenotype (FOXA2 / LMX I ), extensive innervation of the striatum, and / or reversal of functional deficits (such as neurological symptoms) in the subject. In some embodiments, at least 1X106of the administered cells express at least one marker selected from the group comprising or consisting of or consisting essentially of FOXA2, LMX1A, tyrosine hydroxylase (TH), nuclear receptor related 1 protein (NURR1). neuron-specific class 111 beta-tubulin (Tujl), Trefoil factor family 3 (TTF3), paired-like homeodomain 3 (PITX3), achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF-3), transthyretin (TTR), synapsin, dopamine transporter (DAT), or G-protein coupled, inwardly rectifying potassium channel (Kir3.2 / GIRK2). > 3 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration. In some embodiments, at least 1X106of the administered cells express at least one marker selected from the group comprising or consisting of or consisting essentially of Girk2, CD142, DCSM1, CD63, CD99, or ALDH1. > 3Attorney Docket No.: 87874.01416 months, > 6 months, > 9 months, > 12 months, > 18 months, > 24 months or about 1-6 months or about 3-12 months or about 3-24 months after administration.
[0194] In some embodiments, the administered cells are able to form grafts containing up to 12,000 tyrosine hydroxylase (TH)+cells. In some embodiments, the administered cells are able to form grafts containing up to 24,000 tyrosine hydroxylase (TH) cells. In some embodiments, the administered cells are able to form grafts containing 12,000 to 24,000 tyrosine hydroxylase (TH)+cells. In some embodiments, the administered cells are able to form grafts containing up about 2% or 3% or 4% or 5% or 10% or 15% or 20% or 25% or 30% or 35%. or 40 or 45% or 50% of the injected dose of tyrosine hydroxylase (TH)+cells.
[0195] In some embodiments, the administered cells have a detectable neurite outgrowth at about 2 weeks.
[0196] In some embodiments, a plurality of the engrafted cells are positive for tyrosine hydroxylase (TH) markers. In some embodiments, the administered cells differentiate in vivo, and a plurality of the engrafted cells express both FOXA2 and tyrosine hydroxylase (TH). In some embodiments, the administered cells differentiate in vivo, and a plurality of the engrafted cells express FOXA2 and LMX1 (such as LMX1 A), or FOXA2 and TH. In some embodiments, the administered cells differentiate in vivo and express FOXA2 and LMX1 (such as LMX1 A), or FOXA2 and TH, and further express at least one marker selected from the group consisting of orthodenticle homeobox 2 (OTX2), nuclear receptor related 1 protein (NURR1). Neuron-specific class 111 beta-tubulin (Tuj 1). TTF3, paired-like homeodomain 3 (PITX3), achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF-3), transthyretin (TTR), synapsin, dopamine transporter (DAT), and G-protein coupled, inwardly rectifying potassium channel (Kir3.2 / GIRK2), CD 142, DCSM1. CD63 and CD99. In some embodiments, the plurality of engrafted cells that express a marker is between 40%-80%.
[0197] In some embodiments, 10-35% of the engrafted cells are positive for TH markers. In some embodiments, a proportion of the engrafted cells are positive for G-protein-regulated inward- rectifier potassium channel (GIRK2)-positive (midbrain dopamine neurons A9 subtype) and hNuclei / TH / Cal bindin-Positive (A10 neuron subtype) cells.
[0198] In some embodiments, the engrafted cells express phenotypic markers of midbrain dopaminergic neuron cell fate and reverse motor asymmetry. In some embodiments, based on clinical data, graft survival is observed in 1-40% of the subjects based on clinical data. In someAttorney Docket No.: 87874.01416 embodiments, based on clinical data, less than 60% of subjects have diffuse, poorly-defined innervation of the striatum.
[0199] In some embodiments, the subject has diffuse, poorly-defined innervation of the striatum but the engrafted cells are nevertheless sufficient to reverse amphetamine rotations and / or reverse motor asymmetry. In some embodiments, based on clinical data, the administered cells do not affect mortality rates. In some embodiments, the administered cells do not affect changes in body weight, hematology, and clinical chemistry parameters throughout the duration of engraftment.
[0200] In some embodiments, the subj ect demonstrates long-term graft survival (> 6 months, >9 months, >12 months, >18 months, about 2 years or 6-9 months, 6-18 months, or 6-24 months), low levels of transplanted cell proliferation, and / or significant functional recovery'. In some embodiments, the administered cells show long-term survival. In some embodiments, at least 30%, 40%, 60% or between 30-60% or 30-70% of the administered cells show long-term survival (6-24 months) post-engraftment. In some embodiments, at least 1%, 3%, 5%, 10% or between 1-10% or 1-5% of the administered cells show long-term survival (6-24 months) post-engraftment.
[0201] In some embodiments, the administered cells are not form large graft cores. In some embodiments, the cells are dispersed. In some embodiments, the dendrites and axons grow out from A9 cell bodies and innervate targets.
[0202] In some embodiments, the administered cells densely innervate the entire striatum. In some embodiments, the administered cells innervate 1-10%, 1-20%, 20-30% 20-50%, 20-60%, or 50- 80%, or 60-90%, or 70-95% or 80-98% of the striatum (or other cell type). As used here, ‘densely’ can mean a proportion of neuronal density (i.e. number of fibers / unit area) compared to healthy control (non-PD) brain as determined by immunohistochemical staining for tyrosine hydroxylase (TH). As used here, ‘densely’ can mean 1-100 points of 1-50% decrease on MDS-UPDRS-III as a proxy readout of innervation having occurred. In some embodiments, ‘densely’ is determined by 18F-L-DOPA PET, SPECT imaging or FDG PET.
[0203] In some embodiments, the administered cells do not proliferate. In some embodiments, the administered cells exhibit low proliferate. In some embodiments, less than about 1%, 1.5% 2%, 3%, 4%, or less than 5% of the grafted cells at 6 months proliferate.
[0204] In some embodiments, the administered cells contain increased astrocytes compared to adjacent parenchyma. In some embodiments, the administered cells contain decreased microglialAttorney Docket No.: 87874.01416 cells compared to adjacent parenchyma. In some embodiments, the administered cells contain increased astrocytes and decreased microglial cells compared to adjacent parenchyma.
[0205] In some embodiments, the administered cells form microscopically prominent, spaceoccupying. mass-like aggregates that in a plurality of sections appear to variably compress and displace adjacent structures (globus pallidus and / or putamen) but do not infiltrate surrounding tissue.
[0206] In some embodiments, the administered cells and / or grafted cells show below level of detection (BLOD) for the human |3-globin gene.
[0207] In some embodiments, the administered cells result in large numbers of engrafted TH+cells. In some embodiments, the administered cells result in IX, 2X, 3X, 4X. 5X the number of engrafted TH+cells compared to the subject prior to treatment. In some embodiments, the administered cells result in TH+cells representing approximately 15-35% of the total grafted cells. In some embodiments, TH+ cells make up roughly 15-35% of the engrafted cells by 6-9 months.
[0208] In some embodiments, the administered cells show a very low percentage of proliferation (Ki67+) at 6 months. In some embodiments, the administered cells show a low, less than 5% or less than 2% or less than 1%, of proliferation (Ki67+) at 6 months. In some embodiments, less than 1% of the administered cells are proliferative 6-months after administration.
[0209] In some embodiments, the subject exhibits significant functional recover}' by 3 months, by 4 months, by 6 months, by 7 months, by 8 months, by 9 months, by 12 months or by 18 months.
[0210] In some embodiments, the administered cells innervate A10 structures in the prelimbic cortex, olfactory tubercle, anterior olfactory nucleus, septum, and / or nucleus accumbens, with sparse fibers in the striatum. In some embodiments, the administered cells also innervate midbrain dopamine neurons. In some embodiments, the administered cells are able to innervate areas normally innervated by midbrain dopamine neurons. In some embodiments, the administered cells are able to innervate areas normally innervated by the mesotelencephalic dopamine system.
[0211] In some embodiments, the subject exhibits variable hypercellularity of the neuropil along the tract upon administration of the cells. In some embodiments, the subject does not exhibit excessively large foci of haemorrhage, loss of neuropil, evidence of iatrogenic infection, gross lesions, macroscopic evidence of abnormal tissue in the brain, spinal cord, or peripheral tissues, teratoma or ectopic tissue growth in brain tissue upon or after administration of the cells.Attorney Docket No.: 87874.01416
[0212] In some embodiments, the subject exhibits microscopic brain lesions upon administration of the cells.Additional stepsImmunosuppression
[0213] In some embodiments, the subject is exposed to immunosuppression 1-48 hours prior to the transplant. In some embodiments, the subject is administered an immune suppressant, before, and after administration of the cells. In some embodiments, the immune suppressant is LCP-Tacrolimus (Envarsus XR 4 mg po daily, with target levels of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 3-15 or 6-15 ng / ml). In some embodiments, Azathioprine (about 0.5 mg / kg 0.75 mg / kg 1 mg / kg 1.5 mg / kg 1.75 mg / kg 2mg / kg, 2.5 mg / kg 2.75 mg / kg 3 mg / kg. 3.5 mg / kg or 3.75 mg / kg initial dose) is started one day prior to transplant and after checking for Thiopurine methyltransferase (TPMT) deficiency. In some embodiments, on the day of transplant, the subject is treated with dexamethasone (IV Imgxl, 5mgxl, lOmgxl, 15mgxl, 20mgxl, 25mgxl 30mgxl, 35mgxl, 40 mgxl, 45mgxl, 50mgxl,). In some embodiments, on post-transplant day 2, the subject is treated with prednisone (10 mg / day for postoperative days (POD) 1-3, 25 mg / day for postoperative days (POD) 1-3, 50 mg / day for postoperative days (POD) 1-3, 75 mg / day for postoperative days (POD) 1-3, 10 mg / day for POD2 and POD3, 25 mg / day for POD2 and POD3 50 mg / day for POD2 and , 75 mg / day for POD2 and POD3, 100 mg / day for POD2 and POD3). In some embodiments, the prednisone dosage is decreased in the subject on day 4 post-transplant to about 10 mg / day. 9 mg / day, 8 mg / day, 7 mg / day, 6 mg / day, 5mg / day, 4 mg / day, 3 mg / day, 2 mg / day or 1 mg / day. In some embodiments, the subject is continuously treated post-transplant with immune suppressants. In some embodiments, the subject is treated with Tacrolimus and azathioprine post-transplant. In some embodiments, immunosuppression tapering commences at 9 months post-transplant. In some embodiments, to begin immunosuppression tapering a Cortrosyn (IM synthetic ACTH) stimulation test is performed on the patient. In some embodiments, demonstration of hypothalamic-pituitaryadrenal (HP A) suppression (cortisol level <18 mcg / dL) results in a slow' prednisone taper over the next 3 months on a schedule reducing daily prednisone doses from lOmg / dL to 2.5mg / dL, from lOmg / dL to 2 mg / dL, from lOmg / dL to 1.5mg / dL, or from lOmg / dL to 1 mg / dL. In some embodiments, the patient undergoes another Cortrosyn test at 12 months post-transplant to demonstrate recovery' of HPA function. In some embodiments, all immunosuppressants are gradually tapered off about 12 months post-transplant. In some embodiments, all immunosuppressants are gradually tapered off 12 months post-transplant.Attorney Docket No.: 87874.01416
[0214] In some embodiments, the subject is administered medications to mitigate potential immunosuppression side effects. In some embodiments, the subject is administered medications to mitigate potential immunosuppression side effects including daily omeprazole (about 10- 30mg / day), Calichew-D3 (about 300-750mg / 200-500IU / day) and / or Alendronate (about 1- lOmg / day).
[0215] In some embodiments, the patient undergoes infectious disease prophylaxis. In some embodiments, the patient undergoes infectious disease prophylaxis 1 -48 hours prior to transplant with fluconazole (about 50-200mg qd x 12 mo, where fungal exposure endemic, as consulted with infectious disease), Bactrim single strength (about 50-120 mg TMP / 200-600 mg SMX qd x 6 mo), and / or valcyte (about 300-600 qd x 6 mo).
[0216] In some embodiments, if a subject receiving transplants unilaterally, the subject will not undergo immunosuppression taper at 9 months if the subject will receive a second transplant on the previously untransplanted side. In such cases, the patient will continue all immunosuppression medications and at the time of the second transplant (12 months) will commence the higher dose regimen of corticosteroids followed by a post-operative taper identical to the initial transplant. In some embodiments, treatment of the patient with Bactrim single strength (about 50-150 mg TMP / 200-600 mg SMX qd x 6 mo) and valcyte (about 200-600 qd x 6 mo) will be reinitiated. In such situations, fluconazole (about 50-200 mg qd x 12 mo, where fungal exposure endemic, as consulted with infectious disease) will be continued for another 12 months or thereabouts. In some embodiments, tapering of immunosuppression will commence at about 9 months after the second transplant following the schedule and regimen as discussed for the initial transplant.
[0217] In some embodiments, during transplantation the patient will be administered intravenous (IV) antibiotics followed by oral antibiotics.
[0218] In some embodiments, the therapy and patient’s health are monitored using the diagnostic methods known in the art. A non-limiting example of such is by determining the level of DA neurons in a sample isolated from the patient prior to. during and after the therapy compared to levels before treatment or compared to a predetermined threshold or compared to a prior patient sample or compared to wildtype.
[0219] In some embodiments, the subject has been treated with an immune suppressant prior to administration of the first dose and / or prior to the administration of the second dose and / or prior to the administration of the consecutive dose.Attorney Docket No.: 87874.01416
[0220] In some aspects, the subject has not received prior treatment with another therapeutic agent prior to, during or after transplantation. In some aspects, the subject has received prior treatment with another therapeutic agent prior to, during or after transplantation.
[0221] In some embodiments, the subject has been treated with an effective amount of at least one antilipemic agent. In some embodiments, the at least one antilipemic agent is fenofibrate. In some embodiments, the at least one antilipemic agent is administered in a sub-therapeutic dose. In some embodiments, the at least one antilipemic agent is administered in a therapeutic dose. In some embodiments, the effective amount is between 20 and 200 mg / day.
[0222] In some embodiments, the subject has been treated with an effective amount of at least one antilipemic agent and at least one CSF-1R antagonist.
[0223] In some embodiments, the subject has been treated with an effective amount of at least one antilipemic agent, at least one CSF-1R antagonist and pexidartinib. In some embodiments, the composition does not comprise Formula (I) or Formula (II) or a pharmaceutically acceptable salt, a solvate, a tautomer, an isomer, or a deuterated analog of Formulae (I) or (II).
[0224] In some embodiments, the at least one antilipemic agent is administered before, during or after engraftment of the administered progenitors. In some embodiments, the at least one antilipemic agent is administered at least 10 days prior to transplant of the progenitors.
[0225] In some embodiments, the midbrain dopaminergic progenitors are contacted with an antilipemic agent prior to engraftment.
[0226] In some embodiments, the subject is administered at least one other therapeutic agent is i) an alkylating agent selected from adozelesin, altretamine, bizelesin, busulfan, carboplatin, carboquone, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, estramustine, fotemustine, hepsulfam, ifosfamide, improsulfan, irofulven. lomustine, mechlorethamine, melphalan. oxaliplatin, piposulfan, semustine. streptozocin. temozolomide, thiotepa. and treosulfan; ii) an antibiotic selected from bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, menogaril, mitomycin, mitoxantrone, neocarzinostatin, pentostatin, and plicamycin; iii) an antimetabolite selected from the group consisting of azacitidine, capecitabine, cladribine, clofarabine, cytarabine, decitabine, floxuridine, fludarabine, 5 -fluorouracil, ftorafur, gemcitabine, hydroxyurea, mercaptopurine, methotrexate, nelarabine, pemetrexed, raltitrexed, thioguanine, and trimetrexate; iv) an antibody therapy agent selected from alemtuzumab, bevacizumab, cetuximab,Attorney Docket No.: 87874.01416 galiximab, gemtuzumab, nivolumab, pamtumumab, pembrolizumab, pertuzumab, rituximab, tositumomab, trastuzumab, and 90 Y ibritumomab tiuxetan; v) a hormone or hormone antagonist selected from the group consisting of anastrozole, androgens, buserelin, diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelin, idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen, and toremifene: vi) a taxane selected from DJ-927, docetaxel, TPI 287, paclitaxel and DHA-paclitaxel; vii) a retinoid selected from alitretinoin, bexarotene, fenretinide, isotretinoin, and tretinoin; viii) an alkaloid selected from etoposide, homoharringtonine, teniposide, vinblastine, vincristine, vindesine, and vinorelbine; ix) an antiangiogenic agent selected from AE- 941 (GW786034, Neovastat), ABT-510, 2-methoxy estradiol, lenalidomide, and thalidomide; x) a topoisomerase inhibitor selected from amsacrine, edotecarin, exatecan, irinotecan, SN-38 (7-ethyl- 10-hydroxy-camptothecin), rubitecan, topotecan, and 9-aminocamptothecin; xi) a kinase inhibitor selected from erlotinib, gefitinib, flavopiridol, imatinib mesylate, lapatinib, sorafenib, sunitinib malate. AEE-788, AG-013736, AMG 706, AMN107, BMS-354825, BMS-599626, UCN-01 (7- hydroxystaurosporine), vemurafenib, dabrafenib, trametinib, cobimetinib selumetimb and vatalanib; xii) a targeted signal transduction inhibitor selected from bortezomib, geldanamycin, and rapamycin; xiii) a biological response modifier selected from imiquimod, interferon-a and interleukin-2; xiv) an IDO inhibitor; and xv) a chemotherapeutic agent selected from 3-AP (3- amino-2-carboxyaldehyde thiosemicarbazone), altrasentan, aminoglutethimide, anagrelide, asparaginase, bryostatin-1, cilengitide, elesclomol, eribulin mesylate (E7389), ixabepilone, lonidamine, masoprocol, mitoguanazone, oblimersen, sulindac, testolactone, tiazofurin, a mTOR inhibitor, a PI3K inhibitor, a Cdk4 inhibitor, an Akt inhibitor, a Hsp90 inhibitor, a famesyltransferase inhibitor or an aromatase inhibitor (anastrozole letrozole exemestane); xvi) a Mek inhibitor; xvii) a tyrosine kinase inhibitor; xviii) a c-Kit mutant inhibitor, xix) an EGFR inhibitor, or xx) an epigenetic modulator.
[0227] In some embodiments, serotonergic markers are at or below limits of detection in the administered cells. In some embodiments, there are virtually no immunologically labeled serotonergic human cells in the administered cells, i.e., (less than 0.1% or less than between 0. 1- about 0.02%).
[0228] In some embodiments, the subject does not have marked levodopa-induced dyskinesias. In some embodiments, the subject is treated for presumptive GID. In some embodiments, the subject is treated with 5-HT1 A agonists (buspirone), which have been show n to be efficacious in reducing GID if they arise post administration.Attorney Docket No.: 87874.01416
[0229] In some embodiments, the administered cells engraft into the substantia nigra.
[0230] In some embodiments, the administered cells are subject to a 6-hour incubation on ice prior to transplantation.
[0231] In some embodiments, the administered cells are administered without the use of steroids which can eliminate or impair the function of administered cells.
[0232] In some embodiments, the patient is not treated with a dopamine antagonists, any chemotherapy, cytotoxic therapy, or immunotherapy (e.g., IL-2, IL-12, interferon) and / or antipsychotics.Dosing
[0233] In some embodiments, the unit dose comprises the number of cells to be given in the lowest dose in the methods, such as the size of the first dose. In some embodiments, the unit dose includes no more than about 5 x 106cells / hemisphere, no more than about 10 x 106cells / hemisphere or no more than 9.0 x 107cells / hemisphere or no more than the human MFD.
[0234] The timing and size of the multiple doses of cells generally are designed to reduce risk of or minimize toxic outcomes and / or to improve efficacy, such as by providing increased exposure of the subject to the administered cells, e g., over time. The methods involve administering a first dose to a first hemisphere, and, in some embodiments, followed by a consecutive dose in a second different hemisphere.
[0235] In the context of cell therapy, administration of a given "dose" encompasses administration of the given amount or number of cells as a single composition and / or single uninterrupted administration across a plurality of tracks with each track comprising, consisting of, or consisting essentially of a plurality of deposition sites.
[0236] The size of the first and / or one or more consecutive doses of cells are generally designed to provide improved efficacy and / or reduced risk of toxicity. In some embodiments, the number of cells in the first dose is between about 5 x io6cells / hemisphere and 10 x io6cells / hemisphere. inclusive and the second dose is between about 5 x io6cells / hemisphere and 10 x io6cells / hemisphere, inclusive. In some embodiments, the number of cells administered in the consecutive dose is the same as or similar to the number of cells administered in the first dose herein. In some aspects, the consecutive dose is larger than the first dose. For example, in someAttorney Docket No.: 87874.01416 embodiments, the consecutive dose contains more than about 10 x io6cells / hemisphere such as about or at least about 10* 107or 10x108. In some embodiments, the amount or size of the consecutive dose is sufficient to reduce disease burden or an indicator thereof, and / or one or more symptoms of the disease or condition.
[0237] In particular embodiments, the numbers and / or concentrations of cells refer to the number of midbrain dopaminergic progenitor cells administered. In particular embodiments, the numbers and / or concentrations of cells refer to the number of midbrain dopaminergic progenitor cells administered along with a different cell type.
[0238] In certain embodiments, for example, where risk of toxicity and / or disease burden in the subject is determined to be low, the first dose can be a relatively high dose compared to the second dose, such as a high dose that is greater than 10 x io6cells / hemisphere or about between 10 x io6to 10 x io7cells / hemisphere. In some embodiments, disease burden is low if the subject does not exhibit tremor, bradykinesia (extreme slow ness of movement), flexed posture, postural instability and / or rigidity.
[0239] In some embodiments, the number of cells administered are designed to improve one or more outcomes, such as to reduce symptoms of PD selected from the group consisting of tremor, brady kinesia (extreme slowness of movement), flexed posture, postural instability and rigidity.
[0240] The provided dose is based on observations that increased exposure of the subject to the administered cells (e.g., increased number of cells or duration over time) does not necessarily enhance efficacy and can lead to increased or rapid expansion of the administered cells and result in toxicity. Moreover, high doses do not necessarily translate to increased viability, engraftment, proliferation, migration, innervation, and / or differentiation of the administered cells.
[0241] Administering subsequent doses (after the first and second doses) may not be effective, particularly following relapse and / or where the subject has mounted an immune response specific for the administered cells.
[0242] In some embodiments, the methods include assessing a factor indicative of disease burden prior to administration of the first dose, and based on the result of the assessment, determining the concentration of cells to be administered to the subject in a second dose.Attorney Docket No.: 87874.01416Timing of Doses
[0243] In some aspects, the timing of the consecutive dose is measured from the initiation of the first dose to the initiation of the consecutive dose. In some aspects, the timing of the subsequent consecutive dose is measured from the initiation of the prior consecutive dose to the initiation of the subsequent consecutive dose. In some aspects, the consecutive dose is administered at a point in time at which the disease burden in the patient has decreased as compared to the disease burden immediately prior to administration of the first dose.
[0244] In some embodiments, the consecutive dose is administered at a time when a host adaptive immune response is not detected, has not become established, or has not reached a certain level, degree, or stage. In some aspects, the consecutive dose is administered prior to the development of a memory immune response in the subject.
[0245] In some aspects, the time between the administration of the first dose and the administration of the consecutive dose is about 1-60 minutes (i.e. during the same surgical procedure as the first administration), or 9 to about 12 months, about 6 to about 12 months, or 9 to 10 months (i.e. during a different surgical procedure than the first administration). In some embodiments, the administration of the consecutive dose is at a time point more than about 6 months and less than about 18 months after the administration of the first dose.
[0246] In some embodiments, an additional or subsequent dose or doses, e.g., further consecutive doses, are administered following administration of the first consecutive dose. In some aspects, the additional or consecutive dose or doses are administered at least about 1 minute and less than about 5 hours or at least about 6 months and less than about 12 months, or 1-10 years following administration of a prior dose, such as a first prior consecutive dose.Host Immune Responses to Transferred Cells
[0247] In some embodiments, one or more of the doses, e.g., the consecutive dose(s), is administered at a time at which an immune response, e.g., an adaptive or specific immune response to the administered cells, in the subject is not detectable, or not detectable above a certain threshold level. Thus, in some embodiments, the consecutive dose is administered before an immune response, an adaptive or specific immune response, a detectable immune response, and / or a memory response against the administered cells has developed in the subject.Attorney Docket No.: 87874.01416
[0248] The methods may involve the detection of the presence or absence or level of such an immune response or indicator thereof, for example, following the administration of a first or consecutive dose and before the administration of the consecutive or next consecutive dose.
[0249] In some embodiments, where such an immune response is detected, the subject is not administered the consecutive dose.
[0250] In general, the consecutive dose is administered at a time at which the subject does not exhibit a specific or adaptive, e.g.. humoral or cell-mediated, immune response against the administered cells of the first dose, or does not exhibit such a response or indicator thereof at a detectable level or above an acceptable level.
[0251] In some embodiments, the host immune response is or comprises a humoral immune response. The humoral immune response may be indicated by the presence of antibodies specific for the administered cells or receptors expressed thereby in the serum, other bodily fluid, and / or organ or tissue of the subject. In some embodiments, such antibodies of a particular isoty pe are, such as IgM or IgG, e.g.. IgGl, IgG2, IgG3. and / or IgG4; in some embodiments they include IgE.
[0252] In some embodiments, the immune response is or comprises a cell-mediated component. A cell-mediated response may be indicated by the presence of cells, e.g., T cells, e.g.. helper or cytotoxic T cells, that specifically recognize one or more epitopes of the recombinant receptor or cells via a T cell receptor.
[0253] In some embodiments the immune response is a primary immune response; in some aspects, the immune response is a memory response.
[0254] In some of any of the above embodiments, a detectable immune response refers to an amount detectable by any of a number of known methods for assessing specific immune responses to particular antigens and cells. For example, in some embodiments, the immune response of the specified type is detectable by performing ELISpot. ELIS As. or cell-based antibody detection methods, for example, by flow cytometry, on serum from the subject to detect the presence of antibodies that specifically bind to and / or neutralize antigens on the administered cells.
[0255] In some aspects, the presence or absence of such a host immune response and / or quantity, degree, or extent thereof, is detected or measured, for example, following the administration of the first dose or consecutive dose.Attorney Docket No.: 87874.01416Disease Burden
[0256] The administration, e.g., of one or more of the doses, generally reduces or prevents the expansion or burden of the disease or condition in the subject. For example, where the disease or condition is PD, the methods generally reduce tremor, bradykinesia (extreme slowness of movement), flexed posture, postural instability and / or rigidity. In some embodiments, administration of the consecutive dose is timed with respect to a decrease in burden and / or relapse following the first or a prior dose.
[0257] In some embodiments, the methods and / or administration of the first dose decrease(s) disease burden as compared with disease burden at a time immediately prior to the administration of the first dose. In some embodiments, the consecutive dose effects a reduction, e.g., a further reduction, in disease burden after the first dose or prior dose.
[0258] In some embodiments, the first dose contains the administered cells in an amount that is effective to reduce burden of a disease or condition in the subject. In some aspects, administration of the first dose and / or consecutive dose may prevent an increase in disease burden, and this maybe evidenced by no change in disease burden.
[0259] In some aspects, the disease or condition persists following administration of the first dose and / or administration of the first dose is not sufficient to eradicate the disease or condition in the subject.
[0260] In some aspects, administration of the consecutive dose is not sufficient to eradicate the disease or condition in the subject. In some aspects, administration of the consecutive dose reduces disease burden as compared to disease burden at a time immediately prior to the first dose, or at a time immediately prior to the consecutive dose. In some aspects, for example in the context of relapse, administration of the consecutive dose effects a reduction in disease burden as compared to the peak level of disease burden following administration of the first dose.
[0261] In some aspects, disease burden is measured or detected prior to administration of the first dose, following the administration of the first dose but prior to administration of the consecutive dose, and / or following administration of the consecutive dose. In the context of multiple consecutive doses, disease burden in some embodiments may be measured prior to or following any of the consecutive doses, or at a time between administration of consecutive doses.Attorney Docket No.: 87874.01416
[0262] In some embodiments, the burden is decreased by or by at least at or about 10, 20, 30, 40, 50, 60, 70, 90, or 100 percent after administration of the first dose. In some aspects, administration of the consecutive dose effects a further reduction in disease burden, such as at or about 10, 20, 30, 40, 50, 60, 70, 90, or 100 percent decrease in burden compared to immediately prior to the administration of the consecutive dose or overall compared to immediately prior to the first dose.
[0263] In some embodiments, reduction of disease burden is assessed at 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 12 months. 18 months, or more than 9 months, after administration of. e.g., initiation of, the first or consecutive dose.Administered Cells
[0264] In some embodiments, the administered cells are midbrain dopaminergic progenitors. In some embodiments, the administered cell is an allogeneic dopaminergic progenitor cell drug product that is derived from induced human pluripotent stem cells (iPSCs). In some embodiments, the source of the iPSC is a healthy donor who does not harbor any known risk genes associated with neurodegenerative diseases or other major diseases such as cancer. In some embodiments, the administered cells are iPSC-derived, allogeneic, cryopreserved midbrain dopaminergic progenitor cells. In some embodiments, the administered cells are iPSC-derived, allogeneic, cryopreserved midbrain dopaminergic progenitors. .
[0265] In some embodiments, the administered cells are midbrain dopaminergic progenitors that are FOXA2+ / LMX1+. In some embodiments, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80% or between 40-70% of the administered cells are midbrain dopaminergic progenitors that are FOXA2+ / LMX1+. In some embodiments, the administered cells are midbrain dopaminergic progenitors that are FOXA2+ / LMX1+and further express at least one marker selected from the group consisting of orthodenticle homeobox 2 (OTX2), nuclear receptor related 1 protein (NURR1), Neuron-specific class III beta-tubulin (Tujl), TTF3, paired-like homeodomain 3 (PITX3). achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF-3), transthyretin (TTR), synapsin, dopamine transporter (DAT), G-protein coupled, inwardly rectifying potassium channel (Kir3.2 / GIRK2), CD 142, DCSM1, CD63, and CD99.
[0266] The off-the-shelf nature of midbrain dopaminergic progenitors, together with the improved differentiation protocol, have the potential to overcome the disadvantages of other investigational cell therapies in the field, such as fetal ventral mesencephalon (fVM) cells, which are procuredAttorney Docket No.: 87874.01416 from fetal tissues and therefore have the drawbacks of limited tissue availability and the ethical problems of using fetal tissues, or the poor in vivo performance (e.g. contamination by serotonergic cells in the transplant leading to graft-induced dyskinesia (GID)) obtained with embryonic stem cells and iPSC differentiated with earlier protocols.
[0267] In some embodiments, the administered cells are midbrain dopaminergic progenitor cells derived from pluripotent cells (including iPSCs) using a mono-SMAD or dual-SMAD inhibition approach as described in U.S. Patent Nos. 10,590,383 (FCDI) and 10,280,398 (Studer) both of which are incorporated herein by reference in their entirety. In some embodiments, the administered cells are derived from stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs).
[0268] The administered cells are generally eukaryotic cells, such as mammalian cells, and typically are human cells.
[0269] In some embodiments, the administered cells are a D17 progenitor cell. In some embodiments, the administered cell population does not comprise a post-mitotic neuron.
[0270] In some embodiments, the administered cells are implanted following thawing.
[0271] In some embodiments, the administered cells are a mixture of midbrain dopamine progenitors (found in substantia nigra, a specific subtype lost in early PD) and A10 DA neurons (found in the adjacent ventral tegmental area). In some embodiments, the administered cells are a mixture of A9 and A10 DA neurons.
[0272] In some embodiments, administered cells have not been genetically engineered. In some embodiments, administered cells have been genetically engineered. In some embodiments, administered cells are a combination of genetically engineered and non-genetically engineered cells. In some embodiments, the administered cells include one or more nucleic acids introduced via genetic engineering, and thereby express recombinant or genetically engineered products. In some embodiments, the nucleic acids are heterologous, i.e., normally not in a cell or sample obtained from the cell, such as one obtained from another organism or cell, which for example, is not ordinarily found in the cell being engineered and / or an organism from which such cell is derived. In some embodiments, the nucleic acids are not naturally occurring, such as a nucleic acid not found in nature, including one comprising chimeric combinations of nucleic acids encoding various domains from multiple different cell types.Attorney Docket No.: 87874.01416
[0273] In some embodiments, the administered cells are pluripotent stem cells (PSC)-derived midbrain dopaminergic progenitors. In some embodiments, the administered cells are induced pluripotent stem cells (iPSC)-derived midbrain dopaminergic progenitors. In some embodiments, the administered cells are midbrain dopaminergic progenitors obtained from a variety of sources including embryonic and nonembryonic sources, for example, hESCs and nonembryonic hiPSCs (Human induced pluripotent stem cells), somatic stem cells, disease stem cells, i.e. isolated pluripotent cells and engineered derived stem cells isolated from Parkinson disease patients, cancer stem cells, human or mammalian pluripotent cells, etc. In some embodiments, the midbrain dopaminergic progenitors are not obtained from embryonic sources.
[0274] In some embodiments, the administered cells are midbrain dopaminergic progenitors that are genetically modified to be miR-155-3p biased or miR-155-5p biased.
[0275] In some embodiments, the administered cells are midbrain dopaminergic progenitors in which the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) (Seq ID No.l) or a variant thereof is increased or decreased compared to wildtype (or native unmodified cells).
[0276] In some embodiments, the administered cells are midbrain dopaminergic progenitors that comprises or consists of a nucleotide sequence with SEQ ID No 4 (UUCCUACAUAUUAGCAUUAACA) modified hsa-miR-155-3p.
[0277] In some embodiments, the administered cells are midbrain dopaminergic progenitors that comprises or consists of a nucleotide sequence in which all of the nucleotides corresponding to nucleotides 2 to 22 of the SEQ ID No 3 (human hsa-miR-155-3p MIMAT0004658, CUCCUACAUAUUAGCAUUAACA) are retained.
[0278] In some embodiments, the administered cells are midbrain dopaminergic progenitors wherein SEQ ID NO 5 (modified hsa-miR-155 stem loop, CUGUUAAUGCUAAUCGUGAUAGGGAUUUUUGCCUCCAACUGAUUCCUACAUAUUAG CAUUAACAG) or a variant thereof is integrated into the midbrain dopaminergic progenitor cells to increase the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) (Seq ID No. l) or a variant thereof.
[0279] In some embodiments, the administered cells are midbrain dopaminergic progenitors wherein additional copies of miR-155-3p (CAUAAAGUAGAAAGCACUACU) (Seq ID No. l), orAttorney Docket No.: 87874.01416 a variant thereof are inserted into the DA neuronal cells to increase the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) (Seq ID No. 1) or a variant thereof.
[0280] In some embodiments, the administered cells are midbrain dopaminergic progenitors wherein the endogenous genomic sequence encoding miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) (Seq ID No. 2) or a variant thereof is deleted or mutated in the DA neuronal cells to decrease the level of miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) (Seq ID No.2) or a variant thereof.
[0281] In some embodiments, the administered cells are midbrain dopaminergic progenitors wherein the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) (Seq ID No. l) or a variant thereof is increased, for use in the treatment of Parkinsonian disorders.
[0282] In some embodiments, the administered cells are midbrain dopaminergic progenitors wherein the level of miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) (Seq ID No.2) or a variant thereof is decreased, for use in the treatment of Parkinsonian disorders.
[0283] In some embodiments, the administered cells are midbrain dopaminergic progenitors comprise at least one exogenous GBA gene or functional fragment thereof.
[0284] In some embodiments, the administered cells are midbrain dopaminergic progenitors and are engineered to be hemizygous null for SNCA.
[0285] Genetic engineering generally involves introduction of a nucleic acid encoding the recombinant or engineered component into the cell, such as by retroviral transduction, transfection, or transformation as known to those of skill in the art.
[0286] In some embodiments, recombinant nucleic acids are transferred into cells using recombinant infectious virus particles, such as, e.g.. vectors derived from simian virus 40 (SV40), adenoviruses, adeno-associated virus (AAV).
[0287] Among additional nucleic acids, e.g., genes for introduction are those to improve the efficacy of therapy, such as by promoting viability and / or function of administered cells; genes to provide a genetic marker for selection and / or evaluation of the administered cells, such as to assess in vivo survival or localization; genes to improve safety, for example, by making the cell susceptible to negative selection in vivo.Attorney Docket No.: 87874.01416Compositions and Formulations
[0288] Also provided are compositions including the administered cells for administration, including pharmaceutical compositions and formulations, such as unit dose form compositions including the number of cells for administration in a given dose or fraction thereof. The pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient. In some embodiments, the composition includes at least one additional therapeutic agent. In some embodiments, the composition includes a noncompendial excipient that does not have novel excipients nor excipients of human origin.
[0289] In some embodiments, the administered cell populations are allogeneic or autologous to the subject receiving the cell populations.
[0290] In any of the methods described herein the administered cells may be obtained from an autologous, semi-allogeneic or non-autologous (i.e., allogeneic or xenogeneic) human donor or embry o or cord / placenta. For example, cells may be isolated from a human cadaver or a donor subject.
[0291] The term semi-allogeneic refers to donor cells which are partially-mismatched to recipient cells at a major histocompatibility complex (MHC) class I or class II locus.
[0292] This disclosure also provides a pharmaceutical compositions comprising, or alternatively consisting essentially of, or yet further consisting of, a pharmaceutically acceptable carrier and an effective amount of cells differentiated from pluripotent cells. In one aspect, the differentiated cell population comprises, consists of or consists essentially of midbrain dopaminergic progenitors. In one aspect, the differentiated cell population comprises, consists of or consists essentially of genetically altered / recombinant midbrain dopaminergic progenitors.
[0293] The compositions are useful for the preparation of a medicament and / or to perform methods for one or more of: a) inhibiting the progression of, b) preventing or c) treating, a disease, e.g.. a neurologic disease or an associated disorder.
[0294] In one aspect, the compositions are useful for the preparation of a medicament and / or to perform methods for one or more of: a) inhibiting the progression of. b) preventing or c) treating, Parkinson’s disease or an associated disorder in a subject in need thereof. The methods comprise, or alternatively consist essentially of, or yet further consist of, administering to the subject anAttorney Docket No.: 87874.01416 effective amount of the pharmaceutical composition described above including midbrain dopaminergic progenitor cells.
[0295] The pharmaceutical compositions can be conveniently presented in dosage unit form and can be prepared by any of the methods well known in the art of pharmacy. In the pharmaceutical composition the active object compound is included in an amount sufficient to produce the desired therapeutic effect. For example, pharmaceutical compositions of the disclosure may take a form suitable for trans-frontal administration.
[0296] The compositions will generally be used in an amount effective to achieve the intended result, for example, in an amount effective to treat or prevent the particular condition being treated. The compound(s) can be administered therapeutically to achieve therapeutic benefit or prophylactically to achieve prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated and / or eradication or amelioration of one or more of the symptoms associated with the underlying disorder such that the patient reports an improvement in feeling or condition, notwithstanding that the patient may still be afflicted with the underlying disorder. Therapeutic benefit also includes halting or slowing the progression of the disease, regardless of whether improvement is realized.
[0297] For prophy lactic administration, the compound can be administered to a patient at risk of developing one of the previously described conditions. Alternatively, prophylactic administration can be applied to avoid the onset of symptoms in a patient diagnosed with the underlying disorder.
[0298] Preferably, the compound(s) will provide therapeutic or prophylactic benefit without causing substantial toxicity.
[0299] In some aspects, the choice of carrier is determined in part by the particular cell and / or by the method of administration. Accordingly, there are a variety of suitable formulations. For example, the pharmaceutical composition can contain preservatives. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. The preservative or mixtures thereof are typically in an amount of about 0.0001% to about 2% by weight of the total composition. Carriers are described, e.g., by Remington's Pharmaceutical Sciences 16th edition, Osol. A. Ed. (1980). Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine;Attorney Docket No.: 87874.01416 preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and / or non-ionic surfactants such as polyethylene glycol (PEG).
[0300] Buffering agents in some aspects are included in the compositions. Suitable buffering agents include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffering agents is used. The buffering agent or mixtures thereof are typically in an amount of about 0.001% to about 4% by weight of the total composition. Methods for preparing administrable pharmaceutical compositions are known. Exemplary methods are described in more detail in, for example. Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).
[0301] The formulations can include aqueous solutions. The formulation or composition may also contain more than one active ingredient useful for the particular indication, disease, or condition being treated with the administered cells, preferably those with activities complementary to the administered cells, where the respective activities do not adversely affect one another. Such active ingredients are suitably in combination in amounts that are effective for the purpose intended. Thus, in some embodiments, the pharmaceutical composition further includes other pharmaceutically active agents or drugs.
[0302] The pharmaceutical composition in some embodiments contains the administered cells in amounts effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactically effective amount. Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects.
[0303] In some embodiments, the composition includes the administered cells in an amount effective to reduce burden of the disease or condition, and / or in an amount that does not result inAttorney Docket No.: 87874.01416Cytokine release syndrome (CRS) or severe CRS in the subject and / or to effect any of the other outcomes of the methods as described herein.
[0304] The administered cells and compositions may be administered using standard administration techniques, formulations, and / or devices. Administration of the administered cells can be autologous or heterologous. For example, immunoresponsive cells or progenitors can be obtained from one subject, and administered to the same subject or a different, compatible subject.Peripheral blood derived immunoresponsive cells or their progeny (e.g., in vivo, ex vivo or in vitro derived) can be administered via localized injection, including catheter administration, systemic injection, localized injection, intravenous injection, or parenteral administration. When administering a therapeutic composition (e.g., a pharmaceutical composition containing a genetically modified immunoresponsive cell), it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion).
[0305] Formulations include those for trans-frontal administration.
[0306] Compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyoi (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
[0307] Sterile injectable solutions can be prepared by incorporating the administered cells in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, and / or colors, depending upon the route of administration and the preparation desired. Standard texts may in some aspects be consulted to prepare suitable preparations.Attorney Docket No.: 87874.01416
[0308] Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, and sorbic acid. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0309] The formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g.. by filtration through sterile filtration membranes.
[0310] Also provided are cells and compositions for use and uses of cells and compositions for treating a disease or condition in a subject, such as PD, where the cells express FOXA2+ / LMX1+. In some embodiments, the compositions or cells for use or medical uses are for use 6-12 months or 1-10 years after the previous treatment. In some embodiments, the compositions or cells for use are formulated for administration of a consecutive dose in an amount sufficient for reduction in burden of a disease or condition in the subject having been previously treated with the administered cells.
[0311] In some embodiments of such medical uses, the compositions or cells are for use that includes administering to a subject having the disease or condition a first dose of cells expressing FOXA2+ / LMX1+. In some embodiments, the first dose contains no more than about 10 * 106cells / hemisphere. In some embodiments, the compositions or cells are for use that includes administering to the subject a second or consecutive dose(s) of cells expressing FOXA2+ / LMX1+at a time point that is at least or less than about 6-months after initiation of the administration of the first dose.
[0312] In some embodiments, the use of cells expressing FOXA2 / LMX1+are for manufacture of a medicament for the treatment of a disease or condition in a subject includes cells that are formulated and / or packaged for administration to the subject in a first and a second dose.
[0313] In some embodiments, the administered cells for use are formulated and / or packaged for administration to the subject in a first and a second dose. In some embodiments, the first dose contains no more than about 10 x 106cells / hemisphere.
[0314] In some embodiments, the administered cells composition for use includes where the disease or condition is PD.Attorney Docket No.: 87874.01416
[0315] In some embodiments, midbrain dopaminergic progenitor cells are harvested, pelleted and resuspended in a buffer to a concentration of 1.5 x 107viable cells / mL. In some embodiments, the buffer is a non-compendial excipient that does not have novel excipients and / or excipients of human origin. In some embodiments, midbrain dopaminergic progenitor cells are then automatically filled into 2 mL vials to ImL total volume in closed aseptic conditions. In some embodiments, composition of midbrain dopaminergic progenitor cells is listed in Table 1 .Table 1: Composition of Midbrain Dopaminergic Progenitor Drug ProductArticles of Manufacture
[0316] Also provided are articles of manufacture, such as kits, for the administration of the administered cells to subjects in according to the provided methods for cell therapy, and for storage and administration of the administered cells and compositions.
[0317] Also provided are articles of manufacture for carry ing out the methods. In some embodiments, the article of manufacture includes a plurality of containers, e.g., sealable containers, each individually comprising a unit dose of cells, for administration to the subject, packaging material, and / or a label or package insert.
[0318] The articles of manufacture include one or more containers, ty pically a plurality of containers, packaging material, and a label or package insert on or associated with the container or containers and / or packaging, generally including instructions for administration of the administered cells to a subject.
[0319] The containers generally contain the administered cells to be administered, e.g., one or more unit doses thereof. The article of manufacture typically includes a plurality of containers, each containing a single unit dose of the administered cells. The unit dose may be an amount or numberAttorney Docket No.: 87874.01416 of the administered cells to be administered to the subject in the first dose or twice the number (or more) the administered cells to be administered in the first or consecutive dose(s). It may be the lowest dose or lowest possible dose of the administered cells that would be administered to the subject in connection with the administration method. In some embodiments, the unit dose is the minimum number of cells or number of cells that would be administered in a single dose to any subject having a particular disease or condition or any subject, according to the methods herein. For example, the unit dose in some aspects may include a minimum number of cells that would be administered to a patient.
[0320] In some embodiments, each of the containers individually comprises a unit dose of the administered cells, e.g., including the same or substantially the same number of cells. In some embodiments, the unit dose includes less than about 5 * 106cells / hemisphere, less than about 10 x 106cells / hemisphere. In some embodiments, the unit dose includes about 5 x io6to about 10 x io6cells / hemisphere.
[0321] Suitable containers include, for example, bottles, vials, syringes, and flexible bags, such as infusion bags. In particular embodiments, the containers are bags, e.g., flexible bags, such as those suitable for infusion of cells to subjects, e.g., flexible plastic or PVC bags, and / or IV solution bags. The bags in some embodiments are sealable and / or able to be sterilized, so as to provide sterile solution and delivery' of the administered cells and compositions. In some embodiments, the containers, e.g., bags, have a capacity of at or about or at least at or about 10, 20, 30, 40, 50, 60, 70, 80. 90, 100, 200. 300, 400, or 500 ml capacity, such as between at or about 10 and at or about 100 or between at or about 10 and at or about 500 mL capacity. In some embodiments, the containers, e.g., bags, are and / or are made from material which is stable and / or provide stable storage and / or maintenance of cells at one or more of various temperatures, such as in cold temperatures, e.g. below at or about or at or about -20° C., -80° C., -120° C., -135° C. and / or temperatures suitable for cryopreservation, and / or other temperatures, such as temperatures suitable for thawing the administered cells and body temperature such as at or about 37° C., for example, to permit thawing, e.g., at the subject's location or location of treatment, e.g., at bedside, immediately prior to treatment.
[0322] The containers may be formed from a variety of materials such as glass or plastic. In some embodiments, the container has one or more port, e.g., sterile access ports, for example, for connection of tubing or cannulation to one or more tubes, e.g., for intravenous or other infusion and / or for connection for purposes of transfer to and from other containers, such as cell cultureAttorney Docket No.: 87874.01416 and / or storage bags or other containers. Exemplary containers include infusion bags, intravenous solution bags, vials, including those with stoppers pierceable by a needle for injection.
[0323] The article of manufacture may further include a package insert or label with one or more pieces of identifying information and / or instructions for use. In some embodiments, the information or instructions indicates that the contents can or should be used to treat a particular condition or disease, and / or providing instructions therefor. The label or package insert may indicate that the contents of the article of manufacture are to be used for treating the disease or condition. In some embodiments, the label or package insert provides instructions to treat a subject, e.g., the subject from which the administered cells have been derived, via a method involving the administration of a first and one or more consecutive doses of the administered cells, e.g., according to any of the embodiments of the provided methods. In some embodiments, the instructions specify administration, in a first dose, of one unit dose, e.g.. the contents of a single individual container in the article of manufacture. In some embodiments, the instructions specify’ administration of one or more consecutive doses at a specified time point or within a specified time window and / or after the detection of the presence or absence or amount or degree of one or more factors or outcomes in the subject.
[0324] In some embodiments, the instructions specify' administering a plurality of the unit doses to the subject by earn ing out a first administration and a consecutive administration. In some embodiments, the first administration comprises delivering one of the unit doses to the subject and the consecutive administration comprises administering one or a plurality of the unit doses to the subject.
[0325] In some embodiments, the instructions specify that the consecutive administration is to be carried out at a time between about 1-60 minutes or 6-12 months following the initiation of the first administration or the prior administration.
[0326] In some embodiments, the label or package insert, or packaging comprises an identifier to indicate the specific identity of the subject from which the administered cells are derived and / or are to be administered. In the case of autologous transfer, the identity of the subject from which the administered cells are derived is the same as the identity of the subject to which the administered cells are to be administered. Thus, the identifying information may specify that the administered cells are to be administered to a particular patient, such as the one from which the administered cells were originally derived. Such information may be in the packaging material and / or label inAttorney Docket No.: 87874.01416 the form of a bar code or other coded identifier or may indication the name and / or other identifying characteristics of the subject.
[0327] The article of manufacture in some embodiments includes one or more, typically a plurality, of containers containing compositions comprising, consisting of, or consisting essentially of the administered cells, e.g., individual unit dose forms thereof, and further include one or more additional containers with a composition contained therein which includes a further agent, such as a therapeutic agent, for example, which is to be administered in combination, e.g., simultaneously or sequentially in any order, with the administered cells. Alternatively, or additionally, the article of manufacture may further include another or the same container comprising a pharmaceutically- acceptable buffer. It may further include other materials such as other buffers, diluents, filters, tubing, needles, and / or syringes.
[0328] The term '‘package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and / or warnings concerning the use of such therapeutic products.
[0329] In some embodiments, the label or package insert includes instructions for administering a plurality of the unit doses to the subject, for example, by administering a certain number of such unit doses, e.g., one unit dose, in administration of a first dose, and then administering a consecutive dose including one or a plurality of the unit doses.
[0330] In some embodiments, the instructions specify carry ing out a first administration, the first administration comprising delivering one of the unit doses to the subject, and carrying out a consecutive administration, the consecutive administration comprising administering one or a plurality of the unit doses to the subject.Exemplary Embodiments
[0331] Among the embodiments provided herein are:
[0332] 1. A method of treatment, comprising, consisting of or consisting essentially of:
[0333] (a) administering to a subject having a disease or condition a first dose of cells expressing both forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1Attorney Docket No.: 87874.01416(LMX1) (F0XA2+ / LMX1+), the first dose comprising no more than about 10 x 106cells / hemisphere to 5 trajectories, each with 8 depositional sites; and
[0334] (b) administering to the subject a consecutive dose of cells expressingFOXA2+ / LMX1+ at a time point that is (i) no more than about 8 hours after initiation of the administration in (a) or (ii) that is no more than about 12 months after initiation of the administration in (a).
[0335] 2. A method of treatment, comprising, consisting of, or consisting essentially of:
[0336] (a) administering to a subject a first dose of midbrain dopaminergic progenitor cells, the first dose comprising, consisting of, or consisting essentially of the administered cells in an amount sufficient to reduce burden of a disease or condition in the subject; and
[0337] (b) administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells at a time (i) that is no more than about 8 hours after initiation of the administration in (a) or (ii) that is no less than 6 months but no more than about 12 months after initiation of the administration in (a).
[0338] 3. The method of any of embodiments 1-2, wherein the subject has not received a dose of midbrain dopaminergic progenitor cells prior to the administration in (a).
[0339] 4. The method of embodiment 1-3, wherein the midbrain dopaminergic progenitor cells in the consecutive dose are identical to the administered cells in the first dose or is substantially identical to the administered cells in the first dose.
[0340] 5. The method of any of embodiments 1-4, wherein the administered cells in the first dose engraft in the host, proliferate in the host, migrate in the host, innervate in the host, differentiate in the host, or improve the function of DA neuronal cells already in the host.
[0341] 6. The method of embodiments 1-5, wherein the disease or condition is Parkinson’s disease.
[0342] 7. The method of embodiments 1-6, wherein the administration in (a) leads to a reduction in burden of the disease or condition in the subject, as indicated by a reduction in one or more factors indicative of disease burden following the administration in (a).Attorney Docket No.: 87874.01416
[0343] 8. The method of embodiments 1 -7, wherein at the time of the administration in (b)(ii), the subject has not relapsed and / or the one or more factors indicative of disease burden have not increased following the reduction.
[0344] 9. The method of any of embodiments 1-8, wherein the consecutive dose of cells comprises cells in an amount sufficient for reduction in burden of a disease or condition in the subject.
[0345] 10. The method of any of embodiments 1-9, wherein the administration in (b) leads to a further reduction in burden of the disease or condition in the subject.
[0346] 11. The method of any of embodiments 1-10, wherein the administration of the consecutive dose in (b)(ii) leads to a reduction in burden of the disease or condition in the subject as compared with immediately prior to initiation of the administration of the consecutive dose.
[0347] 12. The method of any of embodiments 1-11, wherein the disease or condition persists following the administration of the first dose and / or the administration of the first dose is not sufficient to eradicate the disease or condition in the subject.
[0348] 13. The method of any of embodiments 1-12, wherein the disease or condition persists following the administration of the consecutive dose and / or the administration of the consecutive dose is not sufficient to eradicate the disease or condition in the subject.
[0349] 14. The method of any of embodiments 1-13, wherein: the method results in less than a maximum feasible dose or number of administered cells being administered in step a.
[0350] 15. The method of any of embodiments 1-14, wherein: the method results in less than a maximum feasible dose or number of administered cells being administered in step b.
[0351] 16. The method of any of embodiments 1-15, wherein: at month 9 following the initiation of the administration in (a), rescue or increase survival of dopamine neurons and / or DA neuronal function in the subject is seen.
[0352] 17. The method of any of embodiments 1-16, wherein the consecutive dose comprises about the same number of administered cells as the number of administered cells in the first dose.
[0353] 18. The method of any of embodiments 1-16, wherein the consecutive dose comprises an increased number of administered cells as the number of administered cells in the first dose.Attorney Docket No.: 87874.01416
[0354] 19. The method of any of embodiments 1-18, wherein the consecutive dose comprises genetically engineered cells.
[0355] 20. The method of any of embodiments 1-19, wherein the first dose comprises genetically engineered cells.
[0356] 21. The method of any of embodiments 1-20, wherein the consecutive dose comprises no more than about 10 x io6cells / hemisphere to 5 trajectories, each with 8 depositional sites.
[0357] 22. The method of any of embodiments 1-21, wherein the consecutive dose comprises no more than about 5 x io6cells / hemisphere to 5 trajectories, each with 8 depositional sites.
[0358] 23. The method of any of embodiments 1-22, wherein the firs dose comprises no more than about 5 x io6cells / hemisphere to 5 trajectories, each with 8 depositional sites.
[0359] 24. The method of any of embodiments 1-22, wherein the subject does not exhibit cytokine release syndrome (CRS), does not exhibit severe CRS, does not exhibit neurotoxicity, does not exhibit severe neurotoxicity, or does not exhibit neurotoxicity above grade 3 following administration of the first dose and / or following the administration in of the consecutive dose.
[0360] 25. The method of any of embodiments 1-24, wherein the administered cells in the first dose and / or following the administration of the consecutive dose engraft, proliferate, migrate, innervate, and / or differentiate in the hemisphere where they are implanted.
[0361] 26. The method of any of embodiments 1-25, wherein the administered cells in the first dose and / or following the administration of the consecutive dose rescue or increase survival of dopamine neurons in the hemisphere where they are implanted.
[0362] 27. The method of any of embodiments 1-26, wherein the method further comprises administering a therapeutic agent prior to the administration in (a) and / or the administration in (b) or wherein the subject has been previously treated with a therapeutic agent prior to the administration of the first dose.
[0363] 28. The method of any of embodiments 1-27, wherein the administered cells are autologous to the subject.
[0364] 29. The method of any of embodiments 1-28, wherein the administered cells are administered to a plurality of trajectories, each with a plurality of depositional sites.Attorney Docket No.: 87874.01416
[0365] 30. The method of any of embodiments 1-29, wherein the administered cells are administered to 5 trajectories, each with a plurality of depositional sites.
[0366] 31. The method of any of embodiments 1-30, wherein the administered cells are administered to 5 trajectories, each with 8 depositional sites.
[0367] Among the embodiments provided herein are:
[0368] 1. Use of a composition comprising, consisting of, or consisting essentially of cells expressing FOXA2+ / LMX1+for manufacture of a medicament for treatment of a disease or condition in a subject.
[0369] 2. Use of a composition comprising, consisting of, or consisting essentially of cells expressing FOXA2+ / LMX1+for manufacture of a medicament for treatment of PD in a subject.
[0370] 3. Use of a composition comprising, consisting of, or consisting essentially of cells expressing FOXA2 / LMX for manufacture of a medicament for treatment of PD in a subject wherein the composition is formulated for administration of a first dose comprising, consisting of, or consisting essentially of a plurality of trajectories, each with a plurality of depositional sites.
[0371] 4. Use of a composition comprising, consisting of, or consisting essentially of cells expressing FOXA2+ / LMX1+for manufacture of a medicament for treatment of PD in a subject wherein the composition is formulated for administration of a first dose comprising, consisting of, or consisting essentially of 5 trajectories, each with a plurality of depositional sites.
[0372] 5. Use of a composition comprising, consisting of, or consisting essentially of cells expressing FOXA2+ / LMX1+for manufacture of a medicament for treatment of PD in a subject wherein the composition is formulated for administration of a first dose comprising, consisting of, or consisting essentially of 5 trajectories, each with 8 depositional sites.
[0373] Among the embodiments provided herein are:
[0374] 1. Midbrain dopaminergic progenitor cells for use in treating a disease in a subject, wherein: the administered cells are for use between about 1-8 hours or between 6-12 months after the previous treatment.
[0375] 2. Midbrain dopaminergic progenitor cells for use in treating a disease in a subject, wherein: the subject is administered the cells unilaterally.Attorney Docket No.: 87874.01416
[0376] 3. Midbrain dopaminergic progenitor cells for use in treating a disease in a subject wherein: the subject is administered the cells bilaterally.
[0377] Among the embodiments provided herein are:
[0378] 1. An article of manufacture, comprising, consisting of, or consisting essentially of:
[0379] a plurality’ of sealable containers, each individually comprising, consisting of. or consisting essentially of a unit dose of midbrain dopaminergic progenitors cells for administration to a subject, the unit dose comprising, consisting of, or consisting essentially of no more than about 10 x io6cells / hemisphere; packaging material; and a label or package insert comprising instructions for administering the unit dose to the subject by carrying out a first administration and a consecutive administration, the first administration comprising, consisting of, or consisting essentially of delivering the unit dose to the subject and the consecutive administration comprising, consisting of, or consisting essentially of administering the unit doses to the subject.EXAMPLES
[0380] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.Example 1
[0381] Single Dose GLP Safety. Toxicity. Tumorigenicity and Biodistribution Study in Athymic Nude Rats (Study 2645-006)Objective:
[0382] The objective of this study was to assess the safety, toxicity, tumorigenicity, and biodistribution of the induced pluripotent stem cell-derived midbrain dopaminergic progenitor cell therapy product RNDP-001 for the treatment of PD following intracranial injection into the striatum of athymic nude rats.Methodology:
[0383] The athymic nude rats were between 9 and a half and 12 weeks old and weighed between 162 and 361 g at initiation of dosing. Assignment to study groups was carried out by standard, byAttorney Docket No.: 87874.01416 weight, randomization procedure designed to achieve similar group mean body weight. Males and females were randomized separately.
[0384] The RNDP-001 DP batch used for this study is representative of the clinical material.
[0385] The animals were assigned to the following study groups:1. Vehicle control2. 0.25 x MFD dose cells (2.25 x 105cells)3. MFD (9.0 x 105cells)4. MFD + iPSC spike-in 0.02% (9.0 x 105cells + 0.02% iPSC)5. MFD + iPSC spike-in 0.1% (9.0 x 105cells + 0.1% iPSC)6. 100% iPSC ( 4.5 x 105cells)
[0386] The following parameters and endpoints were evaluated: mortality, clinical signs, body weights, body weight gains, functional observational battery (FOB), clinical pathology parameters (hematology and clinical chemistry), gross necropsy findings, biodistribution, neuropathology, and histopathology examinations.Justification of route and dose levels
[0387] The intended route of administration of RNDP-001 is intracranial injection. The intended treatment for the proposed clinical study is a single dose treatment, and thus, the assessment in the GLP toxicology study focuses solely on single dose toxicity. In-life duration of the study is 9 months and tissue analysis time points at 1 and 9 months.
[0388] The high dose of cells was based on the MFD. 4.5 x 105cells per striatum or 9.0 x 105cells total possible using the highest concentration at which the administered cells could be resuspended (1.5 x 105 / UL) and the injection volume used in all preceding rat studies with (3 pL). The 0.25x MFD w as a 4-fold dilution of the high dose resulting in a total of 112,500 cells per striatum.
[0389] Based on anatomical volume (the volume of the human putamen is 200-times greater than the corresponding region of the rat striatum), the MFD used in this protocol would be equivalent to 9.0 x 107cells per putamen (or 1.8 x 108cells total) in humans. Although the MFD administered inAttorney Docket No.: 87874.01416 rats were 3.3-fold lower than the proposed cohort 1 human clinical dose of 3.0 x 106, scaling of the dose to the size of the putamen emulates the clinical paradigm regarding the ratio of brain tissue to the number of total cells. Once scaled to humans, the MFD that was administered to the rats was equivalent to 20-fold the proposed cohort 2 human clinical dose of 10 x io6.
[0390] For tumorigenicity analysis, the doses of iPSCs to spike into the test article MFD (iPSC Spike-in treatment groups) was selected to test whether the intended QC release assay for detecting residual iPSC was sensitive enough to detect the number of iPSCs that could form a tumour when injected to the striatum. The QC release assay addresses the possibility that RNDP-001 cells could contain pluripotent iPSCs that persist through the differentiation process. The QC release test was a digital droplet polymerase chain reaction (ddPCR)-based assay with a sensitivity of 1: 100,000, i.e., could detect one iPSC mixed with 10.0 x 105RNDP-001 cells. The clinical trial proposes a dose escalation cohort receiving 1.0 x io7cells, meaning the ddPCR assay could detect >100 iPSC in this dose. Thus, if RNDP-001 cells contaminated with >100 iPSC did not form a tumour, the assay was sensitive enough to detect a potentially dangerous number of residual iPS cells. The dose of 180 iPSC + MFD (0.02%) was selected as > 100 iPSC and close to the assay limit of detection (LOD) if the iPSCs were in a dose of 1.0 x io7. The dose of 900 iPSC + MFD (0.1%) was selected as well above the assay LOD, but likely to be below the number needed to form a tumour when the iPSCs were in a single cell suspension without a supportive medium. There is very limited literature on how many stem cells were needed to form a tumour in the striatum, but one report demonstrated tumour formation after injection of 4,000 murine embry onic stem cells (ESCs) to the striatum, but not after injection of 400 ESCs (Harkany, 2004).
[0391] The 100% iPSC treatment group was included as a tumorigenic positive control at a conservative dose of 4.5 x 105cells in total to demonstrate that tumours could be formed using the iPSCs used to manufacture RNDP-001 and the route of administration. Matrigel and ROCK inhibitor were included to promote iPSCs survival in accordance to published reports demonstrating successful teratoma formation in the brain and other organs.Results and Conclusions:
[0392] RNDP-001, was not associated with significantly elevated mortality versus vehicle injected controls at either 0.25X MFD or the MFD. However, animals dosed with 100% iPSCs, which served as a tumorigenic positive control, experienced significant mortality with all animals dying early between 36- and 52-days following dosing. No significant increase in mortality was observedAttorney Docket No.: 87874.01416 in animals dosed at MFD of RNDP-001 spiked with iPSC at 0.02% or 0.1% compared to vehicle treated controls.
[0393] There were no significant clinical observations associated with RNDP-001.
[0394] The biodistribution analysis showed presence of human cells in left and right hemispheres of the brain and persistence up to 270 days. RNDP-001 cells were not detected outside the brain.
[0395] Overall RNDP-001 was shown to be safe at the MFD used in this study with distribution that is limited to the targeted dosed area and with long-term persistence to approximately 270 days (the length of the study).Example 2
[0396] A Phase lb / 2a clinical study is planned with RNDP-001 (“midbrain dopaminergic progenitor cells”) to assess the safety and tolerability of RNDP-001 in Parkinson's disease (PD) patients. This study will be open-label and non-controlled.Safety
[0397] No clinical experience exists to date with RNDP-001.
[0398] Ensuring the safety and long-term efficacy of stem cell-based therapies for PD is a critical concern. Stem cell-based therapies have been investigated for the treatment of Parkinson's disease. ESCs have been considered as a potential source of specific cells for replacement therapies and disease modeling. Parkinson's disease is a suitable candidate for stem cell therapy due to the selective nature of the degenerative process and the feasibility of functional cell replacement, as demonstrated by fetal transplants in some Parkinson's disease patients Olanow et al., 2003. and Freed et al., 2001.
[0399] In contrast to ESCs, iPSCs are adult cells (e.g., derived from skin or blood cells) that have been reprogrammed to a pluripotent state, similar to ESCs. iPSCs offer a more ethically acceptable source of pluripotent cells. Further, human iPSCs and ESCs exhibit equivalent gene expression and neuronal differentiation potential (Marei et al., 2017). In addition, iPSCs are easier to obtain since they are not procured from fetal tissue and the same donor can be used to produce multiple doses of the product, allowing for increased dose to dose consistency for the product.Attorney Docket No.: 87874.01416
[0400] Previous and cunent clinical trial are utilizing cells from various sources: allogeneic bone marrow mesenchymal stem cells, allogeneic human neural progenitor cells, autologous bone marrow stem cells, allogeneic fetal stem cells or allogeneic human retinal pigment epithelial cells.
[0401] RNDP-001 is an allogeneic, cryopreserved, dopamine progenitor cell therapy consisting of iPSC-derived midbrain dopaminergic progenitors. A 9-month GLP study was performed to evaluate safety, toxicity, biodistribution and tumorigenicity. Nude rats received RNDP-001, saline, iPSCs or RNDP-001 with protocol-defined spike-in of iPSCs. No animals with RNDP-001 alone had toxicity, developed tumors, and the administered cells did not migrate. Animals receiving only iPSCs (positive controls) developed teratomas as expected. No spike-in groups manifested toxicity or teratomas. The level of iPSC spike-in was 20 and 100 times greater than the limit of detection of iPSCs in the drug product, indicating that the spike-in level was much higher than a possible number of residual iPSCs in the drug product. This study indicated that RNDP-001 was safe and well tolerated over 9 months and did not cause toxicity or tumors.
[0402] In addition, the safety' of the brain delivery method of RNDP-001 was successfully tested. In the performed studies the safety of precise anatomical delivery to the monkey putamen was established as a relevant model to the human situation.
[0403] Other clinical studies utilizing cell therapy to treat PD reported no tumor formation or severe immune rejections. One trial reported a case of GID and another trial four cases of possibly GID (Wang et al., 2023).
[0404] Various types of stem cell-based therapies have been investigated for the treatment of Parkinson's disease. ESCs as well as iPSCs have shown promise in providing functional cell replacement, and preclinical studies have demonstrated the restoration of function in experimental models of Parkinson’s disease using stem cell-derived dopamine neurons. Further research and clinical trials are ongoing to fully explore the potential of stem cell-based therapies in the management and treatment of Parkinson’s disease.Efficacy
[0405] To date, there is no clinical efficacy data on RNDP-001. In preclinical studies efficacy was demonstrated using the disease relevant 6-OHDA hemi-parkinsonian nude rat model. Briefly, it was demonstrated the robust potency of RNDP-001 accompanied by dose responsive behavioralAttorney Docket No.: 87874.01416 correction, dose-dependent graft survival and dopaminergic innervation in vivo (see Experiments (Hiller et al., 2021; Hiller et al., 2022)).
[0406] Other clinical studies utilizing cell therapy to treat PD showed that cell therapies were effective for improving disease seventy and motor symptoms. The key finding from a comprehensive meta-analysis was that homogenous cell transplantation significantly improves clinical outcomes in PD patients regarding overall disease severity, motor symptoms, and activities of daily life (ADL) in the ‘off state (Wang et al., 2023).
[0407] The main goal of the planned Phase lb / 2a clinical study (Study RNDP-001-02) is to assess the safety and tolerability of RNDP-001 in PD patients. Secondary and exploratory' efficacy endpoints will also be included in these studies to characterize the effects of intraputaminal RNDP- 001 transplant on PD motor and non-motor features, motor complications, measures of function, global assessments, and quality of life.Justification for RNDP-001 dose
[0408] In the planned Phase lb study of RNDP-001 in the treatment of PD, two doses will be investigated per study, and patients will be divided into three dose cohorts. Doses 1 and 2 were derived from preclinical / nonclinical efficacy studies in hemiparkinsonian athymic nude rats showed that the medium dose produced behavioral correction. Doses 1 and 2 were scaled allometrically to effectively bracket the rat efficacious medium dose (see below). 12 patients will receive an injection of RNDP-001 in three different dose cohorts. The first two groups will receive RNDP- 001 unilaterally into the most affected putamen side as determined by18F-L-DOPA PET imaging, while the third group will receive RNDP-001 bilaterally as follows:
[0409] The first 4 patients (#1-4) will receive 5.0 x 106cells, unilaterally,
[0410] The next 4 patients (#5-8) will receive 1.0 x io7cells, unilaterally,
[0411] Based on safety and early clinical impressions from patients #1-8, the last 4 patients (#9-12) will receive the 'Best Dose', either 5.0 x io6cells / hemisphere or 1.0 x io7cells / hemisphere, bilaterally (in total 1.0 x io7cells or 2.0 x io7cells).
[0412] The 'Best Dose' refers to the highest dose which satisfies safety' and tolerability (no SAEs), as assessed by Applicant with input from the clinical advisory' board, Principal Investigators (Pls) (neurosurgeons) and Co-PIs (movement disorders neurologists).Attorney Docket No.: 87874.01416
[0413] Participants in the first two dose cohorts who receive unilateral transplants, if still meeting eligibility criteria, may have at 12 months a second transplant to the previously untransplanted side.
[0414] Table 5 provides an overview of the number of patients allocated to each cohort for the two planned clinical studies.Table 5: Dose and Number of Patients and Cohort Allocation for the RNDP-001-002 Study*Either dose 1 or dose 2, according to the safety and clinical results observed in the patients treated unilaterally.Abbreviations - N: number of patients; PD: Parkinson's disease.
[0415] Dose escalation will proceed in a staggered manner. Patients within the same cohort will be staggered every 15 days, while there will be a 30-day pause between cohorts to enable a DSMB safety review.
[0416] The planned RNDP-001 doses are also considered appropriate from a safety point of view. Proposed doses were allometrically scaled from the MFD of 4.5 x 105, which produced the most robust correction in the rat model, and corresponds, when multiplied by 200, to 9.0 x 107cells per hemisphere for ahuman putamen. For the RNDP-001-002 study, Dose 1 and 2 (5.0 x io6and 1.0 x 107cells / hemisphere, respectively) are 18* and 9x lower than the scaled MFD, respectively.Moreover, the rat MFD was not associated with any toxicity when studied in a 9-month GLP tumorgenicity, biodistribution and toxicity study (see Section 0).Attorney Docket No.: 87874.01416
[0417] For idiopathic PD, Dose 1 at 24 months produces an estimated 6.1 x 105midbrain dopaminergic progenitors per hemisphere (5 x 106 / hemisphere x 0.16 [mean TH+ neurons injected per unit volume] = 8 x 105at To month and 6. 1 x 105at T24 months. Dose 2 at 24 months produces an estimated 1.2 x 106midbrain dopaminergic progenitors per hemisphere (10 x 106 / hemisphere x 0. 16 [mean TH+ neurons injected per unit volume] = 1.6 x 106at To month and 1.2 x 106at T24 months.
[0418] For PRKN PD, Dose 1 at 24 months produces an estimated 3.7 x 105midbrain dopaminergic progenitors per hemisphere (5 x 106 / hemisphere x 0. 16 [mean TH+ neurons injected per unit volume] = 8 x 105at To month and 3.7 x 105at T24 months. Dose 2 at 24 months produces an estimated 6.1 x 105midbrain dopaminergic progenitors per hemisphere (5 x 106 / hemisphere x 0.16 [mean TH+ neurons injected per unit volume] = 8 x 105at To month and 6.1 x 105at T24 months.
[0419] Further, the selected doses in the planned RNDP-001 clinical trials are within the range of doses that have been used in ten clinical studies utilizing cell therapy to treat PD (0.35 and 3 * 107cells / hemisphere), according to a meta-analysis (Wang et al., 2022).
Claims
Attorney Docket No.: 87874.01416CLAIMSThe invention claimed is:
1. A method of treating Parkinson’s disease, comprising, consisting of, or consisting essentially of:(a) administering to a subject having a disease or condition a first dose of allogeneic midbrain dopaminergic progenitor cells expressing both forkhead box protein A2 (F0XA2) and LIM homeobox transcription factor 1 (LMX1) (F0XA2+ / LMX1+), the first dose comprising, consisting of, or consisting essentially of no more than about 10 x 106cells / hemisphere to 5 trajectories, each with 8 depositional sites; and(b) administering to the subject at least one consecutive dose of allogeneic midbrain dopaminergic progenitor cells expressing FOXA2+ / LMX1+ the consecutive dose comprising, consisting of, or consisting essentially of no more than about 10 x 106cells / hemisphere to 5 trajectories, each with 8 depositional sites.
2. The method of claim 1, wherein the consecutive dose is administered between 1 minute and 10 hours of the administration in (a).
3. The method of claim 1, wherein the consecutive dose is administered between 6-12 months of the administration in (a).
4. The method of claim 1, wherein the consecutive dose is administered between 1 minute and 10 hours of the administration in (a) or wherein the consecutive dose is administered between 6-12 months of the administration in (a).
5. The method of claim 1, wherein the midbrain dopaminergic progenitor cells in the consecutive dose are identical to the administered cells in the first dose or are substantially identical to the administered cells in the first dose.
6. The method of claim 1, wherein the administered cells in the first dose engraft in the subject, proliferate in the subject, migrate in the subject, innervate in the subject, differentiate in the subject, or improve the function of DA neuronal cells already in the subject.
7. The method of claim 1, wherein the disease or condition persists following the administration of the first dose and / or the administration of the first dose is not sufficient to eradicate theAttorney Docket No.: 87874.01416 disease or condition in the subject.
8. The method of claim 1, wherein the trajectories will be cantered in a medial-lateral dimension of the putamen.
9. The method of claim 1 , wherein a most anterior trajectories will be administered approximately 1 -5 mm from the anterior putaminal border.
10. The method of claim 1, wherein the first dose has a volume of between 1-5 pL / deposit.
11. The method of claim 1, wherein the depositional sites are made in 1-5 mm intervals.
12. A method of treating Parkinson’s disease, comprising, consisting of, or consisting essentially of: administering to a subject having a disease or condition a first dose of midbrain dopaminergic progenitor cells, the first dose comprising, consisting of, or consisting essentially of less than a maximum feasible dose of cells.
13. The method of claim 12, further comprising administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells comprising 2%, 5%, 10%, 15%, 20%, 30%, 40%, or 50% less than a maximum feasible dose of cells.
14. The method of claim 12, further comprising administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells comprising less than a maximum feasible dose of cells.
15. The method of claim 12. wherein at month 9 following the administration, rescue or increase survival of dopamine neurons and / or DA neuronal function in the subject is observed based on clinical evaluation.
16. The method of claim 12. wherein the first dose comprises genetically engineered cells.
17. The method of claim 12, further comprising administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells and wherein the first dose and second dose comprise, consist of, or consist essentially of genetically engineered cells.
18. The method of claim 12, further comprising administering to the subject a consecutive dose of midbrain dopaminergic progenitor cells and wherein the first dose comprises, consists of, or consists essentially of genetically engineered cells and the second dose does not comprise,Attorney Docket No.: 87874.01416 consist of, or consist essentially of genetically engineered cells.
19. The method of claim 19, wherein the first dose of genetically engineered cells comprises, consists of. or consists essentially of genetic modifications to be miR-155-3p biased or miR- 155-5p biased.
20. The method of claim 12, wherein the first dose of midbrain dopaminergic progenitor cells further comprises a cryoprotectant and / or iPSC cells.
Citation Information
Patent Citations
Methods for differentiating stem cells into dopaminergic progenitor cells
US20230233617A1
Dopaminergic precursor cells and methods of use
US20240219375A1