Use of threonine dehydratase in regulation of growth of didymella segeticola and as bactericide target

By regulating the threonine dehydratase gene (Td) of Didymella segeticola, reducing its mycelial growth, pyruvate and ATP content, and enhancing its sensitivity to Wuyi mycin, the problem of unclear pathogenic mechanism of Didymella segeticola was solved, and the establishment of fungicide screening model and drug development were realized.

WO2026066130A1PCT designated stage Publication Date: 2026-04-02GUIZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/095171
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-24
Filing Date
2025-05-15
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

The existing technology does not understand the pathogenic and infection mechanisms of Didymella segeticola, which limits the development and application of fungicides. There is a lack of effective research on the pathogenic mechanism of the pathogen and the host's defense response mechanism.

Method used

By utilizing the threonine dehydratase gene (Td) to regulate the mycelial growth, pyruvate, and ATP content of Didymella segeticola, thereby enhancing its sensitivity to Wuyi mycin, and by knocking out or inhibiting Td gene expression, a fungicide activity screening model was established using threonine dehydratase as the target.

Benefits of technology

It significantly reduces the mycelial growth, pyruvate and ATP content of Didymella segeticola, increases the sensitivity to Wuyi mycin, improves the accuracy of fungicide screening, and lays the foundation for the development of new agents. Threonine dehydrase can be used as a fungicide target and has broad application prospects in the control of plant pathogenic fungal diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025095171_02042026_PF_FP_ABST
    Figure CN2025095171_02042026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed in the present invention is the use of a threonine dehydratase in the regulation of the growth of Didymella segeticola and as a bactericide target. The threonine dehydratase gene Td of the present invention is derived from Didymella segeticola, and a knockout mutant is obtained by means of constructing a knockout gene fragment targeting the Td gene and then introducing same into a D. segeticola protoplast. Experiments find that the Td gene plays a role in the growth, the in-vivo pyruvic acid content and the in-vivo ATP content of D. segeticola, and the sensitivity thereof to wuyiencin. By means of molecular docking analysis, molecular dynamics simulation and microscale thermophoresis experiments, it is verified that threonine dehydratase can be used as a bactericide target, and the bactericide wuyiencin is obtained by means of screening. The threonine dehydratase of the present invention can be used as a bactericide target and a key protein in the pathogenic mechanism of a disease, and has broad application prospects in the control of plant pathogenic fungal diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Use of threonine dehydratase in regulating growth of didymella segeticola and as fungicide target TECHNICAL FIELD

[0001] The present invention belongs to the field of biotechnology, in particular to the use of threonine dehydratase in regulating growth of Didymella segeticola and as fungicide target. BACKGROUND

[0002] The genus Didymella belongs to the family Didymellaceae in the order Pleosporales in the class Dothideomycetes in the phylum Ascomycota. Fungi in this genus are pathogenic to some plants (Crous, P.W., Gams, W., Stalpers, J.A., Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50: 19-22; Chen, Q., Hou, L.W., Duan, W.J., Crous, P.W., Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymella segeticola can cause Zanthoxylum bungeanum leaf spot disease (Yang, J. Z., Chen, C. X., Yin, X. H., Xu, H., Long, H. J., Gu, G., Shu, R., Yuan, J., Zhou, H. C. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, Z. N., Xie, H. L., Wang, H. C., Huang, Y., Chen, Q. L., Xiang, L. G., Yu, Z. H., Yang, X. H. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104: 1559-1560), Fritillaria taipaiensis P. Y. Li leaf spot disease (Chen, L. J., Hu, Y. W., Huang, L., Luo, M., Wang, G. Z. Isolation and identification of two pathogens causing leaf spot of Fritillaria taipaiensis P. Y. Li. in China. Archives Of Microbiology, 2023, 206: 1), tea leaf spot disease (Zhao, X. Z., Wang, Y., Li, D. X., Ren, Y. F., Chen, Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea. Plant Disease, 2018, 48: 556-559; Deng, X. Y., Yang, J., Wan, Y. H., Han, Y. X., Tong, H. R., Chen, Y. J. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113: 516-527).D. segeticola var. camelliae strain GZSQ-4 (China General Microbiological Culture Collection Center strain preservation number: CGMCC 3.20152, preservation address: No. 1, Beichen West Road, Chaoyang District, Beijing, preservation time: August 2020) is isolated and identified from the tea leaf spot in Shiqian County, Guizhou Province by the research group of the present inventors. The pathogen can infect tea shoots, tender leaves and mature leaves, and has a serious impact on the quality and yield of tea, so it is necessary to develop the technology of the disease (Zhao X Z, Wang Y, Li D X, Ren Y F, Chen Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea plant. Plant Disease and Protection, 2018, 48:556-559).

[0003] So far, the pathogenic biology of D. segeticola is still weak at home and abroad, especially the lack of reports on pathogenic mechanism of pathogen and host defense response mechanism. Although there is some research on the pathogen D. segeticola at present, and some fungicides that can prevent and control D. segeticola have been screened in production, such as zhongshengmycin, shenqinmycin, griseofulvin, carvacol and other biological pesticides (Ren, Y. F., Li, D. X., Jiang, S. L., Wang, Y., Tang, Q., Huang, H. L., Wang, D. L., Song, B. A., Chen, Z. Integration of transcriptomic and proteomic data reveals the possible action mechanism of the antimicrobial zhongshengmycin against Didymella segeticola, the causal agent of tea leaf spot. Phytopathology, 2021, 111: 2238-2249; Zhao, X. Z., Chen, Z., Yu, L., Hu, D. Y., Song, B. A. Investigating the antifungal activity and mechanism of a microbial pesticide shenqinmycin against Phoma sp. Pesticide Biochemistry and Physiology, 2018, 147: 46-50; Huang, H. K., Li, D. X., Jiang, S. L., Yang, R., Yang, Y. Q., Xia, Z. Q., Jiang, X. Y., Zhao, Y. T., Wang, D. L., Song, B. A., Chen, Z. Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulin to control tea leaf spot. Phytopathology, 2023, 113: 194-205; Yin, J. Y., Wu, S., Yang, Y. L., Wang, D. L., Ma, Y., Zhao, Y. T., Sheth, S.Huang, H. L., Song, B. A., Chen, Z. In addition to damaging the plasma membrane, phenolic monoterpenoid carvacrol can bind to minor groove of DNA of Phytopathogenic fungi to potentially control tea leaf spot caused by Lasiodiplodia theobromae. Phytopathology, 2023, 114: 700-716). But due to the unclear pathogenic mechanism and infection mechanism of D. segicola, the development and application of fungicides are limited, so it is very important to construct a D. segicola fungicide target screening model and study the mechanism of fungicides. SUMMARY

[0004] In view of this, one of the purposes of the present application is to provide the application of threonine dehydratase gene Td in any one of the following 1)-5):

[0005] 1) regulating the mycelial growth of Didymella segicola;

[0006] 2) regulating the content of pyruvic acid in Didymella segicola;

[0007] 3) regulating the content of ATP in Didymella segicola;

[0008] 4) regulating the sensitivity of Didymella segicola to Wuyi mycin;

[0009] 5) designing and screening antifungal drugs;

[0010] The nucleotide sequence of the Td gene is as shown in SEQ ID NO. 1 or the encoded amino acid sequence is as shown in SEQ ID NO. 2.

[0011] Preferably, the regulation in the regulation of the mycelial growth of Didymella segicola, the regulation of the content of pyruvic acid in Didymella segicola and the regulation of the content of ATP in Didymella segicola is all reduction; the regulation in the regulation of the sensitivity of Didymella segicola to Wuyi mycin is increase.

[0012] The second object of the present application provides an application of threonine dehydratase gene Td in breeding a transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced content of pyruvate in vivo and / or reduced content of ATP in vivo and / or increased sensitivity to wuyi mycins, wherein the nucleotide sequence of the Td gene is shown as SEQ ID NO. 1 or the amino acid sequence encoded by the Td gene is shown as SEQ ID NO. 2.

[0013] The third object of the present application provides a method for breeding a transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced content of pyruvate in vivo and / or reduced content of ATP in vivo and / or increased sensitivity to wuyi mycins, comprising the step of reducing the expression amount or / and activity of mRNA or protein of threonine dehydratase gene Td in a recipient Didymella segeticola to obtain the transgenic Didymella segeticola, wherein the nucleotide sequence of the Td gene is shown as SEQ ID NO. 1 or the amino acid sequence encoded by the Td gene is shown as SEQ ID NO. 2.

[0014] Preferably, the method for reducing the expression amount or / and activity of mRNA or protein of threonine dehydratase gene Td in the recipient Didymella segeticola is achieved by knocking out or inhibiting or silencing the expression of the Td gene of the recipient.

[0015] The fourth object of the present application provides an application of threonine dehydratase protein as a drug target in screening fungicides, wherein the amino acid sequence of the threonine dehydratase protein is shown as SEQ ID NO. 2.

[0016] The fifth object of the present application provides a method for screening fungicides by using threonine dehydratase protein as a drug target, comprising the following steps:

[0017] 1) Protein expression and purification of threonine dehydratase gene;

[0018] 2) Prediction of candidate fungicides, wherein the prediction method comprises the following steps:

[0019] A1) Homology modeling of threonine dehydratase;

[0020] A2) Molecular docking analysis with the fungicide to be tested, wherein if the components of the fungicide to be tested can form stable chemical bonds with the residues of the homology modeled threonine dehydratase, the fungicide to be tested is determined as an intended fungicide; for the formed chemical bonds, the more and the more stable the chemical bonds are, the stronger the interaction between the two molecules is, the greater the conformational change of the protein is, the more the activity of the protein is affected, and the more outstanding the fungicidal effect of the fungicide is; in addition, the hydrogen bond in the interaction between molecules is a relatively stable chemical bond.

[0021] A3) Molecular dynamics simulation of homology modeling threonine dehydratase and fungicide of intention, confirming that threonine dehydratase has conformational changes, then screening to obtain candidate fungicides;

[0022] 3) Microscale thermophoresis experiment to detect the interaction between the candidate fungicide and the purified threonine dehydratase protein in step 1), if it has interaction, it is determined as a fungicide.

[0023] Preferably, the method of protein expression and purification in step 1) comprises the following steps:

[0024] B1) Construction of a prokaryotic expression vector;

[0025] B2) Induced expression of fusion protein;

[0026] B3) Purification of fusion protein;

[0027] The number of stable chemical bonds in step 2) is at least 5.

[0028] Preferably, the fungicide component in the fungicide determined in step 3) is Wuyi mycins.

[0029] The sixth object of the present application is to provide the application of Wuyi mycins in regulating the structure and activity of threonine dehydratase protein.

[0030] The present application provides the application of threonine dehydratase gene (Td) derived from Didymella segeticola in regulating the growth of D. seiticola, the content of pyruvic acid in vivo, the content of ATP in vivo and the sensitivity to Wuyi mycin. After knocking out the Td gene in wild type D. seiticola, it was found that the mycelial growth, the content of pyruvic acid in vivo and the content of ATP in vivo of the knocked out D. seiticola were significantly reduced. The method for screening fungicides of the present application establishes an activity screening model for fungicides with threonine dehydratase (Td) as the target, improves the accuracy of active screening of drugs, and lays a foundation for the development of new drugs. The protein expression and purification method of threonine dehydratase has the advantages of high expression amount, simple separation and purification of exogenous protein and high recovery rate; the molecular docking analysis, molecular dynamics simulation and microscale thermophoresis experiment prove that Wuyi mycin has strong interaction with the threonine dehydratase protein (Td) of the present application, i.e. threonine dehydratase can be used as a fungicide target. Therefore, the threonine dehydratase of the present application can be used as a fungicide target and a key protein of disease pathogenesis, and has a broad application prospect in the prevention and control of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1. Schematic diagram of Td gene knockout and mutant screening strategy in pathogen D. segeticola;

[0032] Figure 2. Spectrum of plasmid pct74;

[0033] Figure 3. Schematic diagram of microscopic observation of the prepared protoplasts;

[0034] Figure 4. PCR electrophoresis diagram during transformant verification;

[0035] Figure 5. Enzyme activity assays for WT and ΔTd;

[0036] Figure 6 shows the colony growth of WT and ΔTd under different concentrations of Wuyi mycin.

[0037] Figure 7. Recombinant plasmid enzyme digestion detection;

[0038] Figure 8. Alignment results of the target gene fragment with the Td gene sequence;

[0039] Figure 9. SDS-PAGE analysis of the fusion protein expression trial;

[0040] Figure 10. SDS-PAGE analysis of the final purified protein;

[0041] Figure 11 shows the interaction between Td and Wuyi mycin analyzed using molecular docking and molecular dynamics simulation techniques.

[0042] Figure 12 shows the in vitro interaction between Td and Wuyisin using MST. Detailed Implementation

[0043] The present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations made without departing from the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available.

[0044] In the examples described below, the wild-type strain of *D. segeticola* var. *camelliae*, GZSQ-4, was isolated and identified from tea leaf spot disease in the tea-growing area of ​​Shiqian County, Guizhou Province, and deposited at the China General Microbiological Culture Collection Center (CGMCC3.20152), located at No. 1, Beichen West Road, Chaoyang District, Beijing. The CDS sequence of the threonine dehydratase gene Td in this strain is shown in SEQ ID NO.1, and the amino acid sequence of the Td protein encoded by the Td gene is shown in SEQ ID NO.2.

[0045] Experimental Example 1: Construction of the D. segeticola gene knockout ΔTd mutant

[0046] The schematic diagram of the knockout and mutation screening strategy of the threonine dehydratase gene Td of D. segiticola is shown in Figure 1, and the specific construction and screening method is as follows:

[0047] 1. Construction of knockout gene fragment

[0048] 1) Amplification of homologous sequences upstream and downstream of the target gene: using the genomic DNA of the wild strain CGMCC 3.20152 of D. segiticola as a template, the upstream A fragment is amplified using primers 1F and 1R, and the downstream B fragment is amplified using primers 2F and 2R. The 5' end of primer 1R has a reverse complementary sequence of primer hph-F, and the 5' end of primer 2F has a reverse complementary sequence of primer hph-R. The sequences (5' end to 3' end) of primers 1F, 1R, 2F, 2R, hph-F and hph-R are as follows:

[0049] 1F: AGGTCTATCACCAGAAGTAGCTCAG

[0050] 1R: ACCTCCACTAGCTCCAGCCAAGGTGTGTATGTTGTGTTGTGTTGGG

[0051] 2F: GAATAGAGTAGATGCCGACCGGGGGGATTGAACTTCTATCACGTCTTG

[0052] 2R: CATAGCTGACACAAGCGACAGC

[0053] hph-F: CTTGGCTGGAGCTAGTGGAGGT

[0054] hph-R: CCCGGTCGGCATCTACTCTATTC

[0055] 2) Amplification of the hygromycin resistance gene hph: using plasmid pct74 (the map is shown in Figure 2) as a template, the first half H1 (1094 bp) fragment of the hygromycin resistance gene is amplified using primers hph-F and hph-1R; and the second half H2 (748 bp) fragment of the hygromycin resistance gene is amplified using primers hph-1F and hph-R. The sequences (5' end to 3' end) of primers hph-1F and hph-1R are as follows:

[0056] hph-1F: CGTTGCAAGACCTGCCTGAA

[0057] hph-1R: GGATGCCTCCGCTCGAAGTA

[0058] 3) The fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with H1 fragment and H2 fragment, respectively, to obtain A-H1 connecting fragment and H2-B connecting fragment. Primer 1F / hph-1R and hph-1F / 2R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0059] 2, Preparation of D. segiticola protoplasts

[0060] 1) D. segiticola was inoculated on potato glucose agar medium and cultured at 25°C for 48 h. 2-3 mL of sterile water was added to the surface of the colony, and the mycelium was broken with an inoculation loop. The bacterial suspension was transferred to CM liquid medium and shaken for 12 h. Fresh mycelium of D. segiticola was collected by filtration;

[0061] 2) 10 mL of 0.8 mol / L sodium chloride solution was used as an osmotic pressure stabilizer to prepare a mixed enzyme solution of Drislase, Snailase, and Lyticase. The suspension mycelium was lysed at 30°C and 120 rpm for 4 h;

[0062] 3) The filtrate was collected after filtering through sterilized 2-3 layers of lens paper (fiber mesh size 45±12 μm) and washing with 0.8 mol / L sodium chloride. The resulting filtrate was centrifuged at 4°C and 4000 rpm for 6 min, and resuspended with 15 mL of 1.2 mol / L sorbitol buffer (STC) solution.

[0063] 4) The supernatant was discarded, and the protoplasts were resuspended with 1 mL of STC buffer to prepare a protoplast suspension with a concentration of 1×10 7 individuals / mL (protoplast microscopic observation schematic diagram as shown in Figure 3), and placed on ice for use.

[0064] 3, Transformation of D. segiticola protoplasts

[0065] 1) 200 μL of protoplast suspension was added to a 50 mL centrifuge tube, and 10-20 μg of A-H1 and H2-B knockout transformation fragments were added. After gentle mixing, it was placed on ice for 20 min.

[0066] 2) 200 μL, 200 μL, and 800 μL of 60% polyethylene glycol 4000 buffer (PTC) were added in sequence, gently mixed, and incubated at room temperature for 20 min. 5 mL of TB3 liquid medium was added, mixed, and incubated for 8-12 h.

[0067] 3) Room temperature, 4000 rpm / min centrifugation for 6 min, discard the supernatant, the rest 1 mL resuspended with the protoplast resuspended.

[0068] 4) Add 50 mL warm TB3 regeneration solid medium, mix and prepare plate. After 10 h of 25℃ inverted culture, cover with PDA medium containing 50 μg / mL hygromycin B, 25℃ culture for 3-4 days until the transformants grow, then subculture for 3 generations of screening culture.

[0069] 4、Transformant PCR verification

[0070] WT and ΔTd mutant as template for DNA extraction, and using 4 pairs of primers to detect the upstream and downstream of the fusion fragment, hph gene and the target gene. The results are shown in Figure 4 (M: Plus II DNA Marker; Lane 1-4 is WT, Lane 1: Td-up, Lane 2: Td-down, Lane 3: hph, Lane 4: Td; Lane 5-8 is ΔTd mutant, Lane 5: Td-up, Lane 6: Td-down, Lane 7: hph, Lane 8: Td), the upstream and downstream fragments, hph fragments and target gene fragments are 1506 bp, 1521 bp, 1376 bp, 1729 bp, respectively, the fragment size is the same as expected, proving that the transformant ΔTd mutant is obtained, and then entering the follow-up experiment.

[0071] Example 2, biochemical experiment comparison between wild type WT and mutant ΔTd

[0072] 1. Determination of pyruvic acid and ATP content in wild type WT and mutant ΔTd

[0073] WT and ΔTd were inoculated in potato glucose agar medium, and 25℃ culture for 48 h for in vivo pyruvic acid determination (kit: Solabio BC2205) and ATP content determination (kit: Biyun Tian S0026). The determination results are shown in Figure 5 (Figure 5A: pyruvic acid content determination; Figure 5B: ATP content determination), the pyruvic acid and ATP content of ΔTd is significantly lower than that of WT, indicating that knocking out Td gene affects the synthesis of pyruvic acid and ATP in the strain.

[0074] 2. Observation of colony morphology of WT and ΔTd

[0075] WT and ΔTd were inoculated on PDA medium respectively, cultured at 25℃ in dark condition, the colony diameter was measured by cross method at 7d, and the colony morphology was observed. Each treatment was set with 5 replicates. As shown in Figure 6, the mycelium growth of knockout mutant ΔTd on PDA medium was significantly slower than wild type WT, indicating that Td gene affected Didymella segeticola growth.

[0076] 3. Sensitivity determination of WT and ΔTd to Wuyi mycins

[0077] WT and ΔTd were inoculated on PDA medium containing different concentrations (20, 40, 60, 80, 100, 120, 140 μg / mL) of Wuyi mycins respectively, cultured at 25℃ in dark condition, the colony diameter was measured by cross method at 7d, and the colony morphology was observed. Each treatment was set with 5 replicates. The results showed that the indoor virulence regression equation of Wuyi mycins to WT was y = 1.5442x + 1.804, R 2 = 0.9846, EC 50 was 82.34 μg / mL. The indoor virulence regression equation of Wuyi mycins to ΔTd was y = 1.6399x + 2.5775, R 2 = 0.9608, EC 50 was 30.01 μg / mL. Compared with WT, ΔTd mycelium grew slowly, indicating that the sensitivity to Wuyi mycins increased (shown in Figure 6, Figure 6A: WT strain; Figure 6B: ΔTd strain; wherein, A1-A7, B1-B7 were PDA plates corresponding to 7 concentrations of Wuyi mycins from low to high).

[0078] Example 3, Prokaryotic expression and protein purification of Td gene

[0079] 1. Construction of prokaryotic expression vector of Td gene

[0080] The Td gene was synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. according to the sequence of SEQ ID NO. 1, and the synthesized Td gene was inserted into pET-28a(+) vector by double enzyme digestion method to obtain recombinant plasmid (Figure 7A: Td fragment; Figure 7B: pET-28-Td recombinant vector; Figure 8: comparison of sequencing results, the target sequence is completely consistent with the sequence of Td gene).

[0081] 2. Small test of Td protein expression

[0082] Transformation: the recombinant plasmid was transformed into competent BL21 DE3 cells of Escherichia coli, and then coated on a plate containing 30 μg / mL kanamycin after heat shock at 42℃, and cultured at 37℃;

[0083] Activation: pick a single colony to liquid medium containing antibiotics and incubate at 37°C;

[0084] Induction: when the OD value reaches 0.6, add the working concentration of 0.2-1 mM inducer IPTG, continue to culture, respectively, at 16°C overnight, and the one without inducer is the negative control;

[0085] Collecting bacteria: centrifuge at 4000 rpm for 10 min, discard the supernatant, and collect the bacteria;

[0086] Expression detection: add binding buffer (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 sodium chloride, and sterile water to 1 L) to the collected bacteria to suspend, and use an ultrasonic disrupter to fully dissolve it. Centrifuge to collect the supernatant, sample the supernatant protein, and detect it after gelation. The results are shown in Figure 9 (M: protein standard molecular weight; lane 1: 16°C overnight without IPTG; lane 2: 16°C overnight with 0.2 mM IPTG; lane 3: 16°C overnight with 0.4 mM IPTG; lane 4: 16°C overnight with 0.6 mM IPTG; lane 5: 16°C overnight with 0.8 mM IPTG; lane 6: 16°C overnight with 1 mM IPTG). The effect of 16°C overnight with 0.8 mM IPTG on protein expression is better.

[0087] 3. Mass expression of Td protein

[0088] Re-expression: culture the bacteria in a medium containing the corresponding antibiotic, when the OD value reaches 0.6, add 0.8 mM inducer IPTG, and culture overnight at 16°C for mass expression. Centrifuge to collect the cell bacteria.

[0089] 4. Td expression and purification

[0090] After collecting and processing the large-scale sample, perform affinity purification;

[0091] Collecting crude protein: dissolve the cell bacteria with buffer (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 sodium chloride, and sterile water to 1 L), ultrasonic disruption, and centrifuge to collect the supernatant crude protein;

[0092] Equilibrium: take Ni-NTA filler to pack the column, and wash the column with Binding buffer to balance it;

[0093] Column loading: incubate the crude protein with the balanced column filler, and collect the effluent;

[0094] Equilibrium: wash the column with Binding buffer to balance it;

[0095] Washing: Wash the column with Washing buffer and collect the flow-through;

[0096] Elution: Elute with Elution buffer and collect the flow-through;

[0097] Purification detection: The flow-through of crude protein was treated, sample preparation, and SDS-PAGE detection was prepared.

[0098] Collection and treatment: The purified components were dialyzed into protein storage buffer 50mM Tris, 300mM NaCl, 0.1% sarkosyl, 2mM DTT, pH 8.0, concentrated, filtered, 1mL / tube, and stored at -80℃.

[0099] 5. Detection of target protein

[0100] SDS-PAGE detection: The protein sample was treated, sample preparation, 12% separation gel, 5% concentration gel, gel running, and molecular weight detection (Figure 10, M: Marker; 1 lane: desalted protein), which was consistent with the target size, for subsequent micro-thermal swing technology experiments.

[0101] Example 4, molecular docking and molecular dynamics simulation and micro-thermal swing technology experiment

[0102] 1. Molecular docking and molecular dynamics simulation

[0103] The homologous protein of Td (PDB accession number: 2XTS.1) was used as a template for homologous modeling of Td, and then molecular docking analysis was performed with the test fungicide molecule, which formed stable chemical bonds with the residues of threonine dehydratase, and then the intended fungicide was screened for molecular dynamics simulation to interact with threonine dehydratase, causing conformational changes in the protein. The intended fungicide that interacts with threonine dehydratase is determined as a candidate fungicide. The process of molecular docking analysis and molecular dynamics simulation includes: pretreatment of protein by Discovery Studio TM V4.5, hydrogenation and charge, and visualization of the treated protein by PyMol 2.5.4; since there is no active site reported for this protein structure, this time the global search mode is used, and the entire protein is wrapped in a docking box; before docking, the drug small molecule is energy-optimized and set to freely rotate all rotatable bonds, while the protein structure is energy-minimized, hydrogenated, and charged to obtain the optimal conformation. In the Centroid of Workspace ligand module, click Pick to generate a binding cavity on the protein interface, with a binding cavity distance of The small molecule of the drug agent is subjected to 100 independent docking operations, parameters are set as SP (Standard Precision), the docking results are grouped according to RMSD (0.1 nm), the docking conformation with the lowest binding energy and the most operation times is selected, and the interaction mode of the to-be-tested molecule and Td is obtained. As shown in the molecular docking and molecular dynamics simulation results of Wuyi mycotoxin and Td in FIG. 11 (FIG. 11A: molecular docking results of Wuyi mycotoxin and Td; FIG. 11B: molecular dynamics simulation results of Wuyi mycotoxin and Td), Wuyi mycotoxin and Td have interaction, the amino acids N380, N382, K175, A145 and D300 of Td form stable hydrogen bonds, and therefore it is indicated that Td can be used as a target for screening fungicides, and Wuyi mycotoxin is screened as a candidate fungicide.

[0104] 2. The interaction of Td and the candidate fungicide molecule Wuyi mycotoxin is verified by using microscale thermophoresis (MST) technology

[0105] Preparation of Td protein sample: 5 μL of RED-NHS dye and NHS labeling buffer are taken and mixed by gently blowing, 10 μL of purified desalted protein is taken and mixed with 90 μL of the above-mentioned RED-NHS solution in a de-enzyme 1.5 mL centrifuge tube, and the mixture is mixed on ice and incubated at room temperature for 30 min in a dark light-proof environment; 10 μL of protein fluorescence labeling solution is taken by capillary blood vessel and placed on a microscale thermophoresis instrument for determination, and the protein labeling solution with a fluorescence value of 400-1200 is reserved for subsequent experiments;

[0106] Setting of parameters of microscale thermophoresis instrument: the interaction of Wuyi mycotoxin and Td is studied by using Monolith NT.115 microscale thermophoresis instrument, and the instrument parameters are LED power 40%, laser power 30% and Red excitation;

[0107] Analysis of the interaction of Wuyi mycotoxin and Td: it is found by microscale thermophoresis technology that Wuyi mycotoxin and Td have interaction, and the dissociation constant K d = 8.992 ± 2.380 (FIG. 12), which indicates that Td has strong affinity with Wuyi mycotoxin, and experiments prove that Td can be used as a target for screening fungicides.

[0108] The conventional techniques and schemes not described in detail in the above examples are all known in the art, and therefore will not be described in detail here. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept range of the present application, the technical solutions of the present application can be subjected to various simple modifications, and these simple modifications all belong to the protection range of the present application.

Claims

1. Application of threonine dehydratase gene Td in any one of 1)-5) below: 1) regulating mycelium growth of Didymella segeticola; 2) regulating pyruvic acid content in Didymella segeticola; 3) regulating ATP content in Didymella segeticola; 4) regulating sensitivity of Didymella segeticola to Wuyi mycins; 5) designing and screening antifungal drugs; the nucleotide sequence of the Td gene is as shown in SEQ ID NO. 1 or the encoded amino acid sequence is as shown in SEQ ID NO.

2.

2. Use according to claim 1, wherein The regulation in any one of regulating mycelium growth of Didymella segeticola, regulating pyruvic acid content in Didymella segeticola and regulating ATP content in Didymella segeticola is reduction; the regulation in regulating sensitivity of Didymella segeticola to Wuyi mycins is increase.

3. Use of the threonine dehydratase gene Td in a transgenic Didymella segeticola with reduced mycelium growth and / or reduced pyruvate content in the organism and / or reduced ATP content in the organism and / or increased sensitivity to Wuyishunzisu, characterized in that, The nucleotide sequence of the Td gene is as shown in SEQ ID NO. 1 or the encoded amino acid sequence is as shown in SEQ ID NO.

2.

4. A method for breeding a transgenic Didymella segeticola having reduced mycelial growth ability and / or reduced content of pyruvic acid in vivo and / or reduced content of ATP in vivo and / or increased sensitivity to didymicin, characterized in that, The step of obtaining a transgenic Didymella segeticola by reducing the expression amount or / and activity of mRNA or protein of threonine dehydratase gene Td in the recipient Didymella segeticola; the nucleotide sequence of the Td gene is as shown in SEQ ID NO. 1 or the encoded amino acid sequence is as shown in SEQ ID NO.

2.

5. The method of claim 4, wherein, The method of reducing the expression amount or / and activity of mRNA or protein of threonine dehydratase gene Td in the recipient Didymella segeticola is realized by knocking out or inhibiting or silencing expression of the Td gene of the recipient.

6. Use of a threonine dehydratase protein as a drug target for the screening of bactericides, characterized in that, The amino acid sequence of the threonine dehydratase protein is as shown in SEQ ID NO.

2.

7. A method for screening bactericidal agents using threonine dehydratase protein as a drug target, characterized by, The steps include: 1) protein expression and purification of threonine dehydratase gene; 2) prediction of candidate fungicides, the prediction method including the following steps: A1) homology modeling of threonine dehydratase; A2) molecular docking analysis with the fungicide to be tested, if the components of the fungicide to be tested can form stable chemical bonds with the residues of the homology modeled threonine dehydratase, it is determined as an intended fungicide; A3) molecular dynamics simulation of homology modeled threonine dehydratase and intended fungicide, and the determination of threonine dehydratase with conformational change as candidate fungicide; 3) micro-thermal mobility experiment to detect the interaction between candidate fungicide and purified threonine dehydratase protein in step 1), if there is interaction, it is determined as fungicide.

8. The method of claim 7, wherein the protein expression and purification in step 1) includes the following steps: B1) construction of a prokaryotic expression vector; B2) induced expression of fusion protein; B3) purification of fusion protein; ​ The number of stable chemical bonds in step 2) is at least 5.

9. The method of claim 8, wherein, The determined fungicide component in step 3) is wuyishunisu.

10. Application of wuyishunisu in regulating the structure and activity of threonine dehydratase protein.