Cho cell-derived s / MAR and expression vector using same

By integrating S/MAR sequences into expression cassettes, the method stabilizes gene expression and enhances recombinant protein production in cell lines, addressing the challenge of decreasing expression levels with cell generations.

WO2026071760A1PCT designated stage Publication Date: 2026-04-02LG CHEM LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/015147
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-27
Filing Date
2025-09-26
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing cell lines experience a decrease in recombinant protein expression levels due to changes in chromatin structure from intracellular gene expression regulatory mechanisms as cell generations increase, leading to instability in gene expression.

Method used

Incorporating scaffold/matrix attachment region (S/MAR) sequences at both ends of an expression cassette to maintain an open chromatin structure, enhancing expression levels and stability of target proteins.

Benefits of technology

The S/MAR sequences improve target protein expression levels by 23% to 34% and maintain stability, compared to controls without S/MAR sequences, by ensuring consistent gene expression across multiple cell generations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025015147_02042026_PF_FP_ABST
    Figure KR2025015147_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to: an expression cassette comprising a scaffold / matrix attachment region (S / MAR); an expression vector for expressing a target protein, comprising the expression cassette; a transformant cell obtained by introducing the expression vector into a host cell; and a method for producing a target protein, comprising the step of culturing the transformant cell.
Need to check novelty before this filing date? Find Prior Art

Description

CHO cell-derived S / MAR and expression vector using the same

[0001] The present invention relates to a method for producing a target protein comprising: an expression cassette including a scaffold / matrix attachment region (S / MAR); an expression vector for expressing a target protein including said expression cassette; a transformant cell into which said expression vector is introduced into a host cell; and the step of culturing said transformant cell.

[0002]

[0003] In existing cell lines that produce recombinant proteins, as the generation number of the cell increases, the expression level of the gene encoding the recombinant protein decreases due to the intracellular gene expression regulation mechanism.

[0004] For smooth gene expression to occur in CHO cells, genes must form an Open Chromatin structure that allows them to bind smoothly with RNA polymerase. However, as the number of cell generations increases, the Open Chromatin structure changes into a Close Chromatin structure due to intracellular gene expression regulatory mechanisms. Consequently, RNA polymerase is unable to bind to the genes, leading to a decrease in gene expression levels. Therefore, to maintain stable expression levels, genes encoding recombinant proteins must remain in an Open Chromatin structure.

[0005] S / MAR (Scaffold / Matrix Attachment Region) sequences are sequences that bind to the Nuclear Matrix located inside the nucleus of eukaryotic cells. By binding to the Nuclear Matrix, they help the sequences located within the S / MAR maintain an open chromatin structure. Additionally, it has been reported that adding S / MAR sequences to expression constructs is effective in improving expression levels (Biotechnology and Applied Biochemistry 61.5 (2014): 510-516). Since no clear rules have been discovered for S / MAR sequences, they are difficult to predict and require experimental verification, so only a small number of S / MAR sequences have been reported.

[0006]

[0007] There is a growing need to secure appropriate S / MAR sequences and to improve the expression levels and stability of cell lines producing recombinant proteins.

[0008]

[0009] One object of the present invention is to provide an expression cassette in which a scaffold / matrix attached region (S / MAR) and a gene encoding a target protein are operably connected.

[0010] Another objective of the present invention is to provide an expression vector for expressing a target protein, comprising the expression cassette.

[0011] Another objective of the present invention is to provide a transformant cell comprising the expression vector.

[0012] Another objective of the present invention is to provide a method for producing a target protein, comprising the steps of: culturing the transformant cells; and recovering the target protein from the culture medium or culture supernatant of the cultured cells.

[0013] Another objective of the present invention is to provide a nucleic acid molecule having the function of a scaffold / matrix attached region (S / MAR).

[0014]

[0015] It was confirmed that when the S / MAR sequence of the present invention is located at both ends of a structure composed of an expression cassette, the expression level of the target protein in a target protein-producing cell line is enhanced, and the expression stability is also improved.

[0016]

[0017] Figure 1 shows the S / MAR sequence.

[0018] Figures 2 to 5 illustrate maps of vectors produced in the present invention. Specifically, Figure 2 is an antibody protein expression vector in which the S / MAR03 sequence is included at both ends of the expression structure; Figure 3 is an antibody protein expression vector in which the S / MAR04 sequence is included at both ends of the expression structure; Figure 4 is an antibody protein expression vector that does not include the S / MAR sequence (negative control); and Figure 5 is an antibody protein expression vector in which the reported S / MAR sequence is included at both ends of the expression structure (positive control).

[0019] Figures 6 and 7 show the results of the production evaluation and antibody protein production of the experimental group containing S / MAR sequences. Specifically, Figure 6 shows the change in antibody protein specific productivity with increasing generation numbers (0, 20, 40, 60) for Single Clone (GM4 C1, GM4 C248, GM4 C263) produced by inserting an expression structure containing S / MAR sequences and Single Clone (GS Des 22) not containing S / MAR sequences, and Figure 7 shows the change in antibody protein production concentration with increasing generation numbers (0, 20, 40, 60) for Single Clone (GM4 C1, GM4 C248, GM4 C263) produced by inserting an expression structure containing S / MAR sequences and Single Clone (GS Des 22) not containing S / MAR sequences.

[0020]

[0021] The present invention will be described in more detail below.

[0022]

[0023] Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention is not to be limited by the specific descriptions provided below.

[0024] Furthermore, a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments of the present invention described in this invention using only ordinary experiments. In addition, such equivalents are intended to be included in the present invention.

[0025]

[0026] One aspect of the present invention provides an expression cassette in which a scaffold / matrix attachment region (S / MAR) and a gene encoding a target protein are operably connected.

[0027] As one specific example, the scaffold / matrix binding region (S / MAR) may be composed of the nucleotide sequence of SEQ ID NO. 1 or SEQ ID NO. 2.

[0028] The term 'Scaffold / Matrix Attachment Region (S / MAR)' in this invention refers to a sequence located near various nuclear processes, such as promoters, replication origins, recombination and breakpoint sites, that attaches chromosomal DNA to the nuclear scaffold / matrix. The most consistent feature of S / MAR is that it contains replication origin sites that are rich in high AT throughout.

[0029] The S / MAR of the present invention also used the DNA motif sequences when searching for S / MAR sequences by combining or repeating the base sequences of AT-rich sequence numbers 3 to 6, but is not limited thereto.

[0030] The term "expression cassette" in the present invention refers to an expression structure capable of expressing a target protein. The expression cassette of the present invention may additionally include nucleic acid sequences encoding a protein secretion factor and a target protein, as well as various elements recognized in the art as necessary for expression regulation, such as nucleic acid sequences of promoters, enhancers, etc. Sequences that regulate gene expression, that is, its transcription and the expression of its transcription products, are typically referred to as regulatory units. Most regulatory units are operably connected upstream of the coding sequence of the target gene.

[0031] The above term, "operably linked," refers to a state in which a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or peptide are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or peptide may be operably linked to influence the expression of the coding sequence. Operatory linkage with an expression vector can be produced using gene recombination technology well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes, etc., generally known in the art.

[0032] In the present invention, the expression cassette may include a scaffold / matrix attachment region (S / MAR), and specifically may be composed of a nucleotide sequence represented by SEQ ID NO. 1 or SEQ ID NO. 2, but is not limited thereto.

[0033] The nucleotide sequences used in the present invention are interpreted to include sequences that exhibit substantial homology or identity with the sequences listed in the sequence list, provided that variations having biologically equivalent activity are taken into account. The terms "homology" or "identity" refer to the degree of relationship with two given amino acid sequences or nucleotide sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0034] Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by a standard sequence algorithm, and a default gap penalty established by the program used may be utilized. Substantially, homologous or identical sequences can generally be hybridized under moderate or high stringent conditions along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its total length. It is evident that hybridization also includes polynucleotides containing common codons or codons that account for codon degeneracy. Accordingly, sequences having high homology or identity with the sequence indicated by SEQ ID NO. 1 or SEQ ID NO. 2, for example, sequences having high homology or identity of 70% or more, specifically 80% or more, and more specifically 90% or more, should also be interpreted as being included within the scope of the present invention.

[0035] As another specific example, the S / MAR sequence may be located at both ends of a structure composed of an expression cassette. Specifically, the nucleotide sequence of SEQ ID NO. 1 may be located at both ends of a structure composed of an expression cassette, or the nucleotide sequence of SEQ ID NO. 2 may be located at both ends of a structure composed of an expression cassette, or the nucleotide sequence of SEQ ID NO. 1 and the nucleotide sequence of SEQ ID NO. 2 may be located at both ends of a structure composed of an expression cassette, and the sequence may be located in an alternating manner at both ends of a structure composed of an expression cassette, but is not limited thereto.

[0036]

[0037] As one specific example, the target protein in the present invention is not limited as long as its expression level is enhanced by the S / MAR sequence of the present invention. Specifically, the above target protein is an antibody, antibody fragment (Fab or ScFv), fusion protein, protein scaffold, human growth hormone, serum protein, immunoglobulin, cytokine, α-, β-, or γ-interferon, colony-stimulating factor (GM-CSF), platelet-derived growth factor (PDGF), phospholipase-activated protein (PLAP), insulin, tumor necrosis factor (TNF), growth factor, hormone, calcitonin, calcitonin gene-related peptide (CGRP), enkephalin, somatomedin, erythropoietin, hypothalamic-secreted factor, growth differentiation factor, cell adhesion protein, prolactin, chronic gonadotropin, tissue plasminogen activator, growth hormone secretion It may be one or more selected from the group consisting of growth hormone releasing peptide (GHPR), thymic humoral factor (THF), asparaginase, arginase, arginine deaminase, adenosine deaminase, peroxide dismutase, endotoxinase, catalase, chymotrypsin, lipase, uricase, adenosine diphosphatase, tyrosinase, bilirubin oxidase, glucose oxidase, glucodase, galactosidase, glucocerebrosidase, and glucoronidase, but is not limited thereto.

[0038]

[0039] Another aspect of the present invention provides an expression vector for expressing a target protein, comprising the expression cassette.

[0040] In the present invention, the expression cassette, target protein, etc. are the same as those described above.

[0041] The vector for protein expression of the present invention may be a bicistronic vector comprising, but is not limited to, a) a scaffold / matrix binding region composed of the nucleotide sequence of SEQ ID NO. 1 or SEQ ID NO. 2; and a gene encoding an antibody light chain, operably connected thereto; and b) a scaffold / matrix binding region composed of the nucleotide sequence of SEQ ID NO. 1 or SEQ ID NO. 2; and a gene encoding an antibody heavy chain, operably connected thereto. In the bicistronic vector, the scaffold / matrix binding region may be present at both ends of the first expression cassette structure and at both ends of the second expression cassette structure, respectively.

[0042] The term "vector for expressing a target protein" in this invention refers to an expression vector in which an S / MAR sequence and a gene encoding a target protein are operably linked, and which induces the expression of a target protein upon expression after introducing the vector into a host cell.

[0043] The term "expression vector (expression vector)" in the present invention generally refers to a carrier into which a fragment of target DNA is inserted, typically a fragment of double-stranded DNA, and any expression vector used in the art for expressing proteins may be used without limitation. Here, target DNA refers to DNA encoding a protein intended for expression. Once the expression vector is in a host cell, it can replicate independently of the host chromosomal DNA, and the inserted target DNA can be expressed. As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression regulatory sequences that function within the selected expression host.

[0044] Specific examples of the above expression vectors include plasmid vectors, cosmid vectors, bacteriophage vectors, or virus vectors. More specific examples may include Escherichia coli-derived plasmids (pBR322, pBR325, pUC118, pUC119, pET30a, pET30c, or pGEX-GST), Bacillus subtilis-derived plasmids (pUB110 or pTP5), yeast-derived plasmids (YEp13, YEp24, YCp50, pPINKα-HC, pPink-HC, or pPink-LC), or Ti plasmids. Animal viruses such as retroviruses, adenoviruses, or vacciniaviruses, insect viruses such as baculoviruses, or plant viruses may be used, and binary vectors such as pPZP, pGA, and pCAMBIA series may be used, but are not limited thereto as long as the expression cassette of the present invention can be introduced into a host cell.

[0045] Furthermore, the expression vector may be functionally linked to an expression regulatory sequence. As a specific example, the vector may include signal sequences or leader sequences for membrane targeting or expression in addition to expression regulatory elements such as promoters, operators, start codons, stop codons, polyadenylation signals, and enhancers, but is not limited thereto and may be manufactured in various ways depending on the purpose of the invention. Additionally, it may include selective markers and may self-replicate or be integrated into host DNA. The vector of the present invention may be manufactured using gene recombination technology well known in the art, and site-specific DNA cleavage and ligation may be performed using enzymes generally known in the art.

[0046]

[0047] As one specific example, the expression vector may be characterized by an increased expression level of the target protein compared to a control group without an S / MAR sequence. In one specific embodiment of the present invention, it was confirmed that when an S / MAR sequence is added to both ends of a recombinant protein expression structure, the expression level of the target protein is improved by 23% to 34% compared to a negative control group without an S / MAR sequence.

[0048] As another specific example, the expression vector may be characterized by increased expression stability of the target protein compared to a control group without an S / MAR sequence. In a specific embodiment of the present invention, it was confirmed that the stability of an antibody protein-producing cell line is improved when an S / MAR sequence is added to both ends of a recombinant protein expression structure.

[0049]

[0050] Another aspect of the present invention provides a transformed cell in which the expression vector is introduced into a host cell.

[0051] The term "transformation" in the present invention refers to the introduction of DNA into a host cell so that the DNA becomes replicable as a chromosomal factor or through the completion of chromosomal integration. The host cell that can be used for transformation according to the present invention may be a eukaryotic cell.

[0052] In the present invention, the host cell may be, for example, bacteria, well-known eukaryotic and prokaryotic hosts such as yeast, insect cells such as Spodoptera prugiferda (SF9), animal cells such as CHO, COS 1, COS 7, BSC 1, BSC 40, BMT 10, etc. For the purposes of the present invention, the host cell may be a human cell, an animal host cell including isolated human cells, and in particular may be a Chinese hamster ovary cell (CHO). Additionally, it may be a transgenic cell other than a human cell.

[0053] In a specific embodiment of the present invention, a CHO (Chinese Hamster Ovary) cell line, widely used in the production of recombinant proteins, was used as the host cell.

[0054]

[0055] Another aspect of the present invention provides a method for producing a target protein, comprising: i) culturing the transformant cells; and ii) recovering the target protein from the culture or culture supernatant of the cultured cells.

[0056] In addition, the method for producing the above-mentioned target protein may further include a purification step of the recovered target protein, and the purification of the target protein may be carried out through protein purification methods commonly used in the art as necessary. For example, it may be separated from the host cell culture or culture supernatant by conventional chromatographic methods including immunoaffinity chromatography, receptor affinity chromatography, hydrophobicity chromatography, lectin affinity chromatography, size exclusion chromatography, cation or anion exchange chromatography, high-performance liquid chromatography (HPLC), and reverse-phase HPLC. In addition, if the desired protein is a fusion protein having a specific tag, label, or chelate moiety, there is a method of purification by a specific binding partner or agent. By cleaving the fusion protein, a desired protein form having additional amino acids during the cleavage process may be produced.

[0057] In the present invention, the expression cassette, vector for expressing a target protein, transformation, host cell, etc. are the same as those described above.

[0058] The host cells used in the above method may be animal host cells, specifically Chinese hamster ovary cells (CHO). Additionally, the transformed host cells may be cultured using culture methods commonly used in the industry as needed.

[0059]

[0060] Another aspect of the present invention provides a nucleic acid molecule having the function of a scaffold / matrix attached region (S / MAR) composed of the nucleotide sequence of SEQ ID NO. 1 or 2.

[0061] In the present invention, the scaffold / matrix coupling region (S / MAR) is the same as described above.

[0062] The term "nucleic acid molecule having S / MAR function" of the present invention refers to a sequence capable of stably expressing a target protein at a high expression rate, and specifically, may be composed of the nucleotide sequence of SEQ ID NO. 1 or 2.

[0063]

[0064] The present invention will be explained in more detail below through examples. These examples are intended to explain the invention more specifically, and the scope of the invention is not limited to these examples.

[0065]

[0066] Example 1: Preparation of a vector and cell line containing an S / MAR sequence

[0067] 1-1. Construction of a recombinant protein expression vector containing S / MAR sequences

[0068] To verify whether the S / MAR sequences of SEQ ID NOs. 1 and 2 bind to the Nuclear Matrix and are effective in enhancing expression levels and stability, the monoclonal antibody Dupilumab (Dupixent®) was selected as the target protein. The S / MAR sequences and DNA motif sequences of SEQ ID NOs. 1 and 2 are shown in Table 1 below. An expression vector was constructed by cleaving the Dupilumab expression vector (Fig. 4) with PsiI restriction enzyme to clone the PCR product of the S / MAR sequence into the 3' end of the Dupilumab expression construct, and then cleaving the cloned vector with NruI restriction enzyme to clone the PCR product of the S / MAR sequence into the 5' end of the Dupilumab expression construct. The PCR product of the S / MAR sequence was produced by PCR using the genomic DNA of Horizon Discovery’s HD-BIOP3 as a template. The primer sequences used for the production of the PCR product are shown in Table 2 below. The vector map of the created vector is shown in Figures 2 to 5.

[0069]

[0070]

[0071] Name 5' -> 3' SEQ ID NO S / MAR Forward (PsiI)atgcggtgggctctatgttaggcttaagcttattatttttttc7S / MAR Reverse (PsiI)TATTGCTTTATTTGTAACCATTAgacccttccttatcttgccag8S / MAR Forward (NruI)TTAGGCGTTTTGCGCTGCTTCGggcttaagcttattatttttttc9S / MAR Reverse (NruI)TATATCTGGCCCGTACATCGgacccttccttatcttgccag10

[0072]

[0073] 1-2. Construction of cell lines expressing recombinant proteins containing S / MAR sequences

[0074] The vector prepared in Example 1-1 was transfected into the Glutamine Synthetase Knock-out CHO-K1 Cell Line HD-BIOP3 via lipofection. Two days later, a minipool was prepared under 50 μM MSX conditions, and subculture was performed until viability reached over 90%. The recombinant protein expression levels and productivity of the minipools obtained through two stages of fed-batch culture were verified. Among these, the minipool exhibiting the highest recombinant protein expression was selected as the stable pool for obtaining a single clone.

[0075]

[0076] Example 2: Confirmation of Expression Level and Expression Stability of Recombinant Protein

[0077] Single clones for the experimental group and the negative control group were obtained from the cell lines prepared in Examples 1-2. The single clones were Solentim's VIPS TMIt was obtained using [method]. Clones were selected based on the recombinant protein expression levels of the obtained single clones and used to verify expression stability and expression levels.

[0078] Single clones of the selected experimental and negative control groups were subcultured at intervals of 3 to 4 days until the number of cell generations reached 60. Cell stock was prepared every 20 generations during subculture. After completing the preparation of 60 generations of cell stock, the cell stocks from generations 0, 20, 40, and 60 were thawed simultaneously, subcultured three times, and then fed-batch was performed to evaluate yield.

[0079] As a result of evaluating production output, the specific productivity of generation 60 for the negative control group was 11.3% of the specific productivity of generation 0, which was significantly reduced compared to the initial level, whereas the experimental group containing S / MAR sequences maintained a productivity level of 44.1% to 58.1% (Fig. 6).

[0080] The effect of S / MAR sequence on antibody protein production was evaluated by comparing the antibody protein production concentrations of the 0th generation of the experimental group and the negative control group. The negative control group produced 3082 mg / L of antibody protein in the 0th generation, while the experimental group produced 3797–4133 mg / L of antibody protein in the 0th generation, producing approximately 23%–34% more antibody protein compared to the negative control group (Fig. 7).

[0081] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

1. An expression cassette in which a scaffold / matrix attached region (S / MAR) consisting of the nucleotide sequence of SEQ ID NO. 1 or SEQ ID NO. 2; and a gene encoding a target protein are operably linked.

2. In claim 1, the target protein is an antibody, antibody fragment (Fab or ScFv), fusion protein, protein scaffold, human growth hormone, serum protein, immunoglobulin, cytokine, α-, β- or γ- interferon, colony-stimulating factor (GM-CSF), platelet-derived growth factor (PDGF), phospholipase-activated protein (PLAP), insulin, tumor necrosis factor (TNF), growth factor, hormone, calcitonin, calcitonin gene-related peptide (CGRP), enkephalin, somatomedin, erythropoietin, hypothalamic-secreted factor, growth differentiation factor, cell adhesion protein, prolactin, chronic gonadotropin, tissue plasminogen An expression cassette comprising one or more selected from the group consisting of an activator, growth hormone releasing peptide (GHPR), thymic humoral factor (THF), asparaginase, arginase, arginine deaminase, adenosine deaminase, peroxide dismutase, endotoxinase, catalase, chymotrypsin, lipase, uricase, adenosine diphosphatase, tyrosinase, bilirubin oxidase, glucose oxidase, glucodase, galactosidase, glucocerebrosidase, and glucouronidase.

3. An expression cassette according to claim 1, wherein the S / MAR sequence is located at both ends of a structure composed of an expression cassette.

4. An expression vector for expressing a target protein, comprising an expression cassette of any one of claims 1 to 3.

5. An expression vector according to claim 4, characterized in that the expression amount of the target protein is increased compared to a control group without an S / MAR sequence.

6. An expression vector according to claim 4, characterized in that the expression vector has increased expression stability of the target protein compared to a control group without an S / MAR sequence.

7. A transformant cell into which the expression vector of any one of paragraphs 4 to 6 has been introduced into a host cell.

8. In paragraph 7, the above-mentioned host cell is a Chinese hamster ovary cell (CHO cell), a transformed cell. 9.i) a step of culturing the transformant cells of claim 7; and ii) A method for producing a target protein, comprising the step of recovering the target protein from the culture medium or culture supernatant of the cultured cells.

10. A method for producing a target protein according to claim 9, further comprising the step of purifying the recovered target protein.

11. A method for producing a target protein according to claim 9, wherein the host cell is a Chinese hamster ovary cell (CHO cell).

12. A nucleic acid molecule having the function of a scaffold / matrix attached region (S / MAR) consisting of the nucleotide sequence of SEQ ID NO. 1 or 2.

Citation Information

Patent Citations

  • Novel MARs and Method for producing target protein using the same

    KR1020140015999A

  • Evaporation source and deposition device

    KR1020220001199A

  • Matrix attachment regions (MARS) for increasing transcription and uses thereof

    US20110061117A1

  • Vectors and compounds for expression of recombinant infliximab

    WO2011015916A2

  • Scaffold matrix attachment regions for gene therapy

    WO2023014724A2