Recombinant RNA molecule having improved translation efficiency
Recombinant mRNA molecules with heterologous 5' UTR sequences derived from specific genes like F2, F9, CFHR3, MBL2, and C3 enhance protein expression efficiency in diverse tissues, addressing the limitations of current mRNA therapies by achieving up to twice the expression levels of commercial vaccines.
Patent Information
- Application Number
- PCT/KR2025/015152
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-26
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-02
AI Technical Summary
Current mRNA therapies rely on standard UTR sequences that are not expressed in specific tissues or have expression levels below therapeutically effective amounts, limiting the production of target pharmacological proteins.
Development of recombinant mRNA molecules with heterologous 5' UTR sequences derived from genes like F2, F9, CFHR3, MBL2, and C3, which are highly expressed in liver tissue, to increase protein expression levels across a wide range of tissues.
The recombinant mRNA molecules significantly enhance protein expression levels, achieving up to twice the efficiency of current commercial mRNA vaccines in various tissues, ensuring stable and systematic production of therapeutically effective amounts of pharmacological proteins.
Smart Images

Figure KR2025015152_02042026_PF_FP_ABST
Abstract
Description
Recombinant RNA molecules with improved translation efficiency
[0001] The present invention relates to a method for discovering a heterogeneous gene-derived 5' untranslated (UTR) region capable of dramatically increasing the translation efficiency of a nucleic acid molecule into a target protein, and for expressing a target protein with high efficiency in a wide range of tissues through an RNA molecule conjugated thereto.
[0002]
[0003] Although DNA is known to be relatively more stable and easier to handle than RNA in applications such as gene therapy, it has disadvantages. When delivered into a target genome, DNA can be inserted at unintended locations, potentially damaging the host's genes. Furthermore, it can be damaged by anti-DNA antibodies generated by the host's immune response, and the expression levels of the target active protein are limited by various variables affecting transcription. In contrast, mRNA synthesizes proteins directly within the cytoplasm without the need for transcription in the nucleus. It poses no risk of damaging the host cell's genetic structure and has a short half-life that does not induce long-term genetic modification, making it more stable and easier to mass-produce compared to DNA.
[0004] mRNA transcribed from a circular DNA molecule contains a coding region that codes for the protein to be synthesized, and two untranslated regions (UTRs) located upstream of the start codon and downstream of the stop codon, respectively, which are not translated into protein. Typical eukaryotic mRNA has UTRs at the 5' and 3' ends, and UTRs play a crucial role in regulating the degradation or translation of mRNA, thereby significantly influencing mRNA stability and expression, and ultimately regulating protein expression levels.
[0005] In particular, the 5' UTR is a regulatory region of DNA located upstream of the start codon (i.e., the 5' end) within the protein-coding region, and it plays an important role in regulating translation initiation by including various regulatory elements such as the 5' Cap, G-quadruplex, stem-loop, and IRES. Current mRNA therapies have the advantage of being able to continuously produce target pharmacological proteins through the endogenous translation system present in cells, but they often rely on basic or standard UTR sequences that are not expressed in specific tissues or whose expression levels fall below therapeutically effective amounts. Therefore, there is a need for the development of new UTRs that can stabilize therapeutic mRNA and synthesize proteins with high efficiency across a wide range of tissues.
[0006]
[0007] Throughout this specification, numerous papers and patent documents are referenced and cited. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which the present invention pertains and the content of the present invention.
[0008]
[0009] The inventors have made diligent research efforts to search for an excellent recombinant mRNA molecular structure capable of efficiently high-expressing therapeutic pharmacological proteins in various tissues in vivo. As a result, the present invention was completed by discovering that when a heterologous 5' UTR sequence derived from a specific gene that is highly expressed in liver tissue is conjugated to the ORF (open reading frame) of an mRNA molecule, the expression level of the target protein can be significantly increased not only in liver tissue but also in a wide range of tissues.
[0010] Therefore, the objective of the present invention is to provide a recombinant RNA molecule with improved protein expression efficiency and a DNA molecule encoding the same.
[0011] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims, and drawings.
[0012]
[0013] According to one aspect of the present invention, the present invention provides an RNA molecule for expressing a target protein comprising the following:
[0014] (a) a heterologous 5' untranslated region (UTR) or a functional part thereof derived from one or more genes selected from the group consisting of F2 (coagulation factor II, thrombin), F9 (coagulation factor IX), CFHR3 (complement factor H related 3), MBL2 (mannose binding lectin 2) and C3 (Complement C3); and
[0015] (b) Open reading frame (ORF) encoding the target protein.
[0016] The inventors have made diligent research efforts to explore the structure of an excellent nucleic acid molecule capable of efficiently high-expressing a target protein in various tissues in vivo. As a result, it was discovered that using mRNA molecules into which heterologous 5' UTR sequences derived from F2, F9, CFHR3, MBL2, and C3 genes have been introduced can significantly increase the expression level of a target therapeutic protein in a wide range of tissues, thereby making them suitable for use as excellent mRNA therapeutic agents.
[0017] In this specification, the term “target protein” refers to a protein translated through a gene delivered into a target’s cell for the purpose of enabling the target to acquire a specific phenotype or biological activity, and means a protein intended to enhance expression efficiency using the RNA molecule of the present invention.
[0018] In this specification, the term “UTR (untranslated region)” refers to an untranslated region attached to both ends of a coding sequence encoding a target protein within mRNA, and depending on its location, there is a 5’ UTR located upstream of the coding sequence and a 3’ UTR located downstream. A 5’ cap may be attached upstream of the 5’ UTR.
[0019] In this specification, the term “5’ cap” refers to a component of mRNA that is connected to the 5’ UTR and binds to eIF4E (eukaryote translation initiation factor 4E), thereby binding the 40S ribosomal subunit to the mRNA to initiate protein synthesis from the 5’ starting site of the mRNA, as well as protecting the mRNA from nucleases.
[0020] In this specification, the term “functional portion” refers to a fragment in which some bases of the full-length nucleic acid sequence have been deleted, which is an analog of the full-length nucleic acid sequence that retains its inherent biological activity and function. Accordingly, “functional portion of the 5’ UTR” refers to a fragment in which some bases have been deleted to the extent that the inherent function of the 5’ UTR, which regulates the translation of the transcript upstream of the coding sequence, is retained.
[0021] According to a more specific embodiment of the present invention, the RNA molecule of the present invention additionally comprises a poly(A) tail at the 3' end comprising 20 to 200 bases. More specifically, the poly(A) tail comprises 60 to 180 bases, more specifically 80 to 160 bases, even more specifically 100 to 140 bases, and most specifically about 120 bases.
[0022] In this specification, the terms “poly(A) sequence,” “polyadenine sequence,” or “poly(A) tail” refer to an adenine-repeating nucleotide sequence located at the 3’ end of an RNA molecule that protects the RNA molecule from degradation by enzymes.
[0023] According to a more specific embodiment of the present invention, the RNA molecule of the present invention may additionally include a Kozak sequence between the 5'UTR and the start codon of the coding sequence. In this specification, the term “Kozak sequence” refers to a functional sequence motif located at or near the translation initiation site of an mRNA of a eukaryotic cell that mediates ribosome assembly and translation initiation and regulates that a protein be translated in the correct reading frame. The Kozak sequence included in the RNA molecule of the present invention may include, for example, GCCACC (sequence No. 22), but is not limited thereto.
[0024] According to a specific embodiment of the present invention, the heterologous 5' UTR derived from the F2 gene comprises the nucleotide sequence of Sequence List 6.
[0025] In this specification, the term “nucleotide” has a meaning that comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are the basic building blocks of nucleic acid molecules, include not only natural nucleotides but also analogues in which sugar or base sites are modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
[0026] According to a specific embodiment of the present invention, the heterologous 5' UTR derived from the F9 gene comprises the nucleotide sequence of Sequence List 7.
[0027] According to a specific embodiment of the present invention, the RNA molecule is a heterologous 5' UTR derived from the CFHR3 gene and comprises the nucleotide sequence of Sequence List 9.
[0028] According to a specific embodiment of the present invention, the heterologous 5' UTR derived from the MBL2 gene comprises the nucleotide sequence of sequence 10 of the sequence list.
[0029] According to a specific embodiment of the present invention, the heterologous 5' UTR derived from the C3 gene comprises the nucleotide sequence of sequence 13 of the sequence list.
[0030] According to a specific embodiment of the present invention, the RNA molecule described above of the present invention additionally comprises a 3' UTR downstream of a coding sequence encoding a target protein. The 3' UTR is a non-translating region located immediately after a stop codon within the coding region, and any 3' UTR of eukaryotic origin that performs inherent biological functions such as regulating mRNA localization, stability, and translation efficiency may be used; for example, a heterologous 3' UTR derived from the Hba-a1 (hemoglobin alpha adult chain 1) gene or a functional part thereof may be used, but is not limited thereto.
[0031] According to a specific embodiment of the present invention, the heterologous 3' UTR derived from the Hba-a1 gene comprises the nucleotide sequence of sequence 21 of the sequence list.
[0032] The 5' UTR and 3' UTR sequences used in the present invention are interpreted to include sequences exhibiting substantial identity with the sequences described in SEQ ID NOs. 6, 7, 9, 10, 13, and 21. The above substantial identity refers to a sequence that exhibits at least 80% homology, more specifically at least 85% homology, even more specifically at least 90% homology, and most specifically at least 95% homology when any other sequence is aligned with the sequence of the present invention described above to correspond as much as possible and the aligned sequence is analyzed using an algorithm commonly used in the art. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv. Appl. Math. 2:482 (1981) and Needleman and Wunsch, J. Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al., Nuc. Acids Res. 16:10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24:307-31 (1994), NCBI Basic Local Alignment Search Tool (BLAST) (Altschulet al., J. Mol. Biol.215:403-410(1990)) is accessible from NCBI (National Center for Biological Information), etc., and can be used in conjunction with sequence analysis programs such as blastp, blasm, blastx, tblastn and tblastx on the internet.
[0033] According to a specific embodiment of the present invention, all or part of the uracil (U) in the aforementioned RNA molecule of the present invention is substituted with a modified U represented by the following chemical formula 1:
[0034] Chemical formula 1
[0035]
[0036] In the above chemical formula, R1 and R2 are each independently hydrogen, C1-C3 alkyl, or C1-C3 alkoxy, and X and A are carbon or nitrogen and are different from each other. represents a single bond or a double bond.
[0037] In this specification, the term “alkyl” means a straight-chain or branched saturated hydrocarbon group, including, for example, methyl, ethyl, propyl, isopropyl, etc. C1-C3 alkyl means an alkyl group having alkyl units having 1 to 3 carbon atoms, and when C1-C3 alkyl is substituted, the number of carbon atoms of the substituent is not included.
[0038] In this specification, the term “alkoxy” refers to a radical formed by the removal of hydrogen from an alcohol, and in the case where a C1-C3 alkoxy is substituted, the number of carbon atoms of the substituent is not included.
[0039] According to the octet rule, if X or A is nitrogen, the bond in which X or A participates, respectively It is obvious that it is a single bond.
[0040] According to a specific embodiment of the present invention, in the above formula, X is nitrogen, A is carbon, and R1 and R2 are hydrogen. The compound of Formula 1 in which X is nitrogen, A is carbon, and R1 and R2 are hydrogen is pseudouridine.
[0041] According to one embodiment of the present invention, in the above formula, X is nitrogen, A is carbon, R1 is C1 alkyl (methyl), and R2 is hydrogen. The compound of Formula 1, in which X is nitrogen, A is carbon, R1 is methyl, and R2 is hydrogen, is N1-methyl-pseudouridine.
[0042] According to one embodiment of the present invention, in the above formula, X is carbon, A is nitrogen, R1 is a C1 alkoxy (methoxy), and R2 is hydrogen. The compound of Formula 1, in which X is carbon, A is nitrogen, R1 is methoxy, and R2 is hydrogen, is 5-methoxyuridine.
[0043]
[0044] According to a specific embodiment of the present invention, the RNA molecule of the present invention may be an in vitro transcribed (IVT) mRNA molecule. In this specification, the term “IVT mRNA” refers to mRNA that is transcribed in vitro in a DNA-dependent manner. Template DNA may be linearized with a suitable restriction enzyme prior to in vitro transcription, or it may be synthesized in a linearized form without the reaction of a restriction enzyme. Reagents used for in vitro transcription of RNA may include, typically, bacteriophage-encoded RNA polymerases (T7, T3, SP6, or Syn5); nucleoside triphosphates (NTPs) for four bases (adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate) and optionally cap analogs; modified nucleosides; RNase inhibitors, etc.
[0045] According to another aspect of the present invention, the present invention provides a DNA molecule encoding the RNA molecule of the present invention as described above.
[0046] The above DNA molecule may include an expression regulatory sequence operatively bound thereto, in addition to a coding region capable of transcribing the RNA molecule of the present invention described above. In this specification, the term “expression regulatory sequence” encompasses an array of binding sites for a promoter, a signal sequence, and a transcription regulator that operatively binds to a target nucleic acid molecule to be expressed and regulates the initiation of expression. More specifically, the expression regulatory sequence refers to a promoter.
[0047] In this specification, the term “promoter” refers to a nucleic acid control sequence that directs the transcription of a nucleic acid and is a regulatory nucleic acid sequence capable of influencing the expression of a target sequence to which it is operatively linked. The promoter may include a distal enhancer or repressor element that may optionally be located at a distance of several thousand base pairs from the transcription initiation site. The term “operatively linked” refers to a functional linkage between the expression regulatory sequence and the target nucleic acid sequence, thereby causing the regulatory sequence to regulate the transcription and / or translation of the target nucleic acid molecule.
[0048]
[0049] According to another aspect of the present invention, the present invention provides a gene delivery vehicle comprising the RNA molecule of the present invention as described above.
[0050] In this specification, the term “gene carrier” refers to a medium for introducing and expressing a desired target gene in target cells. In this specification, the term “gene delivery” refers to the transport of a gene into a cell and has the same meaning as gene transduction. At the tissue and cellular level, since “gene delivery” has the same meaning as gene spread, the gene carrier may be described as a gene penetration system and a gene diffusion system.
[0051] In this specification, the term “to express” means that a gene becomes replicable as an extrachromosomal factor within a subject’s cell by artificially introducing it using a gene carrier to cause the subject to express an exogenous gene or to increase the natural expression level of an endogenous gene. Accordingly, the term “expression” has the same meaning as “transformation,” “transfection,” or “transduction.”
[0052] The gene delivery vehicle of the present invention may be included in the form of an expression cassette, which is a polynucleotide structure containing all elements necessary for the self-expression of the gene to be introduced. The expression cassette typically includes an expression regulatory sequence, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the gene. The expression cassette may be in the form of a self-replicating expression vector.
[0053] The gene delivery system used in the present invention may be any gene delivery system used for conventional gene insertion, and includes, for example, plasmids, adenoviruses, adeno-associated viruses (AAV), retroviruses, lentiviruses, herpes simplex virus, vaccinia virus, liposomes, and niosomes, but is not limited thereto.
[0054]
[0055] According to another aspect of the present invention, the present invention provides a cell into which the gene delivery vehicle of the present invention described above has been introduced.
[0056] As the RNA molecule with the heterogeneous 5' UTR sequence applied in the present invention and the gene delivery vehicle containing it have already been described above, the description thereof is omitted to avoid excessive duplication.
[0057] The RNA molecule of the present invention can be usefully utilized for gene therapy drugs or gene vaccines that deliver therapeutic proteins by maintaining high structural stability and protein translation efficiency within various gene carriers or host cells, as well as for the recombinant production of target proteins. Accordingly, the cells into which the gene carrier of the present invention is introduced can be human cells as well as various prokaryotic cells (e.g., E. coli), plant cells (e.g., Nicotiana benthamiana cells), mammalian cells (e.g., CHO cells), and insect cells (e.g., sf-9 cells) that can be used for the recombinant production of target proteins, without limitation.
[0058]
[0059] The features and advantages of the present invention are summarized as follows:
[0060] (a) The present invention provides a recombinant RNA molecule with improved expression efficiency of a target protein and a DNA molecule encoding the same.
[0061] (b) The present invention discovered five types of 5' UTR sequences derived from F2, F9, CFHR3, MBL2, and C3 genes as optimal heterogeneous 5' UTR sequences that most efficiently increase protein expression in various tissues in vivo, and these UTRs showed at least equivalent or greater protein expression and up to more than 2 times greater protein expression compared to 5' UTRs applied to currently commercialized mRNA vaccines.
[0062] (c) Accordingly, the present invention can be usefully utilized as an excellent nucleic acid therapeutic composition capable of stably and systematically producing a therapeutically effective amount of pharmacological protein in the body of a patient.
[0063]
[0064] Figure 1 is a figure showing the results of expressing a target protein (antibody) using 20 types of 5' UTR sequences, which are primary candidates of the present invention, in HepG2 cells.
[0065] Figure 2 is a figure showing the results of selecting 5 types of 5'UTRs that showed high expression efficiency of the target protein among 20 types of 5'UTRs and comparing the expression efficiency of the target protein (antibody) in HepG2 cells by these 5' UTR sequences and the control 5' UTR sequence.
[0066] Figure 3 is a figure showing the results of comparing the expression efficiency of the target protein (antibody) in HEK293 cells by five selected types of 5'UTR sequences and a control 5'UTR sequence.
[0067] Figure 4 is a figure showing the results of comparing the expression efficiency of the target protein (antibody) in A549 cells by the five selected 5'UTR sequences and the control 5'UTR sequence.
[0068] Figure 5 is a figure showing the results of comparing the expression efficiency of the target protein (antibody) in C2C12 cells by five selected types of 5'UTR sequences and a control 5'UTR sequence.
[0069] Figure 6 shows the results of comparing the activity of luciferase expressed in HepG2 cells by five selected 5'UTR sequences and a control 5'UTR sequence.
[0070] Figure 7 shows the results of comparing the activity of luciferase expressed in HEK293 cells by five selected 5'UTR sequences and a control 5'UTR sequence.
[0071] Figure 8 shows the results of comparing the activity of luciferase expressed in A549 cells by five selected 5'UTR sequences and a control 5'UTR sequence.
[0072] Figure 9 shows the results of comparing the activity of luciferase expressed in C2C12 cells by five selected 5'UTR sequences and a control 5'UTR sequence.
[0073]
[0074] The present invention will be described in more detail below through examples. These examples are intended solely to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.
[0075]
[0076] Examples
[0077] Experimental method
[0078] Design of template plasmids for mRNA synthesis
[0079] The template plasmid used for mRNA synthesis was designed to have a T7 promoter and a 5' cap binding site (AGG) sequence located before the 5' UTR sequence, and a GCCACC sequence located after the 5' UTR sequence. Following the GCCACC sequence, an ORF (open reading frame) sequence encoding the target protein, either a bispecific antibody or firefly luciferase (FLuc, Genscript), a Mus musculus hemoglobin alpha adult chain 1 (Hba-a1) 3' UTR, and a 120 nt-long Poly A sequence were designed. The pUC57 plasmid vector (Genscript, pUC57-Kan Vector) was used to introduce the poly A sequence starting from different 5' UTR sequences. Restriction enzymes SapI and NcoI (New England Biolabs; NEB, Ca#: R0569, R0193) were used to cut the plasmid vector, and In-Fusion® Snap Assembly Master Mix (Takara, Ca#: 638947) was used to ligate the cut DNA.
[0080]
[0081] mRNA Synthesis and Purification
[0082] After linearizing the template plasmid with BbsI restriction enzyme (NEB, Ca#: R3539L), mRNA was synthesized using T7 RNA polymerase (Roche, Ca#: 08 140 669 103). CleanCap®AG (3'OMe) (TriLink Biotechnologies, Ca#: N-7413) was used as the cap analog, and the uridine base in the mRNA was replaced with N1-Methylpseudouridine (Roche, Ca#: 09 744 878 103), while other nucleoside triphosphates (NTPs) (Roche, Ca#: ATP- 09 744 363 103, CTP- 09 745 092 103, GTP- 09 745 173 103) were used as wild types. The transcription reaction was carried out at 37°C for 3 hours, with NTP at a concentration of 5 mM and cap analog at 4 mM. Subsequently, DNase I (Roche, Ca#: 09 873 562 001) was added, and the reaction was carried out at 37°C for 15 minutes to degrade the template plasmid. The synthesized mRNA was purified using an RNA cleanup kit (QIAGEN RNeasy Maxi Kit, Ca#: 75162), precipitated in LiCl (Thermo Fisher Scientific, Ca#: AM9480) at -20°C for 16 hours, pelleted by centrifugation, and dissolved in 1 mM sodium citrate (Genedepot, Ca#: R7100). After removing double-stranded RNA (dsRNA) using cellulose (Sigma-Aldrich, Ca#: C6288-1kg), the final mRNA, which was precipitated and separated using LiCl in the same manner as above, was dissolved in 1 mM sodium citrate.
[0083]
[0084] In vitro protein transient expression
[0085] To rapidly evaluate the effect of different types of 5' UTRs on protein expression levels through mRNA translation, mRNA containing different 5' UTRs and ORF (open reading frame) sequences encoding either a bispecific antibody or firefly luciferase selected as the target protein was injected into four cell lines, and the amount of expressed protein was measured. For the bispecific antibody protein, cell culture supernatants were collected 72 hours after mRNA injection, and expression levels were measured using the ELISA assay. For the luciferase protein, cells were collected 24 hours after mRNA injection, and protein expression levels were evaluated by measuring the degree of luciferase activity using the luciferase assay.
[0086]
[0087] cell culture
[0088] HepG2(ATCC ® HB-8065™), HEK293(ATCC ® CRL-1573™), A549(ATCC ® CCL-185™) and C2C12 (ATCC) ® CRL-1772™ cell lines were cultured in DMEM (Dulbecco's Modified Eagle Medium, Gibco, Ca#: 11995065) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco, Ca#: 10082147) and 1% penicillin / streptomycin (10,000 U / mL, Gibco, Ca#: 15140122) in a 37°C, 5% CO2 incubator. All transient expression experiments were performed in 12-well cell culture plates with a volume of culture medium of 1 mL per well (n=2).
[0089]
[0090] mRNA transfection into cells
[0091] 1.2 x 10 per well in a 12-well culture plate 6Dog cells were inoculated. 24 hours after cell inoculation, 1.25 μg of mRNA per well was injected into the cells using Messenger Max (Thermo Fisher Scientific, Ca#: LMRNA015). At this time, 1.25 μL (based on a concentration of 1 mg / mL) of mRNA and 3.75 μL of Messenger Max were dissolved in OptiMEM (Gibco, Ca#: 31985070) to prepare a final volume of 120 μL, and then treated.
[0092]
[0093] Antibody protein quantification
[0094] The expression level of bispecific antibody proteins specifically recognizing NKp46 was determined using the ELISA assay. First, cell culture medium was collected from each well of the culture plate; the supernatant was collected after centrifugation at 14,000 g for 5 minutes at 4°C to remove cells. Human NKp46 antigen (Acrobiosystems, Ca#: NC1-H52H4), diluted with 1 x PBS (BioSesang, Ca#: P2007), was coated onto 96-well plates for ELISA at 4°C for 16 hours and washed with wash buffer (1 x PBS with 0.05% Tween-20). 5% bovine serum albumin (Jackson Immuno Research, Ca#: 001-000-173) was used as the blocking buffer, and the plates were incubated at 37°C for 1 hour after treatment with the blocking buffer. After washing, the standard and sample (n=2) diluted in blocking buffer were treated and reacted at 37°C for 1 hour. After washing, Peroxidase AffiniPure Goat Anti-Human IgG, Fcγ fragment specific recombinant proteins (Jackson Immunoresearch, Ca#: 109-035-098), to be used as the detection antibody, were diluted in blocking buffer and treated, and reacted at 37°C for 1 hour. After washing, TMB solution (Thermo Fisher Scientific, Ca#: 1-Step™ Ultra TMB-ELISA Substrate Solution) was treated and reacted at room temperature for 5 minutes, after which detection was performed by measuring the absorbance at 450 nm.
[0095]
[0096] Quantification of Luciferase Protein
[0097] Quantification of luciferase protein was performed using the Bright-Glo luciferase assay system (Promega, Ca#: E2620). First, the supernatant was removed from each well of the culture plate, and 200 μL of 1X Glo lysis buffer was added per well. The mixture was then reacted at room temperature for 5 minutes on a shaker set to 120 rpm. Subsequently, the solution from each well was transferred to a 1.5 mL tube and centrifuged at 15,000 g for 5 minutes at 4°C to collect the supernatant. A portion of the collected supernatant was diluted 40-fold. The diluted supernatant and Bright Glo reagent were then added to a 96-well white plate at a volume ratio of 1:1 (n=2), and the luminescence values were measured using a luminometer.
[0098]
[0099] Experimental results
[0100] A 5' UTR library was constructed to evaluate the expression efficiency of mRNA containing different 5' UTR sequences by cell type (Table 1). As controls, the G209 single guide RNA targeting the mouse TTR gene (No. 14; Control 1) and 5' UTR sequences of mRNA (mRNA-1273 and BNT162b2) included in the COVID-19 vaccines Spikevax (Moderna) and Comitern (Pfizer) (Nos. 19, 20; Controls 2, 3) were used. As candidates, 17 5' UTR sequences derived from specific genes selected by the inventors (Nos. 1-13, 15-18) were used.
[0101] 5’ UTR 라이브러리NO5’UTR뉴클레오타이드 서열(서열번호 )길이1APOA2(apolipoprotein A2)AGGCACAGACACCAAGGACAGAGACGCTGGCTAGGCCGCCCTCCCCACTGTTACCAAC(1)582AHSG (alpha 2-HS glycoprotein)CTACCTTTCCCAGCAGAGCACCTGGGTTGGTCCCGAAGCCTCCAACCACCTGCACGCCTGCCAGGGCCTCTCTGGGGCAGCC(2)823SERPINC1 (serpin family C member 1)AGTTTTCAGGCGGATTGCCTCAGATCACACTATCTCCACTTGCCCAGCCCTGTGGAAGATTAGCGGCC(3)684CFHR2 (complement factor H related 2)ACCACAAAGGACTTTACTAAACTAGCTTCCAGTTAGTACACTGAAATTCAAAGTCATGCTCATAACTGTTAATGAAAGCAGATTCAAAGCAACACCACCACCACTGAAGTATTTTTAGTTATATAAGATTGGAACTACCAAGC(4)1435A1BG (alpha-1-B glycoprotein)ATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATC(5)556F2(coagulation factorⅡ, thrombin)AGTGACCCAGGAGCTGACACACT(6)237F9 (coagulation factor IX)ACTTTCACAATCTGCTAGCAAAGGTT(7)268SPP2 (secreted phosphoprotein 2)AGTGTTTGATAAAGACAGCTCCTCTTAGGAAGAACTGTCATCCCCAAACACATAGAGAGACACTCTCTGTCTCTCGATTACAATC(8)859CFHR3 (complement factor H related 3)AGTGCAACTGAAACTTTTGTATTAGCATACTACTGAGAATATCTAAC(9)4710MBL2 (mannose binding lectin2)AGAGGGCCAGCGTCCTTGTCACTGAGTCCCTGCTCTGCAGAAACACCAGTGAGGACC(10)5711CFHR5 (complement factor H related 5)AGTACATTGAAATTCAAAGTCATGCTTGTAACTGTTAATGAAAGCAGATTTAAAGCAACACCACCATCACTGGAGTATTTTTAGTTATATACGATTGAGACTACCAAGC(11)10912CYP2E1 (Cytochrome P450 family 2 subfamily E member) 1)CTCCCGGGCTGGCAGCAGGGCCCCAGCGGCACC(12)3313C3 (Complement C3)ACTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCACC(13)6114G209 single guide RNA targeting the mouse TTR gene (DNBcon)AAATAAGAGAGAAAAGAAGAGTAAGAAAGAAATATAAGA(14)3815DNBcon_V1_2F2mGATGCACTTCGAAAAGAAGAGTAAGAAGAAATATAAGA(15)3816DNBcon_V2_3A9cAAATTTCGAGAAAAGAAGAGT AAGAAGAAATATAAGA(16)3817DNBcon_V3_3B2mTGCGACCGTTGAAAAGAAGAGTAAGAAGAAATATAAGA(17)3818DNBcon_V4_3E5mTAAGGGCCTTGAAAAGAAGAGTAAGAAGAAATATAAGA(18)3819Pfizer. (BNT162b2) 5' UTRAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCC(19)4520Moderna(mRNA-1273) 5' UTRGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGCGCC(20)51
[0102] In addition, the following 3' UTR sequence derived from Hba-a1 (Mus musculus hemoglobin alpha, adult chain 1) was used as an exemplary 3' UTR to confirm the effect of the candidate 5' UTR sequences of the present invention on enhancing target protein expression: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (Sequence No. 21)
[0103]
[0104] Results of Antibody Protein Expression According to 20 Types of 5' UTRs in HepG2 Cells HepG2 Cells (Human Hepatocellular Carcinoma Cell Line) No. 5' UTR Antibody Protein Expression Amount (ng / mL) Expression Level Compared to Control Group 1APOA2622100%2AHSG47576%3SERPINC1857138%4CFHR220833%5A1BG59896%6F2933150%7F91073172%8SPP2678109%9CFHR3948152%10MBL2888143%11CFHR536258%12CYP2E128646%13C31083174%14G209 single guide RNA(DNBcon)623100%15DNBcon_V1_2F2m25240%16DNBcon_V2_3A9c36859%17DNBcon_V3_3B2m981157%18DNBcon_V4_3E5m54287%19Pfizer (BNT162b2) 5' UTR675108%20Moderna (mRNA-1273) 5' UTR46174%
[0105] When mRNA containing 20 different types of 5' UTRs and an ORF encoding an NKp46-recognizing bispecific antibody as an exemplary target protein was introduced into HepG2 cells, the expression level of the antibody protein was measured (Fig. 1). As a result, five types of 5' UTRs—F2 (No. 6), F9 (No. 7), CFHR3 (No. 9), MBL2 (No. 10), and C3 (No. 13)—showing expression levels approximately 1.5 to 2 times higher than positive control 1 were selected as candidates, and subsequent experiments were performed.
[0106] Results of antibody protein expression of 5 types of 5' UTRs and a control in HepG2 cells HepG2 (Human hepatocellular carcinoma cell line) No. 5' UTR antibody protein expression amount (ng / mL) Expression level compared to control group 1F2933202% 2CFHR3948206% 3MBL2888193% 4F91083235% 5C31073233% 6G209 single guide RNA (DNBcon)623135% 7Moderna (mRNA-1273) 5' UTR461100%
[0107] When mRNA containing five selected 5' UTRs of F2, F9, CFHR3, MBL2, and C3 was injected into HepG2 cells, it was confirmed that the level of expressed antibody protein was more than twice that of control group 2 (Moderna) (Fig. 2).
[0108] In order to verify whether the selected 5' UTR sequences exhibit excellent expression efficiency of the target protein in cells derived from various tissues other than the liver, the inventors introduced mRNA containing five types of 5' UTRs into HEK293 (human embryonic kidney cell line), A549 (human lung cancer cell line), and C2C12 (mouse skeletal muscle cell line) and then measured the expression levels of antibody proteins (Figs. 3 to 5).
[0109] Results of antibody protein expression of 5 types of 5' UTRs and a control in HEK293 cells HEK293 (Human embryonic kidney cell line) No. 5' UTR antibody protein expression amount (ng / mL) Expression level relative to control 1F2 146 718 2% 2CFHR3 (complement factor H related 3) 118 214 7% 3MBL2 (mannose binding lectin 2) 139 817 4% 4F9 (coagulation factor IX) 131 916 4% 5C3 (complement C3) 128 816 0% 6G209 single guide RNA (DNBcon) 650 81% 7Moderna (mRNA-1273) 80 4100%
[0110] When mRNA containing the five selected types of 5' UTRs was injected into HEK293 cells, the level of expressed antibody proteins was also confirmed to be about 1.5 times higher than that of control group 2 (Moderna) (Fig. 3).
[0111] Results of antibody protein expression of 5 types of 5' UTRs and a control in A549 cells A549 (Human lung cancer cell line) No. 5' UTR antibody protein expression amount (ng / mL) Expression level relative to control group 1F2 (coagulation factor II, thrombin) 2034 164% 2CFHR3 (complement factor H related 3) 1532 124% 3MBL2 (mannose binding lectin 2) 1840 148% 4F9 (coagulation factor IX) 1452 117% 5C3 (complement C3) 1662 134% 6G209 single guide RNA targeting the mouse TTR gene (DNBcon) 121 198% 7Moderna (mRNA-1273) 5' UTR 1239 100%
[0112] When mRNA containing the five selected types of 5' UTRs was injected into A549 cells, the levels of expressed antibody proteins were also confirmed to be about 1.1-1.7 times higher than those of the control group 2 (Moderna) (Fig. 4).
[0113] Results of antibody protein expression of 5 types of 5' UTRs and a control in C2C12 cells C2C12 (Mouse skeletal muscle cell line) No. 5' UTR antibody protein expression level (ng / mL) Expression level compared to control 1F2 (coagulation factor II, thrombin) 1773 161% 2CFHR3 (complement factor H related 3) 1028 93% 3MBL2 (mannose binding lectin 2) 1835 167% 4F9 (coagulation factor IX) 1594 145% 5C3 (complement C3) 1473 134% 6G209 single guide RNA targeting the mouse TTR gene (DNBcon) 838 76% 7Moderna (mRNA-1273) 1100 100%
[0114] When mRNA containing five selected types of 5' UTRs was injected into C2C12 cells, the levels of expressed antibody proteins were also confirmed to be up to 1.7 times higher than those of control group 2 (Moderna) (Fig. 5).
[0115]
[0116] Furthermore, to determine whether the expression enhancement efficiency of the five identified 5' UTR sequences for the exemplary target protein, a bispecific antibody, is maintained for other proteins, the inventors measured the levels of luciferase protein expressed when mRNA containing the five selected 5' UTRs and an ORF encoding firefly luciferase was injected into HepG2, HEK293, A549, and C2C12 cells. As a result, in HepG2 cells, F2, CFHR3, and C3 showed expression levels approximately 1.3 to 2 times higher than control group 2 (Moderna), while MBL2 and F9 showed expression levels similar to control group 3 (Fig. 6). In HEK293 cells, CFHR3 showed expression levels approximately 1.6 times higher than control group 2 (Moderna), while F2, MBL2, F9, and C3 showed expression levels similar to control group 3 (Fig. 7). In the case of A549 cells, F2, CFHR3, and C3 showed expression levels approximately 1.5 times higher than control group 2 (Moderna), while MBL2 and F9 showed expression levels similar to control group 3 (Fig. 8). In the case of C2C12 cells, CFHR3 showed expression levels approximately 2 times higher than control group 2 (Moderna), while F2, MBL2, F9, and C3 showed expression levels at least 1.3 times higher than control group 2 (Moderna) (Fig. 9).
[0117]
[0118] conclusion
[0119] As described above, the inventors selected five superior 5' UTRs for mRNA that significantly increase protein expression levels using G209 single guide RNA targeting the mouse TTR gene (Control 1) and 5' UTR sequences of mRNA (mRNA-1273 and BNT162b2) included in Moderna's Spikevax and Pfizer's Comirnaty (Controls 2 and 3) as controls, and analyzed the expression levels of two target proteins expressed via mRNA in four cell lines representing various tissues using ELISA and luciferase assays. As a result, both the dual antibody and luciferase, which are exemplary target proteins, showed significantly superior protein expression increase efficiency compared to the control 5' UTR in HepG2, HEK293, A549, and C2C12 cells, thereby confirming in various ways that the UTR sequence discovered in the present invention can promote the expression of the target protein in various tissues, even though it is derived from a gene that is highly expressed in liver tissue.
[0120]
[0121] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
Claims
1. RNA molecules for expressing a target protein, comprising the following: (a) a heterologous 5' untranslated region (UTR) or a functional part thereof derived from one or more genes selected from the group consisting of F2 (coagulation factor II, thrombin), F9 (coagulation factor IX), CFHR3 (complement factor H related 3), MBL2 (mannose binding lectin 2) and C3 (Complement C3); and (b) Open reading frame (ORF) encoding the target protein.
2. An RNA molecule according to claim 1, characterized in that the heterologous 5' UTR derived from the F2 gene comprises the nucleotide sequence of sequence 6 of the sequence list.
3. An RNA molecule according to claim 1, characterized in that the heterologous 5' UTR derived from the F9 gene comprises the nucleotide sequence of Sequence List 7.
4. An RNA molecule according to claim 1, characterized in that the heterologous 5' UTR derived from the CFHR3 gene comprises the nucleotide sequence of sequence 9 of the sequence list.
5. An RNA molecule according to claim 1, characterized in that the heterologous 5' UTR derived from the MBL2 gene comprises the nucleotide sequence of sequence 10 of the sequence list.
6. An RNA molecule according to claim 1, characterized in that the heterologous 5' UTR derived from the C3 gene comprises the nucleotide sequence of sequence 13 of the sequence list.
7. The RNA molecule according to claim 1, characterized in that the RNA molecule additionally comprises a heterologous 3' UTR derived from the Hba-a1 (hemoglobin alpha adult chain 1) gene or a functional part thereof.
8. An RNA molecule according to claim 7, wherein the heterologous 3' UTR derived from the Hba-a1 gene comprises the nucleotide sequence of sequence 21 of the sequence list.
9. An mRNA molecule according to claim 1, characterized in that all or part of the uracil (U) in the RNA molecule is substituted with a modified U represented by the following chemical formula 1: Chemical formula 1 In the above chemical formula, R1 and R2 are each independently hydrogen, C1-C3 alkyl, or C1-C3 alkoxy, and X and A are carbon or nitrogen and are different from each other. represents a single bond or a double bond.
10. A DNA molecule encoding the RNA molecule of any one of claims 1 to 9.
11. A gene delivery vehicle comprising an RNA molecule according to any one of claims 1 to 9.
12. A cell into which the gene carrier of claim 11 has been introduced.